JOURNAL OF BACTERIOLOGY, Mar. 2007, p. 2468–2476 Vol. 189, No. 60021-9193/07/$08.00�0 doi:10.1128/JB.01848-06Copyright © 2007, American Society for Microbiology. All Rights Reserved.

A Novel Two-Component Signaling System That Activates Transcriptionof an Enterohemorrhagic Escherichia coli Effector Involved in

Remodeling of Host Actin�

Nicola C. Reading,1 Alfredo G. Torres,2 Melissa M. Kendall,1 David T. Hughes,1Kaneyoshi Yamamoto,3 and Vanessa Sperandio1*

Department of Microbiology, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas 75390-90481; Department ofMicrobiology and Immunology, University of Texas Medical Branch, Galveston, Texas 77555-10702; and Department of

Agricultural Chemistry, Kinki University, Nakamachi 3327-204, Nara 631-8505, Japan3

Received 10 December 2006/Accepted 5 January 2007

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is responsible for worldwide outbreaks of bloodydiarrhea, hemorrhagic colitis, and life-threatening hemolytic uremic syndrome. After colonizing the largeintestine, EHEC forms attaching and effacing (AE) lesions on intestinal epithelial cells. These lesions causedestruction of the microvilli and elicit actin rearrangement to form pedestals that cup each bacteriumindividually. EHEC responds to a signal produced by the intestinal microbial flora, autoinducer-3 (AI-3), andthe host hormones epinephrine and norepinephrine to activate transcription of the genes involved in AE lesionformation. These three signals, involved in interkingdom communication, are sensed by bacterial sensorkinases. Here we describe a novel two-component system, QseEF (quorum-sensing E. coli regulators E and F),which is part of the AI-3/epinephrine/norepinephrine signaling system. QseE is the sensor kinase and QseF theresponse regulator. The qseEF genes are cotranscribed, and transcription of qseEF is activated by epinephrinethrough the QseC sensor. A qseF mutant does not form AE lesions. QseF activates transcription of the geneencoding EspFu, an effector protein translocated to the host cell by the EHEC, which mimics a eukaryoticSH2/SH3 adapter protein to engender actin polymerization during pedestal formation. Expression of the espFugene from a plasmid restored AE lesion formation to the qseF mutant, suggesting that lack of espFu expressionin this mutant was responsible for the loss of pedestal formation. These findings suggest the QseEF is atwo-component system involved in the regulation of AE lesion formation by EHEC.

Enterohemorrhagic Escherichia coli (EHEC) has caused nu-merous outbreaks of bloody diarrhea and hemolytic uremicsyndrome throughout the world. In North America, the UnitedKingdom, and Japan, the main serotype associated with theseoutbreaks was O157:H7. EHEC strains are part of a group ofenteric pathogens that includes enteropathogenic Escherichiacoli, rabbit enteropathogenic E. coli, Citrobacter rodentium, andHafnia alvei, all of which are able to cause a lesion on intestinalepithelial cells termed attaching and effacing (AE). This lesionis characterized by the destruction of the microvilli and therearrangement of the cytoskeleton to form a pedestal-likestructure that cups the bacterium individually (21).

The genes involved in AE lesion formation are containedwithin the locus of enterocyte effacement (LEE). This patho-genicity island is composed of 41 genes arranged in five oper-ons that encode structural and secondary proteins required forthe formation of the type III secretion system (TTSS), a bac-terial adhesin (intimin), and several effector proteins, whichare translocated into host cells through the TTSS (10, 12, 26).Aside from effector proteins, this TTSS also secretes proteinsthat constitute its translocon, such as EspA, which forms afilament that creates a sheath around the TTSS needle, and

EspB and EspD, located at the distal end of the TTSS, whichform a pore in the host cell membrane (see Fig. 5A) (18, 25).When EHEC is in close proximity to the epithelial lining, aneffector protein, translocated intimin receptor (Tir), is secretedthrough the TTSS and into the host cell. Once inside the hostcell, it embeds itself into the eukaryotic membrane in a hairpinloop formation, and its extracellular domain serves as a bac-terial receptor that binds the adhesin intimin, allowing thebacteria to attach tightly to the eukaryotic cell (23).

Inside the host cell, the cytoplasmic portion of Tir initiates asignaling cascade that leads to recruitment of Arp2/3 and N-WASP, eliciting actin nucleation to form pedestals character-istic of the AE lesion (1, 3, 20). In enteropathogenic Esche-richia coli, Tir is phosphorylated on Tyr474 by the eukaryoticproteins Src, Arg, and Abl (30, 38). This creates a binding sitefor the actin SH2/SH3 adapter protein Nck, which activatesN-WASP and recruits the Arp2/3 complex to initiate actinnucleation. EHEC Tir does not contain a corresponding ty-rosine residue and forms pedestals in a Nck-independent man-ner. While Tir is the only LEE-encoded effector necessary forpedestal formation in EHEC, an additional non-LEE-encodedeffector is also required. This prophage-encoded and primarilyEHEC-specific protein, EspFu/TccP, binds to the (GTP-bind-ing domain) GBD domain of N-WASP and is recruited to Tir,activating actin polymerization (4, 15).

Transcription of the LEE genes is activated through theautoinducer-3 (AI-3)/epinephrine/norepinephrine interking-dom signaling system. AI-3 is a bacterial quorum-sensing signal

* Corresponding author. Mailing address: University of TexasSouthwestern Medical Center, Dept. of Microbiology, 5323 HarryHines Blvd., Dallas, TX 75390-9048. Phone: (214) 648-1603. Fax: (214)648-5905. E-mail: vanessa.sperandio@utsouthwestern.edu.

� Published ahead of print on 12 January 2007.

2468

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

produced by the resident human intestinal microbial flora (36),whose production under defined environmental conditions re-quires a functional luxS gene in EHEC (39). Both epinephrineand norepinephrine are present in the gastrointestinal tract.Norepinephrine is synthesized within the adrenergic neuronspresent in the enteric nervous system (13). Although epineph-rine is not synthesized in the enteric nervous system, it issynthesized in the central nervous system and in the adrenalmedulla, where it is released into the bloodstream and acts ina systemic manner, eventually reaching the intestine (31). Bothhormones modulate intestinal smooth muscle contraction, sub-mucosal blood flow, and chloride and potassium secretion inthe intestine, all important during bacterial infection (17). TheEHEC sensor kinase, QseC, autophosphorylates in response toeach of these signals (6) and initiates a complex signalingcascade that regulates the expression of genes encoding pro-teins necessary for AE lesion formation and the flagellar regu-lon (6–8, 34–36). QseC is the sensor of the QseBC two-com-ponent system. In two-component signaling, a sensor histidinekinase autophosphorylates in response to environmental cues.It then transfers this phosphate to an aspartate residue on aresponse regulator, which is often a DNA binding protein.Only when phosphorylated are the response regulators able tobind DNA and alter downstream transcriptional activities (40).

Here we report the identification of an additional two-com-ponent regulatory system, YfhK and YfhA, herein renamedquorum-sensing regulators E and F (QseEF). QseE is putativesensor kinase, while QseF is a putative response regulator.QseEF are part of the AI-3/epinephrine/norepinephrine sig-naling cascade and activate transcription of espFu to drive actinpolymerization during AE lesion formation.

MATERIALS AND METHODS

Strains and plasmids. All bacterial strains and plasmids utilized in this studyare listed in Table 1. E. coli strains were grown aerobically in LB medium orDulbecco’s modified Eagle medium (DMEM) at 37°C unless otherwise specified.Antibiotics were added at the following concentrations: 100 �g ml�1 for ampi-cillin, 30 �g ml�1 chloramphenicol, 50 �g ml�1 kanamycin, and 25 �g ml�1

tetracycline.Recombinant DNA techniques. Standard methods were used to perform re-

striction digestions, plasmid purification, PCR, ligation, transformation, and gelelectrophoresis (32). All oligonucleotide primers are listed in Table 2. PlasmidpNR01 was constructed by amplifying the qseE gene from the EHEC strain86-24 by use of Pfx DNA polymerase (Invitrogen) with primers YfhKFBADand YfhKRBAD and cloning the resulting PCR product into the EcoRI-KpnIcloning site of vector pBADMycHisA (Invitrogen). Plasmid pNR02 was con-structed by amplifying the qseF gene from the EHEC strain 86-24 by use ofPfx DNA polymerase (Invitrogen) with primers QseFFBAD and QseFRBADand cloning the resulting PCR product into the KpnI-HindIII cloning site ofvector pBADMycHisA (Invitrogen).

Construction of isogenic mutants. Construction of the qseE polar mutant(KRL7) was carried out by replacing qseE with the tet gene amplified fromplasmid pACYC184 by use of suicide vector pCVD442, as previously described(11). Construction of nonpolar isogenic qseE (NR01) and qseF (NR02) mutantswas carried out as previously described (9). Briefly, 86-24 cells containingpKM201 were prepared for electroporation. PCR products of a chloramphenicolresistance cassette with 50 to 80 overhangs homologous to either qseE or qseFwere generated using primers YfhKP1 and YfhKP2 (qseE) and YfhARedP1 andYfhARedP2 (qseF) and with pKD3 as a template. Electroporation of the PCRproduct into these cells was performed; cells were incubated at 37°C for 2 h andplated on media containing 30 �g ml�1 chloramphenicol overnight at 37°C.Resulting colonies were patched for chloramphenicol resistance and ampicillinsensitivity and PCR verified for the absence of the gene. The chloramphenicolresistance cassette was then resolved from the mutants in order to create non-polar, isogenic qseE (NR01) and qseF (NR02) mutants. Plasmid pCP20, encoding

a resolvase, was electroporated into the mutant strain, and resulting colonieswere patched for chloramphenicol sensitivity. Both mutants were complementedwith plasmids pNR01 for NR01-generating strain NR04 and with pNR02 forNR02-generating strain NR06.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblot-ting. For blots using whole-cell lysates, total proteins were extracted from strains86-24, NR01, NR02, and NR04 grown in DMEM to an optical density at 600 nm(OD600) of 1.0. Briefly, 3 ml of culture was pelleted (13,000 rpm for 5 min at 4°C),resuspended in 300 �l lysis buffer (50 mM Tris-HCl [pH 7.5], 50 mM NaCl, 5%glycerol, 1 mM dithiothreitol, and 30 mM phenylmethylsulfonyl fluoride), sub-jected to lysozyme addition to a final concentration of 300 �g/ml, incubated at4°C for 4 h, and DNase I treated for 45 min at 4°C; cell debris was then pelleted(13,000 rpm for 10 min at 4°C), and supernatant containing whole-cell proteinwas removed. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis andimmunoblotting procedures were performed as previously described (32), andproducts were probed with polyclonal antisera against either EspA, EspB,intimin, or Tir (kindly provided by James Kaper). Proteins were detected usingenhanced chemiluminescence (Bio-Rad). Equal amounts of whole-cell lysateprotein were determined using the Bradford assay (32).

Secreted proteins. Secreted proteins from 86-24, NR01, NR02, and NR04were harvested as previously described by Jarvis et al. (19). Briefly, bacteria weregrown aerobically in DMEM at 37°C and collected at late exponential growthphase (OD600, 1.0). Total secreted protein from culture supernatants was sepa-rated by removing bacteria by use of centrifugation and filtration and thenprecipitating the secreted proteins present in the supernatant with trichloroaceticacid. The samples were then subjected to immunoblotting with rabbit polyclonalantisera to EspA, EspB, and Tir (kindly provided by James Kaper) and visualizedwith enhanced chemiluminescence (Bio-Rad).

TABLE 1. Strains and plasmids used in this study

Strain orplasmid Relevant genotypea Reference or

source

Strains86-24 Stx2� EHEC strain (serotype

O157:H7)16

VS-94 luxS isogenic mutant of 86-24 35NR01 86-24 qseE nonpolar mutant This studyNR02 86-24 qseF nonpolar mutant This studyNR04 NR01 complemented with plasmid

pNR01This study

NR06 NR02 complemented with plasmidpNR02

This study

KRL7 86-24 qseE polar mutant This studyNR26 pK187 in NR02 This studyNR27 pKC471 in NR02 This studyNR28 pKH35-4 in BL21 DE3 cells 40NR30 pNR15 in NR02 This studyNR31 pET16 in NR02 This studyNR32 p635 in NR02 This study

PlasmidspBadMycHis C-terminal Myc-His tag cloning vector InvitrogenpNR01 qseE in pBadMycHis This studypNR02 qseF in pBadMycHis This studypCVD442 Suicide vector 11pBluescript Cloning vector InvitrogenpKD3 pANTS� derivative containing

FRT-flanked chloramphenicolresistance

9

pKM201 � red recombinase expression plasmid 29pCP20 TS replication and thermal induction

of FLP synthesis5

pRS551 lacZ reporter gene fusion vector 33pNR10 espFu regulatory region in pRS551 This studypK187 Low-copy-no. KanR vector 4pKC471 espFu-myc in pK187 4pKH35-4 yfhA in pET21a(�) 40pNR15 qseF in pACYC177 This studypACYC177 Cloning vector New England

BiolabspVS262 espFu regulatory region in TOPO This studyTopo Commercial blunt-end cloning vector Invitrogenp635 espFu in pET16 Kind gift from

John M. LeongpET16 Expression vector Novagen

a TS, temperature sensitive; FRT, FLP recombination target.

VOL. 189, 2007 QseEF SYSTEM ACTIVATES TRANSCRIPTION OF espFu 2469

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

Reporter gene assays. Plasmid pNR10 was generated by amplifying the regu-latory region of espFu with primers EspFuF and EspFuR and cloning the result-ing fragments into the BamHI restriction sites of plasmid pRS551 (33). Becauseof plasmid compatibility issues, to perform these assays, the qseF mutant wascomplemented by cloning the qseF gene into the SmaI restriction site ofpACYC177, generating plasmid pNR15. Bacteria containing the lacZ fusionswere grown overnight at 37°C in LB containing the appropriate selective anti-biotic. Cultures were diluted 1:100 and grown in DMEM to an OD600 of 1.0 at37°C. These cultures were then assayed for �-galactosidase activity by use ofo-nitrophenyl-�-D-galactopyranoside as a substrate as described previously (28).

RNA extraction and real-time RT-PCR studies. Overnight cultures grownaerobically in LB at 37°C of 86-24 and VS94 (luxS mutant) were diluted 1:100 inDMEM and grown aerobically at 37°C. RNA from three biological replicatecultures of each strain was extracted at mid-exponential growth phase (OD600,0.5) and late exponential growth phase (OD600, 1.0) by use of a RiboPurebacterial RNA isolation kit (Ambion) following the manufacturer’s guidelines.The primers used in the real-time assays were designed using Primer Express v1.5(Applied Biosystems) (Table 2). Real-time reverse transcription-PCR (RT-PCR)was performed in a one-step reaction using an ABI 7500 sequence detectionsystem (Applied Biosystems).

For each 20-�l reaction volume, 10 �l 2� SYBR master mix, 0.1 �l Multi-scribe reverse transcriptase (Applied Biosystems), and 0.1 �l RNase inhibitor(Applied Biosystems) were added. The amplification efficiency of each of theprimer pairs was verified using standard curves of known RNA concentrations.Melting curve analysis was used to ensure template specificity by heating prod-ucts to 95°C for 15 s, followed by cooling to 60°C and heating to 95°C whilemonitoring fluorescence. Once amplification efficiency and template specificitywere determined for each primer pair, relative quantification analysis was used toanalyze the unknown samples by use of the following conditions for cDNAgeneration and amplification: 48°C for 30 min, 95°C for 10 min, and 40 cycles at95°C for 15 s and 60°C for 1 min. The rpoA (RNA polymerase subunit A) genewas used as the endogenous control.

Detection, quantification, and statistical analysis. Data collection was per-formed using the ABI Sequence Detection 1.3 software (Applied Biosystems).

Data were normalized to levels of rpoA and analyzed using the comparativecritical threshold method previously described (2). The expression levels of thetarget genes at the different growth phases were compared using the relativequantification method (2). Real-time data are presented as change (n-fold)compared to wild-type (WT) levels at the early exponential growth phase andchange (n-fold) compared to WT levels at late exponential growth phase. Errorbars represent the standard deviation of the ��CT value, where CT is the criticalthreshold (2). Statistical significance was determined by use of Student’s t test. AP value of 0.05 was considered significant.

FAS test. Fluorescein actin staining (FAS) assays were performed as pre-viously described by Knutton et al. (24). In brief, overnight bacterial culturesgrown aerobically in LB at 37°C were diluted 1:100 and used to infectconfluent monolayers of HeLa cells grown on glass coverslips at 37°C and 5%CO2. Cells were grown for 6 h at 37°C and 5% CO2. The coverslips were thenwashed, permeabilized with 0.2% Triton X-100, and treated with fluoresceinisothiocyanate-labeled phalloidin to visualize actin accumulation, and propidiumiodide was added to stain bacteria. Samples were visualized by immunofluores-cence with a Zeiss Axiovert microscope. The entire field of at least six coverslipsfrom each strain was examined, and images of AE lesions were taken.

Purification of QseF. QseF was purified after being expressed from plasmidpKH35-4 (40). E. coli BL21(DE3) containing plasmid pKH35-4 was grown at37°C in LB to an OD600 of 0.7, at which point isopropyl-�-D-thiogalactopyrano-side was added to a final volume of 0.5 mM and allowed to induce for 3 hours.His-tagged QseF protein was then purified under native conditions by use of anickel column according to the manufacturer’s instructions (QIAGEN).

EMSAs. In order to study the binding of QseF to the espFu promoter, elec-trophoretic mobility shift assays (EMSAs) were performed using purified QseF-His and PCR-amplified DNA probes. Probes were end labeled with [�-32P]ATP(NEB) by use of T4 polynucleotide kinase according to standard procedures (32)and gel purified using a QIAGEN PCR purification kit. EMSAs were performedby adding increasing amounts of purified QseF protein (0 to 3 �g) to end-labeledprobe (10 ng) in binding buffer [500 �g ml�1 bovine serum albumin (NEB), 50ng �l�1 poly(dI-dC), 60 mM HEPES (pH 7.5), 5 mM EDTA, 3 mM dithiothre-itol, 300 mM KCl, 25 mM MgCl2] with or without 0.1 M acetyl phosphate for 20

TABLE 2. Oligonucleotides used in this study

Primer name Sequence Description

yfhKP1 GGCAAAGCCTGAATGCGCCTTAGCGACCAGGCGGCGCTGGTCAACCGCACCACGCTTATCGATGCCCGGCGCAGCGAAGCAATGACCAACGCGGCGCTGGATGTAGGCTGGAGCTGCTTC

Construction of the QseE isogenicmutant

yfhKP2 TTGCCCGCTCTCGTCGACCAGATACAGTTCCCCTTGCATACGGCGAATACAATCCCTGGCAATGCTTAATCCCAGACCGCTGCCCTTCACCGCCCCTTTTATATGAATATCCTCCTTA

Construction of the QseE isogenicmutant

yfhARedP1 GAAACTGCTTGGCCTGCGCCTGACCAGCGAAGGCTACAGCGTGGTCACGGGTGTAGGCTGGAGCTGCTTC

Construction of the QseF isogenicmutant

yfhARedP2 AATTCTGTCCGGTTGCGCCCCGCCATTCTCGCCGCGTGGGTGACGTTGCCCATATGAATATCCTCCTTA

Construction of the QseF isogenicmutant

QseFFBAD GGTACCGTGAAAAGCCCGCGCCATCCA Construction of pNR02QseFRBAD AAGCTTATCGTTTGCATCCAGCTCGTGT Construction of pNR02YfhKFBAD GGTACCTATCTGAACTTCCCCTCGGTT Construction of pNR01YfhKRBAD GAATTCCCTTTCGTGTTTTTCGACGACGG Construction of pNR01EspFuF CGCGGATCCCTGTCGGCTCTCTTCTAGAT espFu activity assay, EMSA, RT-PCREspFuR CGC GGA TCC ATA TTG CGG TTG ACG GTT GG espFu activity assayEspFuSEQ ATA TTG CGG TTG ACG GTT GG Primer extension, sequencing ladderQseE RTR CGC GCC ATG ATC TTC GA Real-time analysisQseE RTF CCC TTC ACC GCC CCT TT Real-time analysisEspFuCInv TGC GGC GAT GTA TAA ATG AC Primer extensionEspFuBInv ACA GCC ATT CCT CCT GTG T EMSAEspFuCInv TGC GGC GAT GTA TAA ATG AC EMSAEspFuRN GTTCATTTTGTACTGGCGGC RT-PCREspFuRT2 GCATCCTATTTATTGCTCACGTTA RT-PCREspFuProbeR CGAGCGCTTAGATGTATTAATGCC RT-PCREspFuProbeF ATGATTAACAATGTTTCTTCACTTTTTCC RT-PCRQseF RT R CGT AAG CTG CTG CAA ATT ACC A Real-time analysisQseF RT F CGC CCC GCC ATT CTC Real-time analysis3a GAA ATG GTA CAG GCC ACG CGC ACT RT-PCR3b ATC AGC ACA ATC CAT CGC CCG RT-PCR6a CGG GCG ATG GAT TGT GCT GAT RT-PCR6b TAT GTC GCT CTG CCG CCT GGC RT-PCR

2470 READING ET AL. J. BACTERIOL.

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

min at 4°C. A 5% Ficoll solution was added to the mixtures immediately beforeloading. Reaction mixtures were then electrophoresed on a 6% polyacrylamidegel, dried, and exposed to KODAK X-OMAT film.

RNA purification and primer extension analysis. RNA purification was per-formed according to the manufacturer’s instructions using the TRIzol reagent(Invitrogen). RNA was isolated from strain 86-24 grown in DMEM aerobically at37°C to an OD600 of 1.0. Primer extension analysis was then performed asdescribed previously (27). Briefly, EspFuSEQ, approximately 40 bp downstreamof the ATG start site, and EspFuCInv, approximately 100 bp upstream of theATG start site (Table 2), were end labeled using [�-32P]dATP. A total of 35 �gof RNA was incubated with the end-labeled primer and reverse transcribed usinga SuperScript first-strand synthesis system for RT-PCR (Invitrogen) according tothe manufacturer’s instructions. A sequencing ladder was generated using the

Sequenase version 2.0 DNA sequencing kit (USB) according to the manufactur-er’s instructions. The sequencing ladder was generated using primer EspFuSEQand plasmid pVS262. Plasmid pVS262 was created by amplifying the espFuregulatory region and cloning the product into blunt-end TOPO (Invitrogen).These experiments were repeated three times, with two different primers toensure the correct mapping of this promoter.

RESULTS

QseEF constitute a novel putative two-component systemrequired for pedestal formation. The gene yfhK encodes a55-kDa putative sensor kinase protein predicted to lie in theinner membrane. This protein contains two transmembranedomains, a signal histidine kinase domain, and an ATPasedomain. The gene yfhA encodes a 49-kDa putative responseregulator and contains a response regulator domain, a helix-turn-helix DNA binding domain, and a 54 activation domain(Fig. 1). These genes were originally identified in a microarraystudy comparing differential gene expression for a WT EHECstrain and that for an isogenic EHEC luxS knockout strain.Under defined environmental conditions, the luxS mutant doesnot produce the AI-3 bacterial signal (39). Transcription ofyfhK was up-regulated twofold in the luxS mutant in late ex-ponential growth compared to that for WT (35). To confirmthe array data, we performed real-time RT-PCR analysis usingcDNA synthesized from RNA extracted from WT and an iso-genic luxS mutant during mid-exponential (OD600, 0.5) andlate exponential (OD600, 1.0) growth. Transcription of yfhKwas mildly decreased 0.5-fold for the luxS mutant during mid-exponential growth (P � 0.0075), whereas it was increasedtwofold for the luxS mutant during late exponential growth(P � 0.0051) (Fig. 2A). In the same microarray study, tran-scription of qseBC and qseA was altered in the luxS mutantcompared to WT (34, 37), leading to the subsequent descrip-tion of these regulators as being part of the AI-3/epinephrine/norepinephrine signaling cascade in EHEC (34, 36, 37). Theseresults suggested that yfhK and yfhA could also be part of the

FIG. 1. QseEF is a predicted two-component signaling system thatis a part of the EHEC cell-to-cell signaling cascade. Shown are aschematic of QseE and QseF and their respective domains and theexpected localization of QseE and QseF within the bacterial cell andproposed signaling mechanism.

FIG. 2. (A) Real-time analysis of qseE expression in a luxS mutant and a qseA mutant compared to WT. qseE expression is down at mid-loggrowth and up at late log growth for the luxS mutant. Conversely, qseE expression is up at mid-log phase and down at late log phase for the qseAmutant. (B) Real-time analysis of qseF and qseE expression in a qseC mutant compared to WT in the presence and absence of epinephrine (Epi).qseF and qseE expression is increased in the presence of epinephrine and decreased in the qseC mutant with or without epinephrine.

VOL. 189, 2007 QseEF SYSTEM ACTIVATES TRANSCRIPTION OF espFu 2471

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

AI-3/epinephrine/norepinephrine signaling cascade. QseA, aLysR family regulator (35), is activated by the AI-3/epineph-rine/norepinephrine signaling cascade and subsequently acti-vates the LEE region (36). Transcription of yfhK in a qseAmutant during mid-exponential growth is increased twofold (P �0.0028) and decreased 0.5-fold at late exponential growth (P �0.0047) (Fig. 2A), providing additional evidence that yfhK andyfhA are part of this signaling pathway. Finally, transcription ofyfhK and yfhA is increased by epinephrine in WT EHEC in lateexponential growth, while it is decreased in a qseC mutanteither in the presence of epinephrine or in its absence (Fig. 2B)(QseC is a sensor for AI-3, epinephrine, and norepinephrine,and an EHEC qseC mutant is unable to sense these threesignals [6]). Hence, we renamed these genes quorum-sensingregulators E and F (qseEF), in which QseE is a putative sensorkinase and QseF is a putative response regulator.

To test QseEF’s role in this pathway, a polar mutation inqseE was constructed utilizing a tetracycline resistance cas-sette. We then tested whether any of the phenotypes regulatedby the AI-3/epinephrine/norepinephrine signaling cascade,namely, AE lesion (pedestal) formation and flagellation andmotility, were altered. We used FAS (24) to visualize pedestalformation in the WT and mutant strains. Actin was stainedusing fluorescein isothiocyanate-phalloidin, and HeLa cell nu-clei and bacteria were stained with propidium iodide. Pedestalformation was visualized as brilliant patches of stained actin(green) localized underneath a red bacterium. Wild-typeEHEC formed pedestals; however, the qseE mutant was abro-gated for pedestal formation (see Fig. 4A). There were nodifferences in flagellar expression as seen by Western blottingand no differences in motility between the WT strain and theqseE mutant (data not shown), indicating that QseEF is in-volved in the regulation of the genes required for pedestalformation but not motility.

The qseE and qseF genes are contained in a cluster of severalgenes including yfhG, an uncharacterized gene, and glnB,which encodes the PII protein involved in nitrogen regulation(Fig. 3). To determine if these genes are transcribed in oneoperon, we designed primers flanking qseE to qseF and qseF toglnB and performed RT-PCR. RT-PCR was performed usingcDNA synthesized from RNA isolated from the WT strain.

RT-PCR indicated that transcriptional read-through occurredacross the intergenic region between qseE and qseF and qseFand glnB (Fig. 3), suggesting that these four genes are tran-scriptionally linked. Because qseE, yfhG, qseF, and glnB arecotranscribed, we constructed nonpolar mutations in qseE andqseF. Each mutant was tested for its ability to form pedestalson HeLa cells by use of the FAS assay. The nonpolar qseEmutant was still able to form pedestals; however, the qseFmutant was abrogated for pedestal formation. Pedestal forma-tion was restored in the qseF mutant upon complementationwith the QseF gene on a plasmid (Fig. 4A).

QseE and QseF are predicted to be a cognate two-compo-nent system. This is supported by the fact that the genes en-coding QseEF are cotranscribed and that QseE phosphorylatesQseF (40). However, QseF is also phosphorylated by multiplenoncognate sensor kinases (UhpB, BaeS, EnvZ, RstB) (Fig.4B) (40), which may account for the contrasting phenotypes ofthe qseE and qseF mutants.

QseF activates expression of espFu to induce pedestal for-mation. Several factors are required for pedestal formation inEHEC, including components of the TTSS, intimin, and theeffector protein Tir (21) (Fig. 5A). We suspected that one ofthe genes encoding proteins that comprise different portions ofthis system might be activated by QseF. We tested the expres-sion of EspA, EspB, Tir, and intimin by Western blotting ofwhole-cell lysates and found no defect in production of any ofthese proteins in a qseF mutant (Fig. 5B). In addition, wetested secretion of the TTSS proteins Tir (data not shown),EspA, and EspB, and again no defect was seen in secretion ofthese proteins (Fig. 5B).

EspFu was recently identified as a non-LEE-encoded effec-tor protein necessary for pedestal formation in EHEC (4, 15),possibly serving as a Nck-like protein to recruit N-WASP andArp-2/3 to Tir. We tested whether QseF activated espFu tran-scription using an espFu::lacZ transcriptional reporter fusion.In the qseF mutant, transcription of espFu was abolished. Tran-scription of espFu in this mutant was restored to WT levelsupon complementation with a functional copy of qseF (Fig.5C). Transcription of espFu was only mildly decreased in theqseE mutant (twofold) (Fig. 5C). This mild decrease in theqseE mutant, in contrast to the striking decrease in the qseF

FIG. 3. RT-PCR analysis showing that qseE, yfhG, qseF, and glnB are cotranscribed. In lanes 1 to 3, primers flanking qseE to qseF show noproduct when no RT is added (lane 1) and show product when either a genomic DNA control or cDNA is used (lanes 2 and 3); in lanes 4 to 6,primers flanking qseF to glnB show no product when no RT is added (lane 4) and show product when either the genomic DNA control or cDNAis used (lanes 5 and 6). Neg. Con., negative control.

2472 READING ET AL. J. BACTERIOL.

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

mutant, can again be attributed to the fact that QseF can bephosphorylated by multiple kinases (Fig. 4B). To further in-vestigate whether the lack of espFu expression was the reasonfor the defect on pedestal formation in the qseF mutant, weperformed FAS assays using the qseF mutant containing aplasmid expressing espFu. Under these conditions, we wereable to reconstitute pedestal formation (Fig. 5D).

A recent report suggested that espFu is cotranscribed in anoperon with espJ. The authors of this study created gfp tran-scriptional fusions with the upstream regions of these genesand found low levels of expression of espFu::gfp. However, noprimer extensions, Northern blots, or RT-PCR analysis wasperformed in these studies (14). Given that there are 324 bp inbetween the espJ and espFu genes (AE005419), it is possiblethat espFu is a stand-alone gene. To examine the operon struc-ture of espFu and upstream genes (espJ and Z3069), we usedRT-PCR. We detected transcription of espFu using an internalprimer set to this gene (Fig. 6). No amplification was observedwith primers flanking espFu and either of the two upstreamgenes (Fig. 6). These data indicate that espFu and espJ are nottranscriptionally linked. The contrast between the data ob-tained by our group and those obtained by Garmendia et al.(14) may be due to the low sensitivity of gfp reporters. Toidentify the espFu promoter, we performed primer extensions.

These primer extension studies were performed three timesusing two different primers to ensure the correct mapping ofthe transcriptional start site of espFu. The espFu gene containsa conserved extended 70 consensus sequence (Fig. 7). Thecombined RT-PCR and primer extension data led us to con-clude that espFu is encoded by itself and driven by its ownpromoter. In silico analysis indicates that QseF contains a 54

activator domain (www.promscan.uklinux.net/; Fig. 1). BecauseespFu contains a 70 rather than the alternative 54 promoter, itis likely that QseF indirectly activates transcription of this gene,possibly through an additional regulatory protein. Consistent withthis hypothesis, we were unable to observe direct binding of QseFto the espFu regulatory region by use of EMSAs, even afteraddition of acetyl phosphate as a phosphate source for activationof QseF (data not shown). This suggests that QseF does notdirectly bind to the promoter region of espFu and that QseFregulation of espFu is indirect, involving an intermediary factortranscribed in a 54-dependent fashion.

DISCUSSION

The cell-to-cell signaling system utilized by EHEC to controlvirulence is highly complex, involving many levels of gene reg-ulation. Although we know that multiple EHEC virulence

FIG. 4. (A) Detection of AE lesion formation using the FAS test on HeLa cells comparing WT and a qseE polar (P) mutant. Green shows theHeLa cell actin cytoskeleton, and red shows the bacteria and cell nuclei. WT EHEC forms pedestals (top left); the qseE mutant does not (top right).Nonpolar mutant strains were tested on HeLa cells by use of a FAS assay. Nonpolar mutations reveal that only the qseF mutant is unable to formAE lesions. The qseE mutant formed AE lesions, while the qseF mutant could not (left bottom two panels). Each mutant strain was complementedin a pBADMycHis vector. Cells were viewed at a magnification of �640. (B) QseF is cross-phosphorylated by several E. coli noncognate sensors.It is not known if QseC is able to phosphorylate QseF.

VOL. 189, 2007 QseEF SYSTEM ACTIVATES TRANSCRIPTION OF espFu 2473

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

genes are activated in response to the host epinephrine/nor-epinephrine and the bacterial signal AI-3, numerous aspects ofthis regulation are still unresolved, including how the signalsare sensed and transduced by the bacterial cell as well as theglobal hierarchy of signaling that leads to gene activation. Withrespect to this signaling, EHEC virulence can be divided intotwo main pathways: (i) flagellation and motility and (ii) theformation of AE lesions (Fig. 8). The two-component systemQseBC activates the flagellar regulon in response to AI-3 andepinephrine/norepinephrine. QseC’s autophosphorylation inresponse to these signals can be blocked only by �-adrenergicantagonists (6). AE lesion formation, however, can also beblocked by a �-adrenergic antagonist (36). This suggests thatmore than one sensor kinase responds to AI-3 and epineph-rine/norepinephrine. QseE could function as an additional sen-sor, transducing environmental signals in the direction of AElesion formation rather than in that of flagellar regulation.

Here we describe QseEF, a two-component system regu-lated by cell-to-cell signaling in EHEC. These proteins regu-late pedestal formation through indirect activation of espFu.The response regulator QseF does not bind directly to the 70

promoter region of espFu. Instead, it is likely that QseF regu-

lates espFu through an unidentified 54-dependent intermedi-ate. Based on our data, QseEF do not appear to regulate theLEE genes. These data reinforce the complexity of EHECvirulence signaling and indicate that another two-componentsystem, along with intermediates such as QseA, is involved inAE lesion formation by EHEC (Fig. 8).

The timing of flagellar production and formation of AElesions is crucial for successful EHEC colonization of the hu-man intestine, thus making the kinetics of activation of thesegenes equally important. Interaction of environmental signalswith multiple sensors would allow a precise timing mechanismenabling successive rather than simultaneous production ofthese systems and, ultimately, more efficiency. We suspect thatupon initial colonization of the intestine, EHEC receives sig-nals from the host and commensal flora, allowing the bacteriato activate the flagellar genes and swim across the mucus layerof the intestine. Once in proximity to the epithelium of theintestine, the TTSS genes are activated for AE lesion forma-tion. At this point, the flagellar genes must be down-regulated.It is further intriguing that there is yet an additional level offine tuning through QseEF regulation of espFu transcriptionbut not LEE expression. Determining how these two systems

FIG. 5. QseF regulates transcription of espFu. (A) Schematic of the TTSS machinery in EHEC and injection of effectors, Tir and EspFu, intohost cells, enabling tight adherence to the host cell and AE lesion formation. (B) Western blots were performed on whole-cell lysates and secretedprotein preparations from mutant and WT cultures grown to an OD600 of 1.0 in DMEM with antibodies specific to EspA and B, intimin, and Tir.The mutant qseE strain is complemented with qseE in pBADMycHisA. Production and secretion, where applicable, were not deficient in mutantstrains. (C) �-Galactosidase assay using an espFu::lacZ transcriptional reporter construct in the WT strain, the qseF mutant, and the qseF mutantcontaining qseF in pACYC177. espFu activation in the mutant is at background levels (third bar). (D) FAS assay on the qseF mutant straincontaining an empty vector (left) or espFu under an inducible promoter (right). In the presence of espFu, pedestal formation is restored. Cells wereviewed at a magnification of �640.

2474 READING ET AL. J. BACTERIOL.

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

are connected and how they use cell-to-cell signaling to orches-trate regulation in response to the environment will give usfurther insight not only into cell-to-cell signaling but also intothe biology of the intestine and interaction between pathogenicand commensal organisms.

Only a small number of signals for two-component systemsare currently known. This along with the difficulty in purifyingmembrane proteins prompted Yamamoto et al. (40) to useonly the cytoplasmic region of the sensor kinases in their studyof all two-component systems in E. coli. Although QseE hasbeen shown to phosphorylate QseF (40), the physiological sig-nal that activates QseE is still unknown. We have attempted topurify QseE and insert it into liposomes in order to test pos-sible chemical and environmental signals to which it responds.However, despite attempting to express QseE in several dif-ferent vector contexts, this protein remains insoluble and dif-ficult to purify in large quantities. In addition, we have at-tempted to examine potential interaction between the two

two-component systems, QseBC and QseEF, by conductingcross-phosphorylation experiments in which we assess whetherphosphorylated QseC can phosphorylate QseF. However, thesimilar sizes of QseF (49 kDa) and QseC (56 kDa), as well astheir similar isoelectric points (QseE, 5.6; QseC, 6.0), havemade separation of these proteins after phosphotransfer assayschallenging. Alternative methods to resolve these problems areunder investigation.

Two-component signaling systems are found primarily inprokaryotes and have not yet been identified in animals andhumans, making them an ideal target for drug inhibitors andtherapeutics (39). This is important in an age where antimi-

FIG. 6. Reverse transcription analysis was performed to evaluate the operon structure of espFu by use of espFu internal primers (1.,EspFuProbeR and EspFuProbeF), primers flanking espFu and the two upstream genes espJ and z3069 (2., EspFuRN and EspFuRT2), and primersflanking espFu and one gene upstream, espJ (3., EspFuF and EspFuRN). Only the primers to amplify espFu alone from WT cDNA showed aproduct, indicating that espFu is a stand-alone gene. For each primer set, PCR was performed using genomic DNA as a positive control and RNAwith no reverse transcriptase added as a negative control.

FIG. 7. The promoter of espFu was mapped using primer extensionwith primers downstream and upstream of the ATG start site. Thepromoter region of espFu contains an extended 70 consensus se-quence corresponding to �10 and �35 from the �1 transcriptionalstart site that was mapped.

FIG. 8. Schematic of AI-3, epinephrine, and norepinephrine sig-naling in EHEC. AI-3, epinephrine, and norepinephrine are sensed bysensor kinases in the EHEC membrane. QseBC regulate flagella andmotility, while QseEF may be a second two-component system thatregulates AE lesion formation in conjunction with other EHEC regu-lators such as QseA.

VOL. 189, 2007 QseEF SYSTEM ACTIVATES TRANSCRIPTION OF espFu 2475

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

crobial resistance is becoming increasingly prevalent. In par-ticular, for EHEC infection, no current treatment exists (22),and antibiotics can worsen the infection and lead to hemolyticuremic syndrome. Blocking EHEC’s signaling mechanisms forexpressing virulence genes could potentially render these bac-teria harmless. Elucidating the EHEC hierarchy of virulenceexpression is crucial in order to utilize this pathway in treat-ment.

ACKNOWLEDGMENTS

We thank John Leong from University of Massachusetts School ofMedicine for espFu expression vectors; Kaneyoshi Yamamoto fromKinki University, Japan, for the qseF expression vector; Kirti Rhamanfor creation of the qseE polar mutation; Catherine Wakeland forassistance with the FAS assays; and David Rasko for critical review ofthe manuscript.

This work was supported by NIH grant AI053067 and the EllisonMedical Foundation.

REFERENCES

1. Abe, A., B. Kenny, M. Stein, and B. B. Finlay. 1997. Characterization of twovirulence proteins secreted by rabbit enteropathogenic Escherichia coli,EspA and EspB, whose maximal expression is sensitive to host body tem-perature. Infect. Immun. 65:3547–3555.

2. Anonymous. 1997. Applied Biosystems Prism 7700 sequence detection sys-tem: user bulletin #2. The Perkin-Elmer Corp., Norwalk, CT.

3. Campellone, K. G., and J. M. Leong. 2003. Tails of two Tirs: actin pedestalformation by enteropathogenic E. coli and enterohemorrhagic E. coli O157:H7. Curr. Opin. Microbiol. 6:82–90.

4. Campellone, K. G., D. Robbins, and J. M. Leong. 2004. EspFu is a translo-cated EHEC effector that interacts with Tir and N-WASP and promotesNck-independent actin assembly. Dev. Cell 7:217–228.

5. Cherepanov, P. P., and W. Wackernagel. 1995. Gene disruption in Esche-richia coli: TcR and KmR cassettes with the option of Flp-catalyzed excisionof the antibiotic-resistance determinant. Gene 158:9–14.

6. Clarke, M. B., D. T. Hughes, C. Zhu, E. C. Boedeker, and V. Sperandio. 2006.The QseC sensor kinase: a bacterial adrenergic receptor. Proc. Natl. Acad.Sci. USA 103:10420–10425.

7. Clarke, M. B., and V. Sperandio. 2005. Transcriptional autoregulation byquorum sensing E. coli regulators B and C (QseBC) in enterohemorrhagic E.coli (EHEC). Mol. Microbiol. 58:441–455.

8. Clarke, M. B., and V. Sperandio. 2005. Transcriptional regulation of flhDCby QseBC and sigma (FliA) in enterohaemorrhagic Escherichia coli. Mol.Microbiol. 57:1734–1749.

9. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad.Sci. USA 97:6640–6645.

10. Deng, W., J. L. Puente, S. Gruenheid, Y. Li, B. A. Vallance, A. Vazquez, J.Barba, J. A. Ibarra, P. O’Donnell, P. Metalnikov, K. Ashman, S. Lee, D.Goode, T. Pawson, and B. B. Finlay. 2004. Dissecting virulence: systematicand functional analyses of a pathogenicity island. Proc. Natl. Acad. Sci. USA101:3597–3602.

11. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletionmutant of enteropathogenic Escherichia coli by using a positive-selectionsuicide vector. Infect. Immun. 59:4310–4317.

12. Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. K. Deng,L. C. Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 1998. Thecomplete sequence of the locus of enterocyte effacement (LEE) from en-teropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28:1–4.

13. Furness, J. B. 2000. Types of neurons in the enteric nervous system. J.Auton. Nerv. Syst. 81:87–96.

14. Garmendia, J., and G. Frankel. 2005. Operon structure and gene expressionof the espJ-tccP locus of enterohaemorrhagic Escherichia coli O157:H7.FEMS Microbiol. Lett. 247:137–145.

15. Garmendia, J., A. D. Phillips, M. F. Carlier, Y. Chong, S. Schuller, O.Marches, S. Dahan, E. Oswald, R. K. Shaw, S. Knutton, and G. Frankel.2004. TccP is an enterohaemorrhagic Escherichia coli O157:H7 type IIIeffector protein that couples Tir to the actin-cytoskeleton. Cell. Microbiol.6:1167–1183.

16. Griffin, P. M., S. M. Ostroff, R. V. Tauxe, K. D. Greene, J. G. Wells, J. H.Lewis, and P. A. Blake. 1988. Illnesses associated with Escherichia coliO157:H7 infections. A broad clinical spectrum. Ann. Intern. Med. 109:705–712.

17. Horger, S., G. Schultheiss, and M. Diener. 1998. Segment-specific effects ofepinephrine on ion transport in the colon of the rat. Am. J. Physiol. 275:G1367–G1376.

18. Ide, T., S. Laarmann, L. Greune, H. Schillers, H. Oberleithner, and M. A.Schmidt. 2001. Characterization of translocation pores inserted into plasmamembranes by type III-secreted Esp proteins of enteropathogenic Esche-richia coli. Cell. Microbiol. 3:669–679.

19. Jarvis, K. G., J. A. Giron, A. E. Jerse, T. K. McDaniel, M. S. Donnenberg,and J. B. Kaper. 1995. Enteropathogenic Escherichia coli contains a putativetype III secretion system necessary for the export of proteins involved inattaching and effacing lesion formation. Proc. Natl. Acad. Sci. USA 92:7996–8000.

20. Kalman, D., O. D. Weiner, D. L. Goosney, J. W. Sedat, B. B. Finlay, A. Abo,and J. M. Bishop. 1999. Enteropathogenic E. coli acts through WASP andArp2/3 complex to form actin pedestals. Nat. Cell Biol. 1:389–391.

21. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichiacoli. Nat. Rev. Microbiol. 2:123–140.

22. Karch, H., P. I. Tarr, and M. Bielaszewska. 2005. EnterohaemorrhagicEscherichia coli in human medicine. Int. J. Med. Microbiol. 295:405–418.

23. Kenny, B., R. DeVinney, M. Stein, D. J. Reinscheid, E. A. Frey, and B. B.Finlay. 1997. Enteropathogenic E. coli (EPEC) transfers its receptor forintimate adherence into mammalian cells. Cell 91:511–520.

24. Knutton, S., T. Baldwin, P. H. Williams, and A. S. McNeish. 1989. Actinaccumulation at sites of bacterial adhesion to tissue culture cells: basis of anew diagnostic test for enteropathogenic and enterohemorrhagic Escherichiacoli. Infect. Immun. 57:1290–1298.

25. Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C.Wolff, G. Dougan, and G. Frankel. 1998. A novel EspA-associated surfaceorganelle of enteropathogenic Escherichia coli involved in protein translo-cation into epithelial cells. EMBO J. 17:2166–2176.

26. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. Agenetic locus of enterocyte effacement conserved among diverse enterobac-terial pathogens. Proc. Natl. Acad. Sci. USA 92:1664–1668.

27. Mellies, J. L., S. J. Elliott, V. Sperandio, M. S. Donnenberg, and J. B. Kaper.1999. The Per regulon of enteropathogenic Escherichia coli: identification ofa regulatory cascade and a novel transcriptional activator, the locus ofenterocyte effacement (LEE)-encoded regulator (Ler). Mol. Microbiol. 33:296–306.

28. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

29. Murphy, K. C.1998. Use of bacteriophage � recombination functions topromote gene replacement in Escherichia coli. J. Bacteriol. 180:2063–2071.

30. Phillips, N., R. D. Hayward, and V. Koronakis. 2004. Phosphorylation of theenteropathogenic E. coli receptor by the Src-family kinase c-Fyn triggersactin pedestal formation. Nat. Cell Biol. 6:618–625.

31. Purves, D., D. Fitzpatrick, S. M. Williams, J. O. McNamara, G. J. Augustine,L. C. Katz, and A. LaMantia. 2001. Neuroscience, 2d ed. Sinauer Associates,Inc., Sunderland, MA.

32. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY

33. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single andmulticopy lac-based cloning vectors for protein and operon fusions. Gene53:85–96.

34. Sperandio, V., C. C. Li, and J. B. Kaper. 2002. Quorum-sensing Escherichiacoli regulator A (QseA): a regulator of the LysR family involved in theregulation of the LEE pathogenicity island in enterohemorrhagic Escherichiacoli. Infect. Immun. 70:3085–3093.

35. Sperandio, V., A. G. Torres, J. A. Giron, and J. B. Kaper. 2001. Quorumsensing is a global regulatory mechanism in enterohemorrhagic Escherichiacoli O157:H7. J. Bacteriol. 183:5187–5197.

36. Sperandio, V., A. G. Torres, B. Jarvis, J. P. Nataro, and J. B. Kaper. 2003.Bacteria-host communication: the language of hormones. Proc. Natl. Acad.Sci. USA 100:8951–8956.

37. Sperandio, V., A. G. Torres, and J. B. Kaper. 2002. Quorum sensing Esch-erichia coli regulators B and C (QseBC): a novel two-component regulatorysystem involved in the regulation of flagella and motility by quorum sensingin E. coli. Mol. Microbiol. 43:809–821.

38. Swimm, A., B. Bommarius, P. Reeves, M. Sherman, and D. Kalman. 2004.Complex kinase requirements for EPEC pedestal formation. Nat. Cell Biol.6:795–796.

39. Walters, M., M. P. Sircili, and V. Sperandio. 2006. AI-3 synthesis is notdependent on luxS in Escherichia coli. J. Bacteriol. 188:5668–5681.

40. Yamamoto, K., K. Hirao, T. Oshima, H. Aiba, R. Utsumi, and A. Ishihama.2005. Functional characterization in vitro of all two-component signal trans-duction systems from Escherichia coli. J. Biol. Chem. 280:1448–1456.

2476 READING ET AL. J. BACTERIOL.

on Novem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from