MOLECULAR AND CELLULAR BIOLOGY, Dec. 1993, p. 7604-76110270-7306/93/127604-08$02.00/0Copyright ©D 1993, American Society for Microbiology

A Regulatory Element in the CH41 Promoter WhichConfers Inducibility by Serine and Threonine on

Saccharomyces cerevisiae Genes

Vol. 13, No. 12

CLAUS BORNAES,lt METTE W. IGNJATOVIC,2 PETER SCHJERLING,1MORTEN C. KIELLAND-BRANDT,2 AND STEEN HOLMBERG'*

Department of Genetics, Institute of Molecular Biology, University of Copenhagen, 0ster Farimagsgade 2A,DK-1353 Copenhagen K,' and Department of Yeast Genetics, Carlsberg Laboratory,

DK-2500 Copenhagen Valby,2 Denmark

Received 8 April 1993/Returned for modification 25 May 1993/Accepted 24 September 1993

CHAJ of Saccharomyces cerevisiae is the gene for the catabolic L-serine (L-threonine) dehydratase, which isresponsible for biodegradation of serine and threonine. We have previously shown that expression of the CHiAIgene is transcriptionally induced by serine and threonine. Northern (RNA) analysis showed that the additionalpresence of good nitrogen sources affects induction. This may well be due to inducer exclusion. To identifyinteractions ofcis-acting elements with trans activators of the CA41 promoter, we performed band shift assaysof nuclear protein extracts with CHA41 promoter fragments. By this approach, we identified a protein-bindingsite of the CIL41 promoter. The footprint of this protein contains the ABF1-binding site consensus sequence.This in vitro binding activity is present irrespectively of CIA41 induction. By deletion analysis, two otherelements of the CL41 promoter, UASlcHA and UAS2CHA, which are needed for induction of the CHA1 genewere identified. Each of the two sequence elements is sufficient to confer serine and threonine induction uponthe CYCI promoter when substituting its upstream activating sequence. Further, in a cha4 mutant strain whichis unable to grow with serine or threonine as the sole nitrogen source, the function of UASlcHA, as well as thatof UAS2CHA, is obstructed.

Transcriptional regulation in yeasts is mediated throughcis-acting sequence elements termed upstream activatingsequences (UASs) (19). The function of UASs depends ontheir ability to bind trans-acting factors. When bound toUASs, trans activators are able to stimulate the transcriptioninitiation complex, leading to synthesis of the mRNA. Mu-tant strains lacking certain regulatory abilities have allowedthe genetic identification of trans-acting factors, e.g., GAL4(13) and GCN4 (22). However, this approach is not alwayspossible because of the lethality of mutations in some transactivators, e.g., GRF1/RAP1 and ABF1/BAF1, which havebeen identified by reverse genetics (21, 40).The ability of Saccharomyces cerevisiae to use serine as

the sole nitrogen or carbon source depends on the CI-41gene, which encodes the catabolic L-serine (L-threonine)dehydratase (4, 5, 37). CHILA is regulated by transcriptionalinduction by serine and threonine (34). CAR1 (43), DURI,2(15), PUT1 (47), PUT2 (7), and GLN1 (3) are also induced bythe compounds to be catabolized. Some genes involved innitrogen catabolism, such as CAR1 (43), DAL2, DAL3,DAL5, DAL7 (12, 36, 48), and DUR1,2 (15), are repressed inresponse to the presence of a readily metabolized nitrogensource. This phenomenon has been reviewed by Cooper(10).

This report describes experiments designed to identifyelements required for wild-type regulation of CHA1. SinceCHA1 encodes a protein involved in nitrogen metabolism,Northern (RNA) analysis of Cl-I1 expression was carriedout to clarify the role of nitrogen in CHA1 regulation.Further, two approaches were used to detect regulatory

* Corresponding author.t Present address: Novo Nordisk A/S, DK-2820 Copenhagen,

Denmark.

elements. By analyzing the in vitro activity of yeast nuclearprotein extract binding to CHA1 promoter fragments, asequence containing homology to the consensus sequencefor recognition by the ABF1 protein was identified as aprotein-binding site in the CHIA] promoter. This in vitrobinding activity occurred irrespectively of the transcriptionalstate of CHA1. Additionally, we did a deletion analysis ofthe promoter. This identified two sequence elements neces-sary for induction of ClL41 that are different from theputative ABF1-binding site. To delimit the active elements,insertion of various subfragments into the CYCl promoterwas carried out.

MATERIALS AND METHODS

Strains and chemicals. DNA-modifying enzymes and re-striction enzymes were from New England Biolabs, Beverly,Mass., or Boehringer GmbH, Mannheim, Federal Republicof Germany. Radiolabelled nucleotides were from NewEngland Nuclear. The BamHI linker (CGGATCCG) used atthe fusion point between ClI41 and lacZ was from NewEngland Biolabs. All chemicals were analytical grade. TheS. cerevisiae strains used in this study were 11278b A4Ta(37), M1-2B AL4Ta trpl ura3-52 (Yeast Genetic Stock Cen-ter, University of California, Berkeley), TD28 MATa inolura3-52 (32), SG84 A4Tao cha4 Ailvl trpl lys2 ura3-52 (23),JHRY20-2Ca AL4Ta leu2-3,112 his3-A200 prc]-AI ::HIS3pep4-A2::LEU2 (1), and T2639 AM4Ta chal::GALIp-PRClprc1-A1::LEU2 leu2-3,112 his4-51a ura3-52 (33). The mediaused for growth of yeast strains were as previously described(34), except that the amino acid(s) serving as a nitrogensource(s) was added at a total concentration of 1 g/liter.DNA and RNA techniques. Manipulations of DNA were

done in accordance with standard procedures (39). Esche-

7604

on April 14, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

CHA1 REGULATORY ELEMENTS 7605

richia coli DHSt was used for plasmid preparation. YeastRNA isolation and Northern analysis were done as de-scribed by Holmberg and Petersen (24). The CHA4 ribo-probe used in the Northern analysis was produced bytranscription from pGem3blue-Sc4EH (5), and the URA3-specific probe was from pMP1 (35).

Construction of plasmids. Plasmid pTK120 has alreadybeen described (4). The sequence of the BamHI-SfiI-NotI-EcoRI linker is 5'GGATCCGGCCAACTTGGCCGCGGCCGCGAAT73'. The 5' deletion plasmids were constructedby ExoIII digestion of Sfil- and NotI-restricted pTK120,followed by treatment with Si nuclease, the Klenow en-zyme, and deoxynucleoside triphosphates before the prod-ucts were self-ligated. Plasmids pTK218 and pTK209,pTK233 and pTK228, and pTK224 and pTK207 were con-structed by blunt-end insertion of the BamHI-HindIII (posi-tions -214 to -152) fragment from pTK145 (5' deletionanalysis construct), the NruI-HindIII (-281 to -152) frag-ment from pTK120, and the ClaI-HindIII (-403 to -152)fragment from pTK120, respectively, into the XhoI site ofpLG670Z (18) (see Fig. 8). Plasmids pTK242, pTK249,pTK255, pTK256, pTK268, pTK269, pTK401, and pTK403were constructed by insertion of the following syntheticoligonucleotides into the XhoI site of pLG670Z: pTK242upper strand, 5'TCGATTCCACTGAGTGTCATTAAATAGTGCCAAAGCTT3'; pTK249 upper strand, 5'TCGATGCGGCTCCTGTTAAGCCCCAGCGGAAATGTAA3'; pTK255upper strand, 5'TCGACTCGCGAGTACTAATCACCGCGAACGGAAACTAATGAGTCCTCTGCGC3'; pTK256 up-per strand, 5'TCGAGCGCAGAGGACTCATTAGlTTTCCGTTCGCGGTGATTAGTACTCGCGAG3'; pTK268 upperstrand, 5'TCGATGACACTCAGTGGAATTACATlTCCGCTGGGG3'; pTK269 upper strand, 5'TCGACCCCAGCGGAAATGTAATTCCACTGAGTGTCA3'; pTK401 upperstrand, 5'TCGATCTGCGCGGAGACATGATTCCGCATGGGCGG3'; pTK403 upper strand, 5'TCGACCGCCCATGCGGAATCATGTCTCCGCGCAGA3'. Fragments used asprobes in the band shift assay and DNase I protectionanalysis were propagated as inserts in pGEM3blue (PromegaBiotech) prior to isolation as probes. For band shift assays,the recessed 3' ends of the DNA fragments were filled in asdescribed by Sambrook et al. (39). For footprinting, theClaI-HindIII fragment (positions -403 to -152) was radio-actively labelled at either 5' end by standard procedures (39).The construction of the CHAJ promoter deletion plasmids(see Fig. 2A) has already been described (25).

1-Galactosidase measurements. ,B-Galactosidase was mea-sured as described by Ausubel et al. (2) and expressed inMiller units in accordance with the formula (optical densityat 420 nm x 1,000)/(optical density at 600 nm x milliliters ofculture assayed x time assayed in minutes).

Preparation of yeast nuclear extract and assays for protein-DNA binding. The nuclear protein extract was prepared asdescribed by Machida et al. (29), with minor modifications(25). The crude nuclear extract was passed through a phos-phocellulose column (Whatman P11). The column waswashed with 50 ml of buffer A (25 mM N-2-hydroxyethylpip-erazine-N'-2-ethanesulfonic acid [HEPES; pH 7.5], 5 mMMgCl2, 50 mM KCl, 0.1 mM EDTA, 0.5 mM dithiothreitol,1 mM phenylmethylsulfonyl fluoride, 10% glycerol), and therunthrough and wash were pooled and used as the source ofbinding activity. For the band shift assay (2), DNA-bindingreactions (25 RI) were performed for 20 min at room temper-ature in buffer A. DNase I protection analysis was per-formed as described by Galas and Schmitz (14) and modifiedby Vogel et al. (46).

NITROGEN SER SER THR SER THR PRO SER THR ASN SER THRSOURCE THR PRO PRO ASN ASN AM AM

CHAl _ 3 StURA3 - XA

FIG. 1. Northern analysis of CHA4 expression. About 40 p,g oftotal RNA isolated from S. cerevisiae Y1278b was used in each lane.The nitrogen source(s) is indicated at top of each lane (SER, serine;THR, threonine; PRO, proline; ASN, asparagine; AM, ammoniumions). The CI-I1 and URA3 (internal control) transcripts are indi-cated.

RESULTSNorthern analysis of CHAI gene expression. Enzyme syn-

thesis directed by many nitrogen-catabolic genes ceaseswhen cells are grown in the presence of readily metabolizednitrogen sources such as glutamine, asparagine, and ammo-nia; i.e., enzyme production is subject to nitrogen regulation(NR), also called nitrogen catabolite repression. In the casesstudied so far, NR of the gene products is correlated with adecrease in the steady-state levels of mRNA, suggesting thatNR occurs at the transcriptional level. We have previouslyfound that in wild-type strain X2180-1A, serine and threo-nine induce transcription of the CIHA1 gene (34). Here weaddress the role of NR in the transcription of CHAI in strain1.1278b, which is used for most studies of NR. RNA blotswere prepared with total RNA from 11278b grown with orwithout serine or threonine and with or without the simulta-neous presence of the good nitrogen source asparagine orammonium ions or the poor nitrogen source proline. The blotin Fig. 1 shows that threonine induction of CHLA wasstrongly repressed by addition of asparagine or ammoniumions to the growth medium, while proline had no effect.Also, when serine was used for induction of CHAI, aspar-agine or ammonium ions had a repressing, yet much weaker,effect. Thus, this result suggests that in CHAI, NR also actsat the transcriptional level.

Detection of protein binding to the CHAIL promoter by bandshift assay. Northern analysis of CHA41 expression fromcentromere plasmid YCpSO-Sc4HC, which complements thechal-1 mutation (34), shows that CHAI retaining the se-quences downstream from position -403 (the A of ATG is+1) of the promoter is regulated as in the wild type (25). Todelimit the region needed for normal promoter functionfurther, Northern analysis of CH41 expression with trun-cated constructs was performed. Induced expression wasretained with a 281-bp promoter region but absent from a156-bp promoter region, indicating that the sequence be-tween positions -281 and -156 is essential for normalpromoter function (Fig. 2). To localize the binding of possi-ble regulatory proteins to the CHIAI promoter, three frag-ments covering the region from -403 to +12 were subjectedto a band shift assay after incubation with a yeast nuclearprotein extract prepared from a culture grown in noninduc-ing medium. Binding with the 126-bp NruI-HindIII region,positions -281 to -156, was observed (data not shown).Preliminary DNase I protection analysis indicated that theprotein-DNA interaction occurred near the NruI site, and anoligonucleotide, CHA1ABF1 (positions -284 to -238), cov-ering 47 bp of this region was synthesized. This oligonucle-otide was able to compete for the binding activity of theNruI-HindIII fragment, and the oligonucleotide itself boundand exhibited saturation in a self-competition experiment

VOL. 13, 1993

on April 14, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

7606 BORN)ES ET AL.

A A+1

-403 } - - YCp5O-So4HCClal Hindill

+1..-281 YCp5O-So4HN

Nrul Hindill

-156 *zzzzzzzz .z - YCp5O-Sc4HHHindill Hindll

BPROMOTERILENGOTHR 403 bp 281 bp 157 bp

NITROGEN AM SER SER AM SER AM SERSOURCE THR AM AM AM

CHA1_-0iURA3-= e - U

FIG. 2. Northern analysis of transcription originating from plas-mids with three different CIA41 promoter truncations. (A) CA41constructs inserted into centromere-based vector YCp50. Openboxes represent the CIL4A coding region, and hatched boxes indi-cate promoter sequences. (B) S. cerevisiae T2639 contains a dis-rupted genomic chal gene, the transcript of which (Achal), alongwith the URA3 transcript, served as a marker and internal standard.T2639 was transformed with the three plasmids depicted in panel A.The transformants were cultured in minimal medium with thenitrogen source indicated. Twenty micrograms of total RNA wasprobed-with CIIAJ- and URA3-specific riboprobes.

(data not shown). No difference between extracts fromuninduced and induced cells was observed; i.e., the pres-ence of the binding activity was independent of induction.Mapping of the in vitro-detected binding activity by DNase

I footprinting. The 248-bp ClaI-HindIII DNA fragment fromthe CIHA1 promoter (5) was radioactively labelled at either 5'end and incubated with an increasing amount of a yeastnuclear extract prepared from protease-deficient strainJHRY20-2Ca grown in minimal anmmonium medium. Theproducts of limited DNase I digestion were analyzed on astandard sequencing gel (Fig. 3A). The upper strand wasprotected from positions -276 (relative to the ATG codon)to -253, and the lower strand was protected from positions-280 to -254. The same sequence was protected whenextracts from induced cells were used (25). Within thefootprinted region, a sequence identical to the suggestedABF1-binding site consensus sequence, PuTCPuPyPyNNNNACG (9, 20), was found (Fig. 3B), indicating that anABF1-like protein binds to this region.

Identification of CHl upstream activating elements bydeletion mutagenesis. To determine whether the in vitro-detected binding activity is involved in induction of theCI-IA promoter and to look for other cis-acting elements, a5' deletion analysis of the CA41 promoter was carried out.To quantitate the CI4A promoter function as 3-galactosi-dase activity, the deletion series was made on a yeastcentromere plasmid, pTK120, containing a translational fu-sion between CA41 and lacZ from E. coli (4). The ,-galac-tosidase expression from this plasmid established that the

UPPER STRAND3,GTOAA X -253TCAAAaGCAAGCGCCACTAATCA X - -276TGAOG5'

LOWER STRAND

3.cx -280TcATGAT

Ax -254TTA

5.

BABF1/BAF1 PuT CPu PyPyN N N N A C GCHAJ AATC A C C G CG AACG GA

FIG. 3. (A) DNase I protection analysis. The ClaI-HindIII frag-ment of the CHAJ promoter was used as the probe for the bindingreaction. Increasing amounts of a nuclear protein extract (10 mg/ml)were present in the binding reaction, as indicated in microliters atthe tops of the lanes. The DNA sequence protected from digestionis shown for both strands. The letter 0 marks the most proximalnucleotide seen to be unprotected, and the letter X marks the mostdistal nucleotide seen to be protected. G/A is the purine-specificMaxam and Gilbert (31) sequencing reaction of either the upper orthe lower strand. (B) Sequence of the CHAJ promoter aligned withthe suggested consensus sequences for recognition by the transcrip-tional activator ABF1/BAF1 (9, 20). N is A, T, G, or C; Pu is A orG, and Py is T or C.

translational initiation codon suggested by sequence data (5)is actually used as such in the CA41 gene. The pattern ofP-galactosidase activity expressed by different CH41-lacZfusion plasmids is shown in Fig. 4. The results indicate thatat least the following three regions are of importance forCIA41 promoter activity: the regions from positions -240 to-214, from positions -214 to -161, and from positions-123 to -82. Deletion of DNA between position -699 andposition -241 did not result in significant changes in theactivity of the CHAl promoter, indicating that the ABF1-binding site does not mediate serine and threonine inductionof CA41. Deletion of the next 26 bp of DNA (plasmidpTK145), however, resulted in a two- to threefold drop in theserine-induced activity of the CIL4A promoter. Furtherdeletion of the region between positions -214 and -161resulted in loss of detectable lacZ expression (pTK132).However, a low level of uninducible lacZ expression wasregained by further deletion (pTK166). Finally, when theregion from positions -123 to -82 containing a putativeTATA box (TATATAAA) was deleted, an approximatelyfivefold drop in the activity was observed.

This deletion analysis identified two upstream activatingelements in the CIA41 promoter, UASlcHA, between posi-tions -240 and -214, and UAS2CHA, between positions-214 and -161. Serine induction and threonine inductionwere equally affected by all of the deletions tested, suggest-ing that serine induction and threonine induction are medi-ated through the same elements. The analysis also suggeststhe presence of a negative element between positions -155and -136 because neither pTK132 nor pTK231 has anyCIA41 promoter function, but further experiments are re-

MOL. CELL. BIOL.

L-

on April 14, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

CHL41 REGULATORY ELEMENTS 7607

CONSTRUCr 8-GALACTOeDASE RATIO(MILLER UNITS)

SER THRSER THR AM AM AM

-699 ATO lacZpTK120 _15+ 18 32±9 1.9 t.13 83 17

pTK135-408 95+1 42+14 1.1± .04 86 38

pTK149 4364 1056 3 18±4 0.8 .01 131 23

pTK133 356 _ 87+ 2 22+3 0.8 +.10 109 28

pTK131 -289 886 4 ND 0.9 .01 96

pTK130 -240 6EEM9299K\IIIIII_ 89t 27 24±4 1.1 t .2 81 22

pTK145 -214 \ _ 34 t 2 ND 0.9 .03 36

pTK132 -161el-0\711111111 '0.05 0.05 <0.05

pTK116 -136 _ OA4 .02 1.0 ±.1 0.5 .005 0.8 2

pTK116 -123 _ 0.5 .05 0.4 t .1 0.4 .005 1.3 1

pTK167 -82 _ 0.1 .02 0.1 .005 <0.05

pTK163 -7 ' <0.05 <0.05 0.1 .005

pTK165 +13 [ <0.0- '0.05 <0.05

pTK231 0.05<0.05 <0.05

FIG. 4. Activities of 5' deletions of the CIA41 promoter. The 5'deletion series in a centromere-based vector was introduced intoyeast strain TD28, and transformants were assayed for 3-galactosi-dase activity after growth in inositol-containing medium with serine(SER), threonine (THR), or ammonium ions (AM) as the nitrogensource. The checkered boxes indicate the putative ABF1-bindingsite. The shaded boxes show the positions of the identifiedUASlcHA and UAS2cHA elements. The hatched bars indicate theCH41 upstream region. The open boxes represent part of the CIA41open reading frame. ND, not determined. The values given aremeans + the standard errors of the means.

quired to prove this. The sequence TATATAAA, frompositions -94 to -87, is probably a functional TATA box as

judged from the fivefold drop in activity observed when thesequence between positions -123 and -82 was deleted.To test the possibility that it was the proximity of vector

DNA which affected the function of the C A41 promoterwhen the sequence between position -240 and position-161 was removed in the 5' deletion analysis, we deleted theNruI-HindIII (-281 to -156) fragment in pTK120, givingpTK231. This internal deletion resulted in a nonfunctionalpromoter (Fig. 4), confirming that the sequence betweenpositions -281 and -156 is essential for serine and threonineinduction.

Effect ofUAScHA sequences on a heterologous promoter. Todetermine whether the elements between positions -281 and-152 are sufficient to act as UASs for serine induction, wesubstituted UASCyc in the translational fusion betweenCYCl and lacZ in multiple-copy vector pLG669Z (18) withvarious CH-IA promoter fragments. The constructs were

analyzed in strains TD28 (Fig. 5) and M1-2B (Table 1).Deletion of UAScyc resulted in plasmid pLG67OZ, whichgives a low level of ,-galactosidase activity on yeast minimalmedium with glucose as the carbon source and serine orammonium ions as the nitrogen source (Table 1). Insertion ofthe following C A41 promoter fragments into the XhoI site ofpLG67OZ raised the P-galactosidase activity to about 250-fold on yeast minimal medium with serine as the nitrogensource: the -403 to -152 fragment (pTK224), the -281 to-152 fragment (pTK233), and the -214 to -152 fragment(pTK218). When inserted in the same orientation as in theCHA1 promoter, these three fragments gave rise to similarserine-induced levels of P-galactosidase activity (Fig. 5 andTable 1). This indicates that a functionally intact UASlcHAelement is present between positions -214 and -152 of theCH41 promoter. However, when the fragments were in-verted, their regulatory phenotypes differed significantly

CONSTRUCT B-GALACTOSIDASE(MILLER UNITS)

(CHAIpDNA in pLGOZ) Amnmonium Serine

kkcZpTK224(4OSto -154 11 + 1.1 393+81

pTK207(-152to-403) 0.8+0.0 47+7.8pTK233 (-281 to -152) 10 +0.8 377± 86

pTK228 (-1521o -281) 24 + 4.6 5757 64

pTK218 (-214to -152) 28 6 388 + 61

pTK209(-152to-214) - 79+23 403±51

pTK249(-217 o -18) 0.9 0.1 1.5 0.2

pTK242 (4185to-152) _ 06. 0.0 0.5 0.1

pTK289(-203to-171) 37+±1.8 508±56

pTK268(-471to-203) 34+t1.1 588.+111

pTIC401 (-2431o-213) 21 t 13 531 t 68

pTK4O33(-213to-243) 16± 1.7 162 17

pLG678Z(none)Xh

_ 1.5 0.1 1.6 + 0.3Xhol , ,,,. -'' ,

FIG. 5. Activities of CHAlICYCl promoter constructs. In theplasmids depicted, UAScyC was substituted by different CA41promoter fragments (positions are indicated in parentheses) byinsertion of the fragments into the XhoI site of pLG67OZ. Thearrows indicate orientation relative to the wild-type promoter ori-entation. The checkered boxes indicate the putative ABF1-bindingsite. The shaded boxes show the positions of the identifiedUAS1cHA and UAS2CHA elements. The hatched bars indicate CA41upstream sequences. The open boxes represent part of the CA41open reading frame. The plasmids were introduced into strain TD28,and transformants were grown on inositol-containing medium witheither ammonium ions (uninduced) or serine (induced) as the nitro-gen source. The values given are means t the standard errors of themeans.

(Fig. 5, pTK207, pTK228, and pTK209). The level of expres-sion from pTK207 was low on both inducing (47 U) anduninducing (0.8 U) media, possibly because of the largespacing between upstream and downstream promoter ele-ments in this construct. Nevertheless, the induction ratiowas still high (60-fold). On the other hand, there is norestriction to the orientation of the -281 to -152 fragmentand the -214 to -152 fragment, since the induced ,B-galac-tosidase levels of plasmids pTK233 and pTK228 and plas-mids pTK218 and pTK209 were almost the same (Fig. 5). Todelimit the active element, plasmids pTK249 and pTK242were constructed by insertion of synthetic oligonucleotides,covering the sequences from positions -217 to -186 andfrom positions -185 to -152, respectively, at the XhoI siteof pLG67OZ. None of these plasmids was able to directserine-induced 3-galactosidase expression, indicating thatthe active element of the -214 to -152 sequence wasdestroyed in these constructions. An oligonucleotide cover-ing the sequence from positions -203 to -171 was fullyactive when inserted in both orientations at the XhoI site ofpLG67OZ in plasmids pTK269 and pTK268 (Fig. 5). Thisdefines UASlH as the sequence element 5'C.CCCAGCQQAAAI GTAAII[CCAcJXiA.iTGTCA3', extending fromposition -203 to position -171 in the CHA1 promoter.Closer inspection of UASlcHA reveals an imperfect invertedrepeat (underlined) containing two copies of the sequence5'GPyGGA3' separated by 8 bp. A UASlcHA homolog withthe sequence 5'QCQQAGACATGGATT.QQGC3' is presentfurther upstream in the CHIA promoter from positions -239to -222, that is, within the UAS2CHA element as defined in

VOL. 13, 1993

on April 14, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

7608 BORNIES ET AL.

TABLE 1. Function of CHIAlICYCl chimeric promoters in a cha4 mutant strain and its isogenic parent

,B-Galactosidase activity (mean no. of Miller units + SEM)Construct (positions) Strain Ml-2Ba Strain SG84b

Uninducedc Inducedd Uninducede Inducedf

pLG67OZ 4.8 ± 0.3 3.6 ± 0.4 4.9 ± 0.7 4.9 ± 0.3pTK224 (-403 to -152) 35.7 ± 2.3 551.6 ± 45.3 44.5 ± 4.5 12.2 ± 1.4pTK233 (-281 to -152) 10.1 ± 1.1 411.9 ± 24.8 11.8 ± 1.7 4.3 ± 0.3pTK218 (-214 to -152) 60.3 ± 3.6 641.1 ± 62.5 60.6 ± 12.3 19.0 ± 0.9pTK249 (-217 to -186) 3.6 ± 0.1 3.1 ± 0.2 3.3 ± 0.6 2.7 ± 0.7pTK242 (-185 to -152) 2.4 ± 0.2 2.0 ± 0.1 2.6 ± 0.7 1.6 ± 0.4pTK269 (-203 to -171) 53.5 + 2.9 630.9 ± 54.3 61.1 ± 4.3 40.3 ± 4.9pTK268 (-171 to -203) 47.6 ± 1.6 462.1 ± 33.7 34.8 ± 5.7 19.7 ± 1.4pTK255 (-281 to -235) 10.5 ± 1.0 12.3 ± 1.1 14.7 + 0.9 13.4 ± 1.1pTK256 (-235 to -281) 14.2 + 1.3 16.2 ± 1.8 17.6 ± 3.8 17.7 ± 2.4pTK401 (-243 to -213) 21.5 ± 0.3 294.5 ± 15.7 24.6 + 7.5 16.9 ± 2.3pTK403 (-213 to -243) 20.5 ± 0.8 170.8 ± 14.7 19.8 ± 1.7 17.8 ± 1.6

a MATa trpl ura3-52.b MATc ilvl trpl lys2 cha4 ura3-52.c Grown on minimal ammonium.d Grown on Ser (1 g/liter).I Grown on minimal ammonium plus Ile, Trp, and Lys.f Grown on minimal ammonium plus Ile, Trp, Lys, and Ser (1 g/liter).

the 5' deletion analysis (Fig. 4). To test the functionalsignificance of this element, an oligonucleotide covering thesequence from positions -243 to -213 was inserted in bothorientations into the XhoI site of pLG67OZ, giving plasmidspTK401 and pTK403. As seen in Fig. 5 and Table 1, bothplasmids were able to direct serine-induced ,B-galactosidaseexpression. Thus, in agreement with the 5' deletion analysis,this defines UAS2CHA as this sequence element. BothUASlcHA and UAS2CHA are present on pTK224, pTK207,pTK233, and pTK228, whereas only UASlcHA is present onpTK218 and pTK209. As opposed to the results obtained inthe 5' deletion analysis, the simultaneous presence of bothUASlcHA and UAS2CHA in the heterologous promoters didnot give rise to a higher expression level, possibly as aneffect of the high copy number of these constructs. Todetermine whether the ABF1-binding site from the CA41promoter has a function in vivo, we inserted the 47-bpoligonucleotide used in the band shift assay into the XhoIsite of pLG67OZ, giving pTK255 and pTK256 (Table 1). Thisresulted in an approximately two- to fourfold constitutiveincrease in the efficiency with which the CYCl promoterexpresses ,B-galactosidase. The enhancement by the ABF1-binding site is similar to that found for other ABF1-bindingsites (21, 38), supporting the view that it is ABF1 that bindsto the CHAJ promoter. S. cerevisiae can utilize serine as asole carbon source, and this ability depends on a functionalCHI41 gene. As the 5' deletion analysis indicated that theABF1-binding site is not involved in serine and threonineinduction (Fig. 4), we speculated whether it might play a rolein a possible carbon source-dependent regulation of CHAI.However, we observed no difference in the levels of ,-ga-lactosidase expression from plasmids pTK133, containingthe ABF1 site, and pTK131, lacking the ABF1 site, aftergrowth of the cells in medium with either glucose, galactose,lactate, or serine as the sole carbon source (data not shown).We have isolated an unlinked mutation, designated cha4,

which reduces the serine inducibility of ,B-galactosidaseexpression from pTK120 by 2 orders of magnitude (23). TheCHAJICYC1 heterologous promoter constructs were testedin a cha4 background, and the induction was lost (Table 1,strain SG84). In conclusion, serine-mediated induction

through UAS1cHA and/or UAS2CHA depends on a functionalCHA4 gene.

DISCUSSION

The CHAI gene of S. cerevisiae encodes the catabolicL-serine (L-threonine) dehydratase (5), and it is inducedapproximately 100-fold by serine and threonine (34, 37). Inthis investigation, we studied the effects of several nitrogensources on CHAI expression by Northern analysis. Also, weinitiated a characterization of regulatory elements of theCHA4 promoter.We have previously shown that ammonium ions affect

threonine induction, while no effect on serine induction ofthe CI41 promoter was seen in the strain investigated (34).Furthermore, substitution of a good nitrogen source withproline does not increase the expression of CM4IA1, indicatingthat ClA is not subject to nitrogen regulation (nitrogencatabolite derepression) (34). ThegdhCR mutation is knownto relieve NR (17), and on the basis of enzymatic measure-ments of CH41 expression in a gdhCR mutant it wassuggested that CHA] is weakly affected by NR (two- tothreefold derepression in agdhCR mutant strain) (37). Herewe addressed, by Northern analysis of C4A1 expression,the question of whether CH41 is subject to NR. StrainY.1278b was grown with asparagine or ammonium ions inaddition to serine and threonine as the nitrogen source.Threonine induction of CH41 was prevented by asparagineand ammonium, and serine induction was partially pre-vented by asparagine and ammonium, consistent with ahypothesis stating that NR acts directly at the transcriptionallevel of CA41. However, it is also reasonable to suggest thatthe complete lack of threonine induction of CHAI is due toinducer exclusion. This is based on the following results.First, threonine is taken up by two permeases: (i) by thegeneral amino acid permease, and (ii), with somewhat loweraffinity, also by the asparagine permease (30). The generalamino acid permease is repressed and inactivated by thepresence of ammonium ions and asparagine (16, 26), andthreonine uptake is reduced to 14% in the presence ofasparagine (30). The serine-specific permease is only mildly

MOL. CELL. BIOL.

on April 14, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

CHA41 REGULATORY ELEMENTS 7609

affected by the presence of ammonium ions (45), allowingserine to enter the cell despite the presence of asparagineand ammonium, which may explain the relatively high levelof CHA1 expression under these growth conditions. In thecase of allantoin gene expression, it has been demonstratedthat the presence of several copies of UASNTR is necessary

and sufficient for sensitivity to NR (12). Recently, it has beensuggested that NR of CAR1 expression is derived fromregulated inducer exclusion (11). Consistent with this view,neither the CA41 upstream region nor the CARI upstreamregion contains any UASNTR sequences.

We have identified elements of the CI-4A promoter re-

quired for serine and threonine induction and found them toconfer serine induction upon a heterologous promoter. Theproperties of these elements, UASCHA, are similar to thoseof other upstream promoter elements. Like UASGAL (42),UAScHA functions with equal efficiency in both orientations(Fig. 5 and Table 1, pTK269, pTK268, pTK401, andpTK403), in agreement with the palindromic nature ofUAScHA. Changing the distance between UASCHA and theTATA box from 151 bp in pTK233 to 167 bp in pTK218 doesnot disturb the function of UASCHA. However, when thedistance between UASCHA and the TATA element ischanged from 151 bp in pTK224 to 291 bp in pTK207, thetranscription initiation frequency goes down but the induc-tion ratio is retained. This shows that there is a positioneffect of UASCHA, as with UASGAL (42).The serine inducibility of pTK269 and pTK268 allowed us

to assign UASlcHA to be contained within the sequence

5'CCCCAGCGAAATGTAATTCCACA TGTCA3',situated from positions -203 to -171. Inspection of thesequence revealed an imperfect palindrome (underlined).Likewise, the serine inducibility of pTK401 and pTK403locates UAS2CHA to the sequence 5'TJ7GCGfCGAGACATGiA'TCCCATG.iGCGG3', which is present furtherupstream in the promoter region (positions -243 to -213).Usually there is more than one UAS in a promoter, and inthe case of UASGAL, it has been shown that two UASs are

more efficient than one (27). Indeed, assay in a centromereplasmid revealed a difference between a construct containingonly UASlcHA and those containing both UASs (comparepTK130 and pTK145 in Fig. 4).Between UASlcHA and UAS2CHA at positions -218 to

-210 is a sequence, 3'ACCCGCCGA5', with homology tothe CARl URSJ transcriptional repression site, 5'AGCCGC-CGA3' (44). The URSI site has been identified upstream ofmany different genes, and the DNA fragments from a seriesof such promoters were all competitors of CARI URSIDNA-protein complex formation (28). The URSI site of theHOPI promoter, one of the competitors, is identical to the-218 to -210 sequence of the CHAI promoter, pointing tothe possibility of negative transcriptional regulation of theCI-LAl gene. Deletion of the possible URSI site from theCHAI promoter (pTK145) does not, however, lead to ele-vated transcriptional activity, possibly because of the posi-tion of UAS1cHA downstream of the URSI site. Furtherexperiments are required to establish whether the CI-41promoter contains a functional URSI site. The internaldeletion in pTK231 results in a nonfunctional promoter. Thissupports our mapping of UAScHA. To our surprise, 3-galac-tosidase expression could be detected from neither pTK132(-161) nor pTK231 (-281 to -155). However, when thesequence from position - 161 to position - 136 was deleted inpTK166, a low level of constitutive expression was regained.This could mean that sequences just downstream fromposition -155 and upstream from position -136 have a

negative effect on expression. The negative effect of thissequence is overcome by induction when UASCHA ispresent just upstream from it.We have detected a protein which specifically binds to a

sequence containing the ABF1-binding site consensus se-quence present from positions -272 to -260 in the CA41promoter. This is just upstream from UAS2CHA and imme-diately downstream from a poly(dT-dA) tract. A three- tofourfold increase in transcription was observed when thisputative ABF1-binding site of the CA41 promoter wasinserted into the XhoI site of pLG67OZ. This is a transcrip-tional enhancement which is similar to that found with otherABF1-binding sites (21, 38), suggesting that it is the ABF1protein which binds to this site of the CIIA1 promoter. Theregions of the PGK, ENO1, and EN02 promoters thatcontain ABF1-binding sites have been implicated in carbonsource regulation (8, 41). Since CA41 is required for cellgrowth on serine as the sole carbon source (4), we reasonedthat carbon source-dependent regulation might be a biolog-ical function of ABF1 bound to the C-41 promoter. How-ever, with CA41, when the carbon source was changed fromglucose to either galactose, lactate, or serine, the ABF1 sitehad no effect on expression. Further experiments are re-quired to clarify a possible role of the ABF1 protein in theregulation of CH11.

In nuclear protein extracts, we have not been able toobserve protein binding to UASCHA with the probes used inthis study. Likewise, detection of binding of the potentactivator GAL4 to its target sequence is possible only withpartially purified extracts from cells overexpressing therelevant protein (6).

In conclusion, we have identified a new yeast regulatoryelement that confers serine and threonine inducibility uponthe promoter in which it is present. Among the questionsthat this study has opened, it will be especially interesting tostudy the protein-DNA interactions at UASCHA and thepossible functions and interrelationships of the URSI siteand the putative repressing element.

ACKNOWLEDGMENTS

We thank Torsten Nilsson-Tillgren, Claes Gjermansen, JacquesRemacle, and Mette Pretorius for helpful discussions and encour-agement during this work. Bettina Jakobsen, Birgith Kolding, GitteBank, and Hanne Frederiksen are thanked for technical assistance.Karina Arp Hedegaard is thanked for synthesis of the oligonucleo-tides. Moreover, Enca Martin-Rend6n is thanked for discussion andfor providing unpublished data. We thank Nina Rasmussen andAnn-Sofi Steinholtz for preparation of figures and photographs, andwe thank Olaf Nielsen for helpful discussions and for critical readingof the manuscript.

This work was supported by the Danish Center of Microbiology.

REFERENCES

1. Ammerer, G., C. P. Hunter, J. H. Rothman, C. G. Saari, L. A.Valls, and T. H. Stevens. 1986. PEP4 gene of Saccharomycescerevisiae encodes proteinase A, a vacoular enzyme requiredfor processing of vacuolar precursors. Mol. Cell. Biol. 6:2490-2499.

2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G.Seidman, J. A. Smith, and K. Struhl. 1987. Current protocols inmolecular biology. Greene Publishing Associates and Wiley-Interscience, New York.

3. Benjamin, P. M., J.-I. Wu, A. P. Mitchell, and B. MagasaniL1989. Three regulatory systems control expression of glutaminesynthetase in Saccharomyces cerevisiae at the level of tran-scription. Mol. Gen. Genet. 217:370-377.

VOL. 13, 1993

on April 14, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

7610 BORNf-S ET AL.

4. Bornes, C. 1991. Ph.D. thesis. University of Copenhagen,Copenhagen, Denmark.

5. Bornies, C., J. G. L. Petersen, and S. Holmberg. 1992. Serineand threonine catabolism in Saccharomyces cerevisiae: theCH41 polypeptide is homologous with other serine and threo-nine dehydratases. Genetics 131:531-539.

6. Bram, R. J., and R. D. Kornberg. 1985. Specific protein bindingto far upstream activating sequences in polymerase II promot-ers. Proc. Natl. Acad. Sci. USA 82:43-47.

7. Brandriss, M. C. 1983. Proline utilization in Saccharomycescerevisiae: analysis of the cloned PUT2 gene. Mol. Cell. Biol.3:1846-1856.

8. Brindle, P. K., J. P. Holland, C. E. Willett, M. A. Innis, andM. J. Holland. 1990. Multiple factors bind the upstream activa-tion sites of the yeast enolase genes EN01 and EN02: ABF1protein, like repressor activator protein RAP1, binds cis-actingsequences which modulate repression or activation of transcrip-tion. Mol. Cell. Biol. 10:4872-4885.

9. Buchman, A. R., W. J. Kimmerly, J. Rine, and R. D. Kornberg.1988. Two DNA-binding factors recognize specific sequences atsilencers, upstream activating sequences, autonomously repli-cating sequences, and telomeres in Saccharomyces cerevisiae.Mol. Cell. Biol. 8:210-225.

10. Cooper, T. G. 1982. Nitrogen metabolism in Saccharomycescerevisiae, p. 39-99. In J. N. Strathern, E. W. Jones, and J. R.Broach (ed.), The molecular biology of the yeast Saccharomy-ces. Metabolism and gene expression. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

11. Cooper, T. G., L. Kovari, R. A. Sumrada, H.-D. Park, R. M.Luche, and I. Kovari. 1992. Nitrogen catabolite repression ofarginase (CAR1) expression in Saccharomyces cerevisiae isderived from regulated inducer exclusion. J. Bacteriol. 174:48-55.

12. Cooper, T. G., R. Rai, and H. S. Yoo. 1989. Requirement ofupstream activation sequences for nitrogen catabolite repres-sion of the allantion system genes in Saccharomyces cerevisiae.Mol. Cell. Biol. 9:5440-5444.

13. Douglas, H. C., and D. C. Hawthorne. 1966. Regulation of genescontrolling synthesis of the galactose pathway enzymes inyeast. Genetics 54:911-916.

14. Galas, D. J., and A. Schmitz. 1978. DNase footprinting: a simplemethod for the detection of protein-DNA binding specificity.Nucleic Acids Res. 5:3157-3170.

15. Genbauffe, F. S., and T. G. Cooper. 1986. Induction andrepression of the urea amidolyase gene in Saccharomycescerevisiae. Mol. Cell. Biol. 6:3954-3964.

16. Grenson, M. 1983. Inactivation-reactivation process and repres-sion of permease formation regulate several ammonia-sensitivepermeases in the yeast Saccharomyces cerevisiae. Eur. J.Biochem. 133:135-139.

17. Grenson, M., E. Dubois, M. Piotrowska, R. Drillien, and M.Aigle. 1974. Ammonia assimilation in Saccharomyces cerevisiaeas mediated by the two glutamate dehydrogerases. Mol. Gen.Genet. 128:73-85.

18. Guarente, L., and M. Ptashne. 1981. Fusion of Escherichia colilacZ to the cytochrome c gene of Saccharomyces cerevisiae.Proc. Natl. Acad. Sci. USA 78:2199-2203.

19. Guarente, L., R. R. Yocum, and P. Gifford. 1982. A GALJO-CYCI hybrid yeast promoter identifies the GAL4 regulatoryregion as an upstream site. Proc. Natl. Acad. Sci. USA 79:7410-7414.

20. Halfter, H., B. Kavety, J. Vandekerckhove, F. Kiefer, and D.Gallwitz. 1989. Sequence, expression and mutational analysisof BAF1, a transcriptional activator and ARS1-binding proteinof the yeast Saccharomyces cerevisiae. EMBO J. 8:4265-4272.

21. Halfter, H., U. Muller, E.-L. Winnacker, and D. Gallwitz. 1989.Isolation and DNA-binding characteristics of a protein involvedin transcription activation of two divergently transcribed, essen-tial yeast genes. EMBO J. 8:3029-3037.

22. Hinnebusch, A. G., and G. R. Fink. 1983. Positive regulation inthe general amino acid control of Saccharomyces cerevisiae.Proc. Natl. Acad. Sci. USA 80:5374-5378.

23. Holmberg, S. 1991. Evidence for positive regulation of serineand threonine catabolism in Saccharomyces cerevisiae, p. 191.Abstr. GSA Meet. Yeast Genet. Mol. Biol., San Francisco,Calif. Genetics Society of America, Bethesda, Md.

24. Holmberg, S., and J. G. L. Petersen. 1988. Regulation ofisoleucine-valine biosynthesis in Saccharomyces cerevisiae.Curr. Genet. 13:207-217.

25. Ignjatovic, M. W. 1990. Cand. Scient. thesis. University ofCopenhagen, Copenhagen, Denmark.

26. Jauniaux, J.-C., and M. Grenson. 1990. GAP1, the generalamino acid permease gene of Saccharomyces cerevisiae. Nu-cleotide sequence, protein similarity with other bakers yeastamino acid permeases, and nitrogen catabolite repression. Eur.J. Biochem. 190:39-44.

27. Lorch, Y., and R. D. Kornberg. 1985. A region flanking theGAL7 gene and a binding site for GAL4 protein as upstreamactivating sequences in yeast. J. Mol. Biol. 186:821-824.

28. Luche, R. M., W. C. Smart, and T. G. Cooper. 1992. Purificationof the heteromeric protein binding to the URS1 transcriptionalrepression site in Saccharomyces cerevisiae. Proc. Natl. Acad.Sci. USA 89:7412-7416.

29. Machida, M., H. Uemura, Y. Jigami, and H. Tanaka. 1988. Theprotein actor which binds to the upstream activating sequenceof Saccharomyces cerevisiae ENOI gene. Nucleic Acids Res.16:1407-1422.

30. Martin-Rend6n, E. (University of Seville). 1991. Personal com-munication.

31. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

32. Nagawa, F., and G. R. Finl. 1985. The relationship between the"TATA" sequence and transcription initiation sites at the HIS4gene of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA82:8557-8561.

33. Nielsen, T. L., S. Holmberg, and J. G. L. Petersen. 1990.Regulated overproduction and secretion of yeast carboxypepti-dase Y. Appl. Microbiol. Biotechnol. 33:307-312.

34. Petersen, J. G. L., M. C. Kielland-Brandt, T. Nilsson-Tillgren,C. Bornus, and S. Holmberg. 1988. Molecular genetics of serineand threonine catabolism in Saccharomyces cerevisiae. Genet-ics 119:527-534.

35. Prietorius, M. 1990. Cand. Scient. thesis. University of Copen-hagen, Copenhagen, Denmark.

36. Rai, R., F. Genbauffe, H. Z. Lea, and T. G. Cooper. 1987.Transcriptional regulation of the DAL5 gene in Saccharomycescerevisiae. J. Bacteriol. 169:3521-3524.

37. Ramos, F., and J.-M. Wiame. 1982. Occurrence of a catabolicL-serine (L-threonine) deaminase in Saccharomyces cerevisiae.Eur. J. Biochem. 123:571-576.

38. Remacle, J. E., and S. Holmberg. 1992. A REBl-binding site isrequired for GCN4-independent ILV1 basal level transcriptionand can be functionally replaced by an ABF1-binding site. Mol.Cell. Biol. 12:5516-5526.

39. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

40. Shore, D., and K. Nasmyth. 1987. Purification and cloning of aDNA binding protein from yeast that binds to both silencer andactivator elements. Cell 51:721-732.

41. Stanway, C., J. Mellor, J. E. Ogden, A. J. Kingsman, and S. M.Kingsman. 1987. The UAS of the yeast PGK gene containsfunctionally distinct domains. Nucleic Acids Res. 15:6855-6873.

42. Struhl, K. 1984. Genetic properties and chromatin structure ofthe yeast gal regulatory element: an enhancer-like sequence.Proc. Natl. Acad. Sci. USA 81:7865-7869.

43. Sumrada, R. A., and T. G. Cooper. 1982. Isolation of the CAR]gene from Saccharomyces cerevisiae and analysis of its expres-sion. Mol. Cell. Biol. 2:1514-1523.

44. Sumrada, R. A., and T. G. Cooper. 1987. Ubiquitous upstreamrepression sequences control activation of the inducible argi-nase gene in yeast. Proc. Natl. Acad. Sci. USA 84:3997-4001.

45. Verma, R. S., T. V. G. Rao, and R. Prasad. 1984. An inducible,specific and derepressible transport of L-serine in Saccharomy-

MOL. CELL. BIOL.

on April 14, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

CH41 REGULATORY ELEMENTS 7611

ces cerevisiae. Biochim. Biophys. Acta 778:289-297.46. Vogel, K., W. Horz, and A. Hinnen. 1989. The two positive-

ly acting regulatory proteins PHO2 and PHO4 interact withPH05 upstream activation regions. Mol. Cell. Biol. 9:2050-2057.

47. Wang, S.-S., and M. C. Brandriss. 1986. Proline utilization in

Saccharomyces cerevisiae: analysis of the cloned PUTI gene.Mol. Cell. Biol. 6:2638-2645.

48. Yoo, H.-S., F. S. Genbauffe, and T. G. Cooper. 1985. Identi-fication of the ureidoglycolate hydrolase gene in the DALgene cluster of Saccharonyces cerevisiae. Mol. Cell. Biol. 5:2279-2288.

VOL. 13, 1993

on April 14, 2018 by guest

http://mcb.asm

.org/D

ownloaded from