Abstract Rice production is known to be severely

affected by virus transmitting rice pests, brown plant-

hopper (BPH) and green leafhopper (GLH) of the

order hemiptera, feeding by phloem abstraction.

ASAL, a novel lectin from leaves of garlic (Allium

sativum) was previously demonstrated to be toxic to-

wards hemipteran pests when administered in artificial

diet as well as in ASAL expressing transgenic plants. In

this report ASAL was targeted under the control of

phloem-specific Agrobacterium rolC and rice sucrose

synthase-1 (RSs1) promoters at the insect feeding site

into popular rice cultivar, susceptible to hemipteran

pests. PCR, Southern blot and C-PRINS analyses of

transgenic plants have confirmed stable T-DNA inte-

gration and the transgenes were co-segregated among

self-fertilized progenies. The T0 and T1 plants, har-

bouring single copy of intact T-DNA expression cas-

sette, exhibit stable expression of ASAL in northern

and western blot analyses. ELISA showed that the le-

vel of expressed ASAL was as high as 1.01% of total

soluble protein. Immunohistofluorescence localization

of ASAL depicted the expected expression patterns

regulated by each promoter type. In-planta bioassay

studies revealed that transgenic ASAL adversely affect

survival, growth and population of BPH and GLH.

GLH resistant T1 plants were further evaluated for the

incidence of tungro disease, caused by co-infection of

GLH vectored Rice tungro bacilliform virus (RTBV)

and Rice tungro spherical virus (RTSV), which ap-

peared to be dramatically reduced. The result pre-

sented here is the first report of such GLH mediated

resistance to infection by RTBV/RTSV in ASAL

expressing transgenic rice plant.

Keywords ASAL transgenic rice Æ GLH ÆImmunohistofluorescence Æ RTBV resistance

AbbreviationsASAL Allium sativum agglutinin from leaf

BAP benzylamino purine

BPH brown planthopper

BSA bovine serum albumin

cv. cultivar

C-PRINS cycling-primed in situ labelling

dpi days post inoculation

ELISA enzyme linked immunosorbent assay

FITC fluorescein isothiocyanate

GLH green leafhopper

Hyg hygromycin

MS Murashige and Skoog

NAA a-napthaline acetic acid

PBS phosphate buffered saline

RSs1 rice sucrose synthase-1 promoter

RTBV Rice tungro bacilliform virus

RTSV Rice tungro spherical virus

SDS-PAGE sodium dodecyl sulphate-

polyacrylamide gel electrophoresis

Electronic Supplementary Material Supplementary materialis available to authorised users in the online version of this articleat http://dx.doi.org/10.1007/s11103-006-9054-6.

P. Saha Æ S. Das (&)Plant Molecular and Cellular Genetics, Bose Institute, P1/12CIT Scheme VIIM, Kolkata 700054, Indiae-mail: sampa@bic.boseinst.ernet.in

I. DasguptaDepartment of Plant Molecular Biology, University DelhiSouth Campus, Benito Jaurez Road, New Delhi 110021,India

Plant Mol Biol (2006) 62:735–752

DOI 10.1007/s11103-006-9054-6

123

A novel approach for developing resistance in rice againstphloem limited viruses by antagonizing the phloem feedinghemipteran vectors

Prasenjit Saha Æ Indranil Dasgupta Æ Sampa Das

Received: 17 March 2006 / Accepted: 10 July 2006 / Published online: 29 August 2006� Springer Science+Business Media B.V. 2006

Introduction

Rice (Oryza sativa L.) is the staple food over half of

the world’s population. In South-east Asia, rice is the

most important cultivated crop in terms of human

nutrition. World rice production needs to be increased

by 40% during the next 20 years to meet the demand

of increasing population (Bennet 2001). Unfortunately,

rice productivity is adversely affected by both biotic

and abiotic stress factors. Among the biotic factors,

insects belonging to the order hemiptera cause exten-

sive damage to rice production especially in South-east

Asian countries. Sap-sucking hemipteran pests, namely,

the brown planthopper (BPH; Nilaparvata lugens) and

the green leafhopper (GLH; Nephotettix virescens)

constitute nearly 35% of the total insect pests of rice,

not only cause severe physiological damage to the

plants but also act as vectors for major viral diseases

(Nagadhara et al. 2004). It was estimated that more

than 200 million tonnes of rice lost annually due to

damage caused by insect pests (Nagadhara et al. 2003).

The damage caused by BPH alone amount to

250 million US dollars per annum (Nagadhara et al.

2003). BPH, as a serious rice pest, transmits viruses

such as grassy stunt and ragged stunt viruses (Lee et al.

1999), whereas GLH damages rice by direct feeding as

well as transmitting viruses that cause rice dwarf,

transitory yellowing, yellow dwarf and tungro diseases

(Dahal et al. 1997; Rao et al. 1998). Of these diseases,

tungro is the most serious caused by co-infection of two

viruses, namely, Rice tungro bacilliform virus (RTBV)

which is a double-stranded DNA virus and Rice tungro

spherical virus (RTSV) which a positive-sense single-

stranded RNA virus (Jones et al. 1991). Both the

viruses are known to be transmitted in a semipersistent

manner by the viruliferous GLH (Dasgupta et al. 1991;

Dahal et al. 1997). In South-east Asia alone, the rice

tungro disease resulted in an annual yield loss of more

than 340 million US dollars (Nagadhara et al. 2003).

Upon infection RTBV occurs in the xylem and

phloem, where as RTSV is located only in the phloem

tissue (Dahal et al. 1997). Apart from spreading the

viruses, both the insects are extremely harmful as they

damage the plants by feeding on the phloem sap, dis-

rupt the photosynthate flow to the root system and

induce leaf senescence resulting into ‘hopperburn’

(Rao et al. 1998; Nagadhara et al. 2004).

An important cultivar of Basmati rice, Pusa Bas-

mati1 (PB1) is a popular variety for its exquisite aroma

and grain quality (Singh et al. 2000). However, the

cultivar is highly susceptible to hemipteran insects.

Although several major as well as minor genes

conferring resistance to the above mentioned sap-

sucking insects have been identified in the wild rice

germplasm, so far attempts to introduce genes resistant

to rice sap-sucking pests into Basmati rice cultivar have

not been successful. Additionally, attempts to control

rice sap-sucking pests and tungro disease by classical

breeding have been found unsustainable (Dahal et al.

1997). Genetic engineering approaches offer ingenious

solutions for achieving an increase rice production by

introducing alien insecticidal genes into this popular

Basmati rice cultivar (Jain and Jain 2000).

Mannose-binding plant lectins have been proved to

be promising candidates for the control of hemipteran

insect pests, not only for their different insecticidal

mechanisms, but also for their complementarities to Bt

toxins and protease inhibitors (Chang et al. 2003).

Artificial-diet bioassays revealed that a mannose-

binding garlic leaf lectin (Allium sativum agglutinin

from leaf, ASAL) was highly toxic towards sap-sucking

hemipteran insects (Bandyopadhyay et al. 2001; Ma-

jumder et al. 2004). Transgenic tobacco and mustard

plants expressing ASAL, driven by the constitutive

cauliflower mosaic virus 35S promoter (CaMV35S),

have been shown to decrease the survival and fecun-

dity of phloem feeding aphids (Dutta et al. 2005a, b).

Since BPH and GLH are phloem-feeders (Rao et al.

1998), it was considered that in addition to expressing

ASAL constitutively, specific expression in the phloem

tissue would deliver ASAL efficiently in the insect

feeding site, which minimize any undesirable accumu-

lation of ASAL in other plant parts. In the present

study two important phloem-specific promoters,

Agrobacterium rolC (isolated from A. rhizogenes) and

rice sucrose synthase-1, RSs1 (isolated from rice), were

utilized to develop transgenic rice expressing ASAL in

the phloem tissue. The rolC promoter had earlier been

demonstrated for phloem-specific expression of b-glu-

curonidase (GUS) gene in transgenic tobacco (Sch-

mulling et al. 1989; Sugaya et al. 1989) and in

transgenic rice (Matsuki et al. 1989). The RSs1 pro-

moter (Wang et al. 1992) was found to express gus (Shi

et al. 1994), Galanthus nivalis agglutinin, gna (Shi et al.

1994; Rao et al. 1998; Sudhakar et al. 1998) and ASAL

(Dutta et al. 2005b) in a phloem-specific manner.

Several fertile transgenic PB1 plants were generated

using Agrobacterium-mediated transformation tech-

nique. We report here the localization of the ASAL

expression driven by the above two promoters in the

phloem tissue. The entomotoxic effects of expressed

ASAL on survival and fecundity of BPH and GLH were

monitored on the transgenic rice. The results described

here also indicated that ASAL expressing transgenic

plants, when encountered by GLH, demonstrated less

736 Plant Mol Biol (2006) 62:735–752

123

or no incidence of tungro disease. Therefore, utilization

of phloem-specific promoters for ASAL expression in

phloem tissue for developing genetically superior plants

resistant against phloem feeding insects and phloem

limited viruses is a promising approach in plant biotic

stress improvement programme.

Materials and methods

Plasmid constructs

The cloning of Allium sativum leaf agglutinin

(ASAL) coding sequence (Accession No. AY866499)

under cauliflower mosaic virus 35S (CaMV35S)

promoter in the binary vector, pCAMBIA1301 was

described previously (Dutta et al. 2005a). The p35S-

ASAL construct was used for constitutive expression

of ASAL gene. The rolC promoter sequence was

cloned from TL-DNA of Ri plasmid of Agrobacte-

rium rhizogenes A4 strain by PCR using Pfu DNA

polymerase (MBI Fermentas) and specific forward

and reverse primers (rolC1 and rolC2) including

additional HindIII site and BamHI site respectively

(Table 1). The rolC promoter (Accession No.

DQ160187) fragment was subcloned in pUC18 and

finally inserted into HindIII/BamHI sites of

pCAMBIA-ASAL to develop the prolC-ASAL. The

cloning of rice sucrose synthase-1 (RSs1) promoter

(Accession No. AJ401233) sequence from rice

genomic DNA and subsequent subcloning into

HindIII/BamHI site of binary vector pRSs-ASAL

was reported earlier (Dutta et al. 2005b). Individual

binary vector (p35S-ASAL, prolC-ASAL and pRSs-

ASAL) was mobilized into A. tumefaciens strain

EHA105.

Rice transformation and segregation analysis

Scutellum derived embryogenic calli from mature seed

of indica rice (Oryza sativa L.) cv. Pusa Basmati1 (PB1)

were used for Agrobacterium-mediated transforma-

tion. Approximately 30-days-old calli were infected

with A. tumefaciens strain EHA105 harbouring p35S-

ASAL, prolC-ASAL and pRSs-ASAL gene constructs.

Details of the entire procedure, including selection of

transformed calli and regeneration of plantlets, were

same as described by Mohanty et al. (1999). The only

differences were that full strength MS (Murashige and

Skoog 1962) medium and 30 g l-1maltose (Himedia)

were used instead of 3/2 MS and glucose respectively,

through out the study. The infected calli were co-cul-

tivated on MS medium containing 2 mg l–1 2, 4-D

(Sigma), 100 lM acetosyringone (Aldrich) for 3 days

and subsequently selected and on the same medium

devoid of acetosyringone and supplemented with

50 mg l–1 hygromycin (Hyg) (Roche Diagnostics),

250 mg l–1 cefotaxime for ~45 days including sub-cul-

ture at an interval of ~15 days at 28 ± 2�C under dark.

Plants were regenerated from Hyg resistant calli on a

medium fortified with 2 mg l–1 BAP (Sigma), 1 mg l–1

NAA (Sigma), 50 mg l–1 Hyg and 250 mg l–1 cefotax-

ime at 28 ± 1�C under 16 h photoperiod. Putative

transformants (T0) were transferred to sterile soil and

grown to maturity in the greenhouse. Plants regener-

ated from uninfected scutellum derived calli were em-

ployed as untransformed control (UC).

Segregation analysis was done in antibiotic-amen-

ded medium as well as through gene specific PCR

analysis. In the former method, the surface-sterilized

seeds of transgenic plants as well as untransformed

control plants were inoculated on MS basal medium

for 2 days at 28 ± 1�C under 16 h photoperiod. After

2 days, when seeds had germinated they were transferred

Table 1 Details of oligonucleotide primers used for PCR and C-PRINS analyses

Primer Target Orientation Sequence Annealingtemp. (�C)

Productsize (~kb)

SD1 ASAL Forward 5¢ ATGGCCAGGAACCTACTGACGA 3¢ 60 0.36SD2 Reverse 5¢ CTATCTTCTGTAGGTACCAGTA 3¢rolC1 rolC Forward 5¢ AGGAAGCTTAGCGAAAGGATGTCA 3¢ 58 0.93rolC2 Reverse 5¢ CCGGATCCATGGTAACAAAGTAGGA 3¢HYG1 hpt Forward 5¢ GCTTTCCACTATCGGCGA 3¢ 56 0.98HYG2 Reverse 5¢ AAAGCCTGAACTCACCGC 3¢GUS1 gusA Forward 5¢ CAACGTCTGCTATCAGCGCGGAAGT 3¢ 58 1GUS2 Reverse 5¢ TATCCGGTTCGTTGGCAATACTCC 3¢VB1 Vector Forward 5¢ TGCTACCCTCCGCGAGATCATC 3¢ 55 0.2VB2 backbone Reverse 5¢ TGCCACCAGCCAGCCAACAGC 3¢IDG1 RTBV Forward 5¢ AGATGCATCAGAAGAAGGATGG 3¢ 59 1.1IDG2 Reverse 5¢ ATCGCCTCGCTCCAGTCAATG 3¢

VB1 and VB2 annealing sites are 8431–8452 bp and 8612–8632 bp of pCAMBIA1301 plasmid vector (Accession No. AF234297)respectively; additional restriction endonuclease sites are underlined; temp. = temperature

Plant Mol Biol (2006) 62:735–752 737

123

on to Hyg (50 mg l–1) containing medium. Seeds were

scored for resistance (HygR) and susceptibility (HygS)

after 15 days of incubation. While in the second method,

the seeds were germinated on MS basal medium, DNA

was isolated from the seedlings and PCR was performed

using SD1 and SD2 ASAL specific primers (Table 1).

The segregation patterns in the progeny plants were

calculated from the HygR and PCR detected ASAL

positive and negative (ASALPCR+/–) plants and vali-

dated using v2 test.

Histochemical GUS assay and Nucleic acid analysis

The histochemical assay for gusA gene expression from

putative transgenic rice plants was performed accord-

ing to the method of Jefferson et al. (1987), using 5-

bromo-4-chloro-3-indoxyl-beta-D-glucuronide (X-gluc)

(Biosynth AG) as substrate. Total genomic DNA was

isolated from leaves of transformed and untransformed

rice plants, essentially followed by the method de-

scribed earlier (Dutta et al. 2005a, b) and examined for

the presence of the ASAL, hpt and gusA genes by PCR

using respective oligonucleotide primer pair (Table 1).

In order to determine the transgene copy number

considering left border-junction fragment (LB-JF) and

right border-junction fragment (RB-JF), ~10 lg of

genomic DNA was digested with appropriate restric-

tion enzymes (Roche Diagnostics), fractionated on a

0.8% agarose gel, denatured and transferred onto a

N+-nylon membrane (Amersham Biosciences).

Hybridization of membrane with the [a-32P] dCTP la-

belled BamHI/SacI ~0.36 kb ASAL gene probe, fol-

lowed by washings under stringent conditions, was

carried out according to procedures described earlier

(Dutta et al. 2005a, b).

For monitoring the vector backbone (VB) integra-

tion beyond left border, PCR analyses were performed

using VB1 and VB2 primers designed from left border

sequence and from downstream vector backbone se-

quence of pCAMBIA1301 plasmid (Table 1).

To carry out the northern blot analysis, total RNA

was isolated from young leaves of transformed rice

plants and ~20 lg RNA was fractionated on a 1.2%

formaldehyde–agarose gel, followed by blotting onto a

nylon membrane. Hybridization and washing were

performed as described for the Southern blot proce-

dure (Dutta et al. 2005b).

Chromosome preparation and C-PRINS analysis

To study the stable transgene integration in the

genomic DNA of selected transgenic rice lines,

cycling-primed in situ DNA labelling (C-PRINS)

analyses were carried out using ASAL, hpt and gusA

gene specific oligonucleotide primers (Table 1) on

interphase nuclei and pro-metaphase chromosome

preparations. The preparations of interphase nuclei

and pro-metaphase chromosome plates were per-

formed following the enzyme maceration technique of

Jiang et al. (1995). Actively growing root tips were

excised from transgenic plants and put in ice cold water

for 20–24 h, followed by fixation in ethanol:acetic acid

(3:1) at 14–18 �C for overnight. Root tips were then

washed thoroughly with 0.01 M citrate buffer (sodium

citrate/citric acid, pH 4.8) followed by enzyme macer-

ation with 6% (w/v) cellulase (Sigma), 2% (w/v) pec-

tinase (Sigma) and 0.75% (w/v) macerozyme R200

(Sigma) for 1 h at 37 �C. Finally, the treated root tips

were washed three times in water squashed on Am-

plislides, air dried and stored at –20 �C. Prior to C-

PRINS, the slides were washed three times with 2·SSC

for 5 min at room temperature followed by 50 lg ml–1

RNase (Sigma) treatment in reaction buffer (1 mM

Tris–HCl, 1.5 mM NaCl, pH 7.5) at 37�C for 60 min.

Subsequently, the slides were incubated with 2 lg ml–1

proteinase K (Sigma) at room temperature for 1 min

and rinsed in 1·PCR buffer (10 mM Tris–HCl, pH 8.4,

50 mM KCl, 1.5 mM MgCl2) for 5 min.

The procedure and conditions for C-PRINS were

modified from the method of Abbo et al. (1993) and

Kubalakova et al. (2001). The amplifications were

performed in 50 ll volume containing 1·PCR buffer,

2 Mm MgCl2, 200 lM of primers set for each gene,

100 lM of each dATP, dCTP, dGTP, 34 lM of dTTP

and 2 lM of fluorescein-11-dUTP (Roche Diagnostics)

and 5 U of Amplitaq gold DNA polymerase. Reaction

mixture was sealed under amplicover discs with am-

plicover clips and the C-PRINS reactions were per-

formed following an initial cycle of 18 min at 95�C,

5 min at annealing temperature (Table 1), 10 min at

72�C, followed by 30 cycles each of 1 min at 94�C,

1 min at annealing temperature (Table 1) and 2 min at

72�C with a final extension for 10 min at 72�C. The

reactions were carried out using GeneAmp in situ PCR

system 1000 (Applied Biosystems) and the experiments

were repeated at least three times for each transgenic

line with each set of primer pairs to establish the

reproducibility of the results. The thermal cycle reac-

tions were terminated with stop buffer (0.5 M NaCl,

0.05 M EDTA, pH 8.0) for 5 min at 65�C and washed

with wash buffer (0.1 M maleic acid, 0.15 M NaCl,

0.05% Tween 20, pH 7.5) at room temperature for

5 min. The slides were immediately mounted with

Vectashield antifade solution (Vectolaboratories)

containing 0.2 lg ml–1 4’,6’-diamino-2-phenylindole

738 Plant Mol Biol (2006) 62:735–752

123

(DAPI) and observed with a Zeiss Axioskop 2 fluo-

rescence microscope (Carl Zeiss) using dual excitation

filters (set 27) for FITC and DAPI. Signals were cap-

tured by CCD camera and analyzed in FISH ImagerTM

(v.1.0) software.

Western blot and enzyme linked immunosorbent

assay (ELISA)

The total soluble protein (TSP) was extracted from

leaves of T0 and T1 transgenic rice plants (Dutta et al.

2005a) and the amount of protein in each sample was

determined by Bradford assay (Bradford 1976).

Approximately 10 lg of TSP was separated on 15%

SDS-PAGE and transferred onto a nitrocellulose

membrane by electroblotting. After blocking, the

membrane was probed with anti-ASAL polyclonal

primary antibody, obtained following the method of

Bandyopadhyay et al. (2001), at 1:10,000 dilution and

anti-rabbit IgG-horse radish peroxidase (HRP) conju-

gate (Sigma) as secondary antibody at 1:10,000 dilu-

tions. Bound secondary antibodies were detected by

enhanced chemiluminescence (ECL) reagents (Roche

Diagnostics).

Quantitative level of ASAL expression was esti-

mated by ELISA. The wells of the ELISA plate (Im-

munomaxi) were coated with ~10 lg of TSP from

transgenic leaves and purified native ASAL for over-

night at 4�C. The wells were blocked with 5% (w/v)

non-fat milk (Merck) in PBS and then incubated with

anti-ASAL primary antibody, followed by incubation

with HRP conjugated anti-rabbit secondary antibody.

Washing and incubations were performed according to

standardized protocol (Dutta et al. 2005a). The reading

of the coloured solution developed in microtitre after

reaction with O-phenylenediamine hydrochloride

(OPD) substrate (Sigma) plate was recorded at 415 nm

in a plate reader (BioRad).

Immunohistoflourescent analysis

Hand sections of leaves of plants transformed with

p35S-ASAL, prolC-ASAL and pRSs-ASAL constructs

were incubated in 10% (v/v) trichloroacetic acid (Sig-

ma) for 1 h followed by successive incubation with

absolute alcohol to water through 90, 70, 50 and 30%

(v/v) respectively. Sections were then blocked in

blocking buffer [3% (w/v) BSA (Merck) in 1· PBS],

subsequently incubated with anti-ASAL primary anti-

body at 1:10,000 dilutions in 1 ml blocking buffer

overnight. Immunohistoflourescent localization of

ASAL in transgenic leaf sections was carried out

according to the reported method (Yin et al. 1997) by

incubating with anti-rabbit IgG-biotin conjugate sec-

ondary antibody (Sigma) at 1:1000 dilutions in 1 ml

PBS for 2 h. The sections were then incubated with

avidin-FITC conjugate (Sigma) at 1:200 dilutions in

PBS. Washings were performed following the manu-

facturer’s protocols and sections were mounted on

slides with Vectashield antifade solution. The samples

were observed with a Zeiss Axioskop 2 fluorescence

microscope using excitation filter (set 1) of 450–490 nm

for FITC and photographs were recorded.

Insect bioassay

Insecticidal activity of ASAL toward the major rice

insects BPH and GLH were assayed using in-planta

feeding chamber on transgenic plants under controlled

conditions as described earlier (Rao et al. 1998; Foissac

et al. 2000). For survival, development and fecundity

assays ~35 to 45-days-old, single copy T-DNA bearing

and high ASAL expressive T0 and T1 plants were tested

where as untransformed plants and the T1 plants which

had lost the ASAL gene due to Mendelian segregation

were used as negative controls. A total of 15 first-instar

nymphs were released on each plant with five sets of

replication and the amount of damage to each plant was

counted once every three days. Statistical unpaired t

tests were conducted in order to compare the signifi-

cance of differences between control and treatments for

both the insect bioassay experiments.

Plant inoculation

Challenges of T1 transgenic plants by RTBV/RTSV

viruses using viruliferous GLH were conducted inside

a chamber as described earlier (Sivamani et al. 1999)

with minor modifications. First inoculation was per-

formed with three viruliferous GLH on 15-days-old six

T1 plantlets (first transmission). This was followed by

acquisition of RTBV/RTSV by non viruliferous GLH

(6 GLH/plant) from the above infected transgenic

plants. These viruliferous GLH were then placed

overnight on two 15-day-old untransformed control

PB1 rice plants (3 GLH/plant) in the second trans-

mission assay. In both the first and the second trans-

mission assays, six plants and two untransformed

control PB1 plants (UC) were challenged respectively.

PCR and dot blot analysis for RTBV and RTSV

PCR analyses of the infected plants for detection of

RTBV of first and second transmission assay were

performed following the earlier described simplified

method of Dasgupta et al. (1996) using either undiluted

Plant Mol Biol (2006) 62:735–752 739

123

and/or 100 and 500 fold diluted leaf DNA samples in

10 mM Tris–HCl, 1 mM EDTA, pH 8.0 buffer and

RTBV specific IDG1, IDG2 primers (Table 1). Moni-

toring of the presence of RTSV through dot blot

analysis was carried out with RNA samples isolated

from infected leaf samples of the first transmission

assay using RNeasy Plant Mini Kit (QIAGEN) fol-

lowing the manufacturer’s protocols and recommen-

dations. Approximately 1 lg of total RNA from each

infected and uninfected plants was blotted onto a N+-

nylon membrane using Bio-Dot Micro-filtration appa-

ratus (ATTO). Membranes were then hybridized with

[a-32P] dCTP-labelled BamHI/EcoRI digested ~1 kb

RTSV coat protein 3 (CP3) coding DNA fragment as

probe and autoradiograph was developed.

Results

Gene constructs preparation and rice genotype

used

The DNA fragment containing the ~0.93 kb 5¢ up-

stream sequence of the TL-DNA of Ri plasmid ORF12

gene (rolC) of A. rhizogenes A4 strain was obtained by

PCR using rolC1 and rolC2 primers (Table 1). The

promoter fragment was sequenced and the new se-

quence was submitted to GenBank (Accession No.

DQ160187). The ~1.9 kb RSs1 promoter contains

~0.69 bp 5¢ upstream sequences and ~1.22 kb 3¢downstream sequences to tsp, the intron1. An internal

EcoRI restriction endonuclease site is present at –

0.67 kb position of RSs1. The ASAL gene was initially

cloned under CaMV35S (constitutive) promoter and

nopaline synthase polyA terminator (nosT) in plant

expression vector pCAMBIA1301 to develop p35S-

ASAL (Fig. 1A). Subsequently plant expression cas-

settes prolC-ASAL and pRSs-ASAL containing rolC,

RSs1 (phloem-specific) promoters were constructed,

map of which are shown in Fig. 1(B, C) respectively.

The indica rice cv. PB1, reported to be amenable for

Agrobacterium-mediated transformation has been used

in the present transformation study using A. tumefac-

iens strain EHA105 harboring above three plasmid

constructs.

Generation of transgenic rice plant and inheritance

of transgenes

Scutellar derived calli generated from seed, after co-

cultivation with Agrobacterium were transferred to

the selection medium containing 50 mg l–1 Hyg.

Continuous selection of the proliferating tissues for

two weeks resulted in the appearance of vigorously

growing HygR embryogenic callus. Selected calli

were successively transferred to the regeneration

medium and then to the rooting medium containing

50 mg l–1 Hyg for successfully regeneration and root

development of the plants. Out of the 653 calli co-

cultivated, a total of 94 HygR plants were regener-

ated, of which 25, 31 and 38 plants were derived

from p35S-ASAL, prolC-ASAL and pRSs-ASAL

gene cassettes respectively. The efficiency of trans-

formation was estimated to be 14.4 ± 2.2% by

establishing the ratio between the numbers of HygR

transgenic plants obtained versus the number of calli

co-cultivated. All the plants tested for GUS activity

showed varying levels of GUS expression (Table 2).

Spikelet fertility of the T0 and subsequent T1 gen-

eration was normal.

Segregation pattern of HygR and ASAL gene in T1

generation was analyzed in separate sets of experi-

ments. For HygR, the self-fertilized seeds of selected

T0 lines were germinated on Hyg containing medium.

Alternatively for segregation analysis of ASAL gene,

seeds were germinated in absence of Hyg and ana-

lyzed through PCR using ASAL specific primers

(Table 1). All the lines showed Mendelian pattern of

segregation (Table 2). Six lines (35S-3, 35S-6, rolC-2,

rolC-5, RSs-7, RSs-15) showed a 3:1 segregation ratio

for ASALPCR+/– expected for a single locus of the

transgene. These T1 plants were grown to maturity in

greenhouse to obtain T2 seeds. In the case of 35S-1,

rolC-12 and RSs-1 lines the segregation ratio was 15:1,

suggesting the presence of two copies of transgene in

two different active loci.

Fig. 1 Construction of promoter-gene fusion cassettes within themulti-cloning site of T-DNA region of pCAMBIA1301 binaryvector. (A) p35S-ASAL = pCAMBIA35S-ASAL. (B) prolC-ASAL = pCAMBIArolC-ASAL. (C) pRSs-ASAL = pCAMBI-ARSs-ASAL chimeric gene constructs were used in ricetransformation. The respective restriction endonuclease sitesfor cloning are indicated. CaMV35S = CaMV35S promoter;CaMV35S T = CaMV35S terminator; nos T = nos terminator;RB = right border and LB = left border of T-DNA

740 Plant Mol Biol (2006) 62:735–752

123

Molecular analysis of transgenic rice plant

Samples of the genomic DNA, isolated from leaves of

HygR transgenic plants as well as untransformed con-

trol (UC) plant, were analyzed for the presence of

ASAL and gusA genes by PCR using SD1, SD2 and

GUS1, GUS2 oligonucleotide primers, respectively

(Table 1). Presence of ASAL (~0.36 kb) and gusA

(~1 kb) gene fragments in the genome of all primary

transformants confirmed their transgenic status (data

not shown). However, no such bands were found in the

PCR product of UC plant DNA under the identical

conditions.

In an initial screening out of the 25 p35S-ASAL, 31

prolC-ASAL and 38 pRSs-ASAL plants, we examined

18 independent T0 plants (six plants from each plasmid

construct) by Southern blot for ASAL gene. Genomic

DNA (~10 lg) digested with HindIII showed hybrid-

izable bands in all the transformants (Fig. 2 lane 35S-5

to RSs-34) including a ~0.36 kb band in the positive

control (~0.36 kb ASAL) using ASAL gene probe

(Fig. 2, lane +). Most of the transgenic plants carried

one to two copies of the ASAL gene. For detail

molecular analysis, four plants from each of the pro-

moter driven gene construct were selected depending

upon their high HygR and GUS expression (Table 2).

However, to confirm transgene integration and to

determine the copy number of the integrated T-DNA,

the genomic DNA of 35S-1, 35S-3, 35S-4, 35S-6, rolC-2,

rolC-5, rolC-9, rolC-12 and RSs-1, RSs-7, RSs-11,

RSs-15 plants were digested with HindIII/EcoRI

and HindIII/XhoI to generate T-DNA LB-JF/RB-JF

respectively. After hybridization with [a-32P] dCTP

labelled BamHI/SacI 0.36 kb ASAL gene probe, HindIII

digested DNA from above 35S-ASAL, rolC-ASAL and

RSs-ASAL plants exhibited LB-JFs longer than

~3.5 kb, ~3.6 kb and ~4.6 kb, respectively (Fig. 3, pa-

nel H). The T0 lines 35S-3, 35S-6, rolC-2, rolC-5, RSs-7,

RSs-11 and RSs-15 revealed single junction fragment,

suggesting a single copy T-DNA integration event.

However, plants 35S-1, rolC-9, rolC-12 and RSs-1

showed double copy and only the 35S-4 line showed

triple copy T-DNA integration events. Further analysis

using RB-JF revealed hybridization signals longer than

Table 2 Segregation of hygromycin resistance, GUS activity and presence of ASAL gene in T1 progeny plants of transgenic rice lines

Transgenic plants Segregation in T1 generation T2 seed

T0 lines HygR/GUS/ASALPCR/VBPCR HygR/S gusAPCR+/– ASALPCR+/– Ratio (ASAL) v2(P value)

35S-1 +/+/+/+ 30/2 28/2 28/2 15:1 0.53 (> 0.9)35S-3 +/+/+/– 40/11 38/13 38/13 3:1 0.007 (> 0.8) Yes35S-4 +/–/+/+ NT NT NT – –35S-6 +/+/+/– 22/8 23/7 23/7 3:1 0.04 (> 0.8) YesrolC-2 +/+/+/– 32/12 34/10 32/10 3:1 0.94 (> 0.2) YesrolC-5 +/+/+/– 18/7 20/5 20/5 3:1 0.33 (> 0.5) YesrolC-9 +/–/+/+ NT NT NT – –rolC-12 +/–/+/+ 19/2 NT 21/0 15:1 –RSs-1 +/+/+/+ 36/1 34/3 34/3 15:1 0.22 (> 0.5)RSs-7 +/+/+/– 24/9 25/8 25/8 3:1 0.01 (> 0.9) YesRSs-11 +/+/+/+ NT* NT* NT* – –RSs-15 +/+/+/– 38/10 37/11 36/12 3:1 0.00 (–) Yes

ASALPCR+/– = PCR positive/negative for ASAL gene; GUS + = GUS positive by histochemical assay; gusAPCR+/– = PCR positive/negative for gusA gene; HygR/S = hygromycin resistant/susceptible; NT = not tested; * Plants contaminated during tissue culture;VBPCR = PCR positive for vector backbone sequence; v2 value is calculated for inheritance of one gene (3:1) or two genes (15:1)

Fig. 2 Southern blot hybridization of p35S-ASAL, prolC-ASALand pRSs-ASAL bearing primary transgenic plants. ~10 lg DNAfrom the transformed and untransformed rice plant leaf wasdigested with HindIII and processed for Southern blotting usinga-32P labelled BamHI/SacI ASAL gene fragment as probe.Lane + = positive control ~0.36 kb ASAL gene; lane UC = un-transformed control plant DNA; lane 35S-5 to RSs-34 = differ-ent line of 35S-ASAL, rolC-ASAL and RSs-ASAL. Molecularweight markers are indicated on the left

Plant Mol Biol (2006) 62:735–752 741

123

~4.3 kb in 35S-ASAL, ~4.4 kb in rolC-ASAL with

EcoRI digested genomic DNA (Fig. 3 panel E) and

~6.2 kb in RSs-ASAL with XhoI digested genomic

DNA (Fig. 3 panel X). The primary transformant rolC-

9 line showed ~8.8 kb single copy RB-JF with EcoRI

digested genomic DNA but produced double copy

hybridization signal with HindIII digested LB-JF

genomic DNA, suggesting a ‘head-to-head’ double

copy T-DNA (LB-RBMRB-LB) integration event

(Fig. 3I). However, all the RSs-ASAL lines showed a

~1.3 kb hybridization signal when EcoRI digested

genomic DNA was analyzed indicating about the

presence of an internal EcoRI site in the promoter

sequence.

Fig. 3 Detection of T-DNA genes (ASAL, hpt and gusA) copynumber in transgenic rice lines using Southern blot andinterphase nuclei and/or prometaphase C-PRINS analyses. TheHindIII (H) digested and EcoRI (E) or XhoI (X) digestedgenomic DNA blot are shown in panels which documented thecopy number through left border and right border junctionalfragment analysis. The ~0.36 kb ASAL gene was used as probe inSouthern hybridization. Molecular weight markers are indicated

on the right side of each panel. The respective transgenic line andT-DNA gene used in C-PRINS study are indicated in bracket.Arrows on the figures indicate the strong hybridization signals(fluorescent green colour spot) obtained after incorporation offluorescein-11-dUTP. Nuclei or chromosomes are counterstained with DAPI (blue colour). (A, B, C, D, E, F, H) showedsingle copy and (G, I, J, K, L) showed multi-copy T-DNAintegration

742 Plant Mol Biol (2006) 62:735–752

123

In addition to Southern blot analysis, we adopted

the C-PRINS technique to confirm the transgene copy

number and to characterize the transgene status in

detail. C-PRINS analysis using ASAL, hpt and gusA

gene specific oligonucleotide primers (Table 1) re-

vealed single copy (green fluorescent spot) localization

of T-DNA genes (ASAL, hpt and gusA) in lines 35S-3,

35S-6, rolC-2, rolC-5, RSs-7, RSs-11 and RSs-15 after

incorporation of fluorescein-11-dUTP (Fig. 3A–F, H).

The transgenic lines 35S-1, rolC-12, RSs-1 showed

double spot (Fig. 3G, J, K), whereas 35S-4 showed

triple copy (Fig. 3L) localization of ASAL, hpt and

gusA genes on interphase nuclei and pro-metaphase

chromosomes. The line rolC-9 showed localization of

two subtelomeric hpt gene (two green fluorescent spot

very close to each other) on single chromosome using

HYG1 and HYG2 primers in C-PRINS study, sug-

gesting integration of two copies of complete T-DNA

(Fig. 3I). Therefore, the RB-JF and LB-JF analyses in

Southern blot and C-PRINS studies were confirmed

single copy in 35S-3, 35S-6, rolC-2, rolC-5, RSs-7, RSs-

15 lines; double copy in 35S-1, rolC-12, RSs-1 lines;

triple copy in 35S-4 line and head-to-head double copy

T-DNA integration in rolC-9 line. However, Southern

blot analysis with HindIII digested genomic DNA from

four T1 progeny plants showed single hybridizable

band in accordance with that of parental lines 35S-6,

rolC-2 and RSs-15 (Fig. 4A–C). The untransformed

control plant failed to show any hybridizable band

when either of the junction fragment was analyzed.

Furthermore, all the 12 characterized best lines were

checked for the integration of ~0.2 kb vector backbone

(VB) sequences beyond the T-DNA left border in the

genome by PCR analysis using VB specific primers

(Table 1). All the double copy (35S-1, rolC-9, rolC-12,

RSs-1) and triple copy (35S-4) T-DNA integrated lines

were found to be PCR positive for VB sequence

(VBPCR+, Table 2). Only one single copy line (RSs-11)

showed amplification beyond T-DNA border in PCR

analysis but rest of the lines showing clean T-DNA

integration (Table 2).

Table 3 Insect bioassay and RTBV transmission of T1 progeny plants of T0 rice lines

T1 progeny Amount of ASAL(% TSP)a

% of insect mortal-ity

% of insect fecundity RTBV/RTSV trans-mission

BPH GLH BPH GLH susc/inoc % R

Control 0 0(20)b 0(14)b 100(102)c 100(115)c 12/12 035S-3T1 0.66 NT NT NT NT 3/6 5035S-6T1 0.87 41 37 NT 42 3/6 50rolC-2T1 0.45 35 59 29 25 1/6 83rolC-5 T1 0.33 NT 53 NT NT 2/6 67RSs-7T1 0.09 39 46 NT 37 3/6 50RSs-15T1 0.21 NT 40 NT 28 2/6 67

a Percentage mean value of six plants in total soluble protein; b Insect mortality on control plant; c Mean number of nymphs oncontrol plant; NT = not tested; susc/inoc = susceptible plants (positive in PCR for RTBV and dot blot for RTSV) per total number ofinoculated with viruliferous GLH; % R = percentage of plants showing resistance against RTBV/RTSV; % of insect mortality andfecundity on transgenic T1 lines were determined after deducting the bvalue and calculating from cvalue respectively (n = 5)

Fig. 4 Southern blot analyses of genomic DNA from progenyplant leaves of 35S-ASAL, rolC-ASAL and RSs-ASAL T0 lines.Genomic DNA (~10 lg) was digested with HindIII andhybridized with [a-32P] dCTP labelled BamHI/SacI ASAL geneprobe. (A) Four T1 plants of 35S-6 line. (B) Four T1 plants ofrolC-2 line. (C) Four T1 plants of RSs-15 line. Lane + = ~0.36 kbASAL gene was used as positive control; lane UC = untrans-formed genomic DNA as negative control. Molecular weightmarkers are indicated on the left

Plant Mol Biol (2006) 62:735–752 743

123

Expression of ASAL gene in transgenic plants

On the basis of preliminary screening we have chosen

the high HygR, most strongly GUS expressive, with

single copy ASAL gene insertion and without vector

backbone bearing transgenic lines for further analysis.

Two primary transformants from each construct,

namely, 35S-3, 35S-6 (for constitutive expression),

rolC-2, rolC-5 and RSs-7, RSs-15 (for phloem-specific

expression) were tested in northern, western blot and

ELISA for ASAL gene product. Northern blot analysis

showed the presence of intact, full length hybridisable

transcript using ASAL probe (Fig. 5A). The level of

ASALmRNA accumulation was higher in constitu-

tively expressing lines (35S-3, 35S-6) than the phloem-

specific lines.

Western blot analysis of leaf extracts from trans-

genic plants revealed the presence of a polypeptide of

~12 kDa that corresponds to purified ASAL after

treating with specific anti-ASAL antibodies (Fig. 5B).

All the six T0 lines were accumulated detectable level

of ASAL in their leaf tissue. However, no band was

observed in the untransformed control plant in both

northern and western blot analyses (Fig. 5A, B, lane

UC).

To quantify the amount of ASAL in these selected

lines, ELISA with leaf protein extracts was performed,

the results of which are shown in Fig. 5C. Constitutive

ASAL expression from 35S promoter was estimated to

be 0.86–1.01% of total soluble protein (TSP) by cal-

culating the amount of ASAL in ~10 lg of TSP of each

transgenic line from ELISA reading, which was much

higher than RSs1 promoter driven ASAL expression

(0.11–0.31% of TSP). The quantitative level of ex-

pressed ASAL from rolC promoter (0.38–0.52% of

TSP) was found to be in between the 35S and RSs1

promoters.

Northern blot analysis using total RNA from leaf of

T1 progeny plants was detected hybridisable amount of

ASALmRNA similar to their mother plants after

probed with ASAL gene (Fig. 6). In the T1 progenies

of the T0 lines, the level of expressed ASAL was cal-

culated to be in the range of 0.87% to 0.09% of TSP

(Table 3).

Immunohistofluorescence localization of ASAL

in transgenic plant

The spatial ASAL expression patterns driven by 35S,

rolC and RSs1 promoters in transgenic lines were

determined by in situ immunohistofluorescence locali-

zation of ASAL in trichloroacetic acid fixed leaf tissue

Fig. 5 Expression and quantitative estimation of ASAL drivenby 35S, rolC and RSs1 promoters in selected transgenic rice lines.(A) Northern blot analysis of p35S-ASAL, prolC-ASAL andpRSs-ASAL plants. ~20 lg total RNA from individual plantswas probed with radiolabelled ASAL gene. Lane UC = RNAfrom untransformed control plant. The ASAL transcript accu-mulations in mature leaf of selected lines are represented bytheir lanes. (B) Western blot analysis of protein extracts fromleaves of same T0 plants. Lane + = ~1.5 lg purified native ASALused as positive control; lane UC = crude protein from untrans-formed plant used as negative control; transgenic plants arerepresented by their respective lanes. (C) The amount of ASALin total soluble protein of corresponding T0 plants anduntransformed control plant (UC) as determined by ELISA.The results of the three separate ELISA experiments using totalcrude protein extracts from 30-days-old field grown plant leavesare shown. The bars represent the average ELISA read-ing + standard error of the mean. ELISA reading representedafter subtracting the background readings from UC

Fig. 6 Northern blot analysis of T1 plants of selected parentallines. (A) Ethidium bromide strained rRNA profile of fourprogenies of 35S-6, rolC-2, RSs-15 T0 transformants anduntransformed control (UC). (B) Hybridization signals ofASALmRNA with ASAL gene probe in corresponding lanes.Total RNA (~20 lg) of T1 plants derived from self-fertilizationof the three T0 plants of lanes 35S-6, rolC-2 and RSs-15 in Fig.5A, was subjected to northern blot analysis. Lane UC = un-transformed control RNA. The ASAL transcript accumulation inmature leaf of T1 plants are represented by their lanes

744 Plant Mol Biol (2006) 62:735–752

123

sections after reaction with anti-ASAL primary anti-

body, IgG-biotin conjugate secondary antibody and

avidin-FITC conjugate (Fig. 7). We found that the three

promoters conferred quite different ASAL expression

patterns of which the 35S-ASAL (35S-3, 35S-6) showed

the expected constitutive ASAL expression pattern with

green fluorescence spreading all over the cell types,

strong fluorescence in vascular region and weaker fluo-

rescence in all other tissues (Fig. 7B). Accumulation of

ASAL in both rolC-ASAL and RSs-ASAL lines was

detected in phloem cells and other non-lignified vascular

tissue including lesser amount in the epidermal cells.

Detailed examination of leaf tissue sections of the rolC-

ASAL lines demonstrated that the presence of ASAL

within the vascular bundles, vascular parenchyma,

adjacent cortical cells, epidermal cells and trichromes

(Fig. 7C) where as in RSs-ASAL lines ASAL expression

was restricted to the phloem tissue, sieve elements and

companion cells (Fig. 7D). However, tissue sections of

different leaf blades gave identical results. No green

fluorescence in any cell types of untransformed control

plant was visible (Fig. 7A).

Monitoring insect bioassay on ASAL expressive

transgenic plants

Bioassays for resistance to sap-sucking insect pests

were carried out in-planta on the 35 to 45-days-old

T0 and T1 transgenic plants expressing ASAL. All

the plants that were infested with BPH/GLH

nymphs during bioassay showed significant resistance

against survival, growth and fecundity of BPH and

GLH (Fig. 8), were survived and grew to maturity

with normal fertility. BPH and GLH survival was

monitored on three high ASAL expressive primary

transformants, 35S-6 (constitutively expressive) and

rolC-2, RSs-15 (phloem-specific expressive), using

first-instar nymphs to adults at 3 days intervals up to

18 days of survival assay period. Gradual reduction

of survival of BPH nymphs was observed on all the

transgenic lines tested (Fig. 8A), whereas a sharp

decline of survival of GLH nymphs was recorded

only on the rolC-2 line (Fig. 8B). Phloem expressive

lines showed comparatively higher insect (BPH and

GLH) mortality than the constitutively expressive

line (significant at P < 0.05). However, within the

phloem expressive lines, rolC-2 line has documented

elevated level of BPH and GLH resistant by ~5.1%

and ~11.1% compared to RSs-15 line respectively.

The effect of ASAL on GLH development was

monitored by releasing 15 first-instar nymphs onto

ASAL expressive T0 lines. GLH development on

transgenic plants was significantly retarded compared

to control (significant at P < 0.05). From the Fig. 8

(C, D) it is clearly evident that rolC-2 line showed

maximum retardation of GLH development than

Fig. 7 Immunohistofluorescence localization of ASAL in trans-genic plants containing p35S-ASAL, prolC-ASAL and pRSs-ASAL constructs. Transverse leaf sections were treated withanti-ASAL anti-serum as primary antibody and anti-rabbit IgG-biotin conjugated secondary antibody. The presence of ASAL isindicated by the green fluorescence. (A) The transverse sectionsfrom untransformed control showed no green fluorescence. (B)

The leaf section of p35S-ASAL plants showing detection ofuniform green fluorescence of constitutive ASAL expression inall the cells types. (C) Cross sections of leaf blade of plantstransformed with prolC-ASAL showing localization of ASAL inthe phloem cells, epidermis and trichomes. (D) The pRSs-ASALshowing the presence of ASAL in the phloem cells and nonlignified vascular region

Plant Mol Biol (2006) 62:735–752 745

123

35S-6 and RSs-15 lines, as out of 34.7% survivors,

only 13.3% nymphs were reached to adulthood after

15 days of incubation (significant at P < 0.01). The

poor development of GLH nymphs on all the

respective transgenic lines was reflected by 33.4%,

29.3%, 21.3% immature nymphs after 15 days of

assay period. The effect of ASAL on BPH and

GLH fecundity was also assessed by measuring total

nymphs production by adult insects on the trans-

genic lines used for survival assays after 20 day as-

say period. The rolC-2 line exhibited minimum

mean numbers of BPH and GLH nymph production

per plant followed by RSs-15 and 35S-6 lines

(Fig. 8E, F). Therefore, the three tested lines are

categorized as rolC-2 > RSs-15 > 35S-6 depending on

their ability to control insect survival, development

Fig. 8 Effect of ASAL on the survival, development andfecundity of rice phloem feeding insects. (A, B) Survival ofBPH and GLH on T0 transgenic rice lines expressing ASAL.Fifteen first-instar BPH and GLH nymphs were releasedseparately on each plant at day 0. Untransformed control plantsand transgenic plants 35S-6 (constitutive ASAL expression) androlC-2, RSs-15 (phloem-specific ASAL expression) were used forbioassay experiments. Points and bars show mean ± SE (n = 5).The significant (P < 0.05) differences between control andtransgenic plants were assessed by unpaired t-test. (C, D) Effectof ASAL on the development of GLH nymphs. Fifteen first-instar GLH nymphs were released separately on untransformed

control and transgenic plant at day 0, and after 15 days the insectsurvival and the number of nymphs which reached adult stage oncontrol and transgenic plants were plotted on the graph.Differences between control and transgenic plants were signif-icant at P < 0.05 (t-test). Data represent as mean ± SE (n = 5).(E, F) Effect of ASAL on the fecundity of the BPH and GLH.The total number of nymphs produced from adult BPH andGLH on control and transgenic plants were counted at the end ofthe insect bioassay were plotted on the graph. The significant(P < 0.01) differences in nymph production on control andtransgenic plants were assessed by unpaired t test. Data representas mean ± SE (n = 5)

746 Plant Mol Biol (2006) 62:735–752

123

and fecundity. The percentage of insect mortality

and fecundity on ASAL expressive T1 progeny

plants were tabulated in Table 3.

Evaluation of GLH vectored tungro viruses

transmission on ASAL expressive transgenic plants

RTBV/RTSV infection and/or transmission were

assessed on T1 progeny plants derived from self-

fertilization of ASAL expressing GLH resistant T0

lines. Transgenic T1 plants from all of the T0 lines

described in Table 3 were inoculated with GLH (3

GLH/plant) previously fed on source plants known

to contain both RTBV and RTSV. Out of six T1

plants from each high expressing lines which were

challenged with viruliferous GLH, three T1 progenies

of 35S-6, one T1 progeny of rolC-2 and two T1

progenies RSs-15 plants were found to be positive

for RTBV and RTSV using PCR and RNA dot blot

analyses respectively, where as all the infected

control plants were found to be positive for both

viruses after 10 dpi (Table 3). In addition, the in-

fected transgenic plants (Fig. 8A, B; IT) showed

slower tungro symptom development (stunting of

plant, yellowing of leaf) with normal plant vigour

compared to the infected control plants (Fig. 9A, B;

IC) at the end of 20 dpi. Transmission assays were

repeated with additional T1 offspring of other three

T0 lines (35S-3, rolC-5, RSs-7). Thus, altogether the

aforementioned six lines exhibited 50–83% resis-

tance, free from RTBV after 10 dpi of first inocu-

lation period (Table 3). After first infection, infected

transgenics (IT) and infected control (IC) plants

were used as sources for further virus acquisition by

GLH and allowed to infect or transmit tungro

viruses to control plants. The RTBV transmission as

well as viral titre in control plants was determined

by PCR analysis using either crude or diluted leaf

extracts after 10 dpi of second transmission assay.

Presence of ~1.1 kb RTBV CP fragment in the

crude and 100-fold diluted leaf extract in the IT as

well as IC plants was observed, whereas no such

band was detected in 500-fold diluted leaf extracts

of infected transgenic lines in the same conditions

(Fig. 9C). In the second transmission assay only one

infected control plant which acquired inoculums

from infected 35S-6T14 line showed positive ampli-

fication of RTBV CP sequence when crude leaf

extracts and 100 times diluted leaf extracts were

used (Fig. 9D, lanes IC-1c < 35S6T14, IC-

1100 < 35S6T14). In 500-fold diluted leaf extract

there was no amplification (Fig. 9D lane IC-

1500 < 35S6T14). However, in the similar situation all

the infected control (IC) and IC acquired infected

control (IC < IC) plants of both the transmission

assays showed PCR amplified ~1.1 kb product in

crude, 100- and 500-fold diluted leaf extracts

(Fig. 9C, D). This suggests significantly lower viral

titre in ASAL expressive transgenic lines of first

transmission assay and in the transgenic-acquired

infected control plants of second transmission assay.

In contrast, control plants inoculated from infected

control plants as the source showed relatively higher

viral titers. No such symptom development and

presence of RTBV CP sequence in PCR analysis

were observed in untransformed uninfected control

(Fig. 9C, D lane UC). Therefore, in general it be-

came clear that when GLH were fed on transgenics

they did not acquire or transmit any virus (both

Fig. 9 Viruliferous GLH mediated Rice tungro bacilliform virus(RTBV) transmission assay on selected T1 lines and controlplants. Infected T1 transgenic (IT) plant (right) showing resistantphenotype [healthy growth (A) and less yellowing of leaf (B)]same as uninfected control (UC) plant (left) showing normalphenotype [normal growth (A) and green leaf (B)] compared toinfected control (IC) plant (centre) showing susceptible pheno-type [stunted growth (A) and yellowing of leaf (B)]. Data wastaken after 20 days post inoculation (dpi) in first transmissionassay. (C, D) PCR detection of RTBV sequence after 10 dpi infirst and second transmission assay. Lanes ICC, IC100, IC500, ITC,IT100, IC-1C > 35S-6T14, IC-1100 < 5S-6T14 and both the ICshowed distinct amplification of ~1.1 kb RTBV sequence; lanesM = DNA as ladder molecular weight marker; lane + =plasmidpRTBV 203 (RTBV isolate from West Bengal, India); laneUC = untransformed uninfected control; C, 100, 500 = crude, 100fold diluted, 500-fold diluted leaf extracts respectively

Plant Mol Biol (2006) 62:735–752 747

123

RTBV and RTSV), where as on control plants vir-

uliferous GLH were able to do so.

Discussion

Attempts made so far to introduce agronomically

useful genes through cross hybridization into Basmati

rice have met with limited success because of deterio-

ration or dilution in quality traits present in the back-

ground. This stimulated us to employ the cultivar for

agronomic improvement by genetic transformation

strategy rather than cross hybridization. Genetic

transformation has been an important technique to

transfer one or more useful genes into the elite indica

rice cultivar without disturbing its original genetic

background. For developing resistance in Basmati rice

against hemipteran insects, ASAL gene has been ex-

pressed primarily under the control of CaMV35S pro-

moter (Fig. 1) since it drives high level of constitutive

expression of transgenes. However, to control phloem

feeding vectors (BPH and GLH) and vector mediated

transmission of plant viruses (RTBV and RTSV),

phloem-specific expression of ASAL is highly necessi-

tated because it directly affects the phloem feeding

target insects, avoiding unexpected expression in non-

target organs and tissues, thus reducing metabolic load

on the transgenic plants. In the present study, rolC and

RSs1 promoters (Fig. 1) were selected for phloem-

specific ASAL expression at the insect feeding site.

Transgenic plants derived from ASAL gene driven by

three different promoters constructs were found to be

normal in terms of growth and fertility.

It has been anticipated that multiple copies of a

transgene might lead to cosuppression and silencing

(Dai et al. 2001; Vaucheret and Frgard 2001). In

addition, multiple transgene copies in direct or/and

inverted orientation may be subjected to homology

dependent de novo DNA methylation, either in the

promoter or in the coding region and generate varie-

gated phenotypes due to epistatic silencing (Muskens

et al. 2000; Dai et al. 2001). Single copy integration of

transgene is essential to achieve predictable patterns of

their inheritance and to eliminate the problems of gene

silencing in transgenic plants (Finnegan and McElroy

1994). Moreover, the inverse correlation between

transgene copy number and expression levels was re-

ported previously by several authors (Fagard and

Vaucheret 2000; Dai et al. 2001; Shou et al. 2004).

Southern blot hybridization with HindIII digested

genomic DNA (LB-JF) and EcoRI or XhoI digested

genomic DNA (RB-JF) in selected T0 plants indicated

stable T-DNA integration events (Figs. 2, 3). However,

in the present study, the majority (> 70%) of the

transgenic events contained single copy of the trans-

gene. In one plant (rolC-9) there were two hybridiza-

tion signals of the HindIII digested LB-JF analysis,

suggesting a possibility of head-to-head (LB-RBMRB-

LB) T-DNA integration event. Furthermore, integra-

tion of T-DNA as multiple elements in different

patterns of inverted or tandem repeats (head-to-head

or tail-to-tail) within the rice genome has been reported

(Jacob and Veluthambi 2003; Eamens et al. 2004). The

T1 progeny plants showed similar banding profile and

copy number corresponding to their mother plants in

Southern blot analysis (Fig. 4).

The additional factors that influence transgene

expression are the chromatin structure of the sur-

rounding area of transgene insertion (Muskens et al.

2000; Vaucheret and Fagard 2001) and the integration

of vector backbone sequence beyond the T-DNA

border sequence (Kononov et al. 1997; Shou et al.

2004). Areas like subtelomeric regions within the plant

genome exert positive position effects due to their high

transcriptional activity (Travella et al. 2004). Con-

versely, integration in areas rich in heterochromatin

adjacent to centromeres may exert strong negative

position effects and transgene integrated at such sites

may be prone to silencing (Dong et al. 2001; Jin et al.

2002). Agrobacterium-mediated rice transformation

results in low copy transgene insertion (Dai et al. 2001)

into gene rich transcriptionally active regions of rice

genome (Eamens et al. 2004). However to elucidate

the copy number effect and position effect we have

performed the C-PRINS study on interphase nuclei

and on prometaphase chromosomes. Interestingly,

detection of incorporated fluorescein-11-dUTP as dis-

tinct double spot on same chromosomal location after

C-PRINS using HYG1 and HYG2 primers established

the occurrence of head-to-head T-DNA in rolC-9 line

(Fig. 3I). Most of the transgene integration events took

place in the subtelomeric regions of the chromosomes

(Fig. 3), which corroborated with the earlier fluores-

cence in situ hybridization (FISH) localization of

transgenes in rice developed by Agrobacterium-medi-

ated transformation technique (Dong et al. 2001; Jin

et al. 2002). Thus, C-PRINS proved to be an efficient

techniques for quick insight into the structure of

transgenic loci and suitable for rapid detection of

transgene copy number in transgenic population.

Again if the flanking sequence of the left border of

binary vector is not strong enough to attenuate the

transfer of vector backbone sequence during transfor-

mation, it is likely that backbone DNA contamination

might have existed more commonly in Agrobacterium-

mediated transgenic plants (Kononov et al. 1997;

748 Plant Mol Biol (2006) 62:735–752

123

Wenck et al. 1997; Kim et al. 2003). Wenck et al. (1997)

have showed that the frequency of vector backbone co-

transfer ranges between 30% and 60%, depending on

the plant species. Therefore, the transfer of vector

DNA (beyond border transfer) into the genome of the

primary transformants was taken into consideration in

the present study. PCR analysis detected the presence

of vector backbone DNA sequence of the binary vec-

tor (pCAMBIA1301) into the genome of the multi-

copy transgenic plants. However, in most of the events

in the present study, the T-DNA was found to be stably

integrated into the genome as single copy without any

rearrangement. The segregation and inheritance pat-

terns of the transgenes confirmed definitive transgene

transmission in the next generation. HygR test, PCR

and Southern analyses pointed to the fact that the hpt,

gusA and ASAL genes were co-transmitted in a Men-

delian fashion (Table 2). Segregation analysis of

transgenes in T1 progeny clearly showed a monogenic

ratio (3:1) and co-segregation of transgenes, unequiv-

ocally confirming that all the three T-DNA genes (hpt,

ASAL and gusA) are integrated in a single locus. To

overcome the copy number effect, only the high Hyg

tolerant, strong GUS expressive and single copy ASAL

transgene integrated lines were selected for further

study.

Northern and western blot analysis of RNA and

proteins from the transgenic plants confirmed the sta-

ble expression of the ASAL gene (Fig. 5). The amount

of expressed ASAL in RSs-ASAL transgenic plants is

slightly higher than the previously reported expression

levels of GNA using RSs1 promoter (Rao et al. 1998;

Nagadhara et al. 2003). Stable and consistent ASAL

expression was observed through northern (Fig. 6) blot

and ELISA (Table 3) over the generation. Immuno-

histofluorescence analysis detected high level of gene

expression in a variety of vascular cell types, namely

companion cells, vascular parenchyma and bundle

sheath cells in rolC-ASAL lines, whereas ASAL

expression regulated by the RSs1 seems to occur

exclusively in phloem cells (Fig. 7). Our data is con-

sistent with an earlier report, which described the rolC

driven expression in a variety of vascular cell types

(Graham et al. 1997). In addition, rolC was shown to

direct gene expression in phloem parenchyma and

adjacent cortical cells including sieve elements and

companion cells (Matsuki et al. 1989; Sugaya et al.

1989), while RSs1 has been reported earlier to strictly

direct gene expression in sieve elements and compan-

ion cells of the phloem tissue (Shi et al. 1994). There-

fore the present immunohistofluorescent patterns of

RSs-ASAL are in agreement with that of previously

reported data on transgenic rice and mustard, where

transgene expression has been shown to be exclusively

localized in sieve elements and companion cells

respectively (Rao et al. 1998; Sudhakar et al. 1998;

Dutta et al. 2005b). Thus, the specificity and resolution

of immunohistofluorescent analysis proves to be a

superior alternative to the previously reported immu-

nohistochemical analysis (Rao et al. 1998; Sudhakar

et al. 1998; Dutta et al. 2005b) and could be used for

efficient in situ detection of gene expression.

The present study demonstrates the successful

expression of ASAL in transgenic rice conferring

substantial resistance against BPH and GLH, not only

in terms of increased insect mortality, but also in terms

of retarded development and decreasing fecundity

(Fig. 8). The T1 progenies of two high expressive T0

lines, from each plasmid constructs, were monitored

for insect survival and fecundity assays were exhibited

elevated levels of resistance against the rice sap-suck-

ing insect pests (Table 3). In corroboration with our

previous experience, using transgenic tobacco and

mustard (Dutta et al. 2005a, b), transgenic rice

expressing ASAL amply indicating that ASAL is the

most potent controlling agent against sap-sucking in-

sects. However, the entomotoxic and/or antinutritional

effect of plant lectins on sap-sucking insects have been

reported in several cases (Rao et al. 1998; Gatehouse

et al. 1999; Chang et al. 2003). The precise mechanism

of mannose-binding ASAL toxicity towards sap-suck-

ing insect involves the binding of ASAL to midgut

epithelial cells causing disruption of cell function

(Bandyopadhyay et al. 2001; Fitches et al. 2001). A

good correlation does exist between the number of

mannose-binding sites and the biological activity of the

lectin (Barre et al. 1996). Furthemore, the bound lectin

might inhibit the absorption of nutrients or disrupt the

midgut cells by stimulating endocytosis of lectin and

other toxic metabolites (Eisemann et al. 1994). Re-

cently, such a mechanism of ASAL binding to the

mannose moiety of midgut brush border membrane

vesicle of hemipteran insects has been confirmed by us

(Bandyopadhyay et al. 2001; Majumder et al. 2004;

Dutta et al. 2005a, b), which is mediated by a complex

network of hydrogen bonds and by hydrophobic

interactions between the side chains of amino acid

residues comprised of the lectin binding site and the

sugar residues (Weis and Drickaner 1996). Similar

phenomenon of GNA binding to the gut receptors of

BPH and GLH has been evident from previous studies

(Powell et al. 1998; Fossaic et al. 2000). The mechanism

that affects the fecundity of the insects appears to be

different from the mechanism that results in their

mortality and it seemed to be positively correlated

with the influence of the lectin to the physiology of the

Plant Mol Biol (2006) 62:735–752 749

123

insects. The accumulations of GNA through out the fat

bodies and ovarioles of intoxicated BPH (Powell et al.

1998) and the detection of ASAL in the ovarioles of

peach potato aphid (Dutta et al. 2005a) have been

demonstrated.

Furthermore, there have been a number of reports

dealing with the production of RTBV/RTSV resistant

plants by introducing and expressing viral gene se-

quences (Huet et al. 1999; Sivamani et al. 1999). The

unique achievement of the present study is the GLH

vectored resistance to tungro disease caused by com-

plex interaction of RTBV/RTSV in ASAL expressive

T1 plants, which is the first report of its kind. In the most

promising line rolC-2 and its T1 progeny plants showed

elevated level of resistance against BPH, GLH and

83% of resistance to tungro viruses after first trans-

mission (Table 3), which is higher than that of earlier

attempt of developing resistance using transgenic plants

expressing viral gene sequences (Huet et al. 1999; Siv-

amani et al. 1999). The reduced magnitude of infection

of RTBV and RTSV upon GLH feeding on the ASAL

transgenic plants (Fig. 9) described here implied that

ASAL adversely affects tungro disease transmission.

However, the underlying molecular mechanism

responsible for GLH vectored RTBV/RTSV transmis-

sion inhibited by ASAL is not yet well understood. The

existence of a ‘helper component’ (HC) other than

RTSV virion has previously been shown for plant-to-

plant noncirculative semipersistant transmission of

RTBV by GLH (Froissart et al. 2002). Furthermore,

involvement of aphid endosymbiotic SymL (GroEL

homolog) as HC for transmission of potato leafroll

virus (PLRV), barley yellow dwarf virus (BYDV) and

luteovirus has been well documented (Filichkin et al.

1997; Hogenhout et al. 1998; Banerjee et al. 2004).

Banerjee et al. (2004), using ligand blot analysis of

aphid brush border membrane vesicle (BBMV), char-

acterized a glycoprotein endosymbiotic SymL (GroEL

homolog) receptor binds with ASAL mediated by

mannose residues, involved in the transmission of

viruses by the host aphid. The above ASAL binding

may elicit changes in surface accessibility of symbionin,

leading to its inactivation to the luteovirus RTD bind-

ing ability thus reducing the incidence of viral trans-

mission from one plant to another (Banerjee et al.

2004). Presence of yeast-like endosymbionts (YLSs)

which are involved in an obligate association with BPH

fat body and are transmitted to the offspring through

ovary have been reported (Powell et al. 1998; Suh et al.

2001). Intriguingly, from the observation that since

some yeast cell walls contain high levels of mannosyl

glycoproteins (Fleet 1991), it may be speculated that

reduced RTBV/RTSV transmission on ASAL expres-

sive transgenic plants mediated by viral protein-man-

nose–ASAL interactions. However, the possibility of

expressed ASAL in preventing proper feeding of GLH,

as GLH consumes less or starves on ASAL transgenic

plants, and thereby reducing the inoculation of the virus

particle cannot be ruled out.

In summary, we have shown that ASAL transgenic

rice plants, exhibiting resistance against BPH and

GLH, conferring resistance to RTBV/RTSV. The

expression efficiency of ASAL monitored from the two

phloem specific promoters, rolC demonstrated to be

stronger in sensu lato (s.l.) and more effective for

engineering resistance to phloem limited viruses, than

phloem-specific RSs1 promoter in sensu sticto (s.s.),

which is an important observation from the agronomic

point of view. The high level of inhibitory effect of

ASAL on GLH vectored tungro virus transmission in

the present study indicates that ASAL is a novel can-

didate for transgenic engineering against phloem lim-

ited viruses vectored by phloem feeding insects. Thus,

a field of ASAL expressive transgenic rice plants would

certainly have reduced yield loss in geographical

locations where planthopper or leafhopper attack and

tungro disease are predominant.

Acknowledgements Authors are grateful to Council of Scien-tific and Industrial Research; Government of India for providingfellowships to PS. We are grateful to Prof. S. C. Roy, Centre ofAdvanced Study (CAS), Cell and Chromosome Research,Department of Botany, University of Calcutta, 35 BallygungeCircular Road, Kolkata, India for his help to carry out C-PRINSstudy in his laboratory. Authors thank the Programme Coordi-nator, CAS, Dept. Bot. CU for providing above technicalopportunities. We are thankful to Regional Rice Research Sta-tion, Chinsurah, West Bengal, India for providing nuclear stockseed of Pusa Basmati 1 rice cultivar. For back up service of Mr.Arup Kumar Dey, BI is sincerely acknowledged. Authors arealso thankful to Gautam Basu for critically reading the manu-script. The expert technical help of Anand Singh Rana in viralassays and Trilok Singh Rawat in inoculations of DU(SC) areacknowledged.

References

Abbo S, Dunford RP, Miller TE, Reader SM, King IP (1993)Primer-mediated in situ detection of the B-hordein genecluster on barley chromosome1H. Proc Natl Acad Sci USA90:11821–11824

Bandyopadhyay S, Roy A, Das S (2001) Binding of garlic (Al-lium sativum) leaf lectin to the gut receptors of homopteranpests is correlated to its insecticidal activity. Plant Sci161:1025–1033

Banerjee S, Hess D, Majumder P, Roy D, Das S (2004) Theinteractions of Allium sativum leaf agglutinin with a chap-eronin group of unique receptor protein isolated from abacterial endosymbiont of the mustard aphid. J Biol Chem279:23782–23789

750 Plant Mol Biol (2006) 62:735–752

123

Barre A, Van Damme EJM, Peumaus WJ, Rouge P (1996)Structure-function relationship of monocot mannose-bind-ing lectins. Plant Physiol 112:1531–1540

Bennet J (2001) Summing-up: cutting-edge science for riceimprovement-breakthroughs and beneficiaries. In: Goode J,Chadwick D (Eds.), Rice biotechnology: improving yield,stress tolerance and grain quality, Novartis Foundation/JohnWiley, UK, pp. 242–251

Bradford MM (1976) A rapid and sensitive method for thequantitation of proteins using the principle of protein-dyebinding. Anal Biochem 72:248–254

Chang T, Chen L, Chen S, Cai H, Liu X, Xiao G, Zhu Z (2003)Transformation of tobacco with genes encoding Helianthustuberosus agglutinin (HTA) confers resistance to peach-potato aphid (Myzus persicae). Transgenic Res 12:607–614

Dahal G, Hibino H, Aguiero VM (1997) Population character-istics and tungro transmission by Nephotettix virescens(Hemiptera: Cicadellidea) on selected resistant rice culti-vars. Bull Entomol Res 87:387–395

Dai S, Zheng P, Marmey P, Zhang S, Tian W, Chen S, BeachyRN, Fauquet C (2001) Comparative analysis of transgenicrice plants obtained by Agrobacterium-mediated transfor-mation and particle bombardment. Mol Breed 7:25–33

Dasgupta I, Das BK, Nath SP, Mukhopadhyay S, Niaiz FR,Varma A (1996) Detection of rice tungro bacilliform virus infield and glasshouse samples from India using the poly-merase chain reaction. J Virol Methods 58:53–58

Dasgupta I, Hull R, Eastop S, Poggi PC, Blakebrough M,Boulton MI, Davies JW (1991) Rice tungro bacilliform virusDNA independently infects rice after Agrobacterium med-iated transfer. J Gen Virol 72:1215–1221

Dong J, Kharb P, Cervera M, Hall CT (2001) The use of FISH inchromosomal localization of transgenes in rice. MethodsCell Sci 23:105–113

Dutta I, Saha P, Majumder P, Sarkar A, Chakraborti D,Banerjee S, Das S (2005a) The efficacy of a novel insecti-cidal protein, Allium sativum leaf lectin (ASAL), againsthomopteran insects monitored in transgenic tobacco. PlantBiotechnol J 3:601–611

Dutta I, Majumder I, Saha P, Ray K, Das S (2005b) Constitutiveand phloem specific expression of Allium sativum leafagglutinin (ASAL) to engineer aphid (Lipaphis erysimi)resistance in transgenic Indian mustard (Brassica juncea).Plant Sci 169:996–1007

Eamens AL, Blanchard CL, Dennis ES, Upadhyaya NM (2004)A bidirectional gene trap construct for tDNA and Ds-mediated insertional mutagenesis in rice (Oryza sativa L.).Plant Biotechnol J 2:367–380

Eisemann CH, Donaldson RA, Pearson RD, Cadagon LC,Vuocolo T, Pellam RL (1994) Larvicidal action of lectins onLucilia cuprina; mechanism of action. Entomol Exp Appl72:1–11

Fagard M, Vaucheret H (2000) (Trans)gene siliencing in plants:How many mechanisms? Annu Rev Plant Physiol Plant MolBiol 51:167–194

Fleet GH (1991) Cell walls. In: Harrison AHR, Harrison JS(Eds.), Yeast organelles, Academic Press, London, pp 199–277

Filichkin SA, Brumfield S, Filichkin TP, Young MJ (1997) Invitro interactions of the aphid endosymbiotic SymL chap-eronin with barley yellow dwarf virus. J Virol 71:569–577

Finnegan J, McElory D (1994) Transgene inactivation: plantfight back! Bio/Technol 12:883–888

Fitches E, Woodhouse SD, Edwards JP, Gatehoush JA (2001) Invitro and in vivo binding of snowdrop lectin (Galanthusnivalis agglutinin; GNA) and jackbean (Canavalia ensifor-

mis; Con A) lectins within tomato moth (Lacanobia olera-ceae) larvae; mechanisms of insecticidal action. J InsectPhysiol 47:777–787

Foissac X, Loc NT, Christou P, Gatehouse AMR, Gatehouse JA(2000) Resistance to green leafhopper (Nephotettix vires-cens) and brown planthopper (Nilaparvata lugens) in trans-genic rice expressing snowdrop lectin (Galanthus nivalisagglutinin; GNA). J Insect Physiol 46:573–583

Froissart R, Michalakis Y, Blanc S (2002) Helper component-transcomplementation in the vector transmission of plantviruses. Phytopathol 92:576–579

Gatehouse AM, Davison GM, Stewart JN, Gatehouse LN, Ku-mar A, Geoghegan IE, Birch ANE, Gatehouse JA (1999)Concanavalin A inhibits development of tomato moth(Lacanobia oleracea) and peach-potato aphid (Myzus per-sicae) when expressed in transgenic potato plants. MolBreed 5:153–165

Graham MW, Craig S, Waterhouse PM (1997) Expression pat-terns of vascular-specific promoter RolC and Sh in trans-genic potatoes and their use in engineering PLRV-resistantplants. Plant Mol Biol 33:729–735

Hogenhout SA, van den Wilk F, Verbeek M, Goldbach RW, vanden Heuvel JFJM (1998) Potato leafroll virus binds to theequatorial domain of the aphid endosymbiotic GroELhomolog. J Virol 72:358–365

Huet H, Mahendra S, Wang J, Sivamani E, Ong CA, Chen L,de Kochko A, Beachy RN, Fauquet C (1999) Near immu-nity to rice tungro spherical virus achieved in rice by areplicase-mediated resistance strategy. Phytopathol89:1022–1027

Jacob SS, Valuthambi K (2003) A cointegrate Ti plasmid vectorfor Agrobacterium tumefaciens-mediated transformation ofindiac rice cv Pusa Basmati1. J Plant Biochem Biotech 12:1–9

Jain RK, Jain S (2000) Transgenic strategies for geneticimprovement of Basmati rice. Indian J Exp Biol 38:6–17

Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusion: b-glucuronidase as a sensitive and versatile gene fusion mar-ker in higher plants. EMBO J 6:3901–3907

Jiang J, Gill BS, Wang G-L, Ronald CP, Ward DC (1995)Metaphase and interphase fluorescence in situ hybridizationmapping of the rice genome with bacterial artificial chro-mosomes. Proc Natl Acad Sci USA 92:4487–4491

Jin WW, Li ZY, Fang Q, Altosaar I, Lui LH, Song YC (2002)Fluorescence in situ hybridization analysis of alien genes inAgrobacterium-mediated Cry1A (b)- transformed rice. AnnBot 90:31–36

Jones MC, Gough K, Dasgupta I, Subba-Rao BL, Cliffe J, Qu R,Shen P, Kaniewska M, Blakebrough M, Davies JW, BeachyRN, Hull R (1991) Rice tungro disease is caused by an RNAand a DNA virus. J Gen Virol 72:757–761

Kim SR, Lee J, Jun SH, Park S, Kang HG, Kwon S, An G (2003)Transgene structures in T-DNA-inserted rice plants. PlantMol Biol 52:761–773

Kononov ME, Bassuner B, Gelvin SB (1997) Integration of T-DNA binary vector ‘backbone’ sequences into the tobaccogenome: evidence for multiple complex patterns of inte-gration. Plant J 11:945–957

Kubalakova M, Vrana J, Cıhalıkova J, Lysak MA, DolezelJ (2001) Localization of DNA sequences on plant chromo-somes using PRINS and C-PRINS. Methods Cell Sci 23:71–82

Lee SI, Lee S-H, Koo JC, Chun HJ, Lim CO, Mun JH, Song YH,Cho MJ (1999) Soybean Kunitz trypsin inhibitor (SKTI)confers resistance to the brown planthoppe (Nilaparvatalugens Stal) in transgenic rice. Mol Breed 5:1–9

Plant Mol Biol (2006) 62:735–752 751

123

Majumder P, Banerjee S, Das S (2004) Identification of receptorsresponsible for binding of the mannose specific lectin to thegut epithelial membrane of the target insects. Glycoconju-gate J 20:525–530

Matsuki R, Onodera H, Yamauchi T, Uchimiya H (1989) Tissue-specific expression of the rolC promoter of the Ri plasmid intransgenic rice plants. Mol Gen Genet 220:12–16

Mohanty A, Sarma NP, Tyagi AK (1999) Agrobacterium-medi-ated high frequency transformation of an elite indica ricevariety Pusa Basmati 1 and transformation of the transgeneto R2 progey. Plant Sci 147:127–137

Murashige T, Skoog F (1962) A revised medium for rapid growthand bioassays with tobacco cultures. Plant Physiol 15:473–497

Muskens MWM, Vissers APA, Mol JNM, Kooter JM (2000)Role of inverted DNA repeats in transcriptional andpost-transcriptional gene silencing. Plant Mol Biol 43:243–260

Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Krishnaiah NV,Sarma NP, Brown DP, Gatehouse JA, Reddy VD, Rao KV(2003) Transgenic indica rice resistant to sap-sucking in-sects. Plant Biotechnol J 1:231–240

Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Sarma NP, ReddyVD, Rao KV (2004) Transgenic rice plants expressing thesnowdrop lectin (gna) exhibit high-level resistance to thewhitebacked planthopper (Sogetella furcifera). Theor ApplGenet 109:1399–1405

Powell KS, Spence J, Bharathi M, Gatehouse AJ, GatehouseAMR (1998) Immunohistochemical and developmentalstudies to elucidate the mechanism of action of the snow-drop lectin on the rice brown planthopper, Nilaparvata lu-gens (Stal). J Insect Physiol 44:529–539

Rao KV, Rathore KS, Hodges TK, Fu X, Stoger E, SudhakarS, Williams P, Christou P, Bharathi M, Bown DP, PowellKS, Spence J, Gatehouse A, Gatehouse JA (1998) Expres-sion of snowdrop lectin (GNA) in transgenic plants confersresistance to rice brown planthopper. Plant J 15:469–477

Schmulling T, Schell J, Spena A (1989) Promoters of the rolA, B,and C genes of Agrobacterium rhizogenes are differentiallyregulated in transgenic plants. Plant Cell 1:665–670

Shi Y, Wang MB, Powell KS, Damme EV, Hilder VA,Gatehouse AMR, Boulter D, Gatehouse JA (1994) Use ofthe rice sucrose synthase-1 promoter to direct phloem-spe-cific expression of b-glucuronidase and snowdrop lectingenes in transgenic tobacco plants. J Exp Bot 45:623–

631Shing RK, Shing US, Khush GS, Rohilla R (2000) Genetics and

biotechnology of quality traits in aromatic rices In: ShingRK, Shing US, Khush GS (Eds.), Aromatic rices, SciencePublishers Inc, Enfield, NH, USA, pp 47–69

Shou H, Frame BR, Whitham SAWK (2004) Assessment oftransgenic maize events produced by particle bombardmentor Agrobacterium-mediated transformation. Mol Breed13:201–208

Sivamani E, Huet H, Shen P, Ong CA, de-Kochko A, Fauquet C,Beachy RN (1999) Rice plants (Oryza sativa L.) containingRice tungro spherical virus (RTSV) coat protein transgenesare resistant to virus infection. Mol Breed 5:177–185

Sudhakar D, Fu X, Stoger E, Williams S, Spence J, Brown DP,Bharathi M, Gatehouse JA, Christou P (1998) Expressionand immunolocalization of the snowdrop lectin, GNA intransgenic rice plants. Transgenic Res 7:371–378

Sugaya S, Hayakawa K, Handa K, Uchimiya H (1989) Cell-specific expression of the rolC gene of the TL-DNA of Riplasmid in transgenic tobacco plants. Plant Cell Physiol30:649–653

Suh S-O, Noda H, Blackwell M (2001) Insect symbiosis: deri-vation of yeast-like endosymbionts within an entomopath-ogenic filamentous lineage. Mol Biol Evol 18:995–1000

Travella S, Ross SM, Harden J, Everett C, Snape JW, HarwoodWA (2004) A comparison of transgenic barley lines pro-duced by particle bombardment and Agrobacterium-medi-ated techniques. Plant Cell Rep 23:780–789

Vaucheret H, Fagard M (2001) Transcriptional gene silencing inplant: target, inducers and regulators. Trends Genet 17:29–35

Wang M, Boulter D, Gatehouse JA (1992) A complete sequenceof the rice sucrose synthase-1 (RSs1) gene. Plant Mol Biol19:881–885

Wenck A, Czako M, Kanevski I, Marton L (1997) Frequentcollinear long transfer of DNA inclusive of the whole binaryvector during Agrobacterium-mediated transformation.Plant Mol Biol 34:913–922

Weis WI, Drickaner K (1996) Structural basis of lectin-carbo-hydrate recognition. Annu Rev Biotechnol 65:441–473

Yin Y, Zhu Q, Dai S, Lamb C, Beachy RN (1997) RF2a, a bZIPtranscriptional activator of the phloem-specific rice tungrobacilliform virus promoter, functions in vascular develop-ment. EMBO J 16:5247–5259

752 Plant Mol Biol (2006) 62:735–752

123