A Multifunctional Turnip Crinkle Virus Replication Enhancer

A Multifunctional Turnip Crinkle Virus ReplicationEnhancer Revealed by in vivo Functional SELEX

Guohua Zhang and Anne E. Simon*

Department of Cell Biology andMolecular Genetics Universityof Maryland College ParkCollege Park, MD 20742, USA

The motif1-hairpin (M1H), located on (2 )-strands of Turnip Crinkle Virus(TCV)-associated satellite RNA C (satC), is a replication enhancer andrecombination hotspot. Results of in vivo genetic selection (SELEX:systematic evolution of ligands by exponential enrichment), where 28bases of the M1H were randomized and then subjected to selection inplants, revealed that most winners contained one to three short motifs,many of which in their (2 )-sense orientation are found in TCV and satC(2 )-strand promoter elements. Ability to replicate in protoplasts corre-lated with fitness to accumulate in plants with one significant exception.Winner UC, containing only a seven-base replacement sequence, was thesecond most fit winner, yet replicated no better than a 28-base randomreplacement sequence. Fitness of satC containing different M1H replace-ment sequences could be due to enhanced satC replication or enhancedability to affect TCV movement, since satC interferes with TCV virionaccumulation, which is correlated with enhanced movement to youngertissue. Cells inoculated with TCV and UC accumulated fewer virionswhen compared to other winners that replicated better in protoplasts butwere less fit in plants. UC, and other first and second round winners, con-tained structures that were on average 33% more stable in their (þ )-strandorientation, and most formed hairpins with a A-rich sequence at the base.These results suggest that M1H replacement sequences contribute to thefitness of satC by either containing (2 )-strand elements that enhancesatRNA replication and/or a (þ )-strand hairpin flanked with single-stranded sequence that enhances TCV movement.

q 2003 Elsevier Science Ltd. All rights reserved

Keywords: RNA virus replication; RNA recombination; viral movementenhancer; satellite RNA; RNA-dependent RNA polymerase*Corresponding author

Introduction

Replication of (þ )-sense RNA viruses is a two-step process that begins with the synthesis of anRNA strand complementary to the input strandand finishes when the complementary strand iscopied into an identical version of the input strand.A virus-encoded enzyme, the RNA-dependentRNA polymerases (RdRp), contains the active sitefor nucleotide polymerization and may be associ-ated with additional virus and/or host-encodedsubunits whose functions remain largely

unknown.1 Promoters for RdRp vary widely inboth sequence and structure, even for multiplepromoters of a single RdRp.2,3 Since promoters arerecognition sites for the RdRp or associated factors,it is currently unclear how specificity of the recog-nition is achieved.

Core promoters for full length complementarystrand synthesis of (þ )-strand RNA viruses havebeen identified for a number of RdRp and usuallycomprise one or more hairpins located withinuntranslated sequence near the 30 end, with theterminal nucleotides usually, but not always,single-stranded.4 – 7 Some viral RNAs can supporta low level of replication in the absence of the 508

or 309 untranslated region, suggesting that internalsequences can functionally replace the normallyutilized promoter.8 Recently, a number of internalsequences in viral RNAs have been identified thatcontribute either directly or indirectly to viralRNA replication. An internal region that enhances

0022-2836/03/$ - see front matter q 2003 Elsevier Science Ltd. All rights reserved

E-mail address of the corresponding author:[email protected]

Abbreviations used: TCV, Turnip Crinkle Virus; SELEX,systematic evolution of ligands by exponentialenrichment; M1H, motif1 hairpin; satC, satellite RNA C;RdRp, RNA-dependent RNA polymerase; wt, wild-type;CP, coat protein; sg, subgenomic.

doi:10.1016/S0022-2836(02)01366-9 J. Mol. Biol. (2003) 326, 35–48

the replication of a defective interfering RNAassociated with Tomato Bushy Stunt Virus is also anenhancer in the context of the genomic RNA.10

Internal regions within the coat protein (CP)coding sequence of Tobacco Etch Virus,11 the RNA3intergenic region of Brome mosaic virus (BMV)12

and the 2C coding sequence of poliovirus13,14

also contain important replication elements. Func-tions for the latter two internal elements haverecently been determined. The internal poliovirushairpin, known as the CRE, is the template foruridylylation of the protein replication primer,VPg,14 while the BMV internal sequence isrequired to produce an active replicase complex15

and for template sequestration by the BMV 1aprotein.16

We have been examining Turnip Crinkle Virus(TCV) and its satellite (sat) RNAs for sequencesinvolved in RNA replication.17 TCV (4054 bases), amember of the genus Carmovirus in the family Tom-busviridae, is a (þ )-sense RNA virus with five openreading frames (ORFs) that encode two subunitsof the viral RdRp (p28 and the readthrough pro-duct p88, which contains the polymerase activesite motif GDD); two proteins involved in virusmovement (p8 and p9); and the CP that forms a180 subunit, T ¼ 3 icosahedral capsid18 – 20 (Figure1(A)). The movement proteins and the CP aretranslated from two subgenomic (sg) RNAs of 1.7and 1.45 kb, respectively,21 which are synthesizedfrom internal promoters on the TCV (2 )-strand.22,23

The association of TCV with several small satR-NAs that are also replicated by the TCV RdRp pro-vides a large number of promoter elements thatcan be assayed for functionality and compared forsequence and structural similarities2,22,24 – 28 (Figure1). SatC, a satRNA composed of two regions ofTCV at the 30 end and the nearly completesequence of satD at the 50 end (Figure 1(A)), con-tains a number of elements important for transcrip-tion of (þ ) and (2 )-strands. SatC (þ )-strandscontain a 30 hairpin flanked by six single-stranded30 terminal bases that are conserved among allTCV-associated RNAs (Figure 1(B)). SatC (2 )-strands contain two small linear elements, the30PE and 50PE, which can function as independentpromoters in a cell-free (in vitro) system containingpartially purified TCV RdRp2 (Figure 1(D)). Eitherthe 30PE or 50PE is required for complementarystrand synthesis in vitro2 but only the 50PE isrequired in vivo.27,28 Also required for replicationin vivo is the (2 )-strand 30 terminal Carmovirus con-sensus sequence (CCS: C2-3A/U3-7), which is pre-sent at the transcription initiation sites of all TCV-associated RNAs27 (Figure 1(C)).

A 30-base interior hairpin, the motif1-hairpin(M1H; Figure 1(D)), is also required for efficientreplication of satC monomers (but not dimers) invivo.29,30 The M1H was originally identified as ahotspot for RNA recombination between satD andsatC during (þ )-strand synthesis in vivo.31 Evi-dence that the TCV RdRp is recruited by the M1Hto the (2 )-strand satC acceptor template during

recombination-mediated template switchingcomes from the composition of the (2 )-senseM1H, which includes motifs found in the 50PEand TCV 30CCS promoter elements30 (Figure 1(D));the ability of the (2 )-sense M1H to direct 30 term-inal extension from primers base-paired 30 of thehairpin in vitro32,33; the ability of the p88 polymer-ase subunit expressed in Escherichia coli to extendinternally base-paired 30 ends, a reaction thatrequires the M1H;34 and competition experimentsbetween wt and mutant M1H using template con-taining an internally base-paired 30 end.33 Theseresults suggest a model where the M1H is able topromote recombination between satD and satC bydirecting the RdRp (still complexed with newlysynthesized satD (þ )-strand) to re-initiate syn-thesis 30 of the M1H on satC (2 )-strands. Inaddition, this model suggested that the M1Hmight be an enhancer of satC replication by pro-moting the interaction of the RdRp with satC (2 )-strand templates. In agreement with this model,the M1H was found to function as a replicationenhancer in vitro, stimulating complementarystrand synthesis from a (2 )-strand promoter (the30PE) by tenfold in its (2 )-sense orientation andsevenfold in its (þ )-strand orientation.29 Inaddition, the M1H could convert to an indepen-dent promoter in vitro when placed downstreamof a CA-rich sequence.29 However, the M1H ineither orientation was only weakly stimulative oftranscription from the hairpin promoter at the 30

end of satC (þ )-strands,29 supporting earlier sug-gestions that the M1H functions mainly in its (2 )-sense orientation during (þ )-strand synthesis toaid in attracting the RdRp to satC (2 )-strandtemplates.

Extensive mutagenesis of the satC M1H has beenconducted and alteration of bases in the upperstem, lower stem, interior asymmetric loop andterminal loop were all found to reduce the abilityof the hairpin to promote both recombination withsatD in vivo and the analogous self-primed 30

terminal extension in vitro.32,33 While these resultsindicated a role for both sequence and structure ofthe hairpin in recombination and 30 terminal exten-sion, most individual mutations had little discern-able effect on satC accumulation in plants.31,35

Thus, to clarify the role of the M1H in enhance-ment of satC replication, we initiated an analysisof the hairpin by in vivo functional selection alsoknown as in vivo SELEX (systematic evolution ofligands by exponential amplification). Unliketraditional in vitro SELEX, i.e. SELEX that usesbinding as an assay or searches for a desiredcatalytic activity,36 function-based in vivo SELEXsearches for functional sequences that impart fit-ness to the molecule, regardless of the mechanismof action.26 –28,37 –39 Our results indicate that theM1H can be replaced by a diverse group ofsequences that, in the (2 )-sense orientation, con-tain multiple consecutive cytidylates and motifsfound in TCV promoter and enhancer elements aswell as novel motifs. Surprisingly, the vast majority

36 TCV Replication Enhancer

of 28-base M1H replacement sequences fold intostem-loops that are more stable in the (þ )-senseorientation and retain A-rich sequences on eitherside of the (þ )-strand hairpin. This (þ )-strandstructure may contribute to the fitness of thesatRNA in plants by reducing the accumulation ofTCV virions, which promotes virus long-distancemovement in the host.

Results

Functional selection of M1Hreplacement sequences

In the presence of satC, TCV is able to movemore rapidly to younger tissue (F. Zhang, Q. Kongand A.E.S., unpublished results), which is likely

Figure 1. TCV-associated RNAs and cis-acting sequences involved in replication. (A) RNAs associated with TCV.Upper panel shows the TCV genomic RNA and two sgRNAs. p28 and p88 are the viral encoded subunits of theRdRp; p8 and p9 are movement-related proteins and p38 is the CP. The 1.7 kb sgRNA is the mRNA for p8 and p9and the 1.4 kb sgRNA is the mRNA for the CP. Genomic RNA shading is related to the bottom panel, which showsthe relationship between the recombinant satC and its parental RNAs, satD and TCV. Similar sequences are shadedalike. (B) Hairpin promoter on satC (þ )-strands required for complementary (2)-strand synthesis. Initiation is at the30 terminal nucleotide (arrow). (C) TCV (2 )-strand promoter elements. The TCV CCS (boxed), is located at the 30 endof TCV (2)-strands; the 1.45 sgRNA promoter (1.45 sgP) is a minimal version of the sgP that is equally active as thewt promoter, which contains a much more extensive hairpin stem.22 Note that both sgP have a CCS (C2-3A/U3-7;boxed) at the transcription start sites (arrow). Filled circles above certain bases denote sequence identity with basesin the M1H on satC (2 )-strands shown in (D). (D) SatC (2 )-strand elements required for (þ)-strand synthesis. ThesatC CCS and 30PE are boxed. The 30PE and 50PE can serve as independent promoters in vitro. The M1H sequenceshown (M1H-B) has a single change at the base of the stem (U to C at position 176) that created a Bam HI site in the cor-responding cDNA required for the generation of satC with randomized M1H sequences. Sequence homology betweenmotifs in the M1H and various TCV promoter elements are denoted by similar symbols. M1H boxed sequence wassubjected to randomization for the in vivo functional SELEX.

TCV Replication Enhancer 37

responsible for the enhanced virulence of TCVwhen associated with satC.40 Since satC containingeither a deletion of the M1H, or random sequencesreplacing the hairpin, accumulates poorly inprotoplasts,29,30 there is a strong selection forreplacement sequences that either improve itsability to accumulate in plants and/or enhanceTCV movement.

A total of 28 bases of the M1H (Figure 1(D),boxed) were randomized using a PCR strategy.Two PCR products were generated using a full-length satC cDNA clone: a 50 fragment thatincluded an upstream T7 RNA polymerase promo-ter and a 30 fragment containing randomized basesreplacing positions 181 to 208 of the M1H. Afterproper ligation of the two fragments, satC tran-scripts containing the randomized sequence inplace of the M1H were synthesized using T7 RNA

polymerase and then inoculated onto 19 turnipseedlings. Included in the inoculation were tran-scripts of TCV genomic RNA, which provides thetemplate for translation of the RdRp and CPrequired to replicate and package the satRNA. At21-days post-inoculation, total RNA was extractedfrom uninoculated leaves and full-length satCcDNA clones generated by reverse transcriptase(RT) PCR. Two to 18 full length cDNA clones weresequenced per plant and were designated as win-ners of the first round (Table 1). In all, 15 plantscontained a single species of satC that was uniquefor each plant, while three plants contained mix-tures of satC with two different M1H replacementsequences (unique for each plant) and one plantcontained satC with four different sequences.Thus, a total of 25 satC with different M1H replace-ment sequences were recovered from the 19infected plants.

To subject the first round winners to furthercompetition, transcripts from all 25 satC firstround winners were combined, and equal amountsinoculated onto six additional plants along withTCV genomic RNA. Sequencing the 32 satC clonesgenerated from RNA isolated at 21-days post-inoculation revealed only a single species (clone1-2) accumulating in all plants (Table 2). Thesecond round screen was repeated with nine newplants by omitting 1-2 transcripts from the mixtureand inoculating with transcripts of the remaining24 first round winners. Five of the 24 satC specieswere recovered from at least two of these plants at21-days post-inoculation (Table 2). In addition, anew satC species (clone UC) was recovered thatcontained a seven-base M1H replacementsequence. This sequence, “UCAGGAA” (since thesequence of the M1H is thought to be important inits (2 )-sense orientation, all M1H replacementsequences are shown in (2 )-sense orientated 30 to50 unless otherwise stated) could have originatedfrom several possible first round winners by adeletion of 21 bases from either clone 2-1 (the28-base replacement sequence terminates withUCAGGAA); 2-2 (interior sequence contains CCAGGAA) or 7-1 (contains the sequence CCAGGAU)

Table 1. M1H replacement sequences in first roundSELEX winners

Plant Name Sequence

1 1-1 CCAGCAUAAAAUCUACGUCCAUACGAAU1-2 UCCAAACUAUUAAGUUACGCAGUGACCU

2 2-1 CAAAGGGUGAGUUUUCCUAGGUCAGGAA2-2 CCGUUAGUACCACACCAGGAAGACCCCG

4 4-1 CAACCCCAUCAGCAAUCGUAGUGAGGCC5 5-1 ACCGGCGAAGGUAGUUCCAUCACCAGAA6 6-1 AGCCGCAAUAUAAAUGCCACACGGAACC7 7-1 CCCAGGAUGAACAUCAACCCCGGCACCA8 8-1 GGACCCCUCACCUACGAUGAACCCCUCC9 9-1 CCCCAAUAGCAAUGUAGAUCCUAAGCCA10 10-1 CAUUGUCUGAAACCAGAACCUAUCGCAA11 11-1 ACCCAGGGGACAUAACCCCUCAUCCGCA12 12-1 CAACCCCGAAGAGGUCCCCAAAACCCGG13 13-1 UUCAACCUUAGUGAACCCAUAAAAGCG14 14-1 AAAAUACUACCUCUCUAACACUCCCCCA15 15-1 UACGAUUCACCACAUGACUCGACCCGAU16 16-1 CUCAGAGGUAUCUUACAGGCCCCGAGUC17 17-1 CACACGACCAAACACAGUUCGCGCCAGA18 18-1 CCACCUUUAGUACCGGCCCGUCGAAAAU

18-3 ACGGUAGCACAUCGUUCGGGAUUUUACA18-5 ACACGCCCUGCUCACAUCUAGUGUUGCC18-6 CUAGUUACAUCGCCCGGCCAGGCUUCCG

19 19-1 CUGACACCCAUUAUUCGUGCACAACCCC19-2 AGUAUAGCUGUUAGUAGCUCAACCGCC

20 20-1 CCCACCCGCGGCCAACGCAGGACCUCGA

Table 2. Second round 28-base SELEX

# Recovereda

Name Sequence of second round winnersb Six plants Nine plantsc (total)

1-2 UCCAAACUAUUAAGUUACGCAGUGACCU 322-2 CCGUUAGUACCACACCAGGAAGACCCCG 0 4-0-1-4-0-2-0-0-8 (19)UCd UCAGGAA 0 2-0-0-6-1-0-0-5-0 (14)4-1 CAACCCCAUCAGCAAUCGUAGUGAGGCC 0 0-0-0-0-6-2-0-1-0 (9)11-1 ACCCAGGGGACAUAACCCCUCAUCCGCA 0 0-0-0-0-0-2-5-0-0 (7)6-1 AGCCGCAAUAUAAAUGCCACACGGAACC 0 0-3-0-0-0-3-1-0-0 (7)5-1 ACCGGCGAAGGUAGUUCCAUCACCAGAA 0 0-2-0-1-0-0-1-0-1 (5)

a Only sequences recovered in two or more plants are presented.b (2)-strand sequences are shown in a 30 to 50 orientation.c Rows correspond to the nine different plants and columns indicate the number of times a particular sequence was recovered for

that particular plant.d UC was recovered only in second round plants. “CCAGGAA” was also recovered in one plant.


(see Figure 2, class VI). SatC containing a similarseven-base M1H replacement sequence, CCAGGAA, was also was recovered from one plant.

To ascertain if UC was a functional satRNA andnot an artifact of the cloning process, full lengthsatC containing the UCAGGAA M1H replacementsequence was generated and transcripts inoculatedonto three plants along with TCV genomic RNA.At 21-days post-inoculation, total RNA wasextracted from plants and analyzed by ethidiumbromide-stained gel electrophoresis (satC accumu-lates to the level of 5 S ribosomal RNA and is easily

visible in stained gels). SatRNA migrating slightlyfaster than wt satC was detected in all plants andsequencing revealed that the seven-base replace-ment sequence was stable (data not shown).

M1H replacement sequences contain motifsfound in TCV promoter elements as well asnovel motifs

The base composition of the recovered sequenceswas not random. Cytidylate and adenylateresidues comprised 35% and 29% of the M1H

Figure 2. Motifs found in manyfirst and second round M1Hreplacement sequences are alsofound in TCV and satC (2)-strandpromoter and recombinationelements. Full-length M1H replace-ment sequences from first andsecond round winners are shown(in (2 )-sense oriented 30 to 50) andmotifs with similarity to promoterelements are underlined (classes Ithrough IV). Promoter elements(and their abbreviations) are shownin italics and are described in thelegend to Figure 1. Other sequencesin common among the replacementsequences are shown underlined inclasses V to VII. All second roundwinner names are followed bynumbers in parentheses that denotetheir relative fitness in direct com-petition assays in plants (seeTable 3).


replacement sequences, respectively, whileuridylates and guanylates each made up 18% ofthe remaining residues. Furthermore, there were2.6-fold more CCA triplets and 3.6-fold more CCCtriplets in the replacement sequences thanexpected for a purely random sequence, while noUGG triplets were recovered in any sequence.

While the overall sequences of the first roundand second round winners differed from eachother and from the wt M1H sequence, winnerscould be grouped in classes according to commonsequence motifs (Figure 2). Some of the shortmotifs (generally from six to ten bases) that wereshared among M1H winners comprised portionsof previously defined (2 )-promoter elements or invivo RNA recombination hotspots. For example,1-2, the top second round winner, contained thesequence CCAAACUAU; which is very similar tothe 30PE (UCCCAAAGUAU; identical sequence isunderlined) (Figure 2, class I). The sequenceCACCCAUUAUUCGU in first round winner 19-1is identical to sequence at the transcription startsite of the 1.45 kb sgRNA promoter located onTCV (2 )-strands (CACcCAUUAU; transcriptionstart site is in lower case) and similar to the 30CCS

of TCV (2 )-strands ð30OH-CCAUUAGUCGU…Þ(Figure 2, class II). A portion of the underlinedsequence above from clone 19-1 ðCCAUUAUÞ isalso in one of the two imperfect repeats (M3A)that together comprise the TCV (2 )-strand recom-bination hotspot element known as the motif3-hair-pin (M3H).33,41 Previous results indicated that oneof the two M3H repeats was required for TCVreplication in protoplasts.41 Sequence similaritiesbetween other short sequences in the M3H repeatsand first and second round winners were alsofound (Figure 2, class III).

The motif AACCCCUC was repeated twice insecond round winner 11-1 and once in first roundwinner 8-1 (Figure 2, class IV). Seven of eight con-tiguous bases are also part of the 50PE (AACCCCU). The similar motif CAACCCC, not pre-viously found in any TCV promoter element, wasrecovered in second round winner 4-1 and firstround winners 19-1 and 12-1 (Figure 2, class V).As described above, the second round winner UC,with the seven-base replacement sequence UCAGGAA, contains sequence found in three otherfirst and second round winners (Figure 2, classVI). This motif was not previously found in anyknown TCV promoter element. In addition to themotifs just described, additional regions ofsequence similarity could be found between var-ious first and second round winners. For example,second round winner 4-1 contained the sequenceCCCCAUCAGCAAUCGUAG; which is verysimilar to the 9-1 sequence CCCCAAUAGCAAU·GUAG (Figure 2, class VII). Theseresults indicate that the majority of the M1Hreplacement sequences resemble the wt M1H bybeing composed of short motifs, some of whichcan be found in (2 )-strand TCV promoters andrecombination hotspots.

Fitness to accumulate in plants of most satCwith M1H replacement sequences correlateswith ability to replicate in protoplasts

To determine which of the replacementsequences found in the second round winners con-fers the most fitness for satC to accumulate inplants, equal amounts of transcripts of two orthree of the winners were combined and inocu-lated with TCV genomic RNA onto three to fourplants. At 21-days post-inoculation, total RNA wasextracted and approximately equal numbers ofclones generated from all plants were sequencedand the results combined and shown in Table 3. Indirect competition between 1-2 and wt satC, onlywt satC was recovered. UC, with its seven-baseM1H replacement sequence, was surprisingly fit,accumulating better than 4-1, 5-1, 6-1 and 11-1 indirect competition. Only 1-2 out-competed UC,with 76% of clones recovered from plants havingthe 1-2 replacement sequence. Based on the resultsfrom Table 3, the order of fitness in plants ofsecond round SELEX winners is: 1-2, UC, 4-1, 5-1,2-2, 11-1 and 6-1.

Table 3. Competition for fitness in plants

Co-inoculation Number recovered (three to four plants)

wt satC 571-2 0

wt satC 30UC 0

1-2 28UC 9

UC 304-1 165-1 10

UC 236-1 62-2 0

UC 711-1 1

4-1 315-1 2

4-1 62-2 0

5-1 322-2 3

5-1 76-1 0

2-2 276-1 411-1 1

11-1 286-1 8


The ability of satC, containing different M1Hreplacement sequences, to accumulate in plants islikely a combination of one or more of the follow-ing attributes: (i) ability to replicate; (ii) stability;and (iii) ability to direct the movement of TCVtowards veins and thus promote more rapid sys-temic infection. To determine the effect of differentM1H replacement sequences on accumulation inprotoplasts, protoplasts prepared from TCV hostArabidopsis thaliana were co-inoculated withtranscripts of each second round SELEX winnerand TCV genomic RNA. Accumulation levelswere compared to both wt satC and satC contain-ing a single base change in the base of the M1H(satCB) that was necessary to simplify the originalconstruction of the SELEX constructs. As shown inFigure 3, this single base change in construct satCB

resulted in an 18% reduction in accumulation com-pared with wt satC at 36-hours post-inoculation.The most fit SELEX winner, 1-2, accumulated to89% of satCB levels while the least fit clones (11-1and 6-1) did not accumulate significantly differentfrom satC containing a non-selected 28-basereplacement sequence (R28a). Clones 4-1, 5-1, and2-2, which were intermediate in fitness in plantcompetition assays, accumulated in protoplasts incorrelation with their fitness levels. The one excep-tion, UC, accumulated more poorly in protoplaststhan 4-1, 5-1, 2-2, 6-1 and R28a, while being morecompetitive when co-inoculated in plants (Table 3).SatC containing randomly selected 28-base or ten-base replacement sequences (R28a, R28b and R10)replicated better than satRNA containing adeletion of the M1H (DM1H), which is possibly afunction of satRNA size differences. We havepreviously demonstrated that accumulation ofsatC and another TCV subviral RNA in vivo is sub-stantially affected by reductions in size.42 – 44

To test for stability differences among the secondround winners, protoplasts were inoculated with

full-length transcripts of wt satC, satCB, 1-2, UC,and R28a in the absence of TCV genomic RNA.RNA was extracted between zero and six hourspost-inoculation and satRNA levels detected byRNA gel blot hybridization. All satC tested wereequally stable (data not shown), agreeing withprevious findings that wt satC and satC with adeletion of the M1H did not differ in theirstability.33

These results suggest that most SELEX winnerswere selected due to enhanced replication of satCin infected cells, with the selected sequences func-tionally replacing the replication enhancer attributeof the M1H. However, the poor accumulation ofUC in protoplasts suggests that factors other thanreplication enhancement influenced the selectionof M1H replacement sequences in plants.

Enhanced fitness of winner UC correlates withinhibition of virion accumulation

SatC enhances the movement of TCV towardsyounger leaves in Arabidopsis, resulting in morevirulent symptoms and the death of the plantswithin 14 to 21 days post-inoculation (F. Zhang,Q. Kong and A.E.S., unpublished results). Thisrapid movement of TCV correlates with a markedreduction in virion accumulation in the presenceof satC in co-inoculated protoplasts (F. Zhang,Q. Kong and A.E.S., unpublished results). TCVrequires CP, but not virion formation, formovement23 and thus a reduction in virions,without a concomitant reduction in CP, couldallow TCV to move as a ribonucleoprotein complexin a manner that accelerates movement towardsveins.

To determine if the seven-base M1H replacementsequence in UC enhances fitness by interferingwith virion formation, Arabidopsis protoplastswere inoculated with TCV in the absence or

Figure 3. Accumulation of satCSELEX winners in protoplasts.Arabidopsis protoplasts (5 £ 106)were inoculated with 20 mg of TCVgenomic RNA transcripts and 2 mgof transcripts of wt satC (wtC), orsatC with a U to C alteration atposition 176 (wtCB) that was theparental construct of the SELEXwinners, or SELEX second roundwinners 1-2, UC, 4-1, 5-1, 2-2, 11-1and 6-1 (fitness order in plantsshown by a directional arrow). Con-trol satC constructs R28a and R28bhave randomly selected 28-baseM1H replacement sequences, R10has a ten-base randomly selectedM1H replacement sequence andDM1H contains a 28-base deletionof the M1H. RNA was extracted at

24 or 36 hours post-inoculation and subjected to RNA gel blot analysis using an oligonucleotide probe that hybridizedto TCV genomic RNA and satC. Values shown were calculated from at least three independent experiments.


presence of wt satC, UC, 4-1, 5-1 and satCp. SatCp isa variant of satC that has the wt M1H but containsthe 30 100 bases of TCV in place of its own 30 100bases, resulting in reduced accumulation in proto-plasts to levels comparable with those of UC. Asdescribed above and shown in Figure 4, upperpanel, UC replicated more poorly in protoplaststhan 4-1 and 5-1, even though UC was more fit

than 4-1 and 5-1 in direct competition assays(Table 3). Levels of virions isolated from equalnumbers of infected protoplasts varied markedlydepending on the co-inoculated satRNA. Novirions were detected in Western blots when TCVwas co-inoculated with wt satC. Levels of virionsassociated with UC co-inoculation were reduced by84%, similar to the 73% reduction by the comparablyreplicating satCp. This result suggests that UC isequally capable of virion reduction as this variantsatC containing a wt M1H. Virion accumulation inthe presence of 4-1 and 5-1 was only reduced by48% and 45%, respectively, compared with levels inthe absence of satRNA, even though these satRNAaccumulated ,twofold better than UC and satCp.These results suggest that the seven-base replace-ment sequence in UC contributes to the fitness ofthe satRNA by interfering with virion accumulation,thus enhancing TCV movement.

Figure 4. Effect of co-inoculation of TCV with satC onvirion accumulation in protoplasts. Arabidopsis proto-plasts (5 £ 106) were inoculated with 20 mg of TCV tran-scripts alone or with 2 mg of wt satC (wtC), or secondround 28-base SELEX winners UC, 4-1, and 5-1, or satCp

(satC with the 30 terminal 100 bases of TCV). RNA andvirions were extracted at 40 hours post-inoculation.Upper panel is a representative RNA gel blot of totalRNA probed with an oligonucleotide complementary toboth TCV and satC. Virions (lower panel) were visual-ized by chemiluminescence following treatment withanti-TCV CP antibody.

Figure 5. Plus-strand structures of the wt M1H, theM1H replacement sequence in SELEX winner UC, andTCV H4. TCV H4 is a hairpin similar to the M1H inboth structure and locational proximity to the 30 end ofthe corresponding RNAs. The replacement sequence inUC is underlined. The second recombination event thatproduced satC occurred in the lower stem of TCV H4.Boxed sequence in satC M1H is thus derived from theboxed sequence in H4. Note that H4 forms a structuresimilar to the M1H in the upstream sequence that isunrelated to satC, including an A-rich region at the 50

base of the stem.

Table 4. Stability of local hairpins formed by first andsecond round SELEX winner replacement sequences

Randomizeda

Nameb

DG(þ )-strand

DG(2)-strand

DG(þ )-strand

DG(2)-strand

wt 215.9 217.81-1 21.16 22.1 27.6 26.11-2 (1) 210.9 27.3 26.9 26.22-1 29.5 214.6 24.0 27.32.2 (5) 214.6 29.9 212.0 29.24-1 (3) 29.1 28.5 28.1 28.05-1 (4) 213.8 27.9 27.8 28.86-1 (7) 210.6 29.1 27.9 26.37-1 214.8 28.5 210.5 27.48-1 215.7 29.3 29.6 26.79-1 29.7 22.8 26.9 25.910-1 27.1 26.4 210.7 26.911-1 (6) 214.3 212.4 211.0 27.312-1 216.1 27.7 212.3 26.813-1 212.8 28.9 26.9 26.714-1 214.2 24.2 27.3 23.615-1 29.1 27.4 27.3 25.316-1 211.7 212.3 26.7 28.517-1 211.7 24.5 29.8 25.918-1 29.1 28.2 28.1 26.818-3 23.5 211.3 24.3 26.518-5 28.0 28.3 29.0 28.218-6 29.4 27.6 28.5 29.519-1 211.9 25.2 29.1 25.119-2 210.7 210.3 28.1 27.720-1 213.5 211.1 213.3 210.4Averagec 210.9 ^ 3.5 28.2 ^ 2.9 28.5 ^ 2.2 27.0 ^ 1.5UC (2) 24.4 23.7 20.8 21.6

Structures were ascertained using mFOLD.45

a Minus-strand sequences were shuffled using a randomiz-ation program from Arizona Research Labs. The DG valuesshown are the average of five independent randomizations.The complements of the (2)-strand randomized sequenceswere also folded to give the averaged (þ )-strand randomizedvalues.

b Names followed by parentheses are second round winnersand numbers in parentheses denote order of fitness fromTable 3.

c Averages were calculated using all 28-base replacementsequences and thus excludes UC, which contains a seven-basereplacement sequence.


Structures of the 28-base M1Hreplacement sequences

We previously determined that the structure of theM1H was essential for recombination in vivo.31,33 TheM1H is predicted to form similar structures on both(þ) and (2)-strands according to computer predic-tions using the mFOLD program45 and biochemicalstructural determination41,46 (Figures 1(D) and 5). Toascertain if the M1H replacement sequences of theSELEX winners might also form hairpins in (þ)and/or (2)-strands, all 25 replacement sequences(both (þ) and (2)-orientation) recovered in the firstround (along with 11 upstream and eight down-stream bases) were subjected to computer analysisusing mFOLD. In addition, all (2)-sense sequenceswere randomized using the Shuffle program fromArizona Research Labs and the randomizedsequences along with their complements also exam-ined for possible hairpins. Unexpectedly, as shownin Table 4, (þ)-strand structures of the replacementsequences were, on average, 33% more stable thantheir (2)-strand complements. Furthermore, 80% ofthe structures were more stable in their (þ)-senseorientation than in their (2)-sense orientation,including all second round winners. The hairpinformed by the UC replacement sequence was also19% more stable in its (þ)-sense orientation(24.4 kcal/mol compared with 23.7 kcal/mol).These results suggest that a hairpin in the (þ)-strandmight be more significant to satC fitness than a corre-sponding hairpin in the (2)-strand. In addition, 67%of the (þ)-strand hairpins, including that of UC,formed such that the A-rich sequences at the basemaintained their single-stranded structure, similarto the wt (þ)-strand M1H (Figure 5).

Discussion

DNA enhancers are defined as position-indepen-dent sequences that are functional in both orien-tations, which reduce, but do not abolish

transcription when removed.47 This definition alsodescribes the M1H recombination hotspot/enhancer of satC. The M1H is active as an enhancerwhen located distal to its original position or whenreversed in orientation, and eliminating the M1Hreduces, but does not abolish, RNA replication.29

As described in the Introduction, analysis of theM1H over the past 12 years indicates that theM1H functions in recombination and as anenhancer in its (2 )-sense orientation.29,31,33,48

The M1H was originally derived from three non-contiguous sequences: the 30 end of satD, 16-basesfrom the TCV CP coding sequence, and theremainder from the TCV 30 untranslated region(Figure 6).49 Based on analysis of the parentalsequences, five changes have occurred since theoriginal recombination events that formed satC,all in the satD-derived sequence: the first twochanges (moving 50 to 30 in the (þ )-strand)increased the number of adenylates in the A-richsequence at the 50 base of the hairpin; the nextchange strengthened the hairpin stem and thefinal two-base deletion strengthened the hairpinstem and also resulted in an eight-base sequenceidentity (in the (2 )-sense orientation) with the50PE. The (2 )-sense M1H contains two additionalmotifs found in elements located on satC (2 )-strands known to be important for (þ )-strand syn-thesis (Figure 1(D)). In addition, the 30 end of oneM1H motif, 30CCCUGG, is precisely the junctionof the second recombination event that led to theformation of satC. The identical motif is alsofound in the 50PE of satC, which can serve as anindependent promoter in vitro.28 Since the con-secutive cytidylates in this 50PE motif are absol-utely required for promoter activity,28 it is likelythat the RdRp was attracted to this identicalmotif in TCV to re-initiate synthesis during thecrossover event that formed satC. Thus, theTCV sequences responsible for formation ofsatC by RdRp-mediated recombination arelikely those responsible for the replicationenhancer properties of the M1H.

Figure 6. Evolution of the M1H from the original parental sequences. The M1H is comprised of three non-contiguoussequences: the 30 end of satD and two segments from TCV. Sequences in bold are the original parental sequences andasterisks denote position differences with wt satC. These differences are also shown at the right on the (þ)-strandstructure of the M1H. Lines at or between bases in the structure denote the crossover sites. The cytidylate at position190 could be derived from either satD or TCV.


The discovery that the (2 )-strand M1H con-tained motifs found in other (2 )-strand promoterelements in TCV and TCV-associated RNAsprompted initiation of the SELEX study, to deter-mine if satC fitness in plants was related to M1Hreplacement sequences containing similar shortmotifs. The M1H replacement sequences in (2 )-strands of the first round winners of the 28-baseSELEX were highly variable but not random.Short three to four consecutive cytidylates werepresent in the replacement sequences at three tofivefold more than expected for a purely randomsequence. Short stretches of consecutive cytidylatesare also present in all TCV promoter elements,including the wt (2 )-strand M1H (Figure 1). Aswith the wt M1H, many of the (2 )-strand 28-basereplacement sequences were composed of severalshort six to ten-base motifs found in (2 )-strandTCV promoter elements (Figure 2), the most com-mon being the CCS motif found in the 30PE (Figure2, class I). The CCS motifs located at the 30 ends ofsatC and TCV (2 )-strands also were representedin several SELEX winners (Figure 2, class II). Sincethe most fit of the SELEX winners (1-2, 4-1, 5-1and 2-2) replicated between 1.5 and 3.7-fold betterthan the average of two non-selected satC with 28-base replacement sequences (R28a and R28b;Figure 3), and all contained at least one of theidentified motifs, it is likely that these motifs con-tributed to the enhanced replication of the SELEXwinners.

Since the reverse complement of the M1H is alsoable to enhance replication of satC in vivo and tran-scription in vitro,29 we examined the reverse comp-lement sequence for similar short motifs. Thissequence, 30CCAGGGUAAAUGGGAAACCGACCUCCCAGACCCUAAG50, (presented in 30 to 50

orientation to better compare with the presentationof sequences in Table 1 and Figure 2), also containsseveral stretches of contiguous cytidylates (initalics) and the motif CCCUA (underlined), whichis the 30CCS of satC. While the (þ )-sense orien-tation of the M1H is functional as a replicationenhancer, previous in vitro results indicated thatthe M1H in either orientation provided less thantwofold enhancement when combined with thehairpin promoter at the 30 end of satC (þ )-strands(compared with nearly tenfold enhancement usinga (2 )-sense promoter). Therefore, the M1H0sreplication enhancer role is likely in its (2 )-senseorientation, to enhance (þ )-strand synthesis.

The replication enhancer property of the M1H isthus consistent with the presence of different shortpromoter-like motifs, which can be locatedthroughout the sequence accounting for the vari-ability of the SELEX results. These results alsosuggest that a linear comparison of sequence maynot reveal similarities that may exist betweenpromoter elements for other viral RdRp. Otherstudies using an in vivo functional SELEX approachto analyze a protein binding sequence have alsorecovered a large number of different functionalsequences. Six classes of sequences containing

short six to ten-base motifs that could serve assplicing enhancers by binding to a family of pro-teins called SR, were selected at high frequencyfrom a random population of RNA sequences invivo.38 While some recovered sequences resemblednatural purine-rich SR-binding sequences, otherrecovered sequences were novel and non-purinerich. These recovered sequences were significantlymore degenerate than sequences recovered usingin vitro SELEX and selecting only for SR proteinbinding.50

One reason for the recovery of diverse sequencesfollowing in vivo SELEX is that, unlike in vitroSELEX, where selection is for a single attribute(e.g. binding to a particular protein), in vivoSELEX does not presume a unique function forthe selected sequence. Thus, it is possible that theselected sequences might serve more than a singlefunction, which could account for variability inthe recovered population. While we initiated invivo functional SELEX of the M1H with the pre-sumption that sequences recovered would substi-tute for the missing replication enhancer, a secondin vivo function for the M1H region was suggestedby the recovery of clone UC. UC, with a seven-base replacement sequence did not replicate betterin protoplasts than randomly selected clone R28a,which contains a 28-base replacement sequence(Figure 3). UC did replicate 1.9-fold better thansatC with a ten-base randomly selected replace-ment sequence and eightfold better than satC witha deletion of the M1H, suggesting that the UCreplacement sequence may be weakly enhancingreplication. However, UC replicated more poorlythan clones 4-1, 5-1, 2-2 and 6-1 while being morefit than these satRNAs in direct competition assaysin plants. An explanation for the unusual fitness isthat UC, as with wt satRNA, is able to stronglyinterfere with virion accumulation (Figure 4),which correlates with more rapid helper virus traf-ficking to younger tissue (F. Zhang, Q. Kong, andA.E.S., unpublished results). When assaying equalnumbers of infected protoplasts, second roundwinners 4-1 and 5-1 accumulated 46% better thanUC, yet 2.3-fold fewer virions were isolated fromUC-infected cells. Since the only differencebetween the satRNAs was the M1H replacementsequence, the M1H, possibly in conjunction withsurrounding sequences, or its complement com-prises the movement enhancer that increases fit-ness. These results suggest that the M1H region ismultifunctional, serving as both an enhancer ofreplication and an enhancer of viral movement.

Previous results indicated that the structure ofthe M1H in (2 )-strands was important for recom-bination in vivo31 and the analogous primer exten-sion reaction in vitro.33,51 Computer structuralmodeling of the M1H replacement sequences here,however, suggest a role for a (þ )-strand hairpin inbasic satRNA fitness. The seven-base UC replace-ment sequence, both in full-length satRNA and aportion consisting of 11 upstream and eight down-stream bases, is predicted to form the stem of a


short hairpin (Figure 5) that, like the wt M1H, con-tains A-rich ((þ )-sense) or U-rich ((2 )-sense)sequences at the base of the stem. The (þ )-senseUC hairpin is nearly 20% more stable than thecomplementary hairpin, suggesting that a (þ )-strand hairpin in this location might be importantfor fitness (Table 4). Hairpin stability predictionsfor all first round SELEX replacement sequencesrevealed that 80% of the clones contain sequenceswith (þ )-strand structures more stable than their(2 )-strand complements. Furthermore, all secondround SELEX winners contain hairpins that arebetween 7% and 74% more stable in their (þ )-strand orientation.

Based on the evidence that selection of satC toaccumulate in plants favors (þ )-strand hairpinsflanked by single-stranded A-rich sequences, andthat (þ )-strands accumulate to levels .100-foldhigher than (2 )-strands in infected cells (A.E.S.,unpublished), it is likely that the (þ )-strand hair-pin flanked by A-rich single-stranded sequencecomprises the movement enhancer. Since the com-position of the stems and loops of the hairpinsvaried considerably in size, sequence, and stability,it is possible that the function of the hairpin is tokeep the A-rich sequences single-stranded. Howthis structure and flanking sequence mightinfluence virion accumulation is not known.A specific packaging sequence that folds into ahairpin near the 30 end of the CP coding regionhas been identified as the assembly initiation sitefor the TCV capsid.52 However, there are noobvious sequence interactions between the M1Hregion and this packaging signal. Interestingly,TCV genomic RNA contains a (þ )-strand hairpin(H4), also flanked by A-rich sequences, which issimilar to the (þ )-strand M1H in both structureand proximity to 30 end of the RNA (Figure 5).The 30 base of TCV H4 is the 30 recombination junc-tion site of satC, and thus this sequence, and theA-rich downstream region, comprises the 30 baseand flanking sequences of the (þ )-strand M1H(Figure 5, boxed). The A-rich sequence at the 50

side of H4 is unrelated to the A-rich sequence atthe 50 side of the M1H. Hairpin 4 and its flankingsequences are highly conserved in the related Car-movirus, Cardamine Chlorotic Fleck Virus, differingonly by a single change in the loop and a C:G toG:C reversal in the stem. We are currently deter-mining if the U-rich sequence in the H4 loop inter-acts with the A-rich sequence at the base of thehairpin and if this interaction is disrupted by thepresence of similar A-rich sequences in satC.

In conclusion, our results indicate that a singleregion of satC has evolved to both enhance replica-tion and interfere with virion formation. Whilemultifunctional proteins are well known to existfor viruses,53 multifunctional RNA sequences areonly beginning to be defined. The 250 base inter-genic region in RNA 3 of Brome Mosaic Virus is thesubgenomic promoter in (2 )-strands and on (þ )-strands is involved in membrane sequestrationmediated by the 1a protein.16 The (2 )-strand

complement of the internal ribosome entry site(IRES) of hepatitis C virus is involved in mRNAtranscription, viral replication and binding to thehepatitis C RdRp.54 A second multifunctionsequence in satC also exists. The 50PE on satC (2 )-strands is important for complementary strandsynthesis in the absence of the 30PE in vitro2 andcomprises part of a stem on a (þ )-strand hairpinthat is critical for virus replication (J. Zhang,R. Stuntz and A.E.S., unpublished). The low prob-ability of a series of recombination/alterationevents occurring necessary to produce the multi-functional replication and movement enhancer ofsatC is reflected in our 12 year inability to detectany other recombinant satRNA capable of amplifi-cation to detectable levels in TCV-infected cellseven though recombination events between satDand TCV, similar to those that created satC, occurat high frequency in infected cells.41,55

Materials and Methods

In vivo genetic selection using 28-base M1Hreplacement sequences

In vivo genetic selection was performed asdescribed.26,27 To generate a population of full-lengthsatC containing randomized bases in positions 181 to208, two separate PCR were carried out using pT7C þ ,a full-length cDNA clone of wt satC. To generate thesatC 50 fragment, primers T7C50 (50-GTAATACGACTCACTATAGGGATAACTAAGGG-30), which contains a T7polymerase promoter at the 50 end, and SEL50 (50-GACTGGATCCTTTTGAGTGGGAAACAG-30) were used. Forgenerating the 30 fragment containing the M1H random-ized bases, SEL30 (50-GACTGGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAAAAACGGCGGCAGCACC-30) and oligo7 (50-GGGCAGGCCCCCCGTCCGA-30) were used. These two PCR were designed togenerate a new Bam HI site in the satC cDNA by creatinga U to C alteration at position 176 of satC. This new sitewas required to link the two fragments to avoid cloningand thus reduction of the complexity of the population.Both the 50 and 30 PCR fragments were digested withBam HI, purified through an agarose gel and then ligated.SatC transcripts were directly synthesized from theligated product using T7 RNA polymerase and 5 mgused to inoculate each of 19 turnip seedlings along with2 mg/plant of TCV transcripts. Total RNA was extractedfrom uninoculated leaves at 21 days post-inoculation.SatC accumulating in plants was amplified by RT-PCRusing primers T7C50 and oligo7, cloned into the Sma Isite of pUC19, and then sequenced. For the secondround selection, equal amounts of transcripts from allcloned first round winners were combined and used toinoculate six turnip seedlings. Total RNA was extractedat 21 days post-inoculation and satC cloned as describedabove.

Fitness of second round 28-base SELEX winners toaccumulate in plants

To compare fitness of the second round winners toaccumulate in turnip, transcripts of SELEX winnerswere synthesized by T7 RNA polymerase and equalamounts of transcripts from two or three winners


combined and inoculated onto three turnip seedlings(0.2 mg/plant) together with TCV transcripts (2 mg/plant). Total RNA was extracted at 21 days post-inocu-lation and satC cloned and sequenced as describedabove.

Protoplast inoculations and RNA gel-blot analysis

Protoplasts were prepared from callus cultures ofA. thaliana ecotype Col-0, as described.56 Protoplasts(5 £ 106) were inoculated with 20 mg of TCV genomicRNA transcripts and 2 mg of transcripts of various satCconstructs using polyethelene glycol as described.56

Equal amounts of total RNA isolated from protoplastsat various times post-inoculation were used for RNAgel-blot analysis of TCV and satC.22 Oligo13 (50-AAAGAGCACTAGTTTTCCAG-30), which is complementary topositions 3950–3970 of TCV genomic RNA and positions250–269 of satC, was labeled with [g-32P]ATP using T4polynucleotide kinase and used as the probe. SatC withnon-selected random sequences replacing the M1H con-tained the following replacement sequences: R28a,30GUAUAGAACUUACAUCCUUCCCUAUUAU50; R28b,30AAAUAGCACGGAGACCAUCCCCCAAUAA50; R10,30AUGUUAUUAG50.

Stability of satC with different 28-base M1Hreplacement sequences

Sat-RNA stability in protoplasts was determined asdescribed.29 Briefly, protoplasts were inoculated withsatC in the absence of TCV and levels at one to sixhours post-inoculation determined by RNA gel blotsafter treatment of cells with RNase A to remove anyunabsorbed satC transcripts. The probe was [a-32P]UTP-labeled (2)-strands of satC transcribed by T7 RNA poly-merase from Dra I-linearized pT7C(2), which containsfull-length satC cDNA downstream of a T7 RNApromoter.57

Virion isolation and Western blots

Virus particles were isolated from infected protoplastsand analyzed as described.52 At 40 hours post-inocu-lation with TCV and various satRNA, protoplasts(2.5 £ 106) were collected and resuspended in 200 ml of0.2 M sodium acetate (pH 5.2). Sterile glass beads (30 ml,0.1 mm diameter, Biospec Products, Inc.) in the samebuffer were added, and the mixture was vortexed. Theaqueous phase was recovered after brief microcentrifu-gation, and the solid phase was re-extracted twice. Theaqueous phases were combined and incubated on icefor 60 minutes followed by centrifugation to remove celldebris. Virions were precipitated by addition of 0.25 vol.of 40% polyethlene glycol (Mr 8000)/1 M NaCl,incubated overnight on ice, and then collected by micro-centrifugation. Pelleted virions were dissolved in 15 mlof 0.01 M sodium acetate (pH 5.5), and analyzed byelectrophoresis through 1% (w/v) agarose gels in50 mM Tris–base/38 mM glycine (pH 8.3). Followingelectrophoresis, gels were soaked in 50 mM sodiumhydroxide for 20 minutes and then transferred to 0.2 Msodium acetate (pH 5.5), for 20 minutes. Disruptedvirions were blotted to NitroPlus membranes (MicronSeparations Inc.) and probed with a polyclonal anti-serum raised against TCV coat protein. Chemilumines-cent staining was performed with the Western Lighting

Chemiluminescence Reagent kit (Perkin Elmer LifeSciences).

Acknowledgements

This work was supported by grants from the USPublic Health Service (GM61515-01) and theNational Science Foundation (MCB-0096274 andMCB-0086952) to A.E.S.

References

1. Lai, M. M. C. (1998). Cellular factors in the transcrip-tion and replication of viral RNA genomes: a parallelto DNA-dependent RNA transcription. Virology, 244,1–12.

2. Guan, H., Song, C. & Simon, A. E. (1997). RNA pro-moters located on (2 )-strands of a subviral RNAassociated with turnip crinkle virus. RNA, 3,1401–1412.

3. Koev, G. & Miller, W. A. (2000). A positive-strandRNA virus with three very different subgenomicRNA promoters. J. Virol. 74, 5988–5996.

4. Blight, K. J. & Rice, C. M. (1997). Secondary structuredetermination of the conserved 98-base sequence atthe 30 terminus of hepatitis C virus genome RNA.J. Virol. 71, 7345–7352.

5. Dreher, T. W. (1999). Functions of the 30-untranslatedregions of positive strand RNA viral genomes.Annu. Rev. Phytopathol. 37, 151–174.

6. Kao, C. C., Singh, P. & Ecker, D. J. (2001). De novoinitiation of viral RNA-dependent RNA synthesis.Virology, 287, 251–260.

7. Koev, G., Liu, S. J., Beckett, R. & Miller, W. A. (2002).The 30-terminal structure required for replication ofBarley yellow dwarf virus RNA contains anembedded 30 end. Virology, 292, 114–126.

8. Wu, B., Vanti, W. B. & White, K. A. (2001). An RNAdomain within the 50 untranslated region of theTomato bushy stunt virus genome modulates viralRNA replication. J. Mol. Biol. 305, 741–756.

9. Todd, S., Towner, J. S., Brown, D. M. & Semler, B. L.(1997). Replication-competent picornaviruses withcomplete genomic RNA 30 non-coding regiondeletions. J. Virol. 71, 8868–8874.

10. Ray, D. & White, K. A. (1999). Enhancer-like proper-ties of an RNA element that modulates tombusvirusRNA accumulation. Virology, 256, 162–171.

11. Haldeman-Cahill, R., Daros, J-A. & Carrington, J. C.(1998). Secondary structures in the capsid proteincoding sequence and 30 nontranslated regioninvolved in amplification of the tobacco etch virusgenome. J. Virol. 72, 4072–4079.

12. Sullivan, M. L. & Ahlquist, P. (1999). A brome mosaicvirus intergenic RNA3 replication signal functionswith viral replication protein 1a to dramaticallystabilize RNA in vivo. J. Virol. 73, 2622–2632.

13. Paul, A. V., Rieder, E., Kim, D. W., van Boom, J. H. &Winner, E. (2000). Identification of an RNA hairpin inpoliovirus RNA that serves as the primary templatein the in vitro uridylylation of VPg. J. Virol. 74,10359–10370.

14. Rieder, E., Paul, A. V., Kim, D. W., van Boom, J. H. &Winner, E. (2000). Genetic and biochemical studies ofpoliovirus cis-acting replication element cre in


relation to VPg uridylylation. J. Virol. 74,10371–10380.

15. Quadt, R., Ishikawa, M., Janda, M. & Ahlquist, P.(1995). Formation of brome mosaic virus RNA-dependent RNA polymerase in yeast requirescoexpression of viral proteins and viral RNA. Proc.Natl Acad. Sci. USA, 92, 4892–4896.

16. Schwartz, M., Chen, J. B., Janda, M., Sullivan, M.,den Boon, J. & Ahlquist, P. (2002). A positive-strandRNA virus replication complex parallels form andfunction of retrovirus capsids. Mol. Cell, 9, 505–514.

17. Simon, A. E. (1999). Replication, recombination, andsymptom-modulation properties of the satelliteRNAs of turnip crinkle virus. Cur. Top. Microbiol.Immunol. 239, 19–36.

18. Carrington, J. C., Heaton, L. A., Zuidema, D.,Hillman, B. I. & Morris, T. J. (1989). The genomestructure of Turnip crinkle virus. Virology, 170,219–226.

19. Hacker, D. L., Petty, I. T. D., Wei, N. & Morris, T. J.(1992). Turnip crinkle virus genes required for RNAreplication and virus movement. Virology, 186, 1–8.

20. Oh, J.-W., Kong, Q., Song, C., Carpenter, C. D. &Simon, A. E. (1995). Open reading frames of turnipcrinkle virus involved in satellite symptomexpression and incompatibility with Arabidopsisthaliana ecotype Dijon. Mol. Plant-Microbe Interact. 8,979–987.

21. Li, W. Z., Qu, F. & Morris, T. J. (1998). Cell-to-cellmovement of turnip crinkle virus is controlled bytwo small open reading frames that function intrans. Virology, 244, 405–416.

22. Wang, J. & Simon, A. E. (1997). Analysis of the twosubgenomic RNA promoters for turnip crinkle virusin vivo and in vitro. Virology, 232, 174–186.

23. Wang, J. & Simon, A. E. (1999). Symptom attenuationby a satellite RNA in vivo is dependent on reducedlevels of virus coat protein. Virology, 259, 234–245.

24. Song, C. & Simon, A. E. (1995). Requirement of a30-terminal stem-loop in in vitro transcription by anRNA-dependent RNA polymerase. J. Mol. Biol, 254,6–14.

25. Stupina, V. & Simon, A. E. (1997). Analysis in vivo ofturnip crinkle virus satellite RNA C variants withmutations in the 30 terminal minus strand promoter.Virology, 238, 470–477.

26. Carpenter, C. D. & Simon, A. E. (1998). Analysis ofsequences and putative structures required for viralsatellite RNA accumulation by in vivo geneticselection. Nucl. Acids Res. 26, 2426–2432.

27. Guan, H., Carpenter, C. D. & Simon, A. E. (2000).Analysis of cis-acting sequences involved in plus-strand synthesis of a TCV-associated satellite RNAidentifies a new carmovirus replication element.Virology, 268, 345–354.

28. Guan, H., Carpenter, C. D. & Simon, A. E. (2000).Requirement of a 50-proximal linear sequence onminus strands for plus-strand synthesis of a satelliteRNA associated with TCV. Virology, 268, 355–363.

29. Nagy, P. D., Pogany, J. & Simon, A. E. (1999). RNAelements required for RNA recombination functionas replication enhancers in vitro and in vivo in a plusstrand RNA virus. EMBO J. 18, 5653–5665.

30. Nagy, P. D., Pogany, J. & Simon, A. E. (2001). In vivoand in vitro characterization of an RNA replicationenhancer in a satellite RNA associated with Turnipcrinkle virus: comparison of sequences and struc-tures stimulating primer-dependent and primer-independent RNA synthesis. Virology, 288, 315–324.

31. Cascone, P. J., Haydar, T. & Simon, A. E. (1993).Sequences and structures required for RNA recombi-nation between virus-associated RNAs. Science, 260,801–805.

32. Nagy, P. D. & Simon, A. E. (1998). in vitro characteriz-ation of late steps of RNA recombination in turnipcrinkle virus I: role of the motif1-hairpin structure.Virology, 249, 379–392.

33. Nagy, P. D., Zhang, C., Simon, A. E. & Dissecting,R. N. A. (1998). recombination in vitro: role of RNAsequences and the viral replicase. EMBO J. 17,2392–2403.

34. Rajendran, D. S., Pogany, J. & Nagy, P. D. (2002).Comparison of Turnip crinkle virus RNA-dependentRNA polymerase preparations expressed inEscherichia coli of derived from infected plants.J. Virol. 76, 1707–1717.

35. Cascone, P. J. (1992). RNA recombination in theTurnip crinkle virus system: an analysis of sequencesand structures required for RNA recombination. PhDThesis, University of Massachusetts.

36. Wilson, D. S. & Szostak, J. W. (1999). In vitro selectionof functional nucleic acids. Annu. Rev. Biochem. 68,611–647.

37. Tian, H. H., Kole, R. & Strong, R. N. A. (2001).splicing enhancers identified by a modified methodof cycled selection interact with SR protein. J. Biol.Chem. 276, 33833–33839.

38. Schaal, T. D. & Maniatis, T. (1999). Selection andcharacterization of pre-mRNA splicing enhancers:identification of novel SR protein-specific enhancersequences. Mol. Cell. Biol. 19, 1705–1719.

39. Lund, M. & Kjems, J. (2002). Defining a 50 splice siteby functional selection in the presence and absenceof U1 snRNA 50 end. RNA, 8, 166–179.

40. Li, X. H. & Simon, A. E. (1990). Symptom intensifica-tion on cruciferous hosts by the virulent sat-RNA ofturnip crinkle virus. Phytopathology, 80, 238–242.

41. Carpenter, C. D., Oh, J.-W., Zhang, C. & Simon, A. E.(1995). Involvement of a stem-loop structure in thelocation of junction sites in viral RNA recombination.J. Mol. Biol. 245, 608–622.

42. Carpenter, C. D., Cascone, P. J. & Simon, A. E. (1991).Formation of multimers of linear satellite RNAs.Virology, 183, 586–594.

43. Li, X. H. & Simon, A. E. (1991). In vivo accumulationof a turnip crinkle virus DI RNA is affected by altera-tions in size and sequence. J. Virol. 65, 4582–4590.

44. Zhang, C. & Simon, A. E. (1994). Effect of templatesize on replication of defective interfering RNAs.J. Virol. 68, 8466–8469.

45. Mathews, D. H., Sabina, J., Zuker, M. & Turner, D. H.(1999). Expanded sequence dependence of thermo-dynamic parameters improves prediction of RNAsecondary structure. J. Mol. Biol. 288, 911–940.

46. Song, C. (1995). In vitro study of RNA replicationusing isolated viral RNA-dependent RNA polymer-ase. PhD Thesis, University of Massachusetts.

47. Hertel, K. J., Lynch, K. W. & Maniatis, T. (1997). Com-mon themes in the function of transcription andsplicing enhancers. Curr. Opin. Cell Biol. 9, 350–357.

48. Cascone, P. J., Carpenter, C. D., Li, X. H. & Simon,A. E. (1990). Recombination between satellite RNAsof turnip crinkle virus. EMBO J. 9, 1709–1715.

49. Simon, A. E. & Howell, S. H. (1986). The virulentsatellite RNA of turnip crinkle virus has a majordomain homologous to the 30-end of the helpervirus genome. EMBO J. 5, 3423–3428.


50. Tacke, R. & Manley, J. L. (1999). Determinants of SRprotein specificity. Curr. Opin. Cell Biol. 11, 358–362.

51. Song, C. & Simon, A. E. (1995). Synthesis of novelproducts in vitro by an RNA-dependent RNA poly-merase. J. Virol. 69, 4020–4028.

52. Qu, F. & Morris, T. J. (1997). Encapsidation of turnipcrinkle virus is defined by a specific packaging signaland RNA size. J. Virol. 71, 1428–1435.

53. Callaway, A., Giesman-Cookmeyer, D., Gillock, E. T.,Sit, T. L. & Lommel, S. A. (2001). The multifunctionalcapsid proteins of plant RNA viruses. Annu. Rev.Phytopathol. 39, 419–460.

54. Kashiwagi, T., Hara, K., Kohara, M., Iwahashi, J.,Hamada, N., Honda-Yoshino, H. & Toyoda, T.(2002). Promoter/origin structure of the complemen-

tary strand of Hepatitis C virus genome. J. Biol.Chem. 277, 28700–28705.

55. Zhang, C., Cascone, P. J. & Simon, A. E. (1991).Recombination between satellite and genomic RNAsof turnip crinkle virus. Virology, 184, 791–794.

56. Kong, Q., Wang, J. & Simon, A. E. (1997). SatelliteRNA-mediated resistance to turnip crinkle virus inArabidopsis involves a reduction in virus movement.Plant Cell, 9, 2051–2063.

57. Song, C. & Simon, A. E. (1994). RNA-dependentRNA polymerase from plants infected with turnipcrinkle virus can transcribe (þ )- and (2 )-strands ofvirus-associated RNAs. Proc. Natl Acad Sci. USA, 91,8792–8796.

Edited by N.-H. Chua

(Received 11 September 2002; received in revised form 20 November 2002; accepted 22 November 2002)


A Multifunctional Turnip Crinkle Virus Replication Enhancer

Documents

Transcript of A Multifunctional Turnip Crinkle Virus Replication Enhancer