A MATCH OF INTELLECT AND SPIRIT: An Interview with Richard … · 2015-06-29 · PAGE 2 TROUBADOUR...

VVVVVOL. XVII, NOOL. XVII, NOOL. XVII, NOOL. XVII, NOOL. XVII, NO. 1. 1. 1. 1. 1OCTOCTOCTOCTOCTOBER 2008OBER 2008OBER 2008OBER 2008OBER 2008

EASTERN DIVISIONIS GOING GREEN!

The December 2008 issue of Troubadour will be the final printed issue. In addition, it will also beposted in its entirety on the division website at http:\\www.acdaeast.org. Beginning with the April2009 issue, Troubadour will be available on the website only. You will receive a postcard in themail, notifying you of the posting. Please assist us by notifying webmaster Rick Lueth [email protected] - of any changes in your e-mail address, as this will be vital in maintain-ing contact with you.

HELP US GO GREEN!

Richard M. Coffey has reason to celebrate. Not only is Coffey aboutto begin his 34th year as conductor of the Connecticut Choral Artists(CONCORA), the professional choir that he founded in 1974, he is alsocelebrating his fourth year as music director of the Hartford Chorale,

and his 36th year as Minister of Music at South Congregational-First Baptist Church (SouthChurch) in New Britain, Connecticut. His peers in the community are celebrating as well: theNew Britain Arts Council recently awarded Coffey its Lifetime Achievement Award for his contributions to the arts, andthe Hartford Symphony Orchestra presented him with a “Major Achievement” award for his choral work with theorganization. Keith Burris of the Manchester (CT) Journal Inquirer says that Coffey is a musician “whose intellect and spirit areevenly matched and who exists to serve the music.” Those who make music with Rick Coffey are aware of his deepspiritual commitment and his attention to detail in his personal preparations and in the music itself.

A MATCH OF INTELLECT AND SPIRIT:An Interview with Richard M. Coffey

Part Iby Nathan Zullinger

NZ: Tell me about the musical influences you had when you were growing up in North Carolina.RC: I think that the strongest influence would be the church . . . and by “the church” I mean the English Street BaptistChurch in High Point, North Carolina. I became the organist when I was twelve years old and was paid $10 a week.The church was really the heart of our family, and I was in church three, actually four, times a week. This includedSunday morning, Sunday night, Wednesday night “prayer meeting,” and then choir rehearsal or a youth activity. I wasstrongly impacted by the music there, by the whole thing of singing (which was accompanied by a Hammond organ). Iloved going to church. Maybe it was genetic, as both of my sisters are musicians, and both still have jobs in thechurch. On Sunday afternoons during my early teens, my parents and I drove 40 miles to be with the older sister andher family. As a church music director, she had a stack of anthems on her piano, and we would play and sing anthems.This was in the rural South, and there were anthems! We sang pieces by Luboff and Christiansen, also Jennings’“Springs in the Desert” (I still perform that piece at South Church). My sister’s collection was definitely high-level. Ithought that it was the greatest collection of music I had ever seen.

Richard CoffeyNathan Zullinger

- continued on pg. 8 -

PAGE 2PAGE 2PAGE 2PAGE 2 TROUBADOUR OcTOBER 2008

IN THIS ISSUEARTICLES 1 A Match of Intellect and Spirit:

An Interview with Richard M. CoffeyPart INathan Zullinger

3 Between You and MeLynn E. Drafall

6 Vocal Jazz: A Look BackSheryl Monkelien

7 Mid-summer’s Days’ DreamsKenneth Steele

16 Report on the IFCM 8thWorld SymposiumThomas Lloyd

16 Music and Movement?Lisa Larsen

ADDITIONAL FEATURES 4 Constant Contact 10 Division Shout-Out! 11 Welcome New R&S Chairs 12 A Taste of the 2010 Convention

REGULAR FEATURES 5 Eastern Division Board 7 Directory of Advertisers 14 Welcome New Members 23 Repertoire & Standards Chairs

CONGRACONGRACONGRACONGRACONGRATULATULATULATULATULATIONS TTIONS TTIONS TTIONS TTIONS TOOOOOEASTERN DIVISION MEMBERS WHO AREEASTERN DIVISION MEMBERS WHO AREEASTERN DIVISION MEMBERS WHO AREEASTERN DIVISION MEMBERS WHO AREEASTERN DIVISION MEMBERS WHO ARE

INVOLINVOLINVOLINVOLINVOLVED WITH THE NVED WITH THE NVED WITH THE NVED WITH THE NVED WITH THE NAAAAATIONTIONTIONTIONTIONAL CONVENTION!AL CONVENTION!AL CONVENTION!AL CONVENTION!AL CONVENTION!

MMMMMARARARARARCH 4-7, 2009CH 4-7, 2009CH 4-7, 2009CH 4-7, 2009CH 4-7, 2009OOOOOKLKLKLKLKLAHAHAHAHAHOOOOOMMMMMA CITA CITA CITA CITA CITYYYYY, O, O, O, O, OKKKKK

Anne Howard Jones,Anne Howard Jones,Anne Howard Jones,Anne Howard Jones,Anne Howard Jones,Conductor of the Convention Concert featuring the

2009 Brock commission by Dominick Argento and theVaughan Williams Dona Nobis Pacem

Christine Bass,Christine Bass,Christine Bass,Christine Bass,Christine Bass,Conductor of the Senior High School Honor Choir

Registration opens Sept. 22!

OcTOBER 2008 TROUBADOUR PAGE 3PAGE 3PAGE 3PAGE 3PAGE 3

WWWWWhereashereashereashereashereas,,,,, the Human spirit is elevated to a broader understanding of itselfthrough the study and performance in the aesthetic arts, andWWWWWhereashereashereashereashereas,,,,, serious cutbacks in funding and support have steadily eroded stateinstitutions and their programs throughout our country,Be it resolvedBe it resolvedBe it resolvedBe it resolvedBe it resolved that all citizens of the United States actively voice theiraffirmative and collective support for necessary funding at the local, state, andnational levels of education and government, to ensure the survival of artsprograms.

“Sail, sail thy best, ship of Democracy. Of value is thyfreight.” Ah, those inspiring words by Walt Whitman comeback to me often during this election season. Two capablecandidates vying for the opportunity to lead our nationforward, the debate of ideas and ideals put forth on aninternational stage for all to see and hear. How uplifting! Ofcourse, we have to endure the endless campaign rhetoric andinterminable negative advertisements too… But Whitman’spoetry always inspires me to think beyond the mundane andto consider “the big thought.”

I first learned this text many years agowhile performing Howard Hanson’sstirring choral tribute to education, Song ofDemocracy (1957). In this composition,Hanson combined specific lines ofWhitman’s poem “Thou Mother with ThyEqual Brood” (part four) with anotherWhitman poem titled “An Old Man’sThought of School.” Combining these two works, Hansonsubtly redefined Whitman’s ship of demo-cracy to denoteour American education system, referring to the learners as“these stores of mystic meaning… building, equipping like afleet of ships, immortal ships, soon to sail out over themeasureless seas on the soul’s voyage.”

Now, there’s another “big thought”, eh? Every time wewalk into a rehearsal or a music class, we’re equipping im-mortal ships to set forth on their souls’ voyage! As we standin front of our choir members and students, whether they arenine or ninety years old, we guide them to set sail on theirown musical journeys, and it is our responsibility to equipthem with what they will need along the way.

What do they need? “…’Tis not the Present only, the Pastis also stored in thee.” The fleet of ships that sit in our

BETWEEN YOUAND ME

by Lynn E. DrafallDivision President

choral rehearsals each day represents the future of choralmusic. While leading them forward, however, we know thatlearning about and being inspired by the past is crucial totheir success. It is part of their needed equipment. Further-more, we as their leaders can also never forget that we wereset on own musical voyages by our mentors and others whocame before us. (Ah, another “big thought” worthpondering…)

Our ships also need to know the full extent of themeasureless seas to be explored. “Thou holdest not theventure of thyself alone, not of the Western continent alone.Earth’s resume entire floats on thy keel...” In addition toequipping our singers with knowledge of the past, present,and future, we also bear the responsibility to guide theirmusical journey with knowledge and care for all the musicof all the world, both instrumental and vocal. Even ouryoungest and smallest can set sail while embracing andexperiencing music of every time period and culture. The

voya-ges of their souls will be richer for it.

“Steer then with good strong hand andwary eye O helmsman!” Yes, our respon-sibilities to the music and to our singersare sobering and cannot be taken lightly.We need the good strong hands and waryeyes of true leaders. Granted, it issometimes easy to be washed overboardby that responsibility! But, remember that

we are capable captains of our ships as individuals and evenstronger with the fleet of ACDA colleagues at our sides.Together - with courage, knowledge of our art, and a largedose of humility and humanity - we can steer confidentlyforth.

So, “sail, sail thy best…of value is thy freight.” And,while you are on this year’s musical voyage and in need ofinspiration, remember to think “the big thought!”

The complete texts of “Thou Mother with Thy Equal Brood”(Leaves of Grass, 1881-1882) and “An Old Man’s Thought ofSchool” (Two Rivulets, 1876) may be found atwww.whitmanarchive.org. Howard Hanson’s Song of Democracy(mixed choir and piano) is published by Carl Fischer.

TTTTTo reo reo reo reo reaaaaaccccch a port,h a port,h a port,h a port,h a port,we mwe mwe mwe mwe must sail -ust sail -ust sail -ust sail -ust sail -

sailsailsailsailsail, n, n, n, n, not tiot tiot tiot tiot tie at ane at ane at ane at ane at anccccchhhhhor -or -or -or -or -sailsailsailsailsail, n, n, n, n, not drot drot drot drot driftiftiftiftift.....

Franklin D. Roosevelt

Lynn Drafall is the Director of Cho-ral Activities at The PennsylvaniaState University. She teaches coursesin graduate and undergraduate cho-ral conducting and literature, andconducts the Penn State ConcertChoir as well as the Oriana Singers.An active festival conductor and ad-judicator, she has worked with fes-tival choirs throughout the mid-Westand mid-Atlantic, and has conductedAll-State HS choirs in Illinois, Penn-sylvania, West Virginia, New Jersey,and Maryland.

ACDA ADVACDA ADVACDA ADVACDA ADVACDA ADVOCOCOCOCOCACY RESOLACY RESOLACY RESOLACY RESOLACY RESOLUTIONUTIONUTIONUTIONUTION

EASEASEASEASEASTERN DIVISTERN DIVISTERN DIVISTERN DIVISTERN DIVISIOIOIOIOION BON BON BON BON BOARDARDARDARDARD

PAGE 4PAGE 4PAGE 4PAGE 4PAGE 4 TROUBADOUR OcTOBER 2008

SEEKING MINISTER OF MUSIC

COMMUNITY UNITED METHODIST CHURCH, Massapequa, N.Y. seeks an experienced, talented, creative leader as part-time Minister of Music (Choir Director/ Organist/Pianist) for a

sizeable and growing congregation and music program. Compensation commensurate with experience and ability. Full position description available at www.cumcmassapequa.org or by

calling (516) 541-7008. E-mail resume (with references) to [email protected], attention Jennifer Esposito and call to schedule an interview.

GGGGGet the Laet the Laet the Laet the Laet the Latest — Stay Itest — Stay Itest — Stay Itest — Stay Itest — Stay Infnfnfnfnfororororormed —med —med —med —med —SSSSSavavavavave Eastere Eastere Eastere Eastere Eastern Dn Dn Dn Dn Diiiiivision $$$!vision $$$!vision $$$!vision $$$!vision $$$!

YYYYYour help is essential. Please act nour help is essential. Please act nour help is essential. Please act nour help is essential. Please act nour help is essential. Please act nooooowwwww!!!!!

Sign up now to receive safe and secure e-mail notification of important,new, and exciting Division activities. It’s easy and quick.

1. Go to www.acdaeast.org.2. On the top right enter your Email address.3. Click GO.

Done! You will receive a Constant ContactConstant ContactConstant ContactConstant ContactConstant Contact message verifying youraddress and allowing you to update your profile.

Constant Contact Constant Contact Constant Contact Constant Contact Constant Contact is a safe and secure e-mail provider. Your addressis NOT provided to any second parties. Each message provides you with theoption to unsubscribe at any time.

You will receive important notifications of Eastern Division ACDA events,updates on the website, and links to valuable information for Choral Directors.In addition, by subscribing you help Eastern Division save its financialresources so that it can provide you with even more and better services. Thisis an easy way to have a major impact on Eastern Division ACDA.

Please APlease APlease APlease APlease ATTTTTTTTTTAAAAACCCCCCCCCCA!A!A!A!A!

ACDA MembersSAVE 20%

Our Notes To Success:

(800) 932-0824 • Fax: (856) [email protected]

www.musictime.com

Nation’s LargestInventory Of PrintMusic Titles

Fast & EfficientSpecial OrderService

All In Stock ItemsShipped Within 24Hours Via UPS

Visa, Mastercard,Discover &American Express

Experienced StaffTo Handle SchoolPurchase Orders

Free MusicCatalogs!

President: Lynn E. Drafall106 Music Bldg. I,Pennsylvania State Univ.University Park, PA 16802(814) 863-4219 [email protected]

Vice-President: Brent F. Miller13 Cambridge Dr.Annandale, NJ 08801(908) 735-4429 [email protected]

President-Elect: Robert Eaton146 Stiles Road,Boylston, MA 01505-1504(508) 869-0438 [email protected]

Division Secretary: Heather Flora109 Cambria Hill DriveTarentum, PA 15084(724) [email protected]

Treasurer: Lonnie Arnold796 The CircleLewiston, NY 14092-2031(716) 751-3934 [email protected]

Newsletter Editor: Judith Nicosia13 Fisher DriveFranklin Park, NJ 08823-1344(732) 932-8462 [email protected]

Website: Rick Lueth8 Irving DriveWalpole, MA 02081-2430(508) 668-7931 [email protected]

Ad Solicitation: Sue Fay Allen11520 Howe Rd.Akron, NY 14001(716) [email protected]

State Liaison: Craig Cannon1551 Powers Run RoadPittsburgh, PA 15238-2410(412) [email protected]

Newsletter Billing: Jeffery Thyer P.O. Box 2720, Oklahoma City, OK 73101-2720 (405) 232-8161 ext. 203 [email protected]

From the early days of jazz, the voice has been one of itsprimary instruments. Singers Bessie Smith, Billie Holliday,Ella Fitzgerald, Sarah Vaughn, Billy Eckstine, BingCrosby and countless others were pioneers in vocal jazz.Vocal groups the Boswell Sisters, the Mills Brothers, andthe Rhythm Boys (Bing Crosby’s first group) were influentialto singers and ensembles that came after them. ResearchersJan Shapiro and David Thorne Scott have both written aboutthe innovative style and scope of influence of the BoswellSisters, and have considered them one of the first vocal jazzensembles.

Other groups that shaped the evolution of vocal jazz in-clude the Modernaires, the Pied Pipers, the Mel-Tones, andthe Andrews Sisters. These groups fronted top big bandsduring the Swing era, including the Dorsey Brothers, GlennMiller, and Benny Goodman. The harmonic and rhythmicelements of jazz that were central to the success of vocaljazz ensembles became more sophisticated and innovativewith each decade.

During the 1950s, the popularity of vocal groups was atits highest. The Hi-Lo’s with their complex and uniquearrangements (by Gene Puerling) of a wide variety of musi-cal styles, and the Four Freshmen, one of the most influentialclose-harmony groups of the decade, continued the evolutionof the vocal jazz ensemble with their individual styles. In thelate 50s, Lambert, Hendricks & Ross turned back to theroots of instrumental jazz and sang jazz classics in a be-bopstyle, with only a combo as accompaniment. Their creativeand skillful improvisation, along with cleverly written lyricsto classic jazz instrumental solos, has influenced many oftoday’s jazz singers and vocal jazz ensembles.

Another innovator of the 1960s was Ward Swingle. HisSwingle Singers sang note for note out of Bach’s Well-Tem-pered Clavier and Swingle was surprised by how easily Bachcould swing. Their 1964 recording Jazz Sebastian Bach wasa breakthrough and showed that almost any genre could beperformed in jazz style by a vocal group. The Singers Un-limited epitomizes the best in intricate harmonies, vocalblend and color, and expression of the lyric. Their fourteenalbums, recorded during the 1970s, have been released as aCD set called Magic Voices. The title perfectly describes whatthe listener will experience – pure magic. And, we can’t for-get the Manhattan Transfer, probably the most popular


VOCAL JAZZ –A LOOK BACK

by Sheryl MonkelienVocal Jazz R&S Chair

and versatile vocal jazz ensemble in America today.

Jazz, as popular music, has been around since the 1890s.But jazz in an educational setting began in the late 1940swhen a few pioneering colleges and high schools started jazzdance bands. It was not until 1967 however, after the Tangle-wood Symposium Declaration called for the inclusion ofjazz as part of the music education curriculum, that jazzbegan to grow at a rapid rate. By 1979 it was estimated thatthere were more than 500,000 students in jazz-relatedensembles across the country, and over 70 percent of middleand high schools had at least one instrumental jazz ensemble.The growth of vocal jazz ensembles has not been as steadyor as widespread.

The vocal jazz ensemble movement in an educationalsetting was initiated by three men whose unique talents,educational training, musical experiences, mutual supportsystems and friendships enabled them to conceive and imple-ment the first vocal jazz ensembles. Waldo King, HalMalcolm, and John Moawad are the recognized pioneersthat led the vocal jazz movement in Washington and Oregonin the early 1960s. Malcolm’s Mount Hood Jazz Choirperformed at the MENC National Convention in Anaheim,California in 1974. This was the first time a vocal jazz en-semble had performed in such an important venue. Theperformance brought national attention to the concept ofvocal jazz.

King, Malcolm, and Moawad influenced and nurtured asecond generation of vocal jazz proponents that includedFrank DeMiero, Ken Kraintz, Gene Aitken, and PhilMattson. This group of vocal jazz educators continued themovement by sharing their knowledge of vocal jazz throughworkshops, clinics, camps and festivals. Other innovatorsinclude Larry Lapin, who created the jazz vocal program atthe University of Miami, Paris Rutherford who will retirein 2009 after 30 years at University of North Texas, SteveZegree at Western Michigan University, and Kirby Shawwho has been writing great vocal jazz arrangements forevery age since the early 1970s.

There are many wonderful vocal jazz programs in middleand high schools and colleges and universities across thecountry. If you ask the director, who influence them and wherethey learned about vocal jazz, nine times out of ten, they willmention a person who attended a workshop or clinic givenby an educator who studied with one of the originators of thegenre.

Recordings and videos of vocal jazz performances arereadily available on YouTube, iTunes, and can be purchasedon CD. ALL of the mentioned “vintage” vocal jazz singersand ensembles are worth checking out. There are hundredsof vocal jazz ensembles – professional, community and



(866) 499-3799—toll free [email protected] www.CulturalTourConsultants.com

Tel. (269) 343-5667 Fax. (269) 343-3408

Creating interesting tour combinations is

our specialty and we are never short on

ideas.

2836 W. Main St. Kalamazoo, Michigan 49006 U.S.A.

It Starts With An Idea...

New Company, Old Friends.

I always begin to grouse in mid-July that summer “alwaysgoes by too quickly.” My sweet wife then reminds me thateveryday is “summer” for us, since we are retired! It’s notquite the same….

There are so many exciting things that are “in the works”I hardly know where to begin! My summer months havebeen filled with planning for the 2010 Eastern DivisionConvention in Philadelphia - yes, 2010! I want to make youaware of the main event for Music in Worship so that YOUmay feel the excitement and begin to ready your choristersfor their participation.

We are convening a Festival Chorus of two hundredsingers that is open to choirs of all congregations in ourdivision. Our clinician/conductor will be Craig Courtney,prominent composer, pianist and choral conductor. Heserves as staff composer and editor for Beckenhorst Press(www.beckenhorstpress.com). The details of the selection ofthe choir and the exact schedule of the day’s events are stillin the planning stage, but we want to get out the wordearly so that YOU and YOUR SINGERS can begin thinkingabout participating! The day will culminate in an ecumenicalhour of worship, replete with choral works, hymns of faith,brass, organ and piano! Please mark Friday, February 12,2010, in your long-range planning calendars! It will be amonumental and thrilling event, bringing us together in oneplace to worship one God!

After being in Oklahoma City in June, I am thrilled at theNew Vision that is coming to ACDA, under the leadership ofDr. Tim Sharp! If you have not read his articles in theChoral Journal, look back through recent issues to see hischallenges to us as professionals and as choral musicians.Paul Aitken, National Music in Worship Repertoire &Standards chair, has many wonderful things in store for thenational convention in March of 2009 in Oklahoma City.This event promises to be both rewarding and intimate, in acity that is “going all out” to welcome us to their greatfacilities, plentiful (and affordable!) restaurants and full-blown Southwestern hospitality! “Y’all come on, y’ hear?!”

Please contact me with any suggestions or commentsregarding Music in Worship. I want to hear from you at anytime, on any point. God’s peace.

MID-SUMMER DAYS’DREAMS

by Kenneth SteeleR&S ChairMusic in Worship

DDDDDirecirecirecirecirectttttooooorrrrry oy oy oy oy of Adverf Adverf Adverf Adverf Advertisertisertisertisertisersssss

Boston Singers Resource Pg. 2

Concept Tours Pg. 21

Cultural Tour Consultants Pg. 7

Delaware ACDA Pg. 20

Hawaii Music Festivals Pg. 15

Maryland State Boychoir Pg. 14

Massapequa United Methodist Church Pg. 4

MusicTime, Inc. Pg. 4

National Catholic Youth Choir Pg. 9

NJ-ACDA Pg. 17

SDG Press Pg. 21

The Musical Source Pg. 5

World Cultural Tours Back Cover

school – that produce recordings. Here are my suggestionsfor the groups of today:

1. The Real Group – the premier professionalgroup in the world; they write original tunesand arrangements and sing everything acappella. THEY WILL BE AT MANSFIELDUNIVERSITY IN PENNSYLVANIA FOR ARARE AMERICAN PERFORMANCE ONFEBRUARY 24, 2009.

2. Take 6 – their first CD is their best, greatgospel tunes again proving that vocal jazz canbe anything – six guys that can really sing!

3. Groove for Thought – six guys, some ofthem teachers by day, that sing some of themost creative and intricate arrangementsaround.

4. New York Voices – college friends fromIthaca, NY influenced by jazz, pop, Brazilianand R&B, which take the art form to a newlevel.

5. Voice Trek – three sisters and two guysmake up this group based in St. Paul, MN; theirnatural blend and warmth of sound are theirtrademarks. They sing great originalarrangements too!

In 1987 the United States Congress passed a resolutionwhich recognized jazz as “a rare and valuable national Ame-rican treasure to which we should devote our attention, sup-port and resources to make certain it is preserved, understood,and promulgated.” Vocal jazz is part of the American artform which has been nurtured and advanced by singers,vocal groups and educators for the past 75 years. It will takelearning from the past to ensure vocal jazz has the future itdeserves.

***Get your students interested and involved in vocaljazz: Encourage them (students in grades 10-college) toaudition for the 2010 Eastern Division ACDA Vocal JazzHonor Choir. Details will be on the division website:www.acdaeast.org

- continued from pg. 6 -



I also listened to the Mormon Tabernacle Choir onSundays. Have you ever heard the broadcasts? EverySunday. [Plays “Music and the Spoken Word” theme on thepiano]. I would hear the most beautiful things. I rememberhearing the next-to-last movement of Bach Cantata #4,Christ lag in Todesbanden. It’s that 6/8, soprano/tenor duet,but the whole choir sang, accompanied only by that greatorgan (they never had orchestra in those broadcasts). It justsent me up the wall. I’m not sure that Cantata #4 would havemade it into my repertory at age 15 were it not for theMormon Tabernacle Choir. Believe me, the whole householdhad to stop for those broadcasts. My brothers-in-law werethere - big, athletic dudes, wanting to watch the footballgames. But the sound had to be turned off on the footballgames while the Mormon Tabernacle Choir was on!

My parents gave me the famous Messiah recording - 2 LPs!- of the Mormon Tabernacle Choir and the PhiladelphiaOrchestra. I still love it. A college professor became my firstorgan teacher while I was in junior high school, and shewould take me to community concerts: Robert ShawChorale, Norman Luboff Choir, Pittsburgh Symphony. Iheard the Pittsburgh Symphony play the Tchaikovsky SixthSymphony. That sent me into a whole other world – ecstasy!Unless it was on the radio, orchestral music was generallyunknown to me. The only orchestra that had a radio show inour community was the Boston Pops, also on Sunday after-noons. We didn’t receive program guides in the mail; we hadto find things out on our own. I just loved those broadcasts,especially to hear the announcer say, “Mr. Fiedler is signal-ing for another encore!” It was classical musical entertain-ment at its best. I think that is one of the significant thingsfor me as I look back now.

NZ: Who were your mentors?RC: Robert Shaw, of course, and Alec Wyton, who was themusic director and organist at St. John the Divine in NewYork City for twenty years. Wyton was my principal teacherat Union Seminary. I should also name organist, recordingartist and teacher Marie-Claire Alain, who helped meunderstand why it’s important for musical performances tobe historically informed. But those two gentlemen (Shawand Wyton) were long-term influences. Two years with Alecand, over the course of ten years, a number of two-weekspurts of time with Shaw. As a teenager I was listening toand buying recordings of The Robert Shaw Chorale. Andwhile everyone else was buying the Beatles, I was buyingrecordings of the organ at St. John the Divine. I traded aBeatles album for that particular LP with my cousin. WhatAlec Wyton did for me – I hate the phrase “out of the box,”because I often love being in the box! – was to show meoutside of the box as to music in the church. Wyton helpedme see that music in worship could be way more than what I


Sheryl Monkelien is currently Associate Professor of MusicEducation at Mansfield University, in Pennsylvania. Sheteaches both undergraduate and graduate courses in musiceducation and directs the Mansfieldians- Vocal Jazz. Her vocaljazz ensembles have performed at numerous festivals, stateand regional conferences. The Mansfieldians won a gold medaland were named World Champions in the Jazz Vocal ACappella category during the 2008 World Choir Games inGraz, Austria


had thought, in terms of traditionalism. At the end of mysecond year of seminary studies, the Broadway musical Hairhad been running for only one year, and Wyton invited thecast to come to St. John the Divine and celebrate Mass fortheir first anniversary! Can you imagine that? I have a re-cording of the event; I was there. He said, “They’re going tosing their music here. Their music’s going to be part of theOrdinary and Propers of the Mass. The only thing differentfrom downtown is that they’re going to keep their clothes onin the cathedral.” It was spine-tingling. You couldn’t find aseat. That day, Alec’s vision changed my life. He would nothave said, “Let’s invite the cast of Hair and have them putthe show on at the cathedral.” Rather, it was, “Let’s have aEucharist, let’s have a service of thanksgiving for what thisdramatic cultural event has achieved.” And it worked!

NZ: Can you tell me how you had the opportunity towork with Shaw?RC: That’s thanks to Westminster Choir College. If for noother reason, that institution deserves praise for bringingShaw to the campus. I did not know that this opportunitywas even happening until he’d been there for six years.Thereafter I was with him most summers from 1978 to 1988.Those were significant times, to see this master at work.That is where I realized that I had been on the right trackabout needing to learn and teach music from the foundationup, from its nuts and bolts.

NZ: Critics have contended that this “nuts and bolts”approach may have caused some of Shaw’s interpretationsto be too controlled and lacking in spontaneity. What isyour opinion of that?RC: I would like to have any person who says such a thingcite for me the passage of music that they do not like and tosay why. There are many conductors and singers who reallydo not want to be bothered with in-depth learning of themusic. They hate count-singing, Shaw’s trademark teachingdevice. I once had a woman walk out of a CONCORAsummer workshop because of our use of count-singing. Isaw her recently, and she reminded me of that. I told her,“Well, it’s just as well that you left, because that’s how welearn. That’s how professionals and amateurs should learn,and that’s how my mentor taught me.” Many people simplydo not want to have to work that hard at mastering a musicalscore.

NZ: Tell me about the choral scene in the Hartford areawhen you came to town in 1972.RC: That was 35 years ago, and it astonishes me that somuch time has passed. The local scene consisted of a groupcalled the New Britain Chorale, which was large andamateur and very good. It was run by a local group calledthe Association of Church Musicians, a group that,unfortunately, no longer exists. In my second year at South

- continued from pg. 8 - Church I thought that our community needed a professionalchoir. The music series at the church, which I established atthe end my first year there, launched the South Church ChoralSociety, an auditioned and salaried ensemble. Nobody knewwhether it would take off or not, but I never embarked onanything that I was skittish about. Our first concert was theSchubert Mass in E-Flat Major, accompanied by organalone. In those days nobody thought twice about having alarge choral work accompanied by organ. And we made agreat splash — the impact of our first concert was profound.

Part II of “A Match of Intellect and Spirit” willPart II of “A Match of Intellect and Spirit” willPart II of “A Match of Intellect and Spirit” willPart II of “A Match of Intellect and Spirit” willPart II of “A Match of Intellect and Spirit” willappear in the December 2008 issue.appear in the December 2008 issue.appear in the December 2008 issue.appear in the December 2008 issue.appear in the December 2008 issue.

The National Catholic Youth Choir

Axel Theimer, conductor

Applications due March 31, 2009www.CatholicYouthChoir.org

Fr. Anthony Ruff, OSB(320) [email protected]

June 22-July 9, 2009

Catholics entering grades 10, 11, and 12 may apply.

Cost: $750--Scholarships Available!

Nathan Zullinger teaches at the University of RhodeIsland and serves as Music Director at the United Churchin Walpole, Massachusetts. He has earned degrees inconducting and music education from Boston Universityand Messiah College, respectively.

TTTTThere ahere ahere ahere ahere are two ware two ware two ware two ware two ways of exys of exys of exys of exys of exertingertingertingertingertingoneoneoneoneone’’’’’s strength;s strength;s strength;s strength;s strength;

One is pushing down.One is pushing down.One is pushing down.One is pushing down.One is pushing down.TTTTThe other is pulling up.he other is pulling up.he other is pulling up.he other is pulling up.he other is pulling up.

Booker TBooker TBooker TBooker TBooker T. W. W. W. W. Washingtonashingtonashingtonashingtonashington

DIVISION SHOUT-OUT!DIVISION SHOUT-OUT!DIVISION SHOUT-OUT!DIVISION SHOUT-OUT!DIVISION SHOUT-OUT!PAGE 10PAGE 10PAGE 10PAGE 10PAGE 10 TROUBADOUR OcTOBER 2008

Pennsylvania is proud toshare its list of activities.Won’t you join us? Checkout our website atwww.acdapa.org and clickon Resources in the menu

bar, then Festival Information. Or contact me at [email protected]

Sweet Soundsations:A Middle School Women’s Choral Festival for YoungWomen in grades 7 and 8Friday, Nov. 7, 2008

Boyz Noyz:Young Men’s Choral Festival for Young Men in grades 6through 9Friday, Nov. 21, 2008

The 9th Annual Young Men’s Choral FestivalA Choral Festival for young male singers in grades 7, 8,and 9Friday, October 24, 2008

We are the Boys:A Singing experience for boys with unchanged voices inGrades 4, 5, 6, and 7Wednesday, November 5, 2008

Mucho Macho Music V:A Young Men’s Song Festival for Changing Voices inGrades 6-9Tuesday, November 4, 2008

Northwest PA Choral FestivalSaturday, November 1, 2008

Men’s and Women’s Honor ChoirFriday-Saturday, November 21-22, 2008Central Dauphin High School, Harrisburg

This past summer we featured Eleanor Daily, Z. RandallStroope, Dennis Shrock, and Rollo Dilworth at our summerconference. We hosted a Middle School Honor Choir and aStudent/Director Honor choir. We’re getting ready for nextsummer. Keep your eyes posted, and JOIN US as we celebratefriendship and summer and “recharge” for the coming schoolyear.

ACDA-PA welcomes Mark Zeigler as president of ACDA-NY and we happily announce our friendly membershipcompetition: NY vs PA. The state with the highest number ofmembers reached between Aug. 08 and April ’09 wins a freeregistration to the other’s conference and at stake is AmishPotato Salad vs. Nathan’s Hot Dogs. HOORAY FOR PA!!! ☺And, Mark, I’m looking forward to meeting you!!!!

Eileen Hower,PA President

Margaret Anne ButterfieldDE President

Once upon a time there were two stateACDA chapters, Virginia and Maryland/DC,who had small summer conferences. But therewas one problem…hardly any of their choraldirector friends came to share in all the neatthings that happened at the conferences. Therewas one wise person who went to both events (he had tosince he brought all the music!). “Instead of doing two smallevents that only a few people attend” he thought, “why notput on one BIG event that everybody can come to?!” Heencouraged the leaders to persevere, however, and thus wasborn Voices United.

When the conference reached its 10th birthday, the leaders(now a full-fledged planning committee) pulled out all thestops. They invited Mary Goetze to lead the Children’sHonor Choir teach them songs from cultures around theworld. They asked James Bingham to lead the FestivalChoir. They also brought John Rutter across the pond toconduct the final concert – a performance of his own Massof the Children.

At the end of the weekend, everyone gathered at ViennaPresbyterian Church for the 10th Anniversary Concert. MaryGoetze led the Honor Choir in four numbers that 94 childrensang and danced. James Bingham directed the Festival Choirin a short but stunning program of British and Americansacred music. But the true highlight of the day was Rutter’sMass of the Children conducted by the composer. TheFestival Choir and Children’s Honor Choir were joined by aprofessional orchestra and soloists Samantha Kinney andPatrick Walders in a performance that inspired, amazed anduplifted the audience.

There were also interest sessions – Paul Head onconducting techniques, Judith Nicosia on vocal technique,and Jeffrey Benson with a demonstration of rehearsaltechniques. Reading sessions – led by Karen Kennedy(college), Michael Ehrlich (women), Krystal Rickard (men),Mary Ann Casey (SAB/SATB), David Schwoebel (sacred),and Mary Goetze – gave ample opportunity to find potentialnew tunes for the coming year. We were wonderfully enter-tained at the Friday night banquet by the Rock-n-RollChorus from Howell, NJ.

It all began in 1998 as the brainchild of Jack Ay of TheMusical Source, Paul Rardin, MD/DC president, DebMoyers Proctor, VA president, and Sherri Neill from thefaculty of George Mason University in Fairfax, VA, whichhas graciously hosted this event for eight years out of ten!



WELCOME TO OUR NEWELCOME TO OUR NEWELCOME TO OUR NEWELCOME TO OUR NEWELCOME TO OUR NEW R & S CHAIRS IN THE DIVISIONW R & S CHAIRS IN THE DIVISIONW R & S CHAIRS IN THE DIVISIONW R & S CHAIRS IN THE DIVISIONW R & S CHAIRS IN THE DIVISION

DaDaDaDaDavid Fvid Fvid Fvid Fvid FrylingrylingrylingrylingrylingYouth & Student Activities

MaMaMaMaMargery Heinsrgery Heinsrgery Heinsrgery Heinsrgery HeinsTwo-Year College Choirs

TTTTThomas Lloydhomas Lloydhomas Lloydhomas Lloydhomas LloydCommunity Choirs

KaKaKaKaKaren Kennedyren Kennedyren Kennedyren Kennedyren KennedyCollege & University Choirs

... is Associate Professor ofMusic and Director of ChoralStudies at Hofstra University,where he conducts the selectHofstra Chorale and HofstraChamber Singers, and teachesChoral Methods, ChoralConducting, and AdvancedStudies in Conducting, as well asgraduate level workshops inChoral Conducting andLiterature. During his summers,he serves as conductor and musicdirector of the World YouthHonor Choir and Festival Choirand coordinator of Vocal Studiesfor the acclaimed InterlochenArts Camp in Michigan.

David is an active andengaging guest conductor,clinician and adjudicator ofchoral groups of all ages,with recent professionalengagements in numerousregional, district, and countyhonor choir festivals, choralworkshops, and adjudicationsthroughout the Northeast, as wellas in Michigan, Louisiana andUtah. He has conducted his ownchoirs in concerts both here inthe US and in Europe, andmaintains an active career as aprofessional choral singer in thegreater NY Metropolitan area.

...received her BA fromMount Holyoke College whereshe was a music major and whereshe first studied conducting withTamara Brooks. Margerycompleted her MM at TempleUniversity, where she studiedwith Elaine Brown.

Margery has taught generaland choral music at all levels inMassachusetts and Vermont.Currently she is Director of theGreenfield (MA) CommunityCollege Chorus, a position shehas held since 2001.During the 1980s and 90s,Margery conducted theGreenfield Chamber Singers.She also led the Youth Choralewhich collaborated with theChamber Singers for “A MozartFestival” and the BernsteinChichester Psalms. Margery hasconducted church choirs, and atpresent is at the FirstCongregational Church ofAshfield, MA, which boasts achoir attendance of at leastfifteen each Sunday despitebeing in such a small town.

Margery is also heavilyinvolved in teaching privatevoice lessons to students of allages at Greenfield CommunityCollege and in the communityand conducts her students in theRecital Chorus. She has sung inmany groups in college, graduateschool, and beyond.

... is Associate Professor ofMusic at Haverford College,where he has served since 1996as director of the combinedchoral program for Haverfordand Bryn Mawr Colleges. Therehe directs the 150-voicesymphonic choir, a 28-voiceselect touring choir (mostrecently traveling to Ghana inJanuary of 2007), and teachesconducting, vocal repertoire, andmusic history. He is also theArtistic Director of the BucksCounty Choral Society since2000.

Lloyd graduated from theOberlin College Conservatory asa bassoonist, and earnedgraduate degrees in theologyfrom the Yale Divinity School,voice and opera from the YaleSchool of Music. Following aten-year interlude as an ITmanager on Wall Street, Lloydreturned to music in the doctoralprogram in conducting at theUniversity of Illinois, where hecompleted the DMA in 1994. Inthe previous year, he wasawarded first prize on thegraduate level of the first ACDAStudent Conducting Awards atthe national convention in SanAntonio.

Lloyd has held a variety ofvocal and instrumentalconducting positions, hasappeared as guest conductor withthe Riverside Symphonia, aprofessional chamber orchestrain Lambertville, NJ, and hasremained active as a tenorsoloist.

... currently holds theposition of Director of Choirs atTowson University. Beforejoining the faculty at Towson,she held the positions of ChorusDirector for the HonoluluSymphony, Artistic Director forthe Hawai`i InternationalChoralFestival, and Director of ChoralActivities at the University ofHawai`i at Manoa. A recipient ofthe DMA degree in choral musicfrom Arizona State University,Dr. Kennedy also received anMM in choral conducting fromButler University and a BMEfrom DePauw University.

Dr. Kennedy greatly enjoysworking with high schoolstudents as a clinician and con-ductor. Recent performancesinclude the Oregon All-StateMixed Choir, Oregon All-StateWomen’s Choir, and the Hawai‘iAll-State Honor Choir. She willconduct the Colorado All-StateWomen’s Choir in 2010. She hasalso participated as a conductorfor several county honor choirs,including the Dakota ValleyFestival in Minneapolis,Minnesota, the Clark CountyHonor Choir in Las Vegas,Nevada, and several Marylandcounty honor choirs includingBaltimore County, CarrollCounty, and Calvert County.

Dr. Kennedy is a past-President of the Hawai‘i chapterof ACDA. She is an activemember of Chorus America, andis a founding member of theNational Collegiate ChoralOrganization.

CONTINUED ON PCONTINUED ON PCONTINUED ON PCONTINUED ON PCONTINUED ON PAGE 22AGE 22AGE 22AGE 22AGE 22

I

N

V

I

T

E

D

C

H

O

I

R

S

Craig Hella Johnson &

Conspirare

Independence Hall

Marriott Hotels

Terry Barham

Emporia State University

“Men in the Middle”

Young Men’s Workshop Choir

February 10 13, 2010

Craig Courtney, Composer

Music in Worship Event

Festival Church Choir

NEW for 2010…….Interest Strands:

College, High School, Middle School,

Children, New Teachers,

Multi cultural, Jazz/Show Choir, Music

in Worship, Urban/Rural and

Community Choir

Ysaye Barnwell

Founding Member of

Sweet Honey In the Rock

Philadelphia Singing City

Jeffrey Brillhart, conductor



…and more!...City Hall

H

O

N

O

R

C

H

O

I

R

S

High School Men’s Honor Choir

Singers Grades 9-12

Jerry Blackstone University of Michigan

High School Women’s Honor Choir

Singers Grades 10-12

Jazz Honor Choir

High School Singers Grades 10-12

and College Singers Vijay Singh

Central Washington University

Sharon Paul

University of Oregon

Website Addresses www.acdaeast.org

www.ymbarnwell.com

www.conspirare.org

www.singingcity.org

www.marriott.com/hotels/travel/phldt-philadelphia-marriott-downtown

Kimmel Center

Church of the

Holy Trinity

Rittenhouse Square

National Constitution Center

Elaine Quilichini

Calgary Girls Choir

Children’s Honor Choir

Treble singers to age 16

WELCOME TO OUR NEWEST EASTERN DIVISION MEMBERS

Lillie H. Feierabend CTPhyllis H. Silver CTDavid R. Knox CTJennifer E. Campbell DETalia R. Mercadante MAMarta L. Frey MADawn M. Sykes MAAmanda A. Buscema MARichard R. Brejcha MAIrene M. Idicheria MAEdmond Saint-Jean MDNae H. Pearson MDOlga M. Morales MDLaurel A. Wacyk MDBeth C. Hough MDErik M. Koski MDBlake Leister NHKrystal A. Morin NHRobert J. Diamond NHJulie A. Formidoni NH

Stephen Colby NHBenjamin J. Gruder NJBarbara J. Gray NJKaren N. Olsen NJJulia Adolphe NYRoseanne G. Ackerley NYDaniel S. Rivenburgh NYEmilie D’Andrilli NYMary-Jean Roamer NYKristin Y.M. Yaekel NYAimee M. De Berjeois NYPriscilla Babilonia NYKristen N. Stegville NYMichael L. Devoe NYKaryn E. Pflliger NYKirstie Chen NYYi-Ping C. Chen NYNathan A. Majewski NYJewel F. Buckwalter NYAmanda D. Kraeger NY

Hannah E. Duggins NYElaine C. Grumbine PACorinne W. Bulley PAKathy H. O’Donnell PASouth Eastern School District Music Dept. PACynthia Abeles PAJulie I. Myers PACarrie B. Stein PAKelly E. Koelble PAMelissa M. Lingle PAGeorge B. Caucci PALauren K. Durkin PAJoyce E. Dupuis PADonald F. Smith PAJonathan K. Kreamer PATroy A. Quinn RILynn E. Sweet VTCaroline Whiddon VTJessica G. Allen VT


The Maryland State Boychoir announces

The Tenth Annual

Baltimore Boychoir Festival

With Guest Director-

Dr. Rollo Dilworth May 15-16, 2009

Join us as we celebrate 10 years of the only festival of its kind in the country! Two days of intense rehearsals and fellowship culminate in a mass choir performance, where over 300 boys will join together in song. Don’t miss this unique opportunity!

TO RESERVE YOUR SPOT, OR FOR MORE INFORMATION: (410) 668-2003 [email protected] www.marylandstateboychoir.org


Twenty five years ago I saw an ad for a summer showchoir camp in the Midwest and decided to take the leap andsee what that show choir thing was all about. What did Ifind? Over 500 kids and 100 teachers engaged in an intenseand exciting week which culminated in an impressive per-formance. There were workshops in tap, jazz, hip hop, Broadwayaudition strategies, vocal training, vocal master classes,singing in a jazz group, and many more. There were count-less hours of rehearsal perfecting the music and the move-ment for the show at the end of the week. The kids and theteachers were enthusiastically committed to these experiencesand went home exhausted and musically enriched. It wasinspiring!

Well, moss didn’t grow on me! I immediately started in-corporating movement into my middle school choir classesand started a fledgling high school show choir. Fast forwardtwenty five years to the reunion of my show choir alums whereI heard over and over that show choir was the most meaning-ful experience of their high school years. These kids hadbeen in my other choirs as well, so why was show choir theone that left the lasting impression?

Well, we all know that music is magic and that it takes usplaces like nothing else. Take that magic, add the dimensionof movement and the experience becomes even more mean-ingful. Now that I think of it…wasn’t there some famous guywho believed that movement was integral to learning musicfor everyone?…oh yeah…Dalcroze! Further examplesabound: African musicians never sing without movement,Native Americans combine song and ritual ….you get thepoint. My choir sang a beautiful arrangement of Kum By Yahthis year. We added simple physical movements and theresulting performance was incredibly moving. The moveshelped the kids sing longer lines, draw attention to importantwords, feel more attached to the music and give the musicmore life. The feeling of peace the song created will staywith the kids for a long time. And that’s what I want them toremember for the long term… not the notes or where tocrescendo (even though we did those too), but how it madethem FEEL. The magic.

So this is my suggestion: DON’T START A SHOWCHOIR (well, not today anyway!). Just start using movementin your choir rehearsals. Ask the kids to move their arms to

MUSIC AND MOVEMENT?by Lisa Larsen

R&S Chair, Show Choirs

“We start at the very beginning (a very goodplace to start) . . .”- apologies to Maria von Trapp


Copenhagen, Denmark was the location from July 19-26for the 8th World Symposium on Choral Music. This event isheld on a different continent every three years by the Inter-national Federation of Choral Musicians (IFCM), which wasfounded in 1982 in an effort to support the development ofchoral music worldwide, both for its artistic and socialbenefits.

There were many familiar Eastern Division faces amongthe over 1100 choral directors attending the symposium.While it would be hard to summarize such a whirlwind ofperformances, master classes, and workshops, my last day atthe symposium (Friday) presented a full sampling of thedepth and breadth of the week’s offerings.

The day began with a master class with English conductorSimon Halsey and the young professional voices of the oneof Denmark’s top chamber choirs, Ars Nova. With grace,wit, and sharp perception, Halsey coached an impressivequartet of young conductors from far flung corners of theworld: Malaysia, Bulgaria, Greece, and Australia.

Following this intensive session, focused on Western highart music, we witnessed performances by two very different,yet equally remarkable children’s choirs. The first was theIndonesian Youth Choir of Cordana, founded in 1992 byWestminster Choir College graduate Aida Swenson. Thechildren presented a program representing music and cho-reography from three of their country’s major cultural tra-ditions: the Hinduism of Bali, Christianity of Papua NewGuinea, and Islam of the Aceh region. The musical arrange-ments were primarily drawn from the unison singing, complexrhythms and counterpoint of local sources, with the occa-sional application of Western harmony. While the costumesand choreography were simply dazzling, the children’s boldand forthright singing managed to more than hold its own.

Following this group, which had performed at prior IFCMsymposia, came a choir that had only been rehearsing sinceFebruary, the Mwamba Uganda Childrens Choir, part of anecumenical “non-missionary” Danish NGO DanChurchAid’soutreach program to AIDS orphans. Under the completelyunobtrusive guidance of their director, Jemimah Nsanga,these children, ranging widely in age and height, radiated aninfectious joy of dancing and singing, mostly Christian-themed music in the popular African “high-life” style. Some

REPORT ONTHE IFCM 8th

WORLD SYMPOSIUM

by Thomas LloydR&S Chair, Community Choirs



Sat., October 18, 2008

8:30am - 1pm

Roxbury High School

1 Bryant Drive, Succasunna, NJ 07876

Multicultural &

Ethnic Workshop

New

Jersey

American

Choral

Directors

Association

Workshop Headliner:Dr. Anthony LeachLeach

For Choral Musicians

Reco

gn

ize…

cele

bra

te…

ma

inta

in…

div

ersity

…

• Reading Sessions(Music packets provided)

• Selecting Ethnic & MulticulturalMusic for YOUR classroom

• Cultural Perspective in Warm ups

• Introducing your students toMulticultural Music

• But I don’t speak that language!!

• Improvisation in the MulticulturalClassroom

• How to Start a Successful GospelChoir

Workshop topics

See Our Brochurehttp://www.njacda.com/PDF%20files/M%26E%20Brochure.pdf

Workshop Registration Fee $45

Non-ACDA Members (Add $10)

Retired ACDA Members (Subtract $10)

College ACDA Members (Subtract $10)

Late Registration (Add $15)

Postmarked after September 27, 2008 or at the door

For information about the workshop, please contact

Jessica Harrison at 973-444-3179 or [email protected].

For information about ACDA membership, please visit our national website –

www.acdaonline.org or the NJ Chapter website – www.njacda.com

Attention NJ Public School Teachers

professional development Hours given


match the phrase, stand when their part has the melody orclap overhead for accents. Make up clapping, snapping, footstomping to accompany music or fill the rests. Try silly ideaslike having the kids sit while singing “piano,” stand up for“mezzo forte” and stand on their chair seat for “forte.” Theymight even stay awake and engaged!

Then go to the next step. Teach your kids deaf handsigns, gospel step touches, hand movements or use props! Ithink you’ll find the kids will be more intrigued, excited andquite possibly, sing the song better. Ha! I heard you and yes,those boys are harder to sell, but once you get them interest-ed, they take to it like ducks to water. Give those boys some-thing like Take Me Out to the Ball Game and plastic baseballbats or let them camp up Officer Krupke! Keep it simple andyour chance for success will be much greater. Don’t hesitateto make use of the talents of your students to create move-ment for songs. Remember those kids are young, energeticand need to move!

As my music teacher Dad used to say, “If it’s all vanilla,you’re going to get tired of it pretty fast.” Every choir atyour school should sing a variety of music so the kids willbe exposed to more of our huge and diverse musical world. Ihope to hear that your concert choir performed He Ain’tHeavy, He’s My Brother with deaf hand signs, sang Americathe Beautiful with a DVD of scenic photos, let thedrummers go on Siyahamba and then performed Mozart’sAve Verum with great sensitivity. Remember we want thekids to remember how the music makes them FEEL!


Lisa Larsen has been Choral Director at CoginchaugRegional High School and Strong Middle School inDurham, CT, for 30 years. She directs the Concert Choir,Chamber Choir, Show Choir, 2 a cappella groups, schoolmusicals, 8th Grade Choir and makes really cool posters.Contact: [email protected]


of my colleagues who saw their performance in the operahouse that day were concerned that they might be victims ofartistic manipulation for the benefit of our Westernheartstrings. But I had also seen them the day before in anoutdoor concert where they were more in their element,where they reminded me very much of the children I hadseen during a recent choir tour to Ghana. (Go to http://crawfurd.dk/slideshows/mwamba/index.html to see somewonderful photos of their outdoor performance at the TivoliGardens). Whatever emotional turmoil these children facedoff stage, there was no doubt seeing them up close that theirlove of singing and dancing was for real, and the strong andtender care of their director was palpable.

I was thenfortunate to gainadmittance to aworkshop onRenaissance dancesteps by the Spanishdancer Ana Yepes,daughter of the greatguitarist NarciscoYepes (www.anayepes.com). Another era, another culture, adifferent style altogether. Within a short time, she had agroup of about 50 club-footed choral conductors dancing thepavane using the simple step and close that are the basis ofthe elegant dances at the heart of all Baroque music, eventhe sacred masterworks of Bach.

From there, I journeyed to the first evening concert byusing two of the three most common means of transportationaround Denmark, ferry and foot (bicycle being the only wayI didn’t use to get around, but wish I had!) Copenhagen is acity of canals, much like Venice.

Everyone had said that one choir not to be missed was theEMO Ensemble of Finland and its intense young director, PasiHyökki. They certainly lived up to their reputation. With im-peccable balance, intonation, and dynamic range they pre-sented a program of the repertoire they have become identi-fied with: Finnish harmonic cluster writing that makes EricWhitacre’s now iconic Water Night sound like the simpletextures of Erik Satie.

But the best was still yet to come. The final concert of theday, and of the whole festival for me, proved to be one of themost memorable events I have ever attended. It was aperformance of Rodion Shchedrin’s The Sealed Angel by thegreat Rundfunkchor (Radio Choir) Berlin under the directionof Swedish conductor Stephan Parkman. The music itself,written in 1988 under the last shadows of Soviet communism,was a revelation – a masterpiece in a modern stylistic exten-


Deadline for articles for theDecember issue of TROUBADOURTROUBADOURTROUBADOURTROUBADOURTROUBADOUR

Wednesday, October 1, 2008

Deadline for advertisements forthe December issue

Wednesday, October 15, 2008

For ad reservation form and rates, go tohttp://www.acdaonline.org/publications/newsletters-

div.shtmlPlease contact the editor at [email protected]

with questions or concerns.


sion of the tradition of the long suppressed Moscow SynodalSchool of the early twentieth century. But it was also stagedwith five dancers, who interacted not only with each other,but the chorus in the middle of the stately sculpture court ofthe national Glytoteket (sculpture museum), with the composerpresent in the front row. The combination of great musicsung by a magnificent chorus, dancing of such passion andintensity, a very unusual space perfect for the combination,and a hyper-attentive, audience of only a few hundred madefor a night to long remember.

Looking back on this overwhelmingly full day of inspiredmusic-making, the strengths and challenges of IFCM and itsmission to unite the world through song came into somewhatsharper relief. At select festivals such as this one, the greatdivide between the high art-music aims of Western musicand the passion for inclusivity and social change come to thefore. Most of the black-costumed Western-oriented choirsare models of stillness and concentration when they sing (theSealed Angel concert being the rare, and welcome, exceptionwhere the singers moved). On the other hand, the colorfullycostumed choirs from all over Latin America, Africa, andAsia find that singing without movement makes no sense atall.

It was especially apparent at this convention how influ-ential the Scandinavian sound remains in the West, goingback in the US at least to the origins of the Lutheran colleges inthe Midwest and the later landmark recordings of ErikErickson. This is inspiring in terms of the very high standardsthat have done so much to raise the level of our profession,but at the same time a little discouraging in terms of theuniformity of sound that has also resulted among mostEuropean and American choirs today, and the occasionalnon-Western choirs (such as one Korean choir here) thataspire to the same ideal.

There is also a discouraging sameness in the harmoniclanguage of new music – Scandinavian choral compositionseems to range from the extremes of impressive butexpressively limited cluster music on one end to “new-age”easy-listening singing on the other, with most of the music inbetween being harmonically innocuous and mostlyforgettable. The low point of this particular conference formany listeners was the poor craftsmanship and weakimagination of several of the premiers commissioned by thesymposium.

And much as Westerners may rejoice at the currentabundance of choral music from many cultures which wereinaccessible to us in the past, festivals like this remind us ofa more complex reality. We so easily forget that “choral” musicas it we understand it (vocal harmonization by multiple voices)is primarily a tradition of the Christian West that is not, in

fact, indigenous to the rest of the world. We are discoveringthis again in our well-intentioned but misguided attempts tobring Islamic music into the choral fold. There is no need forfalse guilt here, since the days of “pure” culture preservedby isolated communities is long past, especially in our pre-sent internet age. But we still need to be aware of how thelarge shadow of the missionary past and the internationalmedia present still give Western culture a disproportionateinfluence throughout the world.

While at the symposium, I attended a special meeting fora new IFCM program called Conductors Without Borders.Growing from the remarkable success of Maria Guinand,Alberto Grau, and Latin American leaders in raising thestandards and accessibility of choral music at all levels ofsociety in their region, IFCM seeks to replicate thiseducational process throughout the world, appreciating fullwell that different regions have different challenges. How dowe educate future conductors and develop future choirswithout following in the ways of cultural hegemony pavedby the Christian missionaries long before us, whose presenceis still being felt? How can we encourage and provideotherwise unavailable resources to local conductors todevelop new repertoire that is true to their own culture,wherever that may lead? As a sign of the challenges of thisdisconnect, it was discouraging that there were no blackAfrican conductors at the “Conductors without Borders”meeting, or on the steering committee.

These questions have no easy answers, but IFCM hasenergized a lot of passionate musicians from all over theworld who are asking these questions in constructive waysand doing a lot of careful and joyous listening and discoveryin the process. We should all seek to be part of this impor-tant and visionary conversation. Ifyou are not already a member ofIFCM, go to www.ifcm.net tobecome a part of this importantorganization and receive itsfascinating journal.

Thomas Lloyd is an Associate Professor of Music atHaverford College, where he directs the Choral and VocalStudies Program of Haverford and Bryn Mawr Colleges,and also serves as the Artistic Director of the Bucks CountyChoral Society.

- continued from pg. 18 - NNNNNAAAAATIONTIONTIONTIONTIONAL CONVENTIONAL CONVENTIONAL CONVENTIONAL CONVENTIONAL CONVENTION

March 4-7, 2009Oklahoma City, OK

Registration opens Sept. 22


Delaware American Choral Directors Association

Events

2008-2009

Children's Choir Festival with guest conductor Francisco Núñez

March 13-14, 2009

March 12, Director Workshop University of Delaware, Newark, DE

Sixth Annual

Delaware State Choral Festival (Out of State Choirs Welcome)

April 7, 2009 Cab Calloway School of the Arts, Wilmington, DE

Music in Worship Reading Session Focus on Church Children's Choirs

April 2009 Newark United Methodist Church, Newark, DE

Third Annual State Reading Day with guest composer/conductor Steven Sametz

June 18, 2009 Westminster Presbyterian Church, Wilmington, Delaware

For more information visit deacda.org.


155 West 72nd Street, Suite 302New York, NY 10023

Tel: 800-300-8841 | 212-580-0760Fax: 212-874-4554

www.concept-tours.com [email protected]

It’s all in the details.Leave them to us!

Customized Tours to Europe, Asia, Africa,

& the Americas

Concept ToursA bridge to the world

Have you EVER –Have you EVER –Have you EVER –Have you EVER –Have you EVER –

- Read an article in an ACDA-sponsored state,division, or national journal?

- Attended an ACDA-sponsored workshop orinterest session?

- Listened to an ACDA-sponsored choralperformance?

- Learned new repertoire at an ACDA-sponsored reading session?

- Participated in ACDA-sponsored honorchoirs?

- Experienced a region, state, division ornational ACDA conference?

- Performed with an ACDA-sponsoredDirector’s Choir?

- Discussed choral issues with an ACDAmember colleague?

- Conducted in an ACDA-sponsored masterclass?

- Researched choral issues using ACDA-sponsored monographs?

- Watched ACDA-sponsored videos andDVDs?

If so, you KNOW the benefits of ACDAmembership…

WELCOME NEWELCOME NEWELCOME NEWELCOME NEWELCOME NEW R & S CHAIRS IN THE DIVISION - cont’W R & S CHAIRS IN THE DIVISION - cont’W R & S CHAIRS IN THE DIVISION - cont’W R & S CHAIRS IN THE DIVISION - cont’W R & S CHAIRS IN THE DIVISION - cont’ddddd


...native of Baltimore, LindaHall has taught music educationin The Baltimore Public SchoolSystem since 1976. Lindaassumed the position of ChoralDirector at the Baltimore CityCollege HS in Baltimore, MD in1987 where she conducts theschool’s four choirs: The MixedChorus, The Concert Choir, TheSinging/Swingin’ Knights andthe Knights and ‘Daze’ ShowChoir.

Under her direction, the CityCollege choirs have delightedaudiences from Maine to Florida;from the White House to Europe;in Verona at The InternationalChoral Music Days Festival, TheUnited Nations Climate ChangeConference in Milan, as well as,in Rome, Spain and France. Herchoirs have consistently wonsuperior ratings, awards andtrophies for their electrifyingperformances. Ms Hall also hadthe privilege of conducting theCity Choir at Carnegie Hall inMarch 2008.

Hall has served as clinician,adjudicator and guest conductorfor many churches and choirsincluding the Baltimore CountyHonor Choir, The Prince GeorgesCounty Honor Choir, ACDAVoices United SummerConference festival chorus, andthe Washington Performing ArtsSociety – Men and Women of theGospel, conducting the worldpremiere of INDABA!, written byand performed with Sweet Honeyin the Rock.

Linda HallLinda HallLinda HallLinda HallLinda HallHigh School Choirs

DeborDeborDeborDeborDeborah A. Melloah A. Melloah A. Melloah A. Melloah A. MelloChildren’s Choirs

No photoavailable

... founding director of theChildren’s Chorus of SussexCounty, is the recipient of theMaster Teacher Award from theNew Jersey Music Educator’sAssociation, the NJ Governor’sAward for Arts in Education, theNJ Symphony Orchestra MasterTeacher Collaborative Award,sponsored by the DodgeFoundation and the 2007 YaleDistinguished Music EducatorAward.

As Director of the Children’sChorus of Sussex County,Debbie has developed asequential choral music programfor children age 6 through 18 toexplore the world of singing.Since its inception in 1990, theChildren’s Chorus has grown to100 children in three choirs. Thechoirs have served in residenceat several summer choralworkshops and have workedwith choral music educators andcomposers.

Debbie has served as R&SChair for Children’s Choirs inNew Jersey, Eastern Divisionand at the national level. Arecipient of the Artist Teachercertificate from the ChoralMusic Education coursesfounded by Doreen Rao,Deborah has been a TeachingAssociate in the CME coursestaught in the US, Canada, andin Europe. She has conductedseveral regional and honorchoirs in various states includingNew Jersey, New York,Pennsylvania, Louisiana, Maineand Kentucky.

Lisa LaLisa LaLisa LaLisa LaLisa LarsenrsenrsenrsenrsenShow Choirs

is Choral Director atCoginchaug Regional HighSchool and Strong MiddleSchool in Durham, CT, whereshe is responsible for the musicalmind building of students inConcert Choir, Chamber Choir,Show Choir, two a cappellagroups, high school musicals andthe 8th Grade Chorus. Larsenearned a BME from Murray StateUniversity, and an MALS fromWesleyan University.

She is a member of the 30Years/Beyond Club and has thegray hair to prove it. Lisafollowed in the musical footstepsof her parental units and isforever grateful to them forsharing their wisdom andincredible work ethic.

There are tworeasons. First, weattempt to avoid

conflicts with otherlarge professionalorganizations with

which our membersmight be associated.The third weekendof February is the

New Jersey NJMEAconference. The

fourth weekend isthe Maryland

MMEA conference.Etc. Etc.

The second reason isthat we wish to

avoid the Lentenchurch season.Scheduling theconference later

would severely limitour accessibility tochurch venues for

our performingchoirs and alsopreclude many of our Music in

Worship membersfrom attending.

The weather duringFebruary and Marchis always worrisome

but also alwaysunpredictable.

The 2008 SouthernDivision conference

was held in Louisville, Ken-tucky, during the

second weekend ofMarch.

They had ablizzard !

FAQSWHY are the

Eastern Divisionconventions always

the second weekendin February?

Every childis born

an artist.

The trick isto remain an artist.

Pablo Picasso


One of the best features of this conference is, was andalways will be The Musical Source. Not only did theyprovide music for each of the sessions, they also haddisplays of inventory available for purchase throughout theconference.

Looking ahead, next year’s conference, August 6-8, 2009,will feature Joe Miller from Westminster Choir College,Lynn Gackle from the University of South Florida asChildren’s Honor Choir director, and David Brunner fromthe University of Central Florida, who will lead the FestivalChoir in a masterwork. It promises to be yet another“Capital Choral Convention” and an amazing summerexperience you won’t want to miss.

Information on Voices United can be found on the websitesof the sponsoring states: www.vaacda.org,www.acdamddc.org, or www.deacda.org.

Donna CostesVT President

VT ACDA will sponsor two sessions atthe VMEA Conference on October 23. 1. A high school reading session led by fiveof our finest conductors. Music packets pro-vided by ACDA. Music will include standard

repertoire as well as new repertoire.

2. How to adjudicate! led by Anne Hamilton (prepara-tion for All-State adjudicators) The 28th Midwinter Madrigal Festival on December 5will feature performances by 10-12 small ensembles and acombined program led by Jeffrey Buettner, MiddleburyCollege and Vermont Youth Chorus and Chorale conductor. A combined Spring Conference and Children’s ChoirFestival —dates and venue to be arranged.

- continued from pg. 10 -EASTEREASTEREASTEREASTEREASTERN DIVISIONN DIVISIONN DIVISIONN DIVISIONN DIVISION

REPERREPERREPERREPERREPERTTTTTOIRE & STOIRE & STOIRE & STOIRE & STOIRE & STANDANDANDANDANDARDS CHAIRSARDS CHAIRSARDS CHAIRSARDS CHAIRSARDS CHAIRS

boboboboboyyyyychoirschoirschoirschoirschoirsMichael Sanflippo - [email protected] Sanflippo - [email protected] Sanflippo - [email protected] Sanflippo - [email protected] Sanflippo - [email protected]

CHILDREN’S CHOIRSCHILDREN’S CHOIRSCHILDREN’S CHOIRSCHILDREN’S CHOIRSCHILDREN’S CHOIRSDebbie Mello - [email protected] Mello - [email protected] Mello - [email protected] Mello - [email protected] Mello - [email protected]

CCCCCOLLEGE & UNIVERSITY CHOIRSOLLEGE & UNIVERSITY CHOIRSOLLEGE & UNIVERSITY CHOIRSOLLEGE & UNIVERSITY CHOIRSOLLEGE & UNIVERSITY CHOIRSKKKKKaren Kennedy - kkaren Kennedy - kkaren Kennedy - kkaren Kennedy - kkaren Kennedy - [email protected]@[email protected]@[email protected]

CCCCCOMMUNITY CHOIRSOMMUNITY CHOIRSOMMUNITY CHOIRSOMMUNITY CHOIRSOMMUNITY CHOIRSThomas Lloyd - [email protected] Lloyd - [email protected] Lloyd - [email protected] Lloyd - [email protected] Lloyd - [email protected]

high school choirshigh school choirshigh school choirshigh school choirshigh school choirsLinda Hall - [email protected] Hall - [email protected] Hall - [email protected] Hall - [email protected] Hall - [email protected]

JUNIOR HIGH & MIDDLE SCHOOL CHOIRSJUNIOR HIGH & MIDDLE SCHOOL CHOIRSJUNIOR HIGH & MIDDLE SCHOOL CHOIRSJUNIOR HIGH & MIDDLE SCHOOL CHOIRSJUNIOR HIGH & MIDDLE SCHOOL CHOIRSLon BeerLon BeerLon BeerLon BeerLon Beery - lbeery - lbeery - lbeery - lbeery - [email protected]@[email protected]@[email protected]

JJJJJAZZ CHOIRSAZZ CHOIRSAZZ CHOIRSAZZ CHOIRSAZZ CHOIRSSherSherSherSherSheryl Monkyl Monkyl Monkyl Monkyl Monkelien - smonkelien - smonkelien - smonkelien - smonkelien - [email protected]@[email protected]@[email protected]

MALE CHOIRSMALE CHOIRSMALE CHOIRSMALE CHOIRSMALE CHOIRSScott TScott TScott TScott TScott Tuckuckuckuckucker - [email protected] - [email protected] - [email protected] - [email protected] - [email protected]

MULMULMULMULMULTICULTICULTICULTICULTICULTURAL & ETHNIC PERSPECTIVESTURAL & ETHNIC PERSPECTIVESTURAL & ETHNIC PERSPECTIVESTURAL & ETHNIC PERSPECTIVESTURAL & ETHNIC PERSPECTIVESRRRRRon Johnson - [email protected] Johnson - [email protected] Johnson - [email protected] Johnson - [email protected] Johnson - [email protected]

MUSIC IN WMUSIC IN WMUSIC IN WMUSIC IN WMUSIC IN WORSHIPORSHIPORSHIPORSHIPORSHIPKen Steele - [email protected] Steele - [email protected] Steele - [email protected] Steele - [email protected] Steele - [email protected]

SHOSHOSHOSHOSHOW CHOIRSW CHOIRSW CHOIRSW CHOIRSW CHOIRSLisa Larsen - [email protected] Larsen - [email protected] Larsen - [email protected] Larsen - [email protected] Larsen - [email protected]

TWTWTWTWTWO-YEAR CO-YEAR CO-YEAR CO-YEAR CO-YEAR COLLEGE cHOIRSOLLEGE cHOIRSOLLEGE cHOIRSOLLEGE cHOIRSOLLEGE cHOIRSMargerMargerMargerMargerMargery Heins - singing@cry Heins - singing@cry Heins - singing@cry Heins - singing@cry Heins - [email protected]

wwwwwomen’s choirsomen’s choirsomen’s choirsomen’s choirsomen’s choirsSusan Conkling - [email protected] Conkling - [email protected] Conkling - [email protected] Conkling - [email protected] Conkling - sconkling@esm.rochesterochesterochesterochesterochester.edu.edu.edu.edu.edu

YYYYYOUTH & STUDENT AOUTH & STUDENT AOUTH & STUDENT AOUTH & STUDENT AOUTH & STUDENT ACTIVITIESCTIVITIESCTIVITIESCTIVITIESCTIVITIESDavid FDavid FDavid FDavid FDavid Frrrrryling - Davd.Fyling - Davd.Fyling - Davd.Fyling - Davd.Fyling - [email protected]@[email protected]@[email protected]

For additional information,please consult the division website:

www.acdaeast.org

Troubadour, the official newsletter of the Eastern Division of theACDA, is published three times per year - October, December andApril. All articles for consideration should be submitted to theDivision Repertoire & Standards Chairs listed on page 23, or to theeditor. ACDA reserves the right to approve any application forappearance and to edit all materials proposed for distribution.

CHANGE OF ADDRESS: National ACDA Office, PO Box 2720,Oklahoma City, OK 73101-2720

Advertising in TroubadourAdvertising in TroubadourAdvertising in TroubadourAdvertising in TroubadourAdvertising in TroubadourFor the ad reservation form, please go to:For the ad reservation form, please go to:For the ad reservation form, please go to:For the ad reservation form, please go to:For the ad reservation form, please go to:

www.acdaonline.org/publications/newsletters-div.shtmlwww.acdaonline.org/publications/newsletters-div.shtmlwww.acdaonline.org/publications/newsletters-div.shtmlwww.acdaonline.org/publications/newsletters-div.shtmlwww.acdaonline.org/publications/newsletters-div.shtmlFull page (7 in. x 9.5 in.) $2401/2 page (7 in. x 4.75 in.) $1651/3 page (2.5 in. x 9.5 in. or 7 in. x 3.2 in.) $1351/6 page (2.5 in. x 4.75 in.) $95

American Choral Directors Association545 Couch DriveP.O. Box 2720Oklahoma City, OK 73101-2720

NON PROFIT ORGUS Postage

PAIDWorcester MAPermit No. 2

Let Your voices

World cultural Tours

877- 218-8687 www.worldculturaltours.com

Be Heard

Around the World

Experience the Difference!

A MATCH OF INTELLECT AND SPIRIT: An Interview with Richard … · 2015-06-29 · PAGE 2 TROUBADOUR...

Documents

Transcript of A MATCH OF INTELLECT AND SPIRIT: An Interview with Richard … · 2015-06-29 · PAGE 2 TROUBADOUR...