Supporting online material

A link between mRNA turnover and RNA interference in Arabidopsis

Silvia Gazzani, Tom Lawrenson, Claire Woodward, Denis Headon and Robert Sablowski

Materials and methods

Arabidopsis growth and genetic analysis.

For plant growth, seeds were stratified at 4°C for 4 days before growth at 21°C with

16 h light / 8 h dark cycles, either on soil or on plates with GM medium (S1). For DEX

treatments, seedlings were grown on GM containing 1 µM dexamethasone (SIGMA).

For mutagenesis, 100 mg of homozygous STM-GR seeds (Landsberg-erecta

background, L-er) were treated overnight at room temperature with 0.3% ethyl methane

sulphonate (EMS) in 0.05% Tween 20, rinsed in saturated sodium thiosulphate, germinated

on GM medium and transferred to soil after one week. Progeny from 2000 individual plants

were germinated on separate GM plates containing 1 µM dexamethasone (SIGMA) and

screened for wild-type growth. The xrn4-1 and xrn4-2 mutants were isolated in this screen.

The xrn4-3 allele originated from the Salk Institute collection of T-DNA insertions

(http://signal.salk.edu/cgi-bin/tdnaexpress), strain SALK_014209, obtained via the

Nottingham Arabidopsis Stock Centre (http://nasc.life.nott.ac.uk/)

The STM-GR strain has been described (S2), and an independent STM-GR line was

generated using the same methods. The AG-GR strain was made in L-er background using

the same vector and methods as for STM-GR, except that the STM coding sequence was

replaced with the complete AGAMOUS coding sequence fused in-frame with GR. The

WUS-GR strain (L-er) was a gift from Michael Lenhard (University of Freiburg, Germany)

and has been described (S3). sde1-1(S4) and the corresponding wild-type control (C-24

background) were provided by Alan Herr (Sainsbury Laboratory, Norwich, UK).

For crosses, plants were grown on soil to maturity and four to five flowers were

hand-pollinated two days after their immature stamens had been removed. Genotypes were

confirmed using dCAPS markers. For xrn4-1, genomic DNA was amplified with primers:

5'GACCGATACCCGAAGTCAAT3' and

5'CTAACCAAACATTTCTGAGCTACAACAGA3'. For sde1-1, primers were

5'GGGAGCCTGTGTCAGATCAT3' and

5'GAGATGCTTGAGAGAAGCTATATTGAGATC3'. In both cases, amplification was

initiated by adding Taq polymerase at 94°C, followed by 35 cycles of 94°C for 30 sec, 52°C

for 60 sec and 72° C for 90 sec. The 204 bp XRN4 product was cut to 173 bp by BglII if

amplified from xrn4-1; for SDE1, BglII cut the 183 bp product to 153 bp if amplified from

sde1-1.

RNA extraction and analysis

Total RNA was isolated from the aerial part (leaves, cotyledons and hypocotyl) of

11 days-old seedlings grown on GM medium. For extraction of high molecular weight

RNA, the tissues were frozen and ground in liquid nitrogen and RNA was extracted with

the TRIzol Reagent (Life Technologies) according to manufacturer’s instructions. For

Northern blots, ~10 µg of total RNA was fractionated on 1.2 % formaldehyde-agarose gel

and blotted onto Hybond-NX nylon filter. cDNA probes were labelled by random

priming with [α-32P]dCTP. Equal loading was verified by stripping in boiling 0.5% SDS

and hybridizing with a β–tubulin probe.

For small RNA detection, total RNA was extracted from 11 days-old seedlings as

described (S5). 80 µg of total RNA were analyzed as in (S6), except that a 17%

polyacrylamide gel was used. The gel was soaked in 10 mM phosphate buffer pH 7.2,

followed by 10 min in 20 X SSC and standard Southern transfer (S7) onto Hybond-NX

nylon filter. The filter was probed with STM or GR [α-32P]UTP-labelled riboprobes,

which were hydrolized for 1 hour in 200 µl of 100 mM carbonate buffer (40 mM

NaHCO3, 60 mM Na2CO3, pH 10.2). To probe for miRNAs 157 or 167

(http://cgrb.orst.edu/smallRNA), the filters were stripped in boiling 0.5% SDS and

probed with [γ-32P]ATP-labelled oligonucleotides (5' GTGCTCTCTATCTTCTGTCAA3'

for miRNA157 and 5'TAGATCATGCTGGCAGCTTCA3' for miRNA167) . All blots

were exposed to a Storage Phosphor Screen (Molecular Dynamics) and the images

analyzed with ImageQuant 5.1 (Molecular Dynamics).

RACE-PCR

Detection of RNA 5' ends was performed using the GeneRacer™ Kit (Invitrogen),

without the initial de-capping reaction (S8). After isolation of polyA RNA (PolyATtract

mRNA Isolation System IV - Promega) the GeneRacer™ RNA oligonucleotide (5’-

CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA-3’) was

ligated to exposed 5’ ends and reverse transcription reaction (RT) carried out using an

oligo-dT primer [5’-GCTGTCAACGATACGCTACGTAACGGCATGACAGTG(T)18].

A 10-cycle hot-start polymerase chain reaction (PCR) was performed (94°C/4 min

followed by 10 cycles of 94°C/30 sec and 72°C/90 sec), using a primer specific for the

GeneRacer™ RNA oligonucleotide (GeneRacer™ 5’ Primer: 5’-

CGACTGGAGCACGAGGACACTGA-3’) and STM-specific primer (STMrev1: 5’-

TGTCCTCCGACGGCTTCCAATGC-3’). The PCR products were purified with the

QIAquick PCR purification kit (QIAGEN) and used as templates for a second 40-cycle

hot-start PCR (94°C/4 min then 40 cycles of 94°C/30 sec and 72°C/90 sec) with nested

primers (GeneRacer™ 5’ Nested Primer, 5’-

GGACACTGACATGGACTGAAGGAGTA-3’, and STMrev2, 5’-

CCGACGGCTTCCAATGCCGTTTC-3’). These PCR products were separated on a 1%

agarose gel and transferred to Hybond-NX nylon filter by Southern blotting (S7). The

filter was probed with the full-length STM cDNA, labelled by random priming with [α-

32P]dCTP. Cloning and sequencing of the most prominent PCR product (approx. 1 Kb)

confirmed that it corresponded to full-length cDNA, in which the sequence immediately

following the RNA adaptor sequence was 5' ACGGGATCCATG…3' (plant

transformation vector sequences italicized, transcriptional start from the 35S promoter in

boldface, and STM start codon underlined). Similar results (amplification of the full-

length STM-GR cDNA, with no detectable cleavage products) were obtained using the

GeneRacer™ 5’ primer and a primer directed to the NOS terminator sequence at the 3’

end of STM-GR (NOSrev: 5’ATCATCGCAAGACCGGCAACAGG3’).

For quantitative analysis, the standard was the PCR product obtained with the

GeneRacer™ 5’ Nested Primer and STMrev2, purified with the QIAquick kit (QIAGEN)

and quantified by absorbance at 260 nm. Serial dilutions of the standard and of the

products of the initial 10-cycle PCR of the RACE procedure were used as templates for

hot start PCR (94°C/5 min followed by thirty cycles of 94°C/30 sec, 60°C/60 sec and

72°C/90 sec), using the GeneRacer™ 5’ Nested Primer and primer STMrev3: 5'

CCTGTTGGCCCCATAGATGC 3' (this primer combination allowed more sensitive

amplification with fewer non-specific products). After electrophoresis through 1.2 %

agarose, the ethidium bromide-stained gel was scanned using a Typhoon 8600 scanner

(Molecular Dynamics), with the laser set to 532 nm and emission filter to 610 nm. Band

intensities were measured using ImageQuant 5.1 (Molecular Dynamics).

Map-based cloning and complementation

Homozygous xrn4-1, STM-GR (L-er) was crossed to the Columbia (Col-0)

accession. xrn4-1, STM-GR homozygous mutants were selected in the F2 generation,

based on wild-type growth on medium containing Kanamycin 50 µg/mL and

dexamethasone 1 µM. We initially mapped the mutation to chromosome 1 between

markers pSSLP3 (19.32 Mb) and nga280 (20.15 Mb). One thousand xrn4-1, STM-GR F2

seedlings were then used for fine-mapping, with primers designed using information from

the CEREON collection (http://www.arabidopsis.org/) and dCAPS Finder 2.0

(http://helix.wustl.edu/dcaps/dcaps.html) (S9). The interval was narrowed to an interval

of 100 kb, spanning genes At1g54430 to At1g54710 (http://www.arabidopsis.org/).

Sequencing of candidate genes identified the xrn4-1 and xrn4-2 mutations.

Complementation of xrn4-1 was performed with a genomic fragment amplified by

PCR with primers 5'ATTTTGGAGCTCCTGAATTCAACAATGACGTACTT3' and

5'TTGGAGATGTCCTACTTGTGGAGCTCCTCAGA3'. The PCR product was cloned

as a SacI fragment and the sequence was verified. The fragment was then subcloned into

pPZP222 (S10) and transformed into homozygous xrn4-1, STM-GR plants, using the

floral dip method (S11). Complementation was seen in five independent transformed

lines, based on return of the STM-GR phenotype in xrn4-1, STM-GR seedlings grown on

medium containing kanamycin 50 µg/mL, gentamycin 100 µg/mL and dexamethasone 1

µM.

In situ RNA hybridization

Tissue fixation, sectioning and in situ hybridization were performed as described

(S12). Riboprobes were labelled with digoxigenin (Roche Molecular Biochemicals) and

alkaline phosphatase activity was detected with 5-bromo-4-chloro-3-indolyl phosphate

toluidine salt (BCIP) and nitro blue tetrazolium chloride (NBT) (Roche Molecular

Biochemicals) according to the manufacturer's instructions.

Supporting figures

Fig. S1: Small RNA blots comparing plants with STM-GR present (+) or absent (-) and

wild-type (+) or mutant (-) for XRN4 and SDE1.

(A) Blot hybridized with GR probe, showing siRNAs in STM-GR, xrn4-1 seedlings, but

not in STM-GR, xrn4-1, sde1-1. (B) Same blot, probed for miRNA167 as a loading

control and size marker.

Fig. S2: xrn4-1 suppressed a STM-GR transgene different from the one used in the mutant

screen. The same construct present in the original STM-GR line was transformed

independently into Arabidopsis L-er and crossed to xrn4-1 that had been segregated from

the original transgene. When grown on medium containing DEX, the new transgenic line

showed the typical STM-GR phenotype (A), which was suppressed in xrn4-1 background

(B). Bar: 1 mm.

Fig. S3: xrn4 mutations and complementation.

(A) Structure of XRN4, with mutations indicated. Three independent xrn4 alleles caused

similar suppression of STM-GR. xrn4-1 had a G to A mutation in the first nucleotide of

the first intron. RT-PCR amplification of the mutant cDNA showed two aberrantly

spliced products, with the last 14 or 35 nucleotides of the first exon deleted, causing

frame shifts and premature termination (asterisks) 36 or 44 amino acids after the start

codon. In xrn4-2, the first nucleotide of the sixth exon is changed from G to A, causing

a non-conservative change (N to D) at amino acid 234, which is highly conserved in the

exonuclease domain (Interpro IPR004859). xrn4-3 had a T-DNA insertion in the 16th

intron, but in this case the consequences for the transcript were not analyzed. The

inverted, duplicated T-DNA insertion in xrn4-3 is not drawn to scale; LB and RB are left

and right borders, respectively.

(B,C) Complementation of xrn4-1. (B) Seedlings grown on medium with DEX 1 µM.

The seedlings were homozygous for xrn4-1 and STM-GR, and segregated a T-DNA

containing the wild-type XRN4 genomic sequence, which caused recovery of the wild-

type STM-GR phenotype (arrows). An individual, complemented xrn4-1, STM-GR

seedling is shown at higher magnification in (C).

Fig. S4: Quantitative PCR comparing RACE products corresponding to de-capped STM-

GR mRNA from sde1-1, STM-GR and sde1-1, xrn4-1,STM-GR seedlings.

(A) Standard curve. The standard template (see methods) was diluted to a concentration

range comparable to that of the RACE products. The number of PCR cycles was chosen

to yield clearly measurable products (569 bp, corresponding to the 5' end of STM-GR)

while maintaining a linear relationship between input template and PCR product.

(B) Linear relationship between the amount of template (in fg, x-axis) and the area of

fluorescence peaks corresponding to the bands shown in (A). The linear equation was

calculated using the least squares method (R2=0.957).

(C) PCR amplification of serial 2-fold dilutions (1: undiluted; 2, 4 and 8: 1/2, 1/4 and1/8

of original concentration, respectively) of RACE samples (see methods) prepared from

sde1-1 and sde1-1, xrn4-1 seedlings in three independent experiments (No.1-3). PCR and

analysis were done in parallel with the standards shown in (A) (i.e., same PCR

amplification, same gel).

(D) Peak areas measured for the bands shown in (A) and (C), corresponding estimates of

initial template DNA (calculated using the linear equation shown in (B) and ratio between

estimated initial template in sde1-1, xrn4-1 and sde1-1 samples in the three experiments.

The sample dilution indicated was the highest dilution that still gave clearly measurable

peaks for both samples.

Fig. S5: XRN4 expression detected by RNA in situ hybridization. XRN4 mRNA (purple

signal) was detected throughout the shoot, including the meristem and in the vasculature

and mesophyll of leaves.

(A,C) Longitudinal section through the meristem (m) and leaves (l) of a wild-type

seedling, hybridized with XRN4 antisense probe (A) or GR sense probe as a negative

control (C).

(B,D) Transversal section through a leaf lamina, hybridized with XRN4 antisense probe

(B) or GR sense probe as a negative control (D).

Bar: 100 µm.

Supporting References

S1. D. Valvekens, M. Vanmontagu, M. Vanlijsebettens, Proc. Natl. Acad. Sci. U. S.

A. 85, 5536 (1988).

S2. J. L. Gallois, C. Woodward, G. V. Reddy, R. Sablowski, Development 129, 3207

(2002).

S3. M. Lenhard, G. Jurgens, T. Laux, Development 129, 3195 (2002).

S4. T. Dalmay, A. Hamilton, S. Rudd, S. Angell, D. C. Baulcombe, Cell 101, 543

(2000).

S5. J. L. White, J. M. Kaper, J. Virol. Methods 23, 83 (1989).

S6. G. Szittya, A. Molnar, D. Silhavy, C. Hornyik, J. Burgyan, Plant Cell 14, 359

(2002).

S7. J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning - A Laboratory

Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, ed. 2nd.,

1989).

S8. C. Llave, Z. X. Xie, K. D. Kasschau, J. C. Carrington, Science 297, 2053 (2002).

S9. M. M. Neff, E. Turk, M. Kalishman, Trends Genet. 18, 613 (2002).

S10. P. Hajdukiewicz, Z. Svab, P. Maliga, Plant Mol.Biol. 25, 989 (1994).

S11. S. J. Clough, A. F. Bent, Plant J. 16, 735 (1998).

S12. P. R. Fobert, V. Gaudin, P. Lunness, E. S. Coen, J. H. Doonan, Plant Cell 8, 1465

(1996).