A homozygous FITM2 mutation causes a deafness-dystonia ... · Key words: FITM2, lipid droplets,...
Transcript of A homozygous FITM2 mutation causes a deafness-dystonia ... · Key words: FITM2, lipid droplets,...
© 2016. Published by The Company of Biologists Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution and reproduction in any
medium provided that the original work is properly attributed.
A homozygous FITM2 mutation causes a deafness-dystonia
syndrome with motor regression and signs of ichthyosis and
sensory neuropathy
Celia Zazo Seco1,2,*, Anna Castells-Nobau3,4.*, Seol-hee Joo5, Margit Schraders1,4, Jia Nee
Foo6, Monique van der Voet3,4, S. Sendhil Velan7,8, Bonnie Nijhof3,4, Jaap Oostrik1,4, Erik de
Vrieze1,4, Radoslaw Katana5, Atika Mansoor9, Martijn Huynen10, Radek Szklarczyk10, Martin
Oti2,10,11, Lisbeth Tranebjærg12,13,14, Erwin van Wijk1,4, Jolanda M. Scheffer-de Gooyert3,4,
Saadat Siddique15, Jonathan Baets16,17,18, Peter de Jonghe16,17,18, Syed Ali Raza Kazmi9,
Suresh Anand Sadananthan7,8, Bart P. van de Warrenburg4,19, Chiea Chuen Khor6,20, Martin
C. Göpfert5, Raheel Qamar21,22,#, Annette Schenck3,4,#, Hannie Kremer1,3,4,#,23, Saima
Siddiqi9,#,23
1- Department of Otorhinolaryngology, Hearing & Genes, Radboud university medical
center, Nijmegen, 6525GA, the Netherlands;
2- The Radboud Institute for Molecular Life Sciences, Radboud university medical center,
Nijmegen, 6525GA, the Netherlands;
3- Department of Human Genetics, Radboud University Medical Center, Nijmegen, 6525GA,
The Netherlands;
4- Donders Institute for Brain, Cognition and Behaviour, Radboud university medical center,
Nijmegen, 6525GA, The Netherlands;
5- Department of Cellular Neurobiology, University of Göttingen, Göttingen, 37077,
Germany;
6- Human Genetics, Genome Institute of Singapore, Agency for Science, Technology and
Research, Singapore, 138672, Singapore;
7- Laboratory of Molecular Imaging, Singapore Bioimaging Consortium, A*STAR, Clinical
Imaging Research Centre, NUS-A*STAR, Singapore, 138667, Singapore;
8 - Singapore Institute for Clinical Sciences, A*STAR, Clinical Imaging Research Centre,
NUS-A*STAR, 117609, Singapore;
9- Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, Pakistan;
10- Center for Molecular and Biomolecular Informatics, Radboud university medical center,
Nijmegen, 6525GA, the Netherlands;
11- Department of Molecular Developmental Biology, Radboud University, Nijmegen,
6525GA, The Netherlands;
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
http://dmm.biologists.org/lookup/doi/10.1242/dmm.026476Access the most recent version at DMM Advance Online Articles. Posted 15 December 2016 as doi: 10.1242/dmm.026476http://dmm.biologists.org/lookup/doi/10.1242/dmm.026476Access the most recent version at
First posted online on 15 December 2016 as 10.1242/dmm.026476
12- Wilhelm Johannsen Centre for Functional Genome Research, Department of Cellular and
Molecular Medicine (ICMM), The Panum Institute, University of Copenhagen, Copenhagen,
2200, Denmark;
13- Department of Otorhinolaryngology, Head & Neck Surgery and Audiology, Bispebjerg
Hospital/Rigshospitalet, Copenhagen, 2400, Denmark;
14- Clinical Genetic Clinic, Kennedy Center, Copenhagen University Hospital,
Rigshospitalet, Glostrup, 2600, Denmark;
15- National Institute of Rehabilitation Medicine (NIRM), Islamabad, Pakistan;
16- Neurogenetics Group, VIB-Department of Molecular Genetics, University of Antwerp,
Antwerp, 2610, Belgium;
17- Department of Neurology, Antwerp University Hospital, Antwerp, 2000, Belgium.
18- Laboratories of Neurogenetics and Neuropathology, Institute Born-Bunge, University of
Antwerp, Antwerp, 2000, Belgium;
19- Department of Neurology, Radboud University Medical Center, 6525GA, Nijmegen, the
Netherlands;
20- Singapore Eye Research Institute, Singapore; Department of Biochemistry, Yong Loo
Lin School of Medicine, National University of Singapore, 168751, Singapore;
21- COMSATS Institute of Information Technology, Islamabad, Pakistan;
22- Al-Nafees Medical College & Hospital, Isra University, Islamabad, Pakistan;
23- Corresponding author
Corresponding authors:
Prof. dr. Hannie Kremer
Tel.: +31 (0)24 36 10487
Fax: +31 (0)24 36 68752
Dr. Saima Siddiqi
Tel.: +92 (0)51 91 06281
Fax: +92 (0)51 91 06283
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Key words: FITM2, lipid droplets, Drosophila, hearing impairment, motor development,
dystonia
SUMMARY STATEMENT
Although FITM2 is known to function in lipid droplet synthesis and metabolism, the loss of
FITM2 function in humans causes syndromic hearing loss without any signs of a
lipodystrophy.
ABSTRACT
A consanguineous family from Pakistan was ascertained with a novel deafness-dystonia
syndrome with motor regression, ichthyosis-like features and signs of sensory neuropathy. By
applying a combined strategy of linkage analysis and whole-exome sequencing in the
presented family, a homozygous nonsense mutation, c.4G>T (p.Glu2*), in FITM2 was
identified. FITM2 and its paralog FITM1 constitute an evolutionary conserved protein family
involved in partitioning of triglycerides into cellular lipid droplets. Despite the role of FITM2
in neutral lipid storage and metabolism, no indications for lipodystrophy were observed in the
affected individuals. In order to obtain independent evidence for the involvement of FITM2
in the human pathology, downregulation of the single Fitm ortholog, CG10671, in
Drosophila melanogaster was pursued using RNA-interference. Characteristics of the
syndrome, including progressive locomotor impairment, hearing loss and disturbed sensory
functions, were recapitulated in Drosophila, which supports the causative nature of the
FITM2 mutation. Mutation-based genetic counseling can now be provided to the family and
insight is obtained in the potential impact of genetic variation in FITM2.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
INTRODUCTION
Hearing involves the transformation of sounds into electrical signals by the inner ear and the
subsequent processing of these signals along the central auditory pathways. Mutations in
more than hundred genes cause auditory malfunction and hearing impairment (See URL,
Hereditary hearing loss homepage). Defects in the proteins that function in the inner ear can
give rise to hearing impairment only (non-syndromic) or, as the function of implicated
proteins is often not limited to the auditory system, they can result in multisystem disorders
(syndromic hearing impairment).
Deafness-dystonia syndromes are among the more than 400 syndromic forms of
hearing impairment described to date (Toriello et al., 2004;Kojovic et al., 2013a). Deafness-
dystonia is clinically and etiologically heterogeneous and in many of the investigated cases
the underlying causes remain elusive (Kojovic et al., 2013a;Kojovic et al., 2013b). For part
of the cases with a causative mutation identified, disruption of energy homeostasis and/or
metabolism are emerging as a common theme. This is true for Mohr-Tranebjaerg syndrome
(MIM# 304700) with mutations in TIMM8A (Jin et al., 1996) (MIM# 300356), and for a
number of rare mitochondrial disorders with mutations in mitochondrial genes as well as for
SUCLA2-associated disease (MIM #612073) (Carrozzo et al., 2007).
Cellular energy can be stored as neutral lipids in specialized organelles, the lipid
droplets (LDs) (Walther et al., 2012). LDs also function in the modulation of cellular
signaling, lipid metabolism, transcriptional regulation, autophagy and immunity (Welte,
2015). Defects in genes that affect LD biogenesis and/or function can be associated with
hereditary lipodystrophies or motor neuropathies without obvious effects on lipid storage and
metabolism (Fujimoto et al., 2011). Seipin, for example, which is encoded by BSCL2 (MIM#
606158), is an endoplasmic reticulum (ER) protein involved in LD formation and
maintenance as well as in adipocyte differentiation (Cui et al., 2011;Tian et al., 2011). Loss-
of-function mutations in BSCL2 lead to Berardinelli-Seip congenital lipodystrophy (MIM#
269700), whereas gain-of-toxic-function mutations in BSCL2 cause a motor neuron disease
(MIM# 600794) (Ito et al., 2009;Magre et al., 2001;Yagi et al., 2011).
The Fat storage-Inducing TransMembrane (FITM) protein family consisting of two
conserved proteins, FITM1 and FITM2, is involved in LD partitioning and energy
metabolism (Miranda et al., 2011;Kadereit et al., 2008;Gross et al., 2010;Gross et al.,
2011;Choudhary et al., 2015). FITM1 (MIM# 612028) is primarily expressed in skeletal
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
muscle and, at lower levels, in heart. FITM2 (MIM# 612029) is ubiquitously expressed at low
levels (i.e. in brain, placenta, skeletal muscle, heart, kidney, pancreas, liver, lung, spleen and
colon) (Kadereit et al., 2008). Expression of FITM proteins in human adipose tissue has not
been described yet. In mouse, however, Fit2 expression is demonstrated to be highest in
brown and white adipose tissues (Kadereit et al., 2008). Deficiency of Fit2 in mouse adipose
tissue results in progressive lipodystrophy and postnatal whole body Fit2 knockout is lethal
(Miranda et al., 2014;Goh et al., 2015). FITM2 is part of the FITM2-R3HDML-HNF4A locus
that is associated with type 2 diabetes, but no phenotypes in humans have hitherto been
ascribed specifically to either of the two FITM genes (Cho et al., 2012).
In this study, we identified a homozygous truncating mutation in FITM2 in a
consanguineous family of Pakistani origin with Siddiqi syndrome, a novel and characteristic
combination of clinical features of progressive sensorineural hearing impairment, delayed
development and regression of motor skills, dystonia, low body mass index (BMI), an
ichthosis-like appearance of the skin and signs of a sensory neuropathy. No indications of a
lipodystrophy were present in the affected individuals. RNAi-induced gene down-regulation
in Drosophila melanogaster recapitulated several aspects of the human phenotype,
supporting the link between the syndrome and mutations in FITM2.
RESULTS
Clinical and paraclinical evaluations of the family
Clinical observations of affected individuals
A consanguineous family was ascertained from the Punjab region in Pakistan with five
siblings affected by syndromic hearing impairment and three healthy siblings and parents
(Fig. 1A). All affected individuals had global developmental delay and subsequent neuro-
regression. Sensorineural hearing impairment was the first symptom of the disease at the age
of about six months, and progressed to profound in about ten years (Fig. 1B). No intervention
had been undertaken for the hearing impairment of the affected individuals, whose speech
was limited to single words. Delayed motor development was evident in all five affected
individuals. Four of them only walked independently at the age of three years, whereas
individual II:6 never walked independently. The three oldest affected individuals displayed
regression in their motor skills from six years of age, with a gradual loss of head control and
the ability to sit and walk by the age of ten years. Fine motor skills were poor due to dystonic
hand movements and finger deformities. Affected individuals were only able to feed
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
themselves but needed assistance in other daily living tasks. Significant dystonic limb
movements were present in three cases and truncal dystonia was observed in individuals II:5
and II:8. Contractures, including pes cavus deformities, were seen in all three dystonic
individuals due to long-standing immobility and dystonia.
There were no signs of spasticity. Muscle wasting of the lower limbs was observed, but
given the results of neurophysiological measurements this might more likely be due to
immobility rather than to primary myopathy or motor neuropathy. All affected individuals
had sensory complaints: two had non-specific pain in their joints and the remaining three
experienced paraesthesia or ‘burning sensation’ in their limb peripheries, joints and trunk.
Pain sensation was tested in persons II:5 and II:6 and found to be absent in the upper limbs
and face but preserved in the trunk and lower limbs. Seizures were experienced only by
individual II:1 since the age of 15 years.
All five affected individuals displayed ichthyosis-like whitish scaling of the skin with
more prominent abnormalities on the shin and scarring alopecia. All five individuals also
were poorly thrived and had low weights. They did not display dysmorphic features and their
daily life behavior did not suggest severe cognitive dysfunction or visual abnormalities. The
salient clinical features of the affected individuals are summarized in Table 1.
Clinical examinations of affected individuals
Otological examination, tympanometry and pure-tone audiometry were performed in
individuals II:1, II:5 and II:6 at the ages of 19, 10, and eight years, respectively. No external
or middle ear abnormalities were noticed and tympanograms were normal for both ears. Pure-
tone audiograms displayed bilateral, symmetric, severe or profound hearing impairment,
which is sensorineural since bone conduction thresholds were in accordance with air
conduction thresholds (Fig. 1B). Brainstem evoked response audiometry (BERA) was
performed for II:1 and II:5 and did not reveal any waveforms up to 90 dB, for both ears.
There were no signs of muscle damage, liver or kidney dysfunction since serum levels
of glutamic oxaloacetic transaminase (SGOT), creatine phosphokinase (CPK), lactate
dehydrogenase (LDH) and aldolase were found to be within the normal range (Table 2).
Fasting glucose levels were determined to be normal as well as fasting serum levels of
triglycerides (Table 2).
Nerve conduction studies were performed for individual II:1 at the age of 14 years. For
the left tibial nerve, small Compound Muscle Action Potentials (CMAP) were measured with
normal motor conduction velocity. Normal CMAP and motor conduction velocities were
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
observed in the left Median and Ulnar nerves. Also, sensory action potentials and conduction
velocities in the left Median and Ulnar nerves were found to be normal. Needle EMG was
normal in deltoid, anterior tibial and gastrocnemius muscles. Findings were interpreted as
resulting from decreased muscle bulk.
MRI of the abdomen of individuals II:5 and II:6, and of II:1 as a control did not
demonstrate any signs of lipodystrophy. Values of liver fat content and subcutaneous adipose
tissue (SAT) and visceral adipose tissue (VAT) volumes were in the normal range. MRI of
the brain with particular attention to the basal ganglia was performed for individuals II:1 and
II:5 and showed no abnormalities, neither in the basal ganglia nor in other regions. A skeletal
muscle biopsy (II:1) did not reveal myopathic or neurogenic changes.
In summary, the syndrome in the family is characterized by a novel combination of
features which are progressive hearing impairment, delayed development and subsequent
regression of motor skills, dystonia and low BMI. In addition, ichthyosis-like skin changes
are associated with this phenotype and there is a suggestion of small fiber neuropathy
(burning sensations, non-length dependent distribution of sensory abnormalities, normal
sensory conduction studies). We propose to call the syndrome “Siddiqi syndrome” after Dr.
Saima Siddiqi, who initiated the research in this family.
Whole-exome sequencing identified a nonsense mutation in FITM2
Homozygosity mapping and linkage analysis of all family members revealed a single
homozygous region of 8.4 Mb on chromosome 20q12–q13.2 (rs2903624–rs6096425) (Table
S2). LOD score calculations using 58,023 independent SNPs genome-wide in linkage
equilibrium (pairwise r2 for each SNP <0.1) revealed a maximum LOD score of 4.00 (Fig.
S1). Prolonged ancestral consanguinity that might reduce the significance of linkage peaks is
highly unlikely as shown by the percentage of the genomes present in homozygous runs of
SNPs (> 1Mb) and the pairwise checks for familial relationships (Table S3, see also Fig. S2).
The only linkage region contained 125 genes (USCS, Ref Seq, hg19). Whole-exome
sequencing (WES) was performed in the non-affected parents (I:1, I:2) and in two affected
siblings, (II:5, II:6). The single homozygous 8.4 Mb region on chromosome 20q12–q13.2
was fully covered in the enrichment kit. In the linkage region, only non-synonymous exonic
and canonical splice-site variants were selected that occurred with a frequency of less than
5% in the 1000 genomes and HapMap populations, and that were homozygous in both
affected siblings and heterozygous in the parents (Tables S4, S5). This revealed a single
homozygous nonsense mutation in the second codon, c.4G>T (p.Glu2*, NM_001080472.1;
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Fig. 2), of FITM2 that cosegregated in the family with the disease (Fig. 1A, Table S5). This
FITM2 c.4G>T variant was neither present in 274 Pakistani control alleles nor in whole-
genome or -exome databases (see ‘Subjects and Methods’). In order to exclude other
potentially causative variants, especially in genomic regions with a LOD score ≥-2, we
selected all variants with a MAF <5 % that were heterozygous in the parents and compound
heterozygous or homozygous in both affected sibs. These analyses did not unveil any variants
potentially associated with the syndrome (Tables S5, S6, Fig. S3).
Since postnatal whole-body Fit2 knockout in mouse is lethal (Goh et al., 2015), we
considered the possibility that the present mutation might not lead to complete loss of FITM2
function, potentially due to downstream alternative translation initiation sites. We expressed
C-terminally Strep/FLAG-tagged wild-type and p.Glu2* FITM2 in HEK293T cells to
identify potential N-terminally truncated FITM2 proteins. Even after FLAG-affinity
purification, no indications for significant amounts of alternative FITM2 products were
obtained (Fig. 2B). We conclude that with high likelihood the FITM2 mutation results in a
complete loss of FITM2 function.
To further address the involvement of FITM2 mutations in hearing impairment
syndromes with characteristics overlapping those in the present family, FITM2 was
sequenced in six index patients with deafness and a sensory polyneuropathy. Also, four index
cases were tested who were suspected of Mohr-Tranebjaerg syndrome and who did not carry
TIMM8A mutations. Mutation analysis did not reveal biallelic variants of FITM2 with allele
frequencies < 5% in the HapMap, 1000 genomes or ExAC databases.
Drosophila models of FITM2
To gain independent support for the role of FITM2 in the phenotype of the presented family
and to dissect the underlying tissue-specific pathologies, we studied FITM function in
Drosophila melanogaster. The Drosophila genome harbors a single, so far uncharacterized
gene representing the human FITM protein family (FITM1 and FITM2), CG10671, which we
accordingly name Fitm. FITM1 and FITM2 share 25% amino sequence identity with their
annotated ortholog Fitm (see http://www.ensembl.org/). According to ModEncode and
FlyAtlas expression databases (Chintapalli et al., 2007;Graveley et al., 2011), Fitm is
expressed widely throughout developmental stages and tissues, with highest expression in
adult fat body, heart and carcass. The lack of genetic redundancy of Fitm in Drosophila
suggests that its complete absence in a null mutant is likely to lead to lethality in early stages
of development. Therefore, we pursued to decrease the expression of Fitm by constitutive
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
RNA-mediated interference (RNAi) with the UAS-GAL4 system. The efficacy of Fitm
downregulation was determined by qRT-PCR upon ubiquitous knockdown using the
αTub84B-GAL4 driver. All RNAi lines presented comparable levels of Fitm downregulation
with respect to the corresponding control line. The decrease in Fitm transcripts was 92%
(p=0.003) for Fitm RNAi-1A, 80% (p=0.008) for Fitm RNAi-1B and 80% for Fitm RNAi-2
(p=0.008) as compared to the respective control lines (Fig. S4). Since RNAi-1A and -1B
carry the same RNAi construct, we prioritized RNAi-1A and RNAi-2 lines for our
experiments. For the experiments that did not give conclusive data for one of the tested
conditions and allowed to use females, we in addition also investigated the X chromosome-
linked RNAi line RNAi-1B.
Knockdown of Drosophila Fitm causes locomotor impairment
To address locomotor function, impaired in the presented family, we first subjected Fitm
knockdown models to an explorative test, the negative geotaxis test in which the climbing
capacity was visually evaluated. Flies with Fitm knockdown mediated by the αTub84B-
GAL4 and Mef2-GAL4 drivers displayed a decreased climbing capability at 4, 12 and 21
days after eclosion (Movie S1). The latter driver is highly expressed in muscle cells. Upon
Fitm knockdown mediated by the fat body-specific C7-GAL4 driver, flies were severely
impaired in climbing at day 21 although normal at days 4 and 12 after eclosion. This
locomotion phenotype was highly consistent in both RNAi lines tested with ubiquitous,
preferential skeletal muscle and fat body promoters. Pan-neuronal knockdown of Fitm with
the w; UAS-Dicer-2; elav-GAL4 driver and w, UAS-Dicer-2; n-syb-GAL4 did not lead to
obvious anomalies, flies show normal climbing behavior.
To further characterize the locomotor abilities of Fitm knockdown flies in a quantitative
manner, the island assay (Schmidt et al., 2012) was performed using the two driver lines that
resulted in impaired climbing in the negative geotaxis test. This revealed that ubiquitous Fitm
knockdown leads to severe locomotor impairment, resulting in a significantly higher numbers
of flightless flies at days 4 and 12 after eclosion (p<0,0001) (Fig. 3A). Upon downregulation
of Fitm using the Mef2-GAL4 driver more than 98% of the flies displayed a flightless
phenotype at 4 and 12 days old (p<0,0001 for all analyzed conditions) (Fig. 3B). The effect
of fat body-specific Fitm knockdown on locomotion was evaluated because of the
evolutionary conserved role of FITM2 in LD biogenesis in adipose tissue (Kadereit et al.,
2008;Miranda et al., 2014) and because of high Fitm expression in Drosophila fat bodies. In
agreement with this, a progressive locomotor impairment was observed. A maximum of 13%
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
flightless flies were observed at 4 days past eclosion and a minimum of 51% flightless flies
were observed at 12 days which further raised to more than 78% at 21 days past eclosion
(p<0,001 for all analyzed conditions, Fig. 3C). Pan-neuronal knockdown of Fitm with the w;
UAS-Dicer-2; elav-GAL4 and w, UAS-Dicer-2; n-syb-GAL4 drivers did not lead to any
significant locomotor impairment in the island assay (Fig. S5).
We visually evaluated body and wing movements of the flightless flies, since sensory
motor coordination is essential for flight initiation and a sensory neuropathy is part of the
phenotype in the Pakistani family. At the initiation of flight, flies first raise their wings to a
stable position that will be held for a few seconds before take-off (Card et al., 2008). In a
subset of Fitm knockdown flies, but not in controls, these flight initiation movements were
uncoordinated. The knockdown flies failed to upstroke their wings for take-off and instead
displayed fast wing movements, and uncontrolled jumping and shaking of their corpus
(Movie S2). Upon pan-neuronal Fitm knockdown, flies did not display this phenotype.
In conclusion, loss of Fitm expression in Drosophila causes locomotor defects and Fitm
knockdown preferentially in muscle or specifically in the fat body suffices to induce this
phenotype.
Downregulation of Fitm causes abnormal dendrite branching and field coverage of
Drosophila multi-dendritic sensory neurons
Since signs of a sensory neuropathy are part of the syndrome caused by a nonsense mutation
in FITM2, we evaluated the role for Fitm in sensory neuron development by inspecting the
dorsal class IV dendritic arborization C (ddaC) neurons in third instar larvae. These
nociceptive neurons show a complex, but rather stereotypic dendritic branching with a large
field of coverage (Fig. 4A) that, together with other class IV dendritic arborization neurons,
tile the larval body wall. Fitm expression was downregulated by RNAi in class IV dendritic
arborization neurons using a combination of the 477-GAL4 and ppk-GAL4 drivers, which
simultaneously induce expression of the fluorescent marker UAS-mCD8::GFP. A driver line
with a combination of two GAL4 elements was used to increase the number of GAL4
molecules to bind UAS-mCD8::GFP, UAS-Fitm RNAi, and UAS-Dicer-2 to enhance their
expression. Knockdown of Fitm upon induction of Fitm RNAi-1A resulted in a strong
reduction of the dendritic field coverage in a subset of larvae (5 of 18 analyzed), with contact
to the neighboring sensory neurons being completely absent (Fig. 4B). We have included a
supplementary figure with the obtained microscopic images of the traced neurons and
representive images of untraced neurons of knockdown flies that were evaluated as normal
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
(Fig. S6). A dendritic field coverage defect phenotype was also observed in a Fitm RNAi-2,
but only occurred in one of 40 larvae analyzed (Fig. S7A–F). It was however never observed
in any control larva, neither during this nor other studies (Mukhopadhyay et al., 2010;Kramer
et al., 2011;Klein et al., 2015). Reduced penetrance of RNAi-induced phenotypes is a known
phenomenon and could be dependent on the timing and efficiency of knockdown (Mauss et
al., 2009;Godenschwege et al., 2006). In our experiment, we used genetic tools and
conditions to maximize RNAi efficiency (2 driver elements, UAS-Dicer-2, also a temperature
of 28°C). Alternatively, reduced penetrance can also be observed in null mutants when the
function of the affected gene can partially be compensated by others (Raj et al.,
2010;Chalancon et al., 2012; Cooper et al., 2010).
To gain more insight in the underlying defects of the abnormal field coverage, we
performed manual tracing and quantitative analysis on the control and abnormal Fitm RNAi-
1A dendritic trees (Fig. 4C–G; Tables S8, S9). Sholl analysis showed that the dendritic field
coverage of controls has a maximum radius of 350±21 μm, the dendritic field coverage in
Fitm RNAi-1A is 60% the size with a significantly smaller radius of 210±39 μm (p=0.0001)
(Fig. 4C). Analysis of the dendritic trees revealed a reduced average branch path length
(p=0.01, Fig. 4D) defined as the distance between two branching points, a reduced
accumulative branch path length (p=<0.0001, Fig. 4E) defined as sum of the distance of all
branches contained in a neurons, and a decreased number of branches (p=<0.0001, Fig. 4F);
all in concordance with the reduced field of coverage. The maximal branch order was not
significantly decreased (p=0.2, Fig. 4G) defined as the order of branch respect the soma, each
branching point will lead to branches with a higher branch order. While only one Fitm RNAi-
2 larva was found to be affected, some aspects are similar to the RNAi-1A phenotype.
Analysis of the affected Fitm RNAi-2 dendritic tree revealed a low average branch path
length and accumulative branch path length (Fig. S7C, D, respectively), but the number of
branches and branch order were high (Figure S7E, F; Table S10).
Taken together, our results suggest that Fitm is required for normal branching and
dendritic field coverage in a subset of Drosophila ddaC nociceptive sensory neurons.
Fitm is required for normal hearing in Drosophila
Affected members of the presented family displayed postnatal sensorineural hearing
impairment that progressed to profound. Therefore, we tested whether Fitm is implicated in
Drosophila hearing by analyzing sound-evoked mechanical and electrical responses of the
antennal hearing organ (Fig. 5) upon ubiquitous or pan-neuronal knockdown. To evoke
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
sound-responses, we exposed the flies to pure tones of different intensities at the individual
mechanical best frequency of their antennal sound receiver (Göpfert et al., 2006). The
resulting vibrations of this receiver were measured as well as the ensuing compound action
potentials (CAPs) propagated by the axonal projections of the fly’s auditory sensory neurons
in the antennal nerve (Fig. 5A). In genetic background controls, sound particle velocities
exceeded ca. 0.05 mm s-1 evoked CAP responses (Fig. 5B), consistent with published data on
wild-type flies (Senthilan et al., 2012). As in wild-type flies, the sound-induced displacement
of the antenna also scaled nonlinearly with the intensity of sound stimulation (Fig. 5A),
displaying a compressive nonlinearity that, arising from motile responses of auditory sensory
neurons, actively amplified the antennal displacement response to faint sounds with an
amplification gain of approximately seven (Fig. 5C). Ubiquitous knockdown of Fitm with
Fitm RNAi-1A significantly increased the threshold of the sound-evoked CAP responses
(Fig. 5B, Table S12), documenting a loss in auditory sensitivity. Auditory sensitivity seemed
uncompromised by pan-neural knockdown with Fitm RNAi-1A and knockdown with Fitm
RNAi-1B or RNAi-2 (Fig. 5C), yet significant hearing impairment was detected in all three
RNAi lines upon ubiquitous knockdown when we examined the nonlinear scaling of their
antennal vibrations. RNAi-1A- and RNAi-1B-induced knockdown reduced this nonlinear
scaling, significantly lowering the mechanical amplification gain (Fig. 5C, Table S12).
Moreover, all three knockout constructs significantly increased the best frequency of the
antennal sound receiver (Fig. 5D, Table S12), documenting defects in the active frequency
tuning of the receiver, which is achieved through mechanical amplification.
Together, these results document that Drosophila auditory sensory neurons require
Fitm for normal mechanical amplification in hearing, which is linked to auditory stimulus
transduction and auditory neuron integrity (Senthilan et al., 2012).
Fitm is important for lipid droplet size in the fat body of adult Drosophila
Having shown a number of parallels between human and Drosophila phenotypes, we finally
sought to evaluate whether Drosophila Fitm functions in LD formation, as previously
reported in other organisms (Kadereit et al., 2008;Gross et al., 2011;Choudhary et al.,
2015;Miranda et al., 2014). We thus knocked down Fitm expression in the fat body and
evaluated LD size. Fitm RNAi-1A and RNAi-1B knockdown flies demonstrated a diminished
LD size as compared to flies of the background line at 4, 12 and 21 days after eclosion (Fig.
6). The Fitm RNAi-2 knockdown flies exhibited a reduction in LD size that started at 12 days
after eclosion (Fig. 6A). Strikingly, all RNAi lines showed a progressive phenotype: the
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
reduction in the LD size was milder or inexistent in young flies (4 days after eclosion) and
more severe in ageing flies (12 and 21 days after eclosion) (Fig. 6A, B).
We conclude that Fitm function in LD formation is conserved in Drosophila (Kadereit
et al., 2008).
DISCUSSION
We have described a family with a novel homozygous truncating mutation, c.4G>T
(p.Glu2*), in FITM2. Affected individuals display Siddiqi syndrome, a novel syndrome
characterized by progressive sensorineural hearing impairment, delayed motor development
and subsequent regression, low BMI, ichthyosis-like skin alterations and signs of a small
fiber neuropathy. Dystonia was observed in part of the affected individuals and seizures and
chronic diarrhea only in the oldest affected sibling. The chronic diarrhea might well be a
symptom of malabsorptive enteropathy which is seen in mouse upon postnatal Fit2 deletion
(Goh et al., 2015). The combination of the disease characteristics is novel although observed
phenotypic characteristics in the family are overlapping with several known monogenic
neurological conditions such as Troyer syndrome (MIM #275900) and deafness-dystonia
syndromes including Mohr-Tranebjaerg syndrome (MIM #304700) and Megdel syndrome
(MIM #614739). To delineate Siddiqi syndrome, further families with FITM2 mutations need
to be identified and evaluated clinically. Currently, it cannot be excluded that part of the
phenotype is resulting from mutations in other genes, especially the characteristics seen in
only part of the cases. However, no homozygous rare variants were identified in the
individuals II:5 and II:6 in autozygous regions (>1Mb) shared by II:1, II:5 and II:6 only.
Also, these regions do not harbor genes known to be associated with dystonia. Similarly,
regions uniquely autozygous in II:1 do not harbor potentially pathogenic heterozygous
variants in both parents to explain seizures and diarrhea. Defects in known deafness genes
that could explain the hearing loss only were also not identified. The causative association of
the syndrome with a loss-of-function mutation in FITM2 is supported by modeling of the
disease in Drosophila melanogaster which has been proven to be a suitable model for
studying conserved aspects of lipid metabolism and LD biology (Tian et al., 2011;Baker et
al., 2007). RNAi knockdown of the single Drosophila Fitm ortholog recapitulated hearing
impairment, locomotor defects, and abnormalities of the sensory system.
Sensorineural hearing impairment is the first symptom of Siddiqi syndrome. The
audiometric evaluations did not allow to discriminate whether the hearing impairment has a
cochlear or retrocochlear neuronal origin. The hearing phenotype resulting from Fitm
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
knockdown in Drosophila was reflecting impaired auditory stimulus transduction and
auditory sensory neuron function which support a sensorineuronal hearing impairment in the
human phenotype. A cochlear component might well contribute to progressive dysfunction of
the auditory system in the patients. LDs are prominent constituents of Hensen cells, which are
highly specialized cells in the organ of Corti. Hensen cell LDs have been suggested to
function in an anti-inflammatory response to prevent cochlear damage (Merchan et al.,
1980;Bell et al., 2004;Kalinec et al., 2009;Urrutia et al., 2015). Also a mechanical function in
modulating sound detection has been proposed for LDs in Hensen cells (Merchan et al.,
1980). Whether vestibular dysfunction is part of the inner ear phenotype could not be
evaluated. Therefore, it remains undetermined whether impaired balance contributed to the
delayed motor development of the subjects.
Of note is that affected individuals do not have signs of a lipodystrophy which is in
contrast to findings on mice where post-differentiation adipose-specific knockout of Fit2
results in progressive reduction of white adipose tissue (Miranda et al., 2014). Functional
redundancy in human adipose tissue might exist for FITM2 through FITM1 which is
apparently not the case in the mouse. In the latter, FIT2 is prominently expressed in adipose
tissue in which FIT1 was not detected (Kadereit et al., 2008). The relative expression levels
of FITM1 and FITM2 in human adipose tissue is hitherto unknown. A further explanation for
the discrepancy in lethality of FITM2/Fit2 loss of function could be the presence of
alternative sites of transcription start in humans resulting in mRNAs that are not affected by
the FITM2 variant. Our experimental set-up for detection of alternative translation initiation
sites cannot exclude such alternative transcription start sites.
The molecular mechanism(s) underlying Siddiqi syndrome are still elusive but might
well be related to the expanding functions of LDs (Welte, 2015;Barbosa et al., 2015).
Disturbance of energy metabolism and homeostasis might be part of the underlying
mechanism(s) as it is suggested for some of the deafness-dystonia syndromes (Jin et al.,
1996;Elpeleg et al., 2005;Engl et al., 2012). In this respect, it is interesting that
overexpression of Fit2 in mouse skeletal muscle reportedly leads to increased energy
expenditure, indicating an unexpected function of FIT2 in regulatory aspects of energy
metabolism (Miranda et al., 2011) which might be critical in tissues that are affected in the
described patients. In connection to this, it is tempting to speculate that altered (regulation of)
mitochondrial function is part of the molecular mechanisms of the disease as indications are
increasing for a functional connection between LDs, and thus FITM2, and other organelles
including mitochondria (Barbosa et al., 2015). Interestingly, mitochondrial dysfunction is
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
indicated to underlie some of the deafness-dystonia syndromes e.g. Mohr-Tranebjaerg
syndrome with defects in TIMM8A. TIMM8A is located in the mitochondrial intermembrane
space and functions in mitochondrial morphology (Engl et al., 2012). Alternative and/or
additional pathogenic mechanisms for the presented syndrome might be related to ER-stress,
analogous to the disease mechanism of motor neuropathies that arise from gain of function
mutations in BSCL2 which encodes seipin, a protein that functions in LD biogenesis (Ito et
al., 2009;Cartwright et al., 2015). Also recently proposed roles of LDs in e.g. immunity,
modulation of nuclear functions, protein degradation, autophagy, and lipid signaling might
contribute to the pathogenesis of the syndrome (Welte, 2015;Pol et al., 2014). Further studies
will be needed to elucidate the molecular mechanisms underlying the syndrome.
In conclusion, we have described a novel deafness-dystonia syndrome that is causally
related to a loss-of-function mutation in FITM2 the phenotypic effects of which are
recapitulated in a Drosophila model. The phenotype of the affected individuals suggests that
in humans, FITM2 function extends beyond its roles in neutral lipid storage and metabolism.
MATERIALS AND METHODS
Patient evaluation
Written informed consent was obtained from individuals I:1 and I:2 and included consent for
themselves and for their offspring who were not able to sign and/or were younger than 18
years when the genetic studies were performed. The human subjects review boards of the
Institute of Biomedical and Genetic Engineering, Islamabad, Pakistan, the medical ethics
committee of the Radboud university medical center, Nijmegen, the Netherlands, and the
Domain Specific Review Board for ethics of the National Healthcare Group Singapore
approved the study protocol.
Patients of the presented family (W09-1008; Fig. 1A) were evaluated by medical specialists
in Pediatrics, Otorhinolaryngology, and Neurology.
Tympanometry, pure-tone audiometry, Brainstem Evoked Response Audiometry
(BERA), Magnetic Resonance Imaging (MRI) of the brain, measurements of fasting levels of
glucose and triglycerides and of other molecules in serum and neurophysiological evaluations
were performed according to standard protocols. Muscle tissue derived from a musculus
vastus lateralis biopsy was embedded in paraffin and stained with hematoxilin-eosin
according to standard protocols.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
MRI of abdomen
The abdominal MR images were acquired from a 3T MR scanner (Tim Trio Siemens) using
two-point Dixon sequence repetition time (TR) = 5.28 ms, echo time (TE)1 = 2.45 ms, TE2 =
3.68 ms, FA = 9 deg, bandwidth1 = 500 Hz Px-1, bandwidth2 = 780 Hz Px-1) and Siemens
body matrix coil after anatomical localization. For the parent (I:1), 80 axial slices with 3 mm
thickness, 0.6 mm interslice gap and in-plane resolution of 1.25 × 1.25 mm were acquired and
52 slices with in-plane resolution of 1.02 × 1.02 mm were acquired for two affected children
(II:5 and II:6). A fully automated segmentation technique was employed to segment and
quantify the abdominal fat volumes between the first (L1) and fifth (L5) lumbar vertebrae
(Sadananthan et al., 2015). First, the fat tissues were separated from non-fat tissues by
intensity thresholding. The extracted fat tissues were then classified into subcutaneous (SAT)
and visceral (VAT) adipose tissues using graph theoretic segmentation.
MR spectroscopy of the liver
Fat content in the liver was determined using 1H magnetic resonance spectroscopy (MRS).
The liver spectra were obtained from a 2 × 2 × 2 cm3 voxel from two locations (right and left
lobes) using a point-resolved spectroscopy (PRESS) sequence (TE = 30 ms, TR = 2000 ms)
and a Siemens body matrix coil. The acquired spectra were fitted using the linear
combination of model spectra (LCModel) (Sadananthan et al., 2015;Provencher, 1993). The
liver fat was determined from the concentration of methyl and methylene groups of lipids and
the unsuppressed water signal and corrected for T2 losses (Cowin et al., 2008).
Genetic analyses
SNP Genotyping
Genomic DNA was isolated from peripheral-blood lymphocytes by standard procedures. All
family members were genotyped employing the HumanOmniExpress BeadChip v1.1
(Illumina, Inc., San Diego, CA) arrays with 719,659 SNPs. Homozygosity mapping using
696,513 autosomal SNPs with genotype calls in all samples (364,151 polymorphic) using
PLINK v1.07 was performed (Purcell et al., 2007). Overlapping homozygous regions >5 Mb
in size present in all affected and absent in the unaffected individuals were selected. Family
relationships among genotyped individuals using identity-by-descent checks were performed.
We further conducted a genome-wide linkage scan using MERLIN 1.1.2 on a pruned subset
of 53,028 independent SNPs (defined as pair-wise r2 < 0.1), as the inclusion of SNPs in
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
strong linkage disequilibrium is known to result in inflation of linkage tests, based on
inheritance of the same ancestral mutant allele (0.001) from both parents (coded as first
cousins) under a recessive model (Abecasis et al., 2002).
We confirmed the reported familial relationships among genotyped samples using PLINK
IBD analysis (--genome), with parent-offspring pairs sharing ~50% of alleles IBD and
~100% of loci sharing 1 out of 2 alleles IBD, and full sibling pairs sharing ~50% alleles IBD
with the expected ~25% of loci sharing 0 alleles IBD, ~50% sharing 1 allele IBD and ~25%
sharing 2 alleles IBD.
Sequence analysis; WES and Sanger sequencing
WES was performed in the non-affected parents, I:1 and I:2, and in two affected siblings, II:5
and II:6 using the Nimblegen SeqCap EZ exome v3 kit and protocol (Roche). The captured
libraries were barcoded, pooled and sequenced on a single lane in a multiplexed 2x101 base
pair Illumina HiSeq 2000 sequencing run. Reads were mapped against the UCSC Genome
Browser Hg19 assembly (build 37) using BWA v1.7 and variants were called using the
Genome Analysis Toolkit (GATK) v2 following the recommended guidelines. Mean
sequence depth was 79.5x with >96% of the exome covered by ≥10 reads. Identified variants
were evaluated with the SIFT tool and checked against public databases of exomic or
genomic variants (1000 genomes, HapMap and NHLBI exome variant server).
Primers for amplification of exons and exon-intron boundaries of FITM2 (uc002xlr.1) were
designed with ExonPrimer. Amplification by PCR was performed on 40 ng of genomic DNA
with Taq DNA polymerase (Roche) or Amplitaq (Life Technologies). Primer sequences are
provided in Table S1. PCR fragments were purified with NucleoFast 96 PCR plates
(Clontech) in accordance with the manufacturer’s protocol. Sequence analysis was performed
with the ABI PRISM BigDye Terminator Cycle Sequencing V2.0 Ready Reaction kit and
analyzed with the ABI PRISM 3730 DNA analyzer (Applied Biosystems). Presence of the
FITM2 c.4G>T transversion was determined in 137 ethnically matched healthy controls by
restriction analysis of amplicons encompassing FITM2 exon 1 (primers as indicated in Table
S1) which were purified as described above and digested with NspI (New England Biolabs)
in accordance with the manufacturer’s protocol. Restriction fragments were analyzed on 2%
agarose gels. The mutation removes a restriction site. The absence of the FITM2 c.4G>T
variant was also verified in the Nijmegen WES database (5,031 exomes) and Exome
Aggregation Consortium database (ExAC, 65,000 exomes). The variant was submitted to
the Leiden open variation database (LOVD; ID #0000079006).
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Expression analysis of FITM2 in HEK293T cells
Wild-type and c.4G>T FITM2 cDNA were cloned in an expression vector containing a C-
terminal Streptavidin-FLAG-tag (SF-TAP)(Gloeckner et al., 2007) using Gateway Cloning
technology (Life Technologies) according to the manufacturer’s instructions. Only the
protein coding FITM2 sequences are represented in the construct (NM_001080472.1).
HEK293T cells were cultured in high glucose DMEM AQmedia (Sigma Aldrich),
supplemented with 10% FCS, 1% penicillin/streptomycin and 1 mM sodium pyruvate. For
DNA transfections, HEK293T cells were seeded in 6-well plates, grown overnight, and
transfected with 2 µg of plasmid using PEI transfection reagent (Merck Millipore). Twenty-
four hours after transfection cells were washed with PBS and lysed on ice in lysis buffer (50
mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% Triton-X-100 supplemented with complete
protease inhibitor cocktail (Roche)). Affinity purification of SF-TAP-tagged proteins was
performed on cleared lysates using anti-FLAG M2 affinity gel (Sigma Aldrich). Lysates were
incubated for four hours at 4C and subsequently precipitated by centrifugation and washed
three times in lysis buffer. Protein lysates and affinity purified samples were analyzed on
Western blots of NuPAGE® Novex® 12% Bis-Tris Protein Gels (Life technologies) and
imaged by using the Odyssey Infrared Imaging System (LI-COR, USA). Tagged molecules
were detected by anti-FLAG polyclonal antibodies (Sigma Aldrich) and IRDye800 goat-anti-
rabbit IgG (Licor) as described (Roosing et al., 2014).
RNAi and phenotypic analyses in Drosophila melanogaster
Drosophila melanogaster stocks and maintenance
We modeled loss of human FITM2 by constitutive knockdown in Drosophila, exploiting two
independent, inducible RNAi constructs against both isoforms encoded by CG10671,
CG10671-RA and CG10671-RB, and the UAS-GAL4 system (Brand et al., 1993;Dietzl et al.,
2007). Experiments were replicated in multiple stocks, two from the GD RNAi library
(v44433 and v44435 harboring the RNAi construct GD3580; referred to as Fitm RNAi-1A
and Fitm RNAi-1B, respectively) with the corresponding genetic background control
(Control-1; v60000) and one from the KK RNAi library (v109895 with the RNAi construct
KK107999; Fitm RNAi-2) with the corresponding genetic background control (v60100;
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Control-2). The stocks were obtained from the Vienna Drosophila RNAi Centre (VDRC)
(Dietzl et al., 2007).
RNAi expression was induced by a variety of GAL4 driver lines, which carry a tissue-
specific promoter driving the expression of GAL4. The w; C7-GAL4; UAS-Dcr-2 (fat body
expression) was kindly provided by Marek Jindra (Rynes et al., 2012). The GAL4 promoter
driver lines, w;; αTub84B-GAL4/ TM6C, Sb1 Tb1 (5138) (ubiquitous expression) and w, UAS-
Dcr-2; Mef2-GAL4 (25756) (preferentially expressed in skeletal muscle) were obtained from
the Bloomington Drosophila Stock Center (BDSC). The w;; elav-GAL4 (8760) was obtained
from the BDSC and combined with w; UAS-Dcr-2 (60009) from VDRC to create w; UAS-
Dcr-2; elav-GAL4 (pan-neuronal expression). A copy of UAS-Dcr-2 was included to improve
the efficiency of knockdown (Dietzl et al., 2007). The w, UAS-Dicer-2; 477-GAL4, UAS-
mCD8::GFP; ppk-GAL4 driver (expression in class IV dendritic arborization (da) neurons)
was assembled from yw, 477-GAL4, UAS-mCD8::GFP (8768) and w;; ppk-GAL4 (32079),
both from BDSC. Crosses were maintained according to standard procedures at 28°C.
Confirmation of Fitm knockdown by qRT-PCR
In order to evaluate the efficiency of RNAi-induced knockdown, Fitm RNAi-1A, Fitm RNAi-
1B and Fitm RNAi-2 lines were crossed to the αTub84B-GAL4 driver (ubiquitous). One day
old males of the appropriate genotype were selected for qRT-PCR evaluation of Fitm RNAi-
1A and RNAi-2 lines, one day old females for evaluation of knockdown using the X-linked
Fitm RNAi-1B line. Extraction of mRNA, cDNA synthesis and qPCR were performed as
previously described (Mukhopadhyay et al., 2010). The gene encoding RNA polymerase II
(RpII215) was used as a reference gene. Primer pairs for amplification of both Fitm isoforms
(CG10671-RA and CG10671-RB) and RpII215 transcripts were designed using ExonPrimer
software. For each genotype, three biological and two technical replicates were performed.
Differential gene expression was calculated using the 2ΔΔCt method (Livak et al., 2001). One-
way ANOVA (GraphPad Prism) was employed for calculations of p values.
Negative geotaxis assay
Fitm RNAi lines and the corresponding genetic background control lines were crossed to the
αTub84B-GAL4, Mef2-GAL4 and the C7-GAL4 driver lines, respectively. Female and male
progeny of the appropriate genotypes and age were subjected to the negative geotaxis assay
(Benzer, 1967;Ali et al., 2011). Locomotor climbing abilities where observed after tapping
down the flies in the vials. The natural response of flies is to climb up the vials after the
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
tapping. In case of locomotor impairment, flies exhibit slower or non-ability to climbing
behavior.
All behavioral tests were performed at room temperature under standard light
conditions. Aged flies were transferred to fresh food vials every three to four days.
Island assay
Fitm RNAi lines and the corresponding genetic background control lines were crossed to the
αTub84B-GAL4 (ubiquitous), the Mef2-GAL4 (preferentially expressed in skeletal muscle)
and the C7-GAL4 (fat body) driver lines, respectively. Female and male progeny of the
appropriate genotypes and age were subjected to the island assay (Schmidt et al., 2012). In
brief, flies were thrown to a platform in the middle of a soap bath and their escape response
was videotaped. Flies remaining on the platform after 10 seconds were manually counted.
Flight ability, wing and leg movements were visually evaluated (Lee et al., 2009). If an
abnormal locomotion behavior was found, at least one additional experiment was performed
to confirm the observed behavioral defects. The SPSS statistics 20 package (IBM) was used
for the ANOVA statistical comparisons.
All behavioral experiments were performed at room temperature under standard light
conditions. Aged flies were transferred to fresh food vials every three to four days.
Dendritic morphology of class IV dendritic arborization neurons
Male third instar larvae were dissected following a ventral midline incision for imaging of the
dorsal class IV ddaC neurons. The Fitm RNAi-1A and Fitm RNAi-2 lines and the
corresponding controls were crossed to w, UAS-Dicer-2; 477-GAL4, UAS-mCD8::GFP; ppk-
GAL4 driver line. Dendritic neurons were stained with rat anti-mouse CD8a (1:100; Thermo
Fisher Scientific MCD0800) and goat-anti-rat Alexa Fluor 488 (1:200; Thermo Fisher
Scientific A-11006). Z-stack images were taken at a Zeiss LSM 510 confocal microscope
with a 20x objective. Z-stacks were imported into NeuronStudio (version 0.9.92) for
generation of neuronal reconstructions and Sholl analysis (10 μm interval) (Wearne et al.,
2005). Tracing files were analyzed with L-Measure (version v5.2 (Scorcioni et al., 2008))
and statistical significance was analyzed using the One-Sample T-Test in GraphPad Prism
(version 5.00 for Windows, GraphPad Software). Data was collected from larvae selected
from two independent experiments.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Hearing test
To assess sound responses of the Drosophila Johnston's organ (JO), antennal vibrations and
ensuing antennal nerve potentials were measured in adult flies three days after eclosion as
previously described (Gopfert et al., 2006). The Fitm RNAi-1A, Fitm RNAi-1B and Fitm
RNAi-2 lines and the corresponding controls were crossed to the elav-GAL4 and αTub84B-
GAL4 drivers. In the Fitm RNAi-1B line, the RNAi construct was located in the X
chromosome and therefore only female progeny were evaluated of this condition and its
control. When using the lines Fitm RNAi-1A, Control-1, Fitm RNAi-2 and Control-2, both
females and males were selected. In brief, antennal vibrations were monitored at the tip of the
antennal arista using a PSV-400 scanning laser Doppler vibrometer (LDV) with an OFV-500
close up unit (Polytec GmbH). Pure tones adjusted to the mechanical best frequency of the
antenna were used as sound stimuli. The resulting sound particle velocity was measured with
an Emkay NR3158 pressure gradient microphone (distributed by Knowles Electronics Inc.) at
the position of the fly. In line with previous reports (Gopfert et al., 2006), the individual best
frequency of each antenna was determined from the power spectrum of its mechanical free
fluctuations in the absence of sound stimulation, and tone evoked antennal vibration
amplitudes were measured as Fourier amplitudes at the frequency of sound stimulation.
Ensuing nerve potentials were measured in the form of compound action potentials (CAPs)
from the axonal projections of JO neurons in the antennal nerve via an electrolytically tapered
tungsten electrode inserted between the antenna and the head (Effertz et al., 2011;Senthilan et
al., 2012). A tungsten wire inserted into the thorax served as indifferent electrode. CAP
amplitudes were plotted against the corresponding sound particle velocities. Hill fits were
used to determine the sound particle velocity threshold of the CAPs, whereby the particle
velocity corresponding to 10% of the maximum amplitude approached by the fit was used as
the threshold criterion. To quantify the amplification gain exerted by motile responses of JO
neurons, the antenna’s mechanical sensitivity, measured as antennal displacement amplitudes
normalized to the corresponding sound particle velocities, was plotted against the particle
velocity of the stimulus tones. The amplification gain was then measured as the ratio between
the antenna’s mechanical sensitivity in the low and high intensity regimes (Gopfert et al.,
2006;Senthilan et al., 2012). Data analysis was performed using Polytec-VIB (Polytec
GmbH), Spike 2 (Cambridge Electronic Design), Excel 2007 (Microsoft), SigmaPlot 10
(Systat Software) and Prism (GraphPad Software) software.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Fat body analysis
Fitm RNAi lines and the corresponding controls were crossed to the C7-GAL4 driver line (fat
body). Progeny was transferred to vials with fresh food every two days. Fat bodies of female
flies were dissected at the indicated adult age, fixed in PBS with 3.7% paraformaldehyde for
20 min, rinsed with PBS, stained with Bodipy (1:2000; C3922, Life technologies) for 20 min
at room temperature, and mounted in Vectashield with DAPI (Vector Laboratories). Pictures
were obtained using a Zeiss Axio Imager ZI fluorescence microscope (Zeiss). Data was
collected from flies selected from two independent experiments. LD area was assessed using
FIJI. A minimum of two random regions of interest (ROI) of 35.5 m2 were created from
each image and the area of the LDs contained in the ROI was retrieved and analyzed.
Statistical significance was calculated by using ANOVA with the Tukey correction for
multiple testing incorporated in Prism GraphPad software.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Acknowledgements
We are grateful to the family for participation in this study. We thank the Bloomington
Drosophila Stock Center (NIH P40OD018537) at Indiana University, and Vienna Drosophila
RNAi center for providing transgenic RNAi fly stocks used in this study. We acknowledge
Prof. dr. R.A. Wevers, dr. A. Beynon, dr. E. J. Kamsteeg and dr. B. Kusters for discussions
and M. Wesdorp MSc and K. Kochinke MSc for technical support. This research was
supported in part by the Netherlands Organization for Scientific Research (NWO) VENI
grant 91-614-084 to MvdV, NWO Brain and Cognition Excellence Program grant (433-09-
229) to AS, VIDI grant 917-96-346 to AS, ZonMW TOPsubsidies 912-12-109 to AS and 40-
00812-98-09047 to HK, the German Science Foundation (GO 1092/2, SPP 1680, SFB 889
A1, and INST 186/1081-1) to MCG, a post-doc scholarship of the Higher Education
Commission, Pakistan to SaimaS and a Higher Education Commission (HEC) grant #4885 to
RQ under the National Research Program for Universities. In addition, this study was
supported by the Association Belge contre les Maladies Neuromusculaires and EU FP7/2007-
2013 (grant 2012-305121 ‘NEUROMICS’). JB is supported by a Senior Clinical Investigator
fellowship of the Research Foundation Flanders.
List of contributions
CZS carried out the island assay and fat body analysis and data analysis of island assay, fat
body analysis and type IV neurons. She was involved in writing the manuscript. ACN carried
out the island assay and fat body analysis. She was involved in the preparation of the
manuscript. SHJ was involved in the performance of hearing test in flies and in the
preparation of manuscript. MS was involved in the genetic analyses. JNF was involved in the
genetic analyses and in the preparation of the manuscript. MvdV performed the type IV
neuron analysis and was involved in the preparation of the manuscript. SSV supervised the
analysis of fat distribution in the patients. BN was involved in data analyses and in the
preparation of the manuscript. JO was involved in WES, Sanger sequencing and FITM2
cDNA cloning into an expression vector. EdV performed the expression analysis of FITM2 in
HEK293T cells and was involved in the preparation of the manuscript. RK performed the
hearing tests in flies. AM was involved in patient evaluation. MH, RS and MO were involved
in candidate gene evaluation for the linkage interval. LT contributed patient DNA of
TIMM8A-negative cases. EvW was involved in the preparation of the manuscript. JMSdG
was involved in Drosophila preparations for further analyses. SadaatS was involved in
patient evaluation. JB and PdJ provided patient DNA of polyneuropathy-deafness cases.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
SARK was involved in patient evaluation. SAS performed analysis of fat distribution in the
patients. BPvdW evaluated the clinical data and was involved in the preparation of the
manuscript. CCK was involved in the genetic analyses. MCG supervised the hearing tests in
flies and was involved in the preparation of the manuscript. RQ supervised the collection and
clinical evaluation of the family and was involved in preparation of the manuscript. AS
conceived and supervised the experiments performed in Drosophila and was involved in the
preparation of the manuscript. HK conceived and supervised the study and was involved in
the writing of this paper. SS ascertained the family, was involved in the collection and
management of the clinical data, performed genetic analyses and was involved in the
preparation of the manuscript.
Conflict of interests
There is no conflict of interests.
URL
1000 genomes: http://www.1000genomes.org/
Drosophila Bloomington Stock Center: http://flystocks.bio.indiana.edu/
ENSEMBL: http://www.ensembl.org/
Exome Aggregation Consortium: http://exac.broadinstitute.org/
ExonPrimer: http://ihg.gsf.de/ihg/ExonPrimer.html
Hereditary hearing loss homepage: http://hereditaryhearingloss.org/
HapMap: hapmap.ncbi.nlm.nih.gov
Leiden open variation database (LOVD): http://databases.lovd.nl/
NeuronStudio: http://research.mssm.edu/cnic/tools-ns.html
NHLBI exome variant server: http://evs.gs.washington.edu/EVS/
OMIM: http://www.ncbi.nlm.nih.gov/omim
SIFT: http://sift.jcvi.org/
USCS: https://genome.ucsc.edu/
Vienna Drosophila RNAi Centre: http://stockcenter.vdrc.at/control/main
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
REFERENCES
Abecasis G. R., Cherny S. S., Cookson W. O. and Cardon L. R. (2002). Merlin--rapid analysis of dense genetic maps using sparse gene flow trees. Nat. Genet. 30, 97-101. Ali Y. O., Escala W., Ruan K. and Zhai R. G. (2011). Assaying locomotor, learning, and memory deficits in Drosophila models of neurodegeneration. J. Vis. Exp. 49, 2504. Baker K. D. and Thummel C. S. (2007). Diabetic larvae and obese flies-emerging studies of metabolism in Drosophila. Cell Metab. 6, 257-266. Barbosa A. D., Savage D. B. and Siniossoglou S. (2015). Lipid droplet-organelle interactions: emerging roles in lipid metabolism. Curr Opin Cell Biol 35, 91-97. Bell A. and Fletcher N. H. (2004). The cochlear amplifier as a standing wave: "squirting" waves between rows of outer hair cells? J. Acoust. Soc. Am. 116, 1016-1024. Benzer S. (1967). Behavioral mutants of drosophila isolated by countercurrent distribution. Proc. Natl. Acad. Sci. USA 58, 1112-1119. Brand A. H. and Perrimon N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401-415. Card G. and Dickinson M. (2008). Performance trade-offs in the flight initiation of Drosophila. J. Exp. Biol. 211, 341-353. Carrozzo R., Dionisi-Vici C., Steuerwald U., Lucioli S., Deodato F., Di Giandomenico S., Bertini E., Franke B., Kluijtmans L. A., Meschini M. C., et al. (2007). SUCLA2 mutations are associated with mild methylmalonic aciduria, Leigh-like encephalomyopathy, dystonia and deafness. Brain 130, 862-874. Cartwright B.R., Binns D.D., Hilton C.L., Han S., Gao Q. and Goodman J.M. (2015). Seipin performs dissectible functions in promoting lipid droplet biogenesis and regulating droplet morphology. Mol. Biol. Cell. 26, 726-739. Chalancon G., Ravarani C.N., Balaji S., Martinez-Arias A., Aravind L., Jothi R. and Babu M.M. (2012).
Interplay between gene expression noise and regulatory network architecture. Trends Genet. 28,
221-232.
Chintapalli V. R., Wang J. and Dow J. A. (2007). Using FlyAtlas to identify better Drosophila melanogaster models of human disease. Nat. Genet. 39, 715-720. Cho Y. S., Chen C. H., Hu C., Long J., Ong R. T., Sim X., Takeuchi F., Wu Y., Go M. J., Yamauchi T., et al. (2012). Meta-analysis of genome-wide association studies identifies eight new loci for type 2 diabetes in east Asians. Nat. Genet. 44, 67-72. Choudhary V., Ojha N., Golden A. and Prinz W. A. (2015). A conserved family of proteins facilitates nascent lipid droplet budding from the ER. J. Cell Biol. 211, 261-271. Cooper D.N., Krawczak M., Polychronakos C., Tyler-Smith C. and Kehrer-Sawatzki H. (2013). Where
genotype is not predictive of phenotype: towards an understanding of the molecular basis of
reduced penetrance in human inherited disease. Hum. Genet. 132, 1077-1130.
Cowin G. J., Jonsson J. R., Bauer J. D., Ash S., Ali A., Osland E. J., Purdie D. M., Clouston A. D., Powell E. E. and Galloway G. J. (2008). Magnetic resonance imaging and spectroscopy for monitoring liver steatosis. J. Magn. Reson. Imaging 28, 937-945. Cui X., Wang Y., Tang Y., Liu Y., Zhao L., Deng J., Xu G., Peng X., Ju S., Liu G., et al. (2011). Seipin ablation in mice results in severe generalized lipodystrophy. Hum. Mol. Genet. 20, 3022-3030. Dietzl G., Chen D., Schnorrer F., Su K. C., Barinova Y., Fellner M., Gasser B., Kinsey K., Oppel S., Scheiblauer S., et al. (2007). A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151-156. Duckert P., Brunak S. and Blom N. (2004). Prediction of proprotein convertase cleavage sites. Prot. Eng., Des. & Sel. 17, 107-112. Effertz T., Wiek R. and Göpfert M.C. (2011). NompC TRP channel is essential for Drosophila sound receptor function. Curr. Biol. 21, 592-597. Elpeleg O., Miller C., Hershkovitz E., Bitner-Glindzicz M., Bondi-Rubinstein G., Rahman S., Pagnamenta A., Eshhar S. and Saada A. (2005). Deficiency of the ADP-forming succinyl-CoA synthase
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
activity is associated with encephalomyopathy and mitochondrial DNA depletion. Am. J. Hum. Genet. 76, 1081-1086. Engl G., Florian S., Tranebjaerg L. and Rapaport D. (2012). Alterations in expression levels of deafness dystonia protein 1 affect mitochondrial morphology. Hum. Mol. Genet. 21, 287-299. Fujimoto T. and Parton R. G. (2011). Not just fat: the structure and function of the lipid droplet. Cold Spring Harb Perspect. Biol. 3. Gloeckner C. J., Boldt K., Schumacher A., Roepman R. and Ueffing M. (2007). A novel tandem affinity purification strategy for the efficient isolation and characterisation of native protein complexes. Proteomics 7, 4228-4234. Godenschwege T. A., Kristiansen L. V., Uthaman S. B., Hortsch M. and Murphey R. K. (2006). A conserved role for Drosophila Neuroglian and human L1-CAM in central-synapse formation. Curr. Biol. 16, 12-23. Goh V. J., Tan J. S., Tan B. C., Seow C., Ong W. Y., Lim Y. C., Sun L., Ghosh S. and Silver D. L. (2015). Postnatal deletion of Fat storage-inducing Transmembrane Protein 2 (FIT2/FITM2) causes lethal enteropathy. J. Biol. Chem. 290, 25686-25699. Gopfert M. C., Albert J. T., Nadrowski B. and Kamikouchi A. (2006). Specification of auditory sensitivity by Drosophila TRP channels. Nat. Neurosci. 9, 999-1000. Graveley B. R., Brooks A. N., Carlson J. W., Duff M. O., Landolin J. M., Yang L., Artieri C. G., van Baren M. J., Boley N., Booth B. W., et al. (2011). The developmental transcriptome of Drosophila melanogaster. Nature 471, 473-479. Gross D. A., Snapp E. L. and Silver D. L. (2010). Structural insights into triglyceride storage mediated by fat storage-inducing transmembrane (FIT) protein 2. PLoS One 5, e10796. Gross D. A., Zhan C. and Silver D. L. (2011). Direct binding of triglyceride to fat storage-inducing transmembrane proteins 1 and 2 is important for lipid droplet formation. Proc. Natl. Acad. Sci. USA 108, 19581-19586. Ito D. and Suzuki N. (2009). Seipinopathy: a novel endoplasmic reticulum stress-associated disease. Brain 132, 8-15. Jin H., May M., Tranebjaerg L., Kendall E., Fontan G., Jackson J., Subramony S. H., Arena F., Lubs H., Smith S., et al. (1996). A novel X-linked gene, DDP, shows mutations in families with deafness (DFN-1), dystonia, mental deficiency and blindness. Nat. Genet. 14, 177-180. Kadereit B., Kumar P., Wang W. J., Miranda D., Snapp E. L., Severina N., Torregroza I., Evans T. and Silver D. L. (2008). Evolutionarily conserved gene family important for fat storage. Proc. Natl. Acad. Sci. USA 105, 94-99. Kalinec F., Webster P., Maricle A., Guerrero D., Chakravarti D. N., Chakravarti B., Gellibolian R. and Kalinec G. (2009). Glucocorticoid-stimulated, transcription-independent release of annexin A1 by cochlear Hensen cells. Br. J. Pharmacol. 158, 1820-1834. Klein M., van der Voet M., Harich B., van Hulzen K. J., Onnink A. M., Hoogman M., Guadalupe T., Zwiers M., Groothuismink J. M., Verberkt A., et al. (2015). Converging evidence does not support GIT1 as an ADHD risk gene. Am. J. Med. Genet. B. Neuropsychiatr. Genet. 10.1002/ajmg.b.32327. Kojovic M., Parees I., Kassavetis P., Palomar F. J., Mir P., Teo J. T., Cordivari C., Rothwell J. C., Bhatia K. P. and Edwards M. J. (2013b). Secondary and primary dystonia: pathophysiological differences. Brain 136, 2038-2049. Kojovic M., Parees I., Lampreia T., Pienczk-Reclawowicz K., Xiromerisiou G., Rubio-Agusti I., Kramberger M., Carecchio M., Alazami A. M., Brancati F., et al. (2013a). The syndrome of deafness-dystonia: clinical and genetic heterogeneity. Mov. Disord. 28, 795-803. Kramer J. M., Kochinke K., Oortveld M. A., Marks H., Kramer D., de Jong E. K., Asztalos Z., Westwood J. T., Stunnenberg H. G., Sokolowski M. B., et al. (2011). Epigenetic regulation of learning and memory by Drosophila EHMT/G9a. PLoS Biol. 9, e1000569. Lee D. W., Seo J. B., Ganetzky B. and Koh Y. H. (2009). DeltaFY mutation in human torsin A [corrected] induces locomotor disability and abberant synaptic structures in Drosophila. Mol. Cells 27, 89-97.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Livak K. J. and Schmittgen T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408. Magre J., Delepine M., Khallouf E., Gedde-Dahl T., Jr., Van Maldergem L., Sobel E., Papp J., Meier M., Megarbane A., Bachy A., et al. (2001). Identification of the gene altered in Berardinelli-Seip congenital lipodystrophy on chromosome 11q13. Nat. Genet. 28, 365-370. Mauss A., Tripodi M., Evers J. F. and Landgraf M. (2009). Midline signalling systems direct the formation of a neural map by dendritic targeting in the Drosophila motor system. PLoS Biol. 7, e1000200. Merchan M. A., Merchan J. A. and Ludena M. D. (1980). Morphology of Hensen's cells. J. Anat. 131, 519-523. Miranda D. A., Kim J. H., Nguyen L. N., Cheng W., Tan B. C., Goh V. J., Tan J. S., Yaligar J., Kn B. P., Velan S. S., et al. (2014). Fat storage-inducing transmembrane protein 2 is required for normal fat storage in adipose tissue. J. Biol. Chem. 289, 9560-9572. Miranda D. A., Koves T. R., Gross D. A., Chadt A., Al-Hasani H., Cline G. W., Schwartz G. J., Muoio D. M. and Silver D. L. (2011). Re-patterning of skeletal muscle energy metabolism by fat storage-inducing transmembrane protein 2. J. Biol. Chem. 286, 42188-42199. Mukhopadhyay A., Kramer J. M., Merkx G., Lugtenberg D., Smeets D. F., Oortveld M. A., Blokland E. A., Agrawal J., Schenck A., van Bokhoven H., et al. (2010). CDK19 is disrupted in a female patient with bilateral congenital retinal folds, microcephaly and mild mental retardation. Hum. Genet. 128, 281-291. Pedersen J. Ø., Rodríguez M. A., Prætorius-Ibba M., Nilsson-Tillgren T., Calderón I. L. and Holmberg S. (1997). Locus-specific suppression of ilv1 in Saccharomyces cerevisiae by deregulation of CHA1 transcription. Mol. Gen. Genet. 255, 561-569. Pol A., Gross S. P. and Parton R. G. (2014). Review: biogenesis of the multifunctional lipid droplet: lipids, proteins, and sites. J. Cell. Biol. 204, 635-646. Provencher S. W. (1993). Estimation of metabolite concentrations from localized in vivo proton NMR spectra. Magn. Reson. Med. 30, 672-679. Purcell S., Neale B., Todd-Brown K., Thomas L., Ferreira M. A., Bender D., Maller J., Sklar P., de Bakker P. I., Daly M. J., et al. (2007). PLINK: a tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559-575. Raj A., Rifkin S. A., Andersen E. and van Oudenaarden A. (2010). Variability in gene expression underlies incomplete penetrance. Nature 463, 913-918. Roosing S., Lamers I. J., de Vrieze E., van den Born L. I., Lambertus S., Arts H. H., Group P. B. S., Peters T. A., Hoyng C. B., Kremer H., et al. (2014). Disruption of the basal body protein POC1B results in autosomal-recessive cone-rod dystrophy. Am. J. Hum. Genet. 95, 131-142. Rynes J., Donohoe C. D., Frommolt P., Brodesser S., Jindra M. and Uhlirova M. (2012). Activating transcription factor 3 regulates immune and metabolic homeostasis. Mol. Cell Biol. 32, 3949-3962. Sadananthan S. A., Prakash B., Leow M. K., Khoo C. M., Chou H., Venkataraman K., Khoo E. Y., Lee Y. S., Gluckman P. D., Tai E. S., et al. (2015). Automated segmentation of visceral and subcutaneous (deep and superficial) adipose tissues in normal and overweight men. J. Magn. Reson. Imaging 41, 924-934. Schmidt I., Thomas S., Kain P., Risse B., Naffin E. and Klambt C. (2012). Kinesin heavy chain function in Drosophila glial cells controls neuronal activity. J. Neurosci. 32, 7466-7476. Scorcioni R., Polavaram S. and Ascoli G. A. (2008). L-Measure: a web-accessible tool for the analysis, comparison and search of digital reconstructions of neuronal morphologies. Nat. Protoc. 3, 866-876. Senthilan P. R., Piepenbrock D., Ovezmyradov G., Nadrowski B., Bechstedt S., Pauls S., Winkler M., Mobius W., Howard J. and Gopfert M. C. (2012). Drosophila auditory organ genes and genetic hearing defects. Cell 150, 1042-1054. Tian Y., Bi J., Shui G., Liu Z., Xiang Y., Liu Y., Wenk M. R., Yang H. and Huang X. (2011). Tissue-autonomous function of Drosophila seipin in preventing ectopic lipid droplet formation. PLoS Genet. 7, e1001364.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Toriello H. V., Reardon W., Gorlin R. J. and Gorlin R. J. (2004). Hereditary hearing loss and its syndromes. Oxford, New York: Oxford University Press. Urrutia R. A. and Kalinec F. (2015). Biology and pathobiology of lipid droplets and their potential role in the protection of the organ of Corti. Hearing research. 330, 26-38. Walther T. C. and Farese R. V., Jr. (2012). Lipid droplets and cellular lipid metabolism. Annu. Rev. Biochem. 81, 687-714. Wearne S. L., Rodriguez A., Ehlenberger D. B., Rocher A. B., Henderson S. C. and Hof P. R. (2005). New techniques for imaging, digitization and analysis of three-dimensional neural morphology on multiple scales. Neuroscience 136, 661-680. Welte M. A. (2015). Expanding Roles for Lipid Droplets. Curr. Biol. 25,R470-R481. Yagi T., Ito D., Nihei Y., Ishihara T. and Suzuki N. (2011). N88S seipin mutant transgenic mice develop features of seipinopathy/BSCL2-related motor neuron disease via endoplasmic reticulum stress. Hum. Mol. Genet. 20, 3831-3840.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Figures
Fig. 1. (A) Pedigree of family W09-1008 and segregation of the c.4G>T (p.Glu2*) mutation
in FITM2 and (B) pure tone audiometry of individuals II:1, II:5 and II:6. Age (years) is
indicated with the symbol keys. The p95 lines indicate that 95% of individuals of 19 years
old have thresholds lower than these. The arrows indicate that the thresholds are lower than
120 dB.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Fig. 2. Identification of a genetic defect underlying syndromic hearing impairment in
family W09-1008 and expression analysis of wild-type and p.Glu2* FITM2 fused to a
FLAG-tag in HEK293T cells.(A) Partial sequences of FITM2 exon 1 are shown from an
affected member, an unaffected heterozygous sib and an unaffected wild-type sib of family
W09-1008. The predicted amino acid changes and the surrounding amino acids are indicated
above the sequence. As reference sequence NM_001080472.1 was employed. (B) The left
panel shows a Western blot of a gel on which 10 % of the cell lysate was loaded (before
affinity purification). The right panel shows a Western blot of a gel on which 10 µl of the
lysate after affinity purification (anti-FLAG) was loaded. Wildtype (WT) FITM2 migrates
around 29 kDa and it is absent upon transfection of the p.Glu2* FITM2 construct expressed.
After affinity purification, a very weak band is observed at ~16kDa. However, the intensity of
the 16 kDa band is about 2700 fold lower than the wild-type FITM2 band and therefore it is
likely to have little or no biological impact. The gel was immunostained with an anti-FLAG
polyclonal antibody. Of four ATG-triplets in the original reading-frame, three (codon
positions 94, 493 and 508) are predicted to be potential translation initiation sites by the
Netstart 1.0 algorithm (Pedersen et al., 1997). Accordingly, alternative proteins would consist
of 285 amino acids (aa) (26.2 kDa), 152 aa (11.2 kDa), and 147 aa (10.6 kDa), respectively.
Expression constructs encode FITM2 fused to a C-terminal Strep-FLAG-tag (SF-TAP),
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
adding approximately 6 kDa to the proteins. Wild-type FITM2 was found to migrate
according to molecular weight of ~29 kDa, which is lower as compared to the predicted mass
of the complete protein. However, fragments of similar length are observed with anti-FITM2
staining in the work of Duckert et al. and pro-peptide cleavage is predicted by the ProP
algorithm (Duckert et al., 2004). Marker size is indicated between the panels and given in
kDa.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Fig.3. Knockdown of Fitm impairs locomotor abilities in Drosophila. Stacked bar graphs
show the average percentage of flightless flies (black bars) and flies with normal flight
responses (white bars). Error bars represent S.E.M. The indicated days represent days of age
past eclosion. Fitm knocked down ubiquitously and preferentially in skeletal muscle with the
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
αTub84B-GAL4 (A) and Mef2-GAL4 (B) promoters, respectively, and Fitm RNAi-1A and
Fitm RNAi-2 showed significant locomotor impairment at all time points. (C) Fitm
knockdown in the fat body (C7-GAL4 driver) using Fitm RNAi-1A and Fitm RNAi-2
revealed a progressive locomotor impairment evident at 12 days after eclosion as compared
to corresponding age-matched control flies. The percentages of normal and flightless flies per
experiment was used to determine statistical differences by one-Way ANOVA with Tukey’s
correction for multiple testing. Average percentages are plotted in the graphs. The n refers to
the number of experiments. Number, percentages of flightless and normal flies in each
independent experiment can be found in Table S7.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Fig. 4. Fitm RNAi-1 knockdown in Drosophila interferes with morphology of
nociceptive multi-dendritic sensory neurons. (A–B) Confocal projections of class IV da
neurons within segment A3 of third instar larvae, visualized with the class IV da-specific
drivers 477-GAL4 and ppk-GAL4 and UAS-mCD8::GFP. The ddaC neurons show abnormal
dendritic morphology in a subset of Fitm RNAi larvae. (A) Control-1 shows ddaC contact to
neighboring neurons. (B) Knockdown of Fitm in line RNAi-1A results in a severe outgrowth
defect, observed in 5/18 larvae. The five highly abnormal neurons (see Fig. S.6) were
analyzed further, to test whether they significantly differ from the control. (C) Sholl analysis
(Wearne et al., 2005) of control (n=5) and selected highly abnormal neurons (n=5) reveals
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
defects as a measure of the soma distance. The Fitm RNAi-1A dendritic field coverage has a
radius that is 60% the size of that of the control. (D–G) Quantitative analysis of dendritic
trees reveals that the affected Fitm RNAi-1 neurons have D) a reduced average branch path
length (p=0.01), (E) a reduced accumulative branch path length (p=<0.0001), (F) a decreased
number of branches (p=<0.0001), and G) not significantly changed maximal branch order
(p=0.2). Dorsal is up in (A, B), scale bar is 100 μm, error bars in (D–G) indicate S.E.M. T-
test between control and knockdown conditions was performed for each parameter to
determine significance. P-values are depicted in each graph. Per strain 5 neurons, derived
from 5 different larvae, were analyzed. The data were collected in two independent
experiments. For underlying numerical data see Tables S8 and S9. More information about
the depicted parameters can be found it Table S11.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Fig. 5. Knockdown of Fitm impairs Drosophila hearing. Antennal vibrations and ensuing
antennal nerve potentials were measured in the Fitm RNAi-1A, Fitm RNAi-1B and Fitm
RNAi-2 lines and the corresponding controls (Control-1 and Control-2, respectively) crossed
to the pan-neuronal elav-GAL4 and ubiquitous αTub84B-GAL4 drivers three days after
eclosion. (A) Sound-evoked antennal displacement amplitudes (upper panels, log scale) and
normalized compound action potential (CAP) amplitudes as functions of the sound particle
velocity. Each circle indicates a single data point. Solid (upper panels) and dashed (lower
panels) lines indicate linear auditory mechanics, as observed upon the loss of mechanical
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
amplification by auditory sensory neuron motility (Senthilan et al., 2012), and Hill fits to the
pooled CAP responses of each strain, respectively. Red arrows indicate significant
differences to controls. (B) Respective CAP thresholds, deduced from Hill fits to the CAP
amplitudes of each individual. (C) Respective mechanical amplification gains provided by
auditory sensory neuron motility. (D) Respective mechanical best frequencies of the antennal
sound receivers, deduced from the mechanical fluctuations in the absence of sound
stimulation (Senthilan et al., 2012). Per strain, 5 flies were analyzed and three independent
measures were taken. Each data point represents the average response to 10 stimulus
presentations. Significances: *: p<0.05, and ns: not significant (two-tailed Mann-Whitney U-
tests. If applicable, Bonferroni correction was used to correct for multiple testing). For
original values, see Table S12.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Fig. 6. Fitm knockdown leads to progressive decrease of lipid droplet size. (A)
Representative images of lipid droplets (LDs) labeled with Bodipy (red) in fat bodies of C7-
GAL4-induced Fitm knockdown flies (Fitm RNAi-1A and Fitm RNAi-1B) as compared to
the corresponding genetic background control flies at the indicated time points past eclosion.
Nuclei were stained with DAPI (blue). Scale bar, 10µm. (B) LD area is significantly reduced
at 4, 12 and 21 days after eclosion upon Fitm knockdown with RNAi-1A and 1B constructs,
and with RNAi-2 at 12 and 21 days after eclosion. The graphs display the mean of LD areas
per experimental condition. Error bars represent the 95% confidence interval. The **
indicates significance of p<0.01 (ANOVA-tests with Tukey correction). The number of
images analyzed, the number of female flies per strain selected for this analysis and the mean
size of lipid droplet per condition are, respectively, as follows: 1) at 4 days: RNAi-1A (11; 5;
10.49μm), RNAi-1B (14; 6; 6.33μm), Control 1 (10; 4; 14.73μm), RNAi-2 (17; 4; 11.86μm),
Control 2 (22; 6; 10.66μm); 2) at 12 days: RNAi-1A (38; 5; 9.31μm), RNAi-1B (33; 6;
5.14μm), Control 1 (24; 6; 22.52μm), RNAi-2 (29; 5; 15.16μm), Control 2 (18; 6; 21.95μm);
3) at 21 days: RNAi-1A (16; 5; 5.14μm), RNAi-1B (21; 7; 11.49μm), Control 1 (31; 4;
18.56μm), RNAi-2B (18; 6; 7.63μm), Control 2 (32; 6; 11.44μm). Quantification of lipid
droplet size was performed in one experiment. The observation of progressively reduced lipid
droplet sizes in the RNAi-lines was made in three independent experiments.
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Table 1. Clinical features of affected individuals with the homozygous c.4G>T (p.Glu2*)
mutation in FITM2
For comparison, the BMI of two healthy siblings (II:2 and II:7) was 23.5 and 21.0 at the ages
of 22 years and 12 years, respectively.
Characteristics II:1 II:3 II:5 II:6 II:8
Age (years) 26 22 13 9 6
Gender Female Female Male Male Male
Onset of HI
(months) 6
Current speech Single words
Sensory
disturbances Frequent pain in joints Daily burning sensation in peripheries
Autonomic
features
Urinary incontinence
from 12 years; daily
diarrhea from 16 years
Normal
Motor function
Delayed walking at 3
years; bedridden by 10
years
Delayed walking at 3 years; loss
of ambulation by 10 years
Crawled at 2
years; never
walked
independently
Delayed
walking at 3.5
years; unable
to run
Dystonic
movements
Dystonic limb
movements from 2 years None
Dystonic limb movements
from 2 years None
Seizures Daily seizures from 15
years None
Skin features Ichthyosis-like features, most prominent at the shin
Height (m)/weight
(kg)/BMI/age at
measurement
(yrs)
1.36/32.0/17.2/23 1.38/31.0/16.1/
19
1.21/22.0/14.8/
12
1.06/17.0/15.
2/8
0.91/15.0/18.
1/5
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
Table 2. Biochemical evaluation of serum and liver fat content of affected subjects
SGOT, serum levels of glutamic oxaloacetic transaminase; CPK, creatine phosphokinase;
LDH, lactate dehydrogenase; ND, not determined.
Measurements II:1 II:5 II:6 Control values
Fasting glucose
(mg/dl)
101 110 94 60-110
SGOT (AST) (U/L) 27 (32) 25 (38) ND In brackets per
individual
CPK (U/L) 136 (26-140) 150 (38-174) ND In brackets per
individual
LDH (U/L) 263 397 ND 240-480
Aldolase (U/L) 4.5 (0.1-7.6) 3.0 (0.2-15.2) ND In brackets per
individual
Urea (mg/dL) 30 45 ND 10-50
Creatinine (mg/dL) 0.8 0.7 ND 0.7-1.19
Triglycerides
(mmol/L)
ND 1.31 1.21 <1.7
Liver fat (%) ND 3.63 ND <10%
Dis
ease
Mo
dels
& M
echa
nism
s •
DM
M •
Adv
ance
art
icle
1
SUPPLEMENTAL FIGURES, TABLES, MOVIES AND LEGENDS
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
2
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
3
Fig. S1. Genome wide LOD scores as calculated using MERLIN 1.1.2
The Y-axis represents LOD scores and the X-axis genetic distance in centimorgans (cM), per
chromosome. The dotted line marks a LOD score of 3.3 indicating genome wide significance
and the dashed line marks a LOD score of -2.0 indicating exclusion of linkage. In the
calculations, the disease allele frequency was set at 0.001. There is only one region in
chromosome 20q12–q13.2, delimited by rs2903624 and rs6096425 (chr20:41,616,510–
50,037,207; GRCh37, hg19) with a significant maximum LOD score of 4.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
4
Fig. S2. Extended pedigree of family W09-1008.
Individuals I:1 and I:2 are not aware of more complex family relationships except for a more
remote familial relation of the parents of individual I:2. Their exact family relationship is
unknown. They are not first cousins. In this extended pedigree, neither early onset hearing
impairment nor other symptoms of the presented syndrome have been reported. As
information about being alive or deceased is lacking for many of the individuals, we have
displayed all pedigree members as alive.
Fig. S3. IFDR1 variant c.5_8delinsAA does not co-segregate with the disease in family
W09-1008.
Filtering of WES data as displayed in Table S3 revealed a homozygous variant in IFDR1
(Table S4). As this gene was reported to be associated with dominantly inherited
spinocerebellar ataxia 18 (SCA18, OMIM# 607458) in one family, segregation of the variant
in family W09-1008 was determined by Sanger sequencing.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
5
Fig. S4. Significantly reduced Fitm transcript levels in the employed RNAi lines upon
ubiquitous RNAi knockdown.
The qRT-PCR in Fitm RNAi lines revealed comparable levels of Fitm downregulation upon
ubiquitous RNAi induction by the αTub84B-GAL4 driver. Fitm transcript levels were
compared to the corresponding genetic background control conditions (100%). Fitm
expression was decreased by 92% (p=0.003) for Fitm RNAi-1A, 80% (p=0.008) for Fitm
RNAi-1B and 80% for Fitm RNAi-2 (p=0.008). Error bars represent normalized S.E.M., p-
values were determined using the ANOVA test. Data are derived from three biological and
two technical replicates.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
6
Fig. S5. Downregulation of Fitm with the pan-neuronal drivers w; UAS-Dicer-2; elav-
GAL4 or w, UAS-Dicer-2; n-syb-GAL4 does not impair locomotor abilities in
Drosophila.
Stacked bar graphs show the average percentage of flightless flies (black bars) and flies with
normal flight response (white bars). Error bars represent S.E.M.. The indicated days represent
days of age after eclosion. Fitm downregulation with pan-neuronal elav-GAL4 (A) and n-syb-
GAL4 (B) drivers, respectively, did not show significant differences in the island test
performance in any of the tested conditions. Tests were performed in a minimum of three
separate experiments (number of experiments (n) per condition is indicated). The percentage
of normal and flightless flies per experiment was used to test for statistical differences by one-
way ANOVA with a Tukey’s correction for multiple testing. Average percentages are plotted
in the graphs. Number, percentages of flightless and normal flies in each independent
experiment can be found in Table S7.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
7
Fig. S6. Fitm RNAi-1 knockdown and Control1 confocal projections and
reconstructions.
(A–C) Confocal projections of class IV da neurons within segment A3 of third instar larvae of
Fitm RNAi-1A, visualized with the class IV da-specific drivers 477-GAL4 and ppk-GAL4
and UAS-mCD8::GFP. (A) 5/18 of Fitm RNAi-1A ddaC neurons showed abnormal dendritic
morphology, the abnormal neurons were traced, the reconstructions of these neurons can be
seen underneath. (B) Representative examples of Fitm RNAi-1A ddaC neurons that did not
show a striking abnormal dendritic morphology. (C) Five Control-1 ddaC neurons were
traced, the reconstructions of these neurons can be seen underneath. Scale bar is 100 μm.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
8
Fig. S7. Fitm RNAi-2 knockdown supports the RNAi-1 multi-dendritic sensory neuron
morphology phenotype, but with decreased penetrance.
(A–B) Confocal projections of class IV da neurons within segment A3 of third instar larvae,
visualized with the class IV da-specific drivers 477-GAL4 and ppk-GAL4 and UAS-
mCD8::GFP. The ddaC neurons showed abnormal dendritic morphology in a subset of Fitm
RNAi larvae. (A) Control 2 showed contact to neighboring neurons. (B) Knockdown of Fitm
RNAi-2 resulted in a severe outgrowth defect in one of 40 larvae. With manual tracing and
quantitative analysis the extent of the Fitm RNAi-2 phenotype was further analyzed and
compared to Control 2 (five neurons derived from five different larvae) (C–F). Quantitative
analysis of dendritic trees revealed that the affected Fitm RNAi-2 neuron has (C) a reduced
average branch path length, (D) a reduced accumulative branch path length, (E) an increased
number of branches, and F) an increased maximal branch order. Dorsal is up in A, A’, B and
B’, scale bar is 100 μm, error bars in (E–J) indicate the S.E.M. Data are collected in two
separate experiments. For the underlying numerical dataset see Table S10. More information
about the depicted parameters can be found in Table S11.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
9
Table S1. Primer sequences and PCR conditions for genomic PCR and Sanger sequence
analysis of FITM2 (uc002xlr.1).
PCR amplicon Oligonucleotides (5` to 3`)
FITM2_Exon 1_forward agaggagacgagcgagttc
FITM2_Exon 1_reverse ctccaatgactcgtccacc
FITM2_Exon 2_forward cccctgacagtgtagagacc
FITM2_Exon 2_reverse aagtgcctaactgggaatgg
FITM2_Exon 1 _Digestion_forward ggcacggagaggaggac
FITM2_Exon 1_Digestion_reverse cactcacacgttgaggacg
Fitm_Exon1_forward cgtcatagccaccttcttctg
Fitm_Exon1-2_reverse gtcgcataaccctttgtgg
RpII215_Exon 3_forward ccgcgatacttctctccac
RpII215_Exon 4_reverse gaccagctaggcgacattc
Table S2. Homozygous genomic regions (> 1Mb) shared by individuals in family W09-
1008.
POOL FID IID PHE CHR BP1 BP2 KB SNP1 SNP2 NSNP
S1 FAM1 II:5 2 17 58083715 59808196 1724.48 rs17842773 rs7212440 306
S1 FAM1 II:3 2 17 58083715 59760996 1677.28 rs17842773 rs4986763 291
S1 FAM1 I:2 1 17 58083715 59367553 1283.84 rs17842773 rs7211984 177
S1 FAM1 I:1 1 17 58083715 59323043 1239.33 rs17842773 rs17513268 159
S1 FAM1 II:4 1 17 58083715 59323043 1239.33 rs17842773 rs17513268 159
S1 FAM1 II:6 2 17 58083715 59323043 1239.33 rs17842773 rs17513268 159
S1 FAM1 II:8 2 17 58083715 59323043 1239.33 rs17842773 rs17513268 159
S1 FAM1 II:7 1 17 57544641 59392826 1848.18 rs4968371 rs6504034 262
S1 FAM1 II:1 2 17 57544641 59315145 1770.5 rs4968371 rs8073676 235
S1 FAM1 II:2 1 17 57544641 59315145 1770.5 rs4968371 rs8073676 235
S1 CON 10 5|5 17 58083715 59315145 1231.43 rs17842773 rs8073676 158
S1 UNION 10 5|5 17 57544641 59808196 2263.55 rs4968371 rs7212440 383
S2 FAM1 I:1 1 16 66748612 68437189 1688.58 rs11075640 rs4783626 347
S2 FAM1 II:1 2 16 66748612 68437189 1688.58 rs11075640 rs4783626 347
S2 FAM1 II:5 2 16 66748612 68437189 1688.58 rs11075640 rs4783626 347
S2 FAM1 I:2 1 16 66706552 68417669 1711.12 rs4258603 rs1110569 344
S2 FAM1 II:2 1 16 66706552 68417669 1711.12 rs4258603 rs1110569 344
S2 FAM1 II:3 2 16 66706552 68417669 1711.12 rs4258603 rs1110569 344
S2 FAM1 II:6 2 16 66706552 68417669 1711.12 rs4258603 rs1110569 344
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
10
S2 FAM1 II:7 1 16 66706552 68417669 1711.12 rs4258603 rs1110569 344
S2 FAM1 II:4 1 16 61101396 71124923 10023.5 rs4785146 rs7205580 2045
S2 FAM1 II:8 2 16 61101396 71091088 9989.69 rs4785146 rs6499412 2043
S2 CON 10 5|5 16 66748612 68417669 1669.06 rs11075640 rs1110569 342
S2 UNION 10 5|5 16 61101396 71124923 10023.5 rs4785146 rs7205580 2045
S4 FAM1 II:5 2 5 131408842 135993372 4584.53 rs1469149 rs11242338 1265
S4 FAM1 II:7 1 5 131408842 135993372 4584.53 rs1469149 rs11242338 1265
S4 FAM1 II:2 1 5 129997196 131457028 1459.83 rs17714209 rs247294 147
S4 FAM1 II:4 1 5 129997196 131457028 1459.83 rs17714209 rs247294 147
S4 FAM1 II:6 2 5 129997196 131457028 1459.83 rs17714209 rs247294 147
S4 FAM1 II:8 2 5 129997196 131457028 1459.83 rs17714209 rs247294 147
S4 FAM1 I:1 1 5 129997196 131409768 1412.57 rs17714209 rs10072253 135
S4 FAM1 II:3 2 5 129703802 131409768 1705.97 rs6870318 rs10072253 165
S4 CON 8 4|4 5 131408842 131409768 0.926 rs1469149 rs10072253 2
S4 UNION 8 4|4 5 129703802 135993372 6289.57 rs6870318 rs11242338 1428
S6 FAM1 I:2 1 2 187213730 188388311 1174.58 rs10497668 rs12613071 184
S6 FAM1 II:6 2 2 187213730 188388311 1174.58 rs10497668 rs12613071 184
S6 FAM1 II:7 1 2 187213730 188388311 1174.58 rs10497668 rs12613071 184
S6 FAM1 II:1 2 2 186245653 188573244 2327.59 rs17403192 rs13388743 321
S6 FAM1 II:3 2 2 186245653 188573244 2327.59 rs17403192 rs13388743 321
S6 FAM1 II:5 2 2 186245653 188573244 2327.59 rs17403192 rs13388743 321
S6 FAM1 II:8 2 2 186245653 188573244 2327.59 rs17403192 rs13388743 321
S6 CON 7 5|2 2 187213730 188388311 1174.58 rs10497668 rs12613071 184
S6 UNION 7 5|2 2 186245653 188573244 2327.59 rs17403192 rs13388743 321
S7 FAM1 I:2 1 1 105306516 106622689 1316.17 rs4620554 rs6582953 248
S7 FAM1 II:4 1 1 105306516 106622689 1316.17 rs4620554 rs6582953 248
S7 FAM1 II:5 2 1 105306516 106622689 1316.17 rs4620554 rs6582953 248
S7 FAM1 II:8 2 1 105306516 106622689 1316.17 rs4620554 rs6582953 248
S7 FAM1 II:1 2 1 104981506 112078726 7097.22 rs10881158 rs2798565 1901
S7 FAM1 II:6 2 1 97892858 112078726 14185.9 rs1556798 rs2798565 3689
S7 FAM1 II:2 1 1 97892858 110334034 12441.2 rs1556798 rs11102006 3058
S7 CON 7 4|3 1 105306516 106622689 1316.17 rs4620554 rs6582953 248
S7 UNION 7 4|3 1 97892858 112078726 14185.9 rs1556798 rs2798565 3689
S8 FAM1 I:2 1 8 50349102 51403548 1054.45 rs1674270 rs2068238 162
S8 FAM1 II:5 2 8 50349102 51403548 1054.45 rs1674270 rs2068238 162
S8 FAM1 II:6 2 8 50349102 51403548 1054.45 rs1674270 rs2068238 162
S8 FAM1 II:1 2 8 46886735 54414255 7527.52 rs11993658 rs2068035 1108
S8 FAM1 II:2 1 8 46886735 54414255 7527.52 rs11993658 rs2068035 1108
S8 FAM1 II:3 2 8 46886735 53323786 6437.05 rs11993658 rs3758126 853
S8 CON 6 4|2 8 50349102 51403548 1054.45 rs1674270 rs2068238 162
S8 UNION 6 4|2 8 46886735 54414255 7527.52 rs11993658 rs2068035 1108
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
11
S11 FAM1 I:2 1 3 159822667 160853401 1030.73 rs9861636 rs9810737 182
S11 FAM1 II:2 1 3 159822667 160853401 1030.73 rs9861636 rs9810737 182
S11 FAM1 II:6 2 3 159822667 160853401 1030.73 rs9861636 rs9810737 182
S11 FAM1 II:3 2 3 147502818 176338830 28836 rs7627412 rs936033 5795
S11 FAM1 II:7 1 3 137915204 176338830 38423.6 rs6439792 rs936033 8019
S11 FAM1 II:4 1 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S11 CON 6 2|4 3 159822667 160853401 1030.73 rs9861636 rs9810737 182
S11 UNION 6 2|4 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S12 FAM1 II:1 2 2 173113143 174119970 1006.83 rs6757886 rs16861447 274
S12 FAM1 II:3 2 2 173113143 174119970 1006.83 rs6757886 rs16861447 274
S12 FAM1 II:5 2 2 173113143 174119970 1006.83 rs6757886 rs16861447 274
S12 FAM1 II:6 2 2 173113143 174119970 1006.83 rs6757886 rs16861447 274
S12 FAM1 II:7 1 2 173113143 174119970 1006.83 rs6757886 rs16861447 274
S12 FAM1 II:8 2 2 173113143 174119970 1006.83 rs6757886 rs16861447 274
S12 CON 6 5|1 2 173113143 174119970 1006.83 rs6757886 rs16861447 274
S12 UNION 6 5|1 2 173113143 174119970 1006.83 rs6757886 rs16861447 274
S13 FAM1 II:5 2 20 41616510 61600831 19984.3 rs2903624 rs1056011 6786
S13 FAM1 II:6 2 20 41616510 56223061 14606.6 rs2903624 rs6099703 4809
S13 FAM1 II:3 2 20 41616510 51938506 10322 rs2903624 rs200646 3289
S13 FAM1 II:1 2 20 41616510 50214629 8598.12 rs2903624 rs12632 2764
S13 FAM1 II:8 2 20 41616510 50102203 8485.69 rs2903624 rs747063 2708
S13 CON 5 5|0 20 41616510 50102203 8485.69 rs2903624 rs747063 2708
S13 UNION 5 5|0 20 41616510 61600831 19984.3 rs2903624 rs1056011 6786
S14 FAM1 II:5 2 19 54827040 56691571 1864.53 rs1645784 rs11084424 667
S14 FAM1 II:8 2 19 54357764 63759397 9401.63 rs3844453 rs8105097 1617
S14 FAM1 II:4 1 19 54357764 55485173 1127.41 rs3844453 rs703467 354
S14 FAM1 II:1 2 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S14 FAM1 II:2 1 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S14 CON 5 3|2 19 54827040 55485173 658.133 rs1645784 rs703467 208
S14 UNION 5 3|2 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S15 FAM1 II:7 1 17 57544641 59392826 1848.18 rs4968371 rs6504034 262
S15 FAM1 II:1 2 17 57544641 59315145 1770.5 rs4968371 rs8073676 235
S15 FAM1 II:2 1 17 57544641 59315145 1770.5 rs4968371 rs8073676 235
S15 FAM1 II:3 2 17 56439930 57560539 1120.61 rs2285990 rs6503921 159
S15 FAM1 II:5 2 17 56439930 57560539 1120.61 rs2285990 rs6503921 159
S15 CON 5 3|2 17 57544641 57560539 15.898 rs4968371 rs6503921 3
S15 UNION 5 3|2 17 56439930 59392826 2952.9 rs2285990 rs6504034 418
S17 FAM1 I:2 1 14 45225953 46331724 1105.77 rs17115489 rs8018854 151
S17 FAM1 II:1 2 14 45225953 46285478 1059.53 rs17115489 rs176788 140
S17 FAM1 II:5 2 14 45225953 46285478 1059.53 rs17115489 rs176788 140
S17 FAM1 II:7 1 14 45225953 46285478 1059.53 rs17115489 rs176788 140
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
12
S17 FAM1 II:2 1 14 45201544 46285478 1083.93 rs712415 rs176788 146
S17 CON 5 2|3 14 45225953 46285478 1059.53 rs17115489 rs176788 140
S17 UNION 5 2|3 14 45201544 46331724 1130.18 rs712415 rs8018854 157
S18 FAM1 I:2 1 11 30780931 31872707 1091.78 rs638196 rs7935771 126
S18 FAM1 II:2 1 11 21355784 31936515 10580.7 rs12421240 rs17720050 2551
S18 FAM1 II:5 2 11 21355784 31936515 10580.7 rs12421240 rs17720050 2551
S18 FAM1 II:8 2 11 21355784 31936515 10580.7 rs12421240 rs17720050 2551
S18 FAM1 II:7 1 11 21355784 31872707 10516.9 rs12421240 rs7935771 2534
S18 CON 5 2|3 11 30780931 31872707 1091.78 rs638196 rs7935771 126
S18 UNION 5 2|3 11 21355784 31936515 10580.7 rs12421240 rs17720050 2551
S19 FAM1 I:1 1 10 73869663 75108146 1238.48 rs17726002 rs3812622 153
S19 FAM1 II:2 1 10 73869663 75108146 1238.48 rs17726002 rs3812622 153
S19 FAM1 II:4 1 10 73869663 75108146 1238.48 rs17726002 rs3812622 153
S19 FAM1 II:5 2 10 57035385 79384253 22348.9 rs12412156 rs1476318 5662
S19 FAM1 II:7 1 10 53104260 79384253 26280 rs211083 rs1476318 7013
S19 CON 5 1|4 10 73869663 75108146 1238.48 rs17726002 rs3812622 153
S19 UNION 5 1|4 10 53104260 79384253 26280 rs211083 rs1476318 7013
S20 FAM1 I:2 1 10 37312705 39097912 1785.21 rs1914159 rs7089520 172
S20 FAM1 II:1 2 10 37312705 39097912 1785.21 rs1914159 rs7089520 172
S20 FAM1 II:2 1 10 37312705 39097912 1785.21 rs1914159 rs7089520 172
S20 FAM1 II:7 1 10 37312705 39097912 1785.21 rs1914159 rs7089520 172
S20 FAM1 II:3 2 10 37254098 39097912 1843.81 rs1852491 rs7089520 190
S20 CON 5 2|3 10 37312705 39097912 1785.21 rs1914159 rs7089520 172
S20 UNION 5 2|3 10 37254098 39097912 1843.81 rs1852491 rs7089520 190
S21 FAM1 II:1 2 8 100369465 101369801 1000.34 rs3110405 rs17423888 126
S21 FAM1 II:4 1 8 100369465 101369801 1000.34 rs3110405 rs17423888 126
S21 FAM1 II:7 1 8 100369465 101369801 1000.34 rs3110405 rs17423888 126
S21 FAM1 II:8 2 8 100369465 101369801 1000.34 rs3110405 rs17423888 126
S21 FAM1 I:1 1 8 99500634 100973453 1472.82 rs10441500 rs4518636 120
S21 CON 5 2|3 8 100369465 100973453 603.988 rs3110405 rs4518636 57
S21 UNION 5 2|3 8 99500634 101369801 1869.17 rs10441500 rs17423888 189
S22 FAM1 I:1 1 8 47338235 49064147 1725.91 rs7293734 rs10112655 126
S22 FAM1 II:4 1 8 47338235 49064147 1725.91 rs7293734 rs10112655 126
S22 FAM1 II:1 2 8 46886735 54414255 7527.52 rs11993658 rs2068035 1108
S22 FAM1 II:2 1 8 46886735 54414255 7527.52 rs11993658 rs2068035 1108
S22 FAM1 II:3 2 8 46886735 53323786 6437.05 rs11993658 rs3758126 853
S22 CON 5 2|3 8 47338235 49064147 1725.91 rs7293734 rs10112655 126
S22 UNION 5 2|3 8 46886735 54414255 7527.52 rs11993658 rs2068035 1108
S23 FAM1 I:2 1 7 55838545 57208666 1370.12 rs11766051 rs13240443 152
S23 FAM1 II:5 2 7 55838545 57208666 1370.12 rs11766051 rs13240443 152
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
13
S23 FAM1 II:4 1 7 44250826 58019061 13768.2 rs2072439 rs8185482 3132
S23 FAM1 II:8 2 7 40937782 58019061 17081.3 rs11767531 rs8185482 3943
S23 FAM1 II:3 2 7 24158809 58019061 33860.3 rs272703 rs8185482 8780
S23 CON 5 3|2 7 55838545 57208666 1370.12 rs11766051 rs13240443 152
S23 UNION 5 3|2 7 24158809 58019061 33860.3 rs272703 rs8185482 8780
S24 FAM1 I:1 1 3 135464712 136674500 1209.79 rs11717874 rs835636 144
S24 FAM1 II:1 2 3 135464712 136674500 1209.79 rs11717874 rs835636 144
S24 FAM1 II:5 2 3 135464712 136674500 1209.79 rs11717874 rs835636 144
S24 FAM1 II:4 1 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S24 FAM1 II:6 2 3 130255698 142931713 12676 rs1396330 rs9826732 2858
S24 CON 5 3|2 3 135464712 136674500 1209.79 rs11717874 rs835636 144
S24 UNION 5 3|2 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S25 FAM1 II:2 1 3 71741557 73412599 1671.04 rs12635700 rs3905755 538
S25 FAM1 II:1 2 3 67754695 73412599 5657.9 rs1037823 rs3905755 1529
S25 FAM1 II:4 1 3 64137693 73412599 9274.91 rs929701 rs3905755 2672
S25 FAM1 II:6 2 3 64137693 73412599 9274.91 rs929701 rs3905755 2672
S25 FAM1 II:8 2 3 64137693 73412599 9274.91 rs929701 rs3905755 2672
S25 CON 5 3|2 3 71741557 73412599 1671.04 rs12635700 rs3905755 538
S25 UNION 5 3|2 3 64137693 73412599 9274.91 rs929701 rs3905755 2672
S26 FAM1 II:2 1 2 31606670 32981379 1374.71 rs4407290 rs7606648 212
S26 FAM1 II:3 2 2 31606670 32981379 1374.71 rs4407290 rs7606648 212
S26 FAM1 II:7 1 2 31606670 32981379 1374.71 rs4407290 rs7606648 212
S26 FAM1 II:1 2 2 31563797 32806385 1242.59 rs207444 rs6721331 210
S26 FAM1 II:4 1 2 31563797 32806385 1242.59 rs207444 rs6721331 210
S26 CON 5 2|3 2 31606670 32806385 1199.71 rs4407290 rs6721331 180
S26 UNION 5 2|3 2 31563797 32981379 1417.58 rs207444 rs7606648 242
S28 FAM1 II:5 2 19 56694505 63759397 7064.89 rs575756 rs8105097 800
S28 FAM1 II:8 2 19 54357764 63759397 9401.63 rs3844453 rs8105097 1617
S28 FAM1 II:1 2 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S28 FAM1 II:2 1 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S28 CON 4 3|1 19 56694505 63759397 7064.89 rs575756 rs8105097 800
S28 UNION 4 3|1 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S31 FAM1 II:4 1 19 52294097 54332061 2037.96 rs12985955 rs7259148 677
S31 FAM1 II:1 2 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S31 FAM1 II:2 1 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S31 FAM1 II:8 2 19 51550855 54332061 2781.21 rs8105944 rs7259148 973
S31 CON 4 2|2 19 52294097 54332061 2037.96 rs12985955 rs7259148 677
S31 UNION 4 2|2 19 51550855 63759397 12208.5 rs8105944 rs8105097 2595
S33 FAM1 II:3 2 17 56439930 57560539 1120.61 rs2285990 rs6503921 159
S33 FAM1 II:5 2 17 56439930 57560539 1120.61 rs2285990 rs6503921 159
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
14
S33 FAM1 I:2 1 17 56423114 57446588 1023.47 rs8263 rs16943470 137
S33 FAM1 II:7 1 17 56246317 57446588 1200.27 rs9901524 rs16943470 194
S33 CON 4 2|2 17 56439930 57446588 1006.66 rs2285990 rs16943470 133
S33 UNION 4 2|2 17 56246317 57560539 1314.22 rs9901524 rs6503921 220
S34 FAM1 II:1 2 15 42905340 44373887 1468.55 rs1197547 rs12903579 220
S34 FAM1 II:3 2 15 42905340 44373887 1468.55 rs1197547 rs12903579 220
S34 FAM1 II:4 1 15 42905340 44373887 1468.55 rs1197547 rs12903579 220
S34 FAM1 II:8 2 15 42905340 44373887 1468.55 rs1197547 rs12903579 220
S34 CON 4 3|1 15 42905340 44373887 1468.55 rs1197547 rs12903579 220
S34 UNION 4 3|1 15 42905340 44373887 1468.55 rs1197547 rs12903579 220
S36 FAM1 II:7 1 11 3657436 12902243 9244.81 rs1514691 rs2304731 3685
S36 FAM1 II:2 1 11 1857270 12902243 11045 rs907609 rs2304731 4277
S36 FAM1 II:8 2 11 1857270 12902243 11045 rs907609 rs2304731 4277
S36 FAM1 II:1 2 11 1857270 3849711 1992.44 rs907609 rs12272393 650
S36 CON 4 2|2 11 3657436 3849711 192.275 rs1514691 rs12272393 58
S36 UNION 4 2|2 11 1857270 12902243 11045 rs907609 rs2304731 4277
S37 FAM1 II:4 1 10 72114219 73514554 1400.34 rs4747010 rs7908979 642
S37 FAM1 II:5 2 10 57035385 79384253 22348.9 rs12412156 rs1476318 5662
S37 FAM1 II:7 1 10 53104260 79384253 26280 rs211083 rs1476318 7013
S37 FAM1 II:8 2 10 44855740 72880512 28024.8 rs11595588 rs7900882 6913
S37 CON 4 2|2 10 72114219 72880512 766.293 rs4747010 rs7900882 346
S37 UNION 4 2|2 10 44855740 79384253 34528.5 rs11595588 rs1476318 8481
S38 FAM1 II:3 2 10 8592821 9964451 1371.63 rs4747803 rs4747843 409
S38 FAM1 II:1 2 10 7576231 9964451 2388.22 rs2050352 rs4747843 865
S38 FAM1 II:4 1 10 7576231 9964451 2388.22 rs2050352 rs4747843 865
S38 FAM1 II:6 2 10 7576231 9964451 2388.22 rs2050352 rs4747843 865
S38 CON 4 3|1 10 8592821 9964451 1371.63 rs4747803 rs4747843 409
S38 UNION 4 3|1 10 7576231 9964451 2388.22 rs2050352 rs4747843 865
S39 FAM1 II:7 1 9 139000752 141066491 2065.74 rs1620864 rs9314655 513
S39 FAM1 II:2 1 9 137037501 141066491 4028.99 rs28379755 rs9314655 1269
S39 FAM1 II:5 2 9 137037501 141066491 4028.99 rs28379755 rs9314655 1269
S39 FAM1 II:8 2 9 137037501 141066491 4028.99 rs28379755 rs9314655 1269
S39 CON 4 2|2 9 139000752 141066491 2065.74 rs1620864 rs9314655 513
S39 UNION 4 2|2 9 137037501 141066491 4028.99 rs28379755 rs9314655 1269
S41 FAM1 II:2 1 7 152784233 159119486 6335.25 rs7779529 rs1124425 1855
S41 FAM1 II:1 2 7 151473179 159119486 7646.31 rs4725431 rs1124425 2167
S41 FAM1 II:7 1 7 151473179 159119486 7646.31 rs4725431 rs1124425 2167
S41 FAM1 II:4 1 7 151473179 157791029 6317.85 rs4725431 rs11984274 1900
S41 CON 4 1|3 7 152784233 157791029 5006.8 rs7779529 rs11984274 1588
S41 UNION 4 1|3 7 151473179 159119486 7646.31 rs4725431 rs1124425 2167
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
15
S42 FAM1 II:7 1 7 91303198 92477082 1173.88 rs12668203 rs4605988 183
S42 FAM1 II:2 1 7 91299161 92438490 1139.33 rs2974129 rs13438182 181
S42 FAM1 II:6 2 7 91299161 92438490 1139.33 rs2974129 rs13438182 181
S42 FAM1 I:1 1 7 91170941 92477082 1306.14 rs4727257 rs4605988 218
S42 CON 4 1|3 7 91303198 92438490 1135.29 rs12668203 rs13438182 180
S42 UNION 4 1|3 7 91170941 92477082 1306.14 rs4727257 rs4605988 218
S43 FAM1 II:2 1 7 32496930 33497548 1000.62 rs3801328 rs17170255 140
S43 FAM1 II:6 2 7 32496930 33497548 1000.62 rs3801328 rs17170255 140
S43 FAM1 II:8 2 7 32496930 33497548 1000.62 rs3801328 rs17170255 140
S43 FAM1 II:3 2 7 24158809 58019061 33860.3 rs272703 rs8185482 8780
S43 CON 4 3|1 7 32496930 33497548 1000.62 rs3801328 rs17170255 140
S43 UNION 4 3|1 7 24158809 58019061 33860.3 rs272703 rs8185482 8780
S44 FAM1 II:1 2 7 139113 1213127 1074.01 rs10275469 rs1543985 161
S44 FAM1 II:3 2 7 139113 1213127 1074.01 rs10275469 rs1543985 161
S44 FAM1 II:4 1 7 139113 1213127 1074.01 rs10275469 rs1543985 161
S44 FAM1 II:6 2 7 139113 1213127 1074.01 rs10275469 rs1543985 161
S44 CON 4 3|1 7 139113 1213127 1074.01 rs10275469 rs1543985 161
S44 UNION 4 3|1 7 139113 1213127 1074.01 rs10275469 rs1543985 161
S45 FAM1 I:2 1 6 28295533 29356687 1061.15 rs6902583 rs442694 598
S45 FAM1 II:1 2 6 28295533 29355113 1059.58 rs6902583 rs238869 591
S45 FAM1 II:2 1 6 27746178 29355113 1608.93 rs9468226 rs238869 897
S45 FAM1 II:8 2 6 27746178 29355113 1608.93 rs9468226 rs238869 897
S45 CON 4 2|2 6 28295533 29355113 1059.58 rs6902583 rs238869 591
S45 UNION 4 2|2 6 27746178 29356687 1610.51 rs9468226 rs442694 904
S46 FAM1 II:2 1 4 176126818 177689133 1562.32 rs6812564 rs4557213 377
S46 FAM1 II:4 1 4 176126818 177689133 1562.32 rs6812564 rs4557213 377
S46 FAM1 II:8 2 4 176126818 177689133 1562.32 rs6812564 rs4557213 377
S46 FAM1 II:6 2 4 176126818 177195145 1068.33 rs6812564 rs6820078 225
S46 CON 4 2|2 4 176126818 177195145 1068.33 rs6812564 rs6820078 225
S46 UNION 4 2|2 4 176126818 177689133 1562.32 rs6812564 rs4557213 377
S47 FAM1 II:1 2 3 194785443 196426606 1641.16 rs7627043 rs12718037 298
S47 FAM1 II:3 2 3 192909721 196426606 3516.89 rs1531464 rs12718037 798
S47 FAM1 II:7 1 3 192909721 196426606 3516.89 rs1531464 rs12718037 798
S47 FAM1 II:8 2 3 192909721 196426606 3516.89 rs1531464 rs12718037 798
S47 CON 4 3|1 3 194785443 196426606 1641.16 rs7627043 rs12718037 298
S47 UNION 4 3|1 3 192909721 196426606 3516.89 rs1531464 rs12718037 798
S48 FAM1 II:3 2 3 192909721 196426606 3516.89 rs1531464 rs12718037 798
S48 FAM1 II:7 1 3 192909721 196426606 3516.89 rs1531464 rs12718037 798
S48 FAM1 II:8 2 3 192909721 196426606 3516.89 rs1531464 rs12718037 798
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
16
S48 FAM1 II:4 1 3 192909721 194769773 1860.05 rs1531464 rs9812839 496
S48 CON 4 2|2 3 192909721 194769773 1860.05 rs1531464 rs9812839 496
S48 UNION 4 2|2 3 192909721 196426606 3516.89 rs1531464 rs12718037 798
S49 FAM1 II:6 2 3 166782767 176338830 9556.06 rs2030351 rs936033 2062
S49 FAM1 II:3 2 3 147502818 176338830 28836 rs7627412 rs936033 5795
S49 FAM1 II:7 1 3 137915204 176338830 38423.6 rs6439792 rs936033 8019
S49 FAM1 II:4 1 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S49 CON 4 2|2 3 166782767 176338830 9556.06 rs2030351 rs936033 2062
S49 UNION 4 2|2 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S50 FAM1 II:3 2 3 147502818 176338830 28836 rs7627412 rs936033 5795
S50 FAM1 II:7 1 3 137915204 176338830 38423.6 rs6439792 rs936033 8019
S50 FAM1 II:4 1 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S50 FAM1 II:8 2 3 164895453 166444743 1549.29 rs2053371 rs2863837 213
S50 CON 4 2|2 3 164895453 166444743 1549.29 rs2053371 rs2863837 213
S50 UNION 4 2|2 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S51 FAM1 II:7 1 3 137915204 176338830 38423.6 rs6439792 rs936033 8019
S51 FAM1 II:4 1 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S51 FAM1 II:6 2 3 130255698 142931713 12676 rs1396330 rs9826732 2858
S51 FAM1 II:8 2 3 137915204 138980265 1065.06 rs6439792 rs6439841 155
S51 CON 4 2|2 3 137915204 138980265 1065.06 rs6439792 rs6439841 155
S51 UNION 4 2|2 3 130255698 176338830 46083.1 rs1396330 rs936033 9728
S54 FAM1 II:1 2 22 28620907 29652158 1031.25 rs5752710 rs16987328 185
S54 FAM1 II:3 2 22 28620907 29652158 1031.25 rs5752710 rs16987328 185
S54 FAM1 II:4 1 22 28620907 29652158 1031.25 rs5752710 rs16987328 185
S54 CON 3 2|1 22 28620907 29652158 1031.25 rs5752710 rs16987328 185
S54 UNION 3 2|1 22 28620907 29652158 1031.25 rs5752710 rs16987328 185
S58 FAM1 II:7 1 19 7834274 9932347 2098.07 rs15282 rs2277969 533
S58 FAM1 II:1 2 19 7283414 9932347 2648.93 rs7254060 rs2277969 689
S58 FAM1 II:4 1 19 7283414 9932347 2648.93 rs7254060 rs2277969 689
S58 CON 3 1|2 19 7834274 9932347 2098.07 rs15282 rs2277969 533
S58 UNION 3 1|2 19 7283414 9932347 2648.93 rs7254060 rs2277969 689
S59 FAM1 II:2 1 19 2977638 3990291 1012.65 rs929535 rs737204 289
S59 FAM1 II:1 2 19 1723463 7273991 5550.53 rs10413694 rs10411676 1595
S59 FAM1 II:4 1 19 1723463 7273991 5550.53 rs10413694 rs10411676 1595
S59 CON 3 1|2 19 2977638 3990291 1012.65 rs929535 rs737204 289
S59 UNION 3 1|2 19 1723463 7273991 5550.53 rs10413694 rs10411676 1595
S60 FAM1 II:2 1 18 57129997 60878883 3748.89 rs7237683 rs9955190 1114
S60 FAM1 II:6 2 18 57129997 60878883 3748.89 rs7237683 rs9955190 1114
S60 FAM1 II:8 2 18 57129997 60878883 3748.89 rs7237683 rs9955190 1114
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
17
S60 CON 3 2|1 18 57129997 60878883 3748.89 rs7237683 rs9955190 1114
S60 UNION 3 2|1 18 57129997 60878883 3748.89 rs7237683 rs9955190 1114
S61 FAM1 II:2 1 18 17704301 22027144 4322.84 rs14062 rs16940749 601
S61 FAM1 II:6 2 18 17704301 22027144 4322.84 rs14062 rs16940749 601
S61 FAM1 II:8 2 18 17704301 22027144 4322.84 rs14062 rs16940749 601
S61 CON 3 2|1 18 17704301 22027144 4322.84 rs14062 rs16940749 601
S61 UNION 3 2|1 18 17704301 22027144 4322.84 rs14062 rs16940749 601
S62 FAM1 II:6 2 18 5204070 15375878 10171.8 rs8090209 rs11080827 3155
S62 FAM1 II:2 1 18 4204048 15375878 11171.8 rs17657040 rs11080827 3510
S62 FAM1 II:8 2 18 4204048 15375878 11171.8 rs17657040 rs11080827 3510
S62 CON 3 2|1 18 5204070 15375878 10171.8 rs8090209 rs11080827 3155
S62 UNION 3 2|1 18 4204048 15375878 11171.8 rs17657040 rs11080827 3510
S65 FAM1 I:2 1 17 20292395 22213908 1921.51 rs16941857 rs12325748 205
S65 FAM1 II:3 2 17 19510081 20673512 1163.43 rs11654072 rs9899961 168
S65 FAM1 II:5 2 17 19510081 20673512 1163.43 rs11654072 rs9899961 168
S65 CON 3 2|1 17 20292395 20673512 381.117 rs16941857 rs9899961 21
S65 UNION 3 2|1 17 19510081 22213908 2703.83 rs11654072 rs12325748 352
S66 FAM1 II:4 1 16 61101396 71124923 10023.5 rs4785146 rs7205580 2045
S66 FAM1 II:8 2 16 61101396 71091088 9989.69 rs4785146 rs6499412 2043
S66 FAM1 II:5 2 16 61101396 62778362 1676.97 rs4785146 rs17428476 346
S66 CON 3 2|1 16 61101396 62778362 1676.97 rs4785146 rs17428476 346
S66 UNION 3 2|1 16 61101396 71124923 10023.5 rs4785146 rs7205580 2045
S67 FAM1 II:2 1 16 21254235 22722308 1468.07 rs9933675 rs12920317 154
S67 FAM1 II:4 1 16 21254235 22722308 1468.07 rs9933675 rs12920317 154
S67 FAM1 II:5 2 16 21254235 22722308 1468.07 rs9933675 rs12920317 154
S67 CON 3 1|2 16 21254235 22722308 1468.07 rs9933675 rs12920317 154
S67 UNION 3 1|2 16 21254235 22722308 1468.07 rs9933675 rs12920317 154
S68 FAM1 II:2 1 14 105660766 107287663 1626.9 rs8017698 rs10149476 105
S68 FAM1 II:5 2 14 105660766 107287663 1626.9 rs8017698 rs10149476 105
S68 FAM1 II:6 2 14 105660766 107287663 1626.9 rs8017698 rs10149476 105
S68 CON 3 2|1 14 105660766 107287663 1626.9 rs8017698 rs10149476 105
S68 UNION 3 2|1 14 105660766 107287663 1626.9 rs8017698 rs10149476 105
S69 FAM1 II:1 2 14 46334342 47459909 1125.57 rs10147303 rs8016110 188
S69 FAM1 II:5 2 14 46334342 47459909 1125.57 rs10147303 rs8016110 188
S69 FAM1 II:7 1 14 46334342 47459909 1125.57 rs10147303 rs8016110 188
S69 CON 3 2|1 14 46334342 47459909 1125.57 rs10147303 rs8016110 188
S69 UNION 3 2|1 14 46334342 47459909 1125.57 rs10147303 rs8016110 188
S70 FAM1 II:1 2 14 41952148 43008997 1056.85 rs12878670 rs2173539 211
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
18
S70 FAM1 II:5 2 14 41952148 43008997 1056.85 rs12878670 rs2173539 211
S70 FAM1 II:7 1 14 41952148 43008997 1056.85 rs12878670 rs2173539 211
S70 CON 3 2|1 14 41952148 43008997 1056.85 rs12878670 rs2173539 211
S70 UNION 3 2|1 14 41952148 43008997 1056.85 rs12878670 rs2173539 211
S71 FAM1 II:3 2 13 112353025 114047471 1694.45 rs7319901 rs8000162 522
S71 FAM1 II:7 1 13 112353025 114047471 1694.45 rs7319901 rs8000162 522
S71 FAM1 II:8 2 13 112353025 114047471 1694.45 rs7319901 rs8000162 522
S71 CON 3 2|1 13 112353025 114047471 1694.45 rs7319901 rs8000162 522
S71 UNION 3 2|1 13 112353025 114047471 1694.45 rs7319901 rs8000162 522
S72 FAM1 II:1 2 13 81026092 82151904 1125.81 rs1930352 rs9601645 259
S72 FAM1 II:5 2 13 81026092 82151904 1125.81 rs1930352 rs9601645 259
S72 FAM1 II:6 2 13 81026092 82151904 1125.81 rs1930352 rs9601645 259
S72 CON 3 3|0 13 81026092 82151904 1125.81 rs1930352 rs9601645 259
S72 UNION 3 3|0 13 81026092 82151904 1125.81 rs1930352 rs9601645 259
S73 FAM1 II:1 2 11 48164721 51518261 3353.54 rs1566729 rs11246610 240
S73 FAM1 II:3 2 11 48164721 51518261 3353.54 rs1566729 rs11246610 240
S73 FAM1 II:4 1 11 48164721 51518261 3353.54 rs1566729 rs11246610 240
S73 CON 3 2|1 11 48164721 51518261 3353.54 rs1566729 rs11246610 240
S73 UNION 3 2|1 11 48164721 51518261 3353.54 rs1566729 rs11246610 240
S82 FAM1 II:1 2 8 29865216 43791691 13926.5 rs16876321 rs10958798 2467
S82 FAM1 II:2 1 8 25482766 43791691 18308.9 rs6990076 rs10958798 3932
S82 FAM1 II:3 2 8 25482766 43791691 18308.9 rs6990076 rs10958798 3932
S82 CON 3 2|1 8 29865216 43791691 13926.5 rs16876321 rs10958798 2467
S82 UNION 3 2|1 8 25482766 43791691 18308.9 rs6990076 rs10958798 3932
S85 FAM1 I:2 1 7 118569946 120243576 1673.63 rs17141871 rs1527650 144
S85 FAM1 II:2 1 7 118569946 120243576 1673.63 rs17141871 rs1527650 144
S85 FAM1 II:3 2 7 118228470 120224300 1995.83 rs1588447 rs4730964 188
S85 CON 3 1|2 7 118569946 120224300 1654.35 rs17141871 rs4730964 143
S85 UNION 3 1|2 7 118228470 120243576 2015.11 rs1588447 rs1527650 189
S87 FAM1 II:4 1 7 61074194 70655941 9581.75 rs9314244 rs4339520 1257
S87 FAM1 II:8 2 7 61074194 70655941 9581.75 rs9314244 rs4339520 1257
S87 FAM1 II:3 2 7 61074194 70271908 9197.71 rs9314244 rs1918427 1179
S87 CON 3 2|1 7 61074194 70271908 9197.71 rs9314244 rs1918427 1179
S87 UNION 3 2|1 7 61074194 70655941 9581.75 rs9314244 rs4339520 1257
S89 FAM1 II:1 2 6 110659185 123886231 13227 rs976471 rs4897302 2647
S89 FAM1 II:5 2 6 110659185 123886231 13227 rs976471 rs4897302 2647
S89 FAM1 II:6 2 6 110659185 123886231 13227 rs976471 rs4897302 2647
S89 CON 3 3|0 6 110659185 123886231 13227 rs976471 rs4897302 2647
S89 UNION 3 3|0 6 110659185 123886231 13227 rs976471 rs4897302 2647
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
19
S90 FAM1 II:3 2 5 148206646 167090534 18883.9 rs1042717 rs17068925 4854
S90 FAM1 II:5 2 5 148206646 166166054 17959.4 rs1042717 rs6860339 4611
S90 FAM1 II:7 1 5 148206646 160026777 11820.1 rs1042717 rs4921307 3142
S90 CON 3 2|1 5 148206646 160026777 11820.1 rs1042717 rs4921307 3142
S90 UNION 3 2|1 5 148206646 167090534 18883.9 rs1042717 rs17068925 4854
S92 FAM1 II:8 2 4 158479507 169567817 11088.3 rs1434384 rs12643131 2285
S92 FAM1 II:4 1 4 156600197 169567817 12967.6 rs2625276 rs12643131 2695
S92 FAM1 II:6 2 4 154950464 169567817 14617.4 rs12512005 rs12643131 3095
S92 CON 3 2|1 4 158479507 169567817 11088.3 rs1434384 rs12643131 2285
S92 UNION 3 2|1 4 154950464 169567817 14617.4 rs12512005 rs12643131 3095
S93 FAM1 II:2 1 4 131599780 133743326 2143.55 rs1489435 rs6534907 305
S93 FAM1 II:4 1 4 131599780 133743326 2143.55 rs1489435 rs6534907 305
S93 FAM1 II:7 1 4 131599780 133743326 2143.55 rs1489435 rs6534907 305
S93 CON 3 0|3 4 131599780 133743326 2143.55 rs1489435 rs6534907 305
S93 UNION 3 0|3 4 131599780 133743326 2143.55 rs1489435 rs6534907 305
S94 FAM1 II:2 1 4 79455733 80513004 1057.27 rs4975139 rs12501981 153
S94 FAM1 II:4 1 4 79455733 80513004 1057.27 rs4975139 rs12501981 153
S94 FAM1 II:7 1 4 79455733 80513004 1057.27 rs4975139 rs12501981 153
S94 CON 3 0|3 4 79455733 80513004 1057.27 rs4975139 rs12501981 153
S94 UNION 3 0|3 4 79455733 80513004 1057.27 rs4975139 rs12501981 153
S95 FAM1 II:3 2 4 33616414 34749635 1133.22 rs1454609 rs11944699 109
S95 FAM1 II:7 1 4 33616414 34749635 1133.22 rs1454609 rs11944699 109
S95 FAM1 II:8 2 4 33616414 34749635 1133.22 rs1454609 rs11944699 109
S95 CON 3 2|1 4 33616414 34749635 1133.22 rs1454609 rs11944699 109
S95 UNION 3 2|1 4 33616414 34749635 1133.22 rs1454609 rs11944699 109
S99 FAM1 II:3 2 3 96112179 97350763 1238.58 rs2875764 rs301931 146
S99 FAM1 II:6 2 3 96112179 97350763 1238.58 rs2875764 rs301931 146
S99 FAM1 II:7 1 3 96112179 97350763 1238.58 rs2875764 rs301931 146
S99 CON 3 2|1 3 96112179 97350763 1238.58 rs2875764 rs301931 146
S99 UNION 3 2|1 3 96112179 97350763 1238.58 rs2875764 rs301931 146
S100 FAM1 II:3 2 3 87766543 89097831 1331.29 rs6769025 rs1496502 234
S100 FAM1 II:6 2 3 87766543 89097831 1331.29 rs6769025 rs1496502 234
S100 FAM1 II:7 1 3 87766543 89097831 1331.29 rs6769025 rs1496502 234
S100 CON 3 2|1 3 87766543 89097831 1331.29 rs6769025 rs1496502 234
S100 UNION 3 2|1 3 87766543 89097831 1331.29 rs6769025 rs1496502 234
S101 FAM1 II:3 2 3 79927812 81069531 1141.72 rs4856212 rs2639234 127
S101 FAM1 II:6 2 3 79927812 81069531 1141.72 rs4856212 rs2639234 127
S101 FAM1 II:7 1 3 79927812 81069531 1141.72 rs4856212 rs2639234 127
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
20
S101 CON 3 2|1 3 79927812 81069531 1141.72 rs4856212 rs2639234 127
S101 UNION 3 2|1 3 79927812 81069531 1141.72 rs4856212 rs2639234 127
S103 FAM1 II:6 2 2 201151824 202956470 1804.65 rs186089 rs11690765 526
S103 FAM1 II:7 1 2 201151824 202956470 1804.65 rs186089 rs11690765 526
S103 FAM1 II:8 2 2 201151824 202956470 1804.65 rs186089 rs11690765 526
S103 CON 3 2|1 2 201151824 202956470 1804.65 rs186089 rs11690765 526
S103 UNION 3 2|1 2 201151824 202956470 1804.65 rs186089 rs11690765 526
S104 FAM1 II:6 2 2 197300379 198643631 1343.25 rs6745575 rs700655 205
S104 FAM1 II:7 1 2 197300379 198643631 1343.25 rs6745575 rs700655 205
S104 FAM1 II:8 2 2 197300379 198643631 1343.25 rs6745575 rs700655 205
S104 CON 3 2|1 2 197300379 198643631 1343.25 rs6745575 rs700655 205
S104 UNION 3 2|1 2 197300379 198643631 1343.25 rs6745575 rs700655 205
S105 FAM1 II:1 2 2 135466520 137007076 1540.56 rs16830921 rs6756490 240
S105 FAM1 II:3 2 2 135466520 137007076 1540.56 rs16830921 rs6756490 240
S105 FAM1 II:8 2 2 135466520 137007076 1540.56 rs16830921 rs6756490 240
S105 CON 3 3|0 2 135466520 137007076 1540.56 rs16830921 rs6756490 240
S105 UNION 3 3|0 2 135466520 137007076 1540.56 rs16830921 rs6756490 240
S106 FAM1 II:1 2 2 122055684 123099547 1043.86 rs6760235 rs10496581 161
S106 FAM1 II:3 2 2 122055684 123099547 1043.86 rs6760235 rs10496581 161
S106 FAM1 II:8 2 2 122055684 123099547 1043.86 rs6760235 rs10496581 161
S106 CON 3 3|0 2 122055684 123099547 1043.86 rs6760235 rs10496581 161
S106 UNION 3 3|0 2 122055684 123099547 1043.86 rs6760235 rs10496581 161
S107 FAM1 II:4 1 2 95395757 98677164 3281.41 rs28672994 rs17026292 334
S107 FAM1 II:5 2 2 95395757 98677164 3281.41 rs28672994 rs17026292 334
S107 FAM1 II:6 2 2 95395757 98677164 3281.41 rs28672994 rs17026292 334
S107 CON 3 2|1 2 95395757 98677164 3281.41 rs28672994 rs17026292 334
S107 UNION 3 2|1 2 95395757 98677164 3281.41 rs28672994 rs17026292 334
S108 FAM1 II:5 2 2 38762291 39963667 1201.38 rs6544167 rs8265 227
S108 FAM1 II:6 2 2 38762291 39963667 1201.38 rs6544167 rs8265 227
S108 FAM1 II:7 1 2 38762291 39963667 1201.38 rs6544167 rs8265 227
S108 CON 3 2|1 2 38762291 39963667 1201.38 rs6544167 rs8265 227
S108 UNION 3 2|1 2 38762291 39963667 1201.38 rs6544167 rs8265 227
S111 FAM1 II:2 1 20 57796507 61600831 3804.32 rs259986 rs1056011 1414
S111 FAM1 II:5 2 20 41616510 61600831 19984.3 rs2903624 rs1056011 6786
S111 CON 2 1|1 20 57796507 61600831 3804.32 rs259986 rs1056011 1414
S111 UNION 2 1|1 20 41616510 61600831 19984.3 rs2903624 rs1056011 6786
S117 FAM1 II:3 2 17 67444543 70438529 2993.99 rs2715825 rs12452969 873
S117 FAM1 II:7 1 17 67444543 70438529 2993.99 rs2715825 rs12452969 873
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
21
S117 CON 2 1|1 17 67444543 70438529 2993.99 rs2715825 rs12452969 873
S117 UNION 2 1|1 17 67444543 70438529 2993.99 rs2715825 rs12452969 873
S118 FAM1 II:4 1 17 61072624 62109123 1036.5 rs241074 rs17688326 205
S118 FAM1 II:6 2 17 61072624 62109123 1036.5 rs241074 rs17688326 205
S118 CON 2 1|1 17 61072624 62109123 1036.5 rs241074 rs17688326 205
S118 UNION 2 1|1 17 61072624 62109123 1036.5 rs241074 rs17688326 205
S123 FAM1 II:8 2 16 71174886 85207028 14032.1 rs9924525 rs4072655 5657
S123 FAM1 II:4 1 16 71174886 74124877 2949.99 rs9924525 rs7500608 722
S123 CON 2 1|1 16 71174886 74124877 2949.99 rs9924525 rs7500608 722
S123 UNION 2 1|1 16 71174886 85207028 14032.1 rs9924525 rs4072655 5657
S125 FAM1 II:3 2 15 98858716 100502494 1643.78 rs7177705 rs746435 557
S125 FAM1 II:8 2 15 98858716 100412680 1553.96 rs7177705 rs12101368 532
S125 CON 2 2|0 15 98858716 100412680 1553.96 rs7177705 rs12101368 532
S125 UNION 2 2|0 15 98858716 100502494 1643.78 rs7177705 rs746435 557
S126 FAM1 II:1 2 15 64194173 65198591 1004.42 rs730589 rs1631677 132
S126 FAM1 II:3 2 15 64194173 65198591 1004.42 rs730589 rs1631677 132
S126 CON 2 2|0 15 64194173 65198591 1004.42 rs730589 rs1631677 132
S126 UNION 2 2|0 15 64194173 65198591 1004.42 rs730589 rs1631677 132
S127 FAM1 II:3 2 14 18251590 21303284 3051.69 rs28696174 rs10150744 475
S127 FAM1 II:5 2 14 18251590 21303284 3051.69 rs28696174 rs10150744 475
S127 CON 2 2|0 14 18251590 21303284 3051.69 rs28696174 rs10150744 475
S127 UNION 2 2|0 14 18251590 21303284 3051.69 rs28696174 rs10150744 475
S128 FAM1 II:1 2 12 4108124 8759936 4651.81 rs11834507 rs17792729 1534
S128 FAM1 II:6 2 12 189386 8759936 8570.55 rs557881 rs17792729 2797
S128 CON 2 2|0 12 4108124 8759936 4651.81 rs11834507 rs17792729 1534
S128 UNION 2 2|0 12 189386 8759936 8570.55 rs557881 rs17792729 2797
S129 FAM1 II:5 2 10 133521382 135477883 1956.5 rs11156567 rs11528930 568
S129 FAM1 II:1 2 10 131033938 135477883 4443.94 rs555788 rs11528930 1556
S129 CON 2 2|0 10 133521382 135477883 1956.5 rs11156567 rs11528930 568
S129 UNION 2 2|0 10 131033938 135477883 4443.94 rs555788 rs11528930 1556
S130 FAM1 II:1 2 10 131033938 135477883 4443.94 rs555788 rs11528930 1556
S130 FAM1 II:3 2 10 131033938 132254561 1220.62 rs555788 rs10829748 424
S130 CON 2 2|0 10 131033938 132254561 1220.62 rs555788 rs10829748 424
S130 UNION 2 2|0 10 131033938 135477883 4443.94 rs555788 rs11528930 1556
S133 FAM1 II:2 1 9 30467975 31573759 1105.78 rs10813260 rs10970427 210
S133 FAM1 II:6 2 9 30467975 31573759 1105.78 rs10813260 rs10970427 210
S133 CON 2 1|1 9 30467975 31573759 1105.78 rs10813260 rs10970427 210
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
22
S133 UNION 2 1|1 9 30467975 31573759 1105.78 rs10813260 rs10970427 210
S134 FAM1 II:5 2 8 138329394 146293414 7964.02 rs7820415 rs6599566 2179
S134 FAM1 II:2 1 8 119338870 146293414 26954.5 rs2450221 rs6599566 7486
S134 CON 2 1|1 8 138329394 146293414 7964.02 rs7820415 rs6599566 2179
S134 UNION 2 1|1 8 119338870 146293414 26954.5 rs2450221 rs6599566 7486
S135 FAM1 I:2 1 8 111478321 112738096 1259.78 rs13267290 rs7814781 142
S135 FAM1 II:2 1 8 111478321 112738096 1259.78 rs13267290 rs7814781 142
S135 CON 2 0|2 8 111478321 112738096 1259.78 rs13267290 rs7814781 142
S135 UNION 2 0|2 8 111478321 112738096 1259.78 rs13267290 rs7814781 142
S143 FAM1 II:1 2 6 5534271 23519714 17985.4 rs9405274 rs2206333 5534
S143 FAM1 II:2 1 6 5534271 16807562 11273.3 rs9405274 rs13193662 3570
S143 CON 2 1|1 6 5534271 16807562 11273.3 rs9405274 rs13193662 3570
S143 UNION 2 1|1 6 5534271 23519714 17985.4 rs9405274 rs2206333 5534
S146 FAM1 II:5 2 5 64778944 69175823 4396.88 rs33394 rs28591114 974
S146 FAM1 II:7 1 5 64778944 66797307 2018.36 rs33394 rs1532121 500
S146 CON 2 1|1 5 64778944 66797307 2018.36 rs33394 rs1532121 500
S146 UNION 2 1|1 5 64778944 69175823 4396.88 rs33394 rs28591114 974
S147 FAM1 II:5 2 5 63131886 64759675 1627.79 rs6449685 rs386188 268
S147 FAM1 II:7 1 5 63131886 64759675 1627.79 rs6449685 rs386188 268
S147 CON 2 1|1 5 63131886 64759675 1627.79 rs6449685 rs386188 268
S147 UNION 2 1|1 5 63131886 64759675 1627.79 rs6449685 rs386188 268
S148 FAM1 II:4 1 5 11926837 13149677 1222.84 rs10064613 rs32534 133
S148 FAM1 II:5 2 5 11926837 13021815 1094.98 rs10064613 rs16902341 131
S148 CON 2 1|1 5 11926837 13021815 1094.98 rs10064613 rs16902341 131
S148 UNION 2 1|1 5 11926837 13149677 1222.84 rs10064613 rs32534 133
S150 FAM1 II:1 2 4 142874553 144003159 1128.61 rs6537091 rs7686660 169
S150 FAM1 II:5 2 4 142874553 144003159 1128.61 rs6537091 rs7686660 169
S150 CON 2 2|0 4 142874553 144003159 1128.61 rs6537091 rs7686660 169
S150 UNION 2 2|0 4 142874553 144003159 1128.61 rs6537091 rs7686660 169
S151 FAM1 II:5 2 4 98127149 99387827 1260.68 rs4642255 rs2090118 122
S151 FAM1 II:6 2 4 98127149 99387827 1260.68 rs4642255 rs2090118 122
S151 CON 2 2|0 4 98127149 99387827 1260.68 rs4642255 rs2090118 122
S151 UNION 2 2|0 4 98127149 99387827 1260.68 rs4642255 rs2090118 122
S154 FAM1 II:2 1 3 51655856 52860936 1205.08 rs4687592 rs2276817 223
S154 FAM1 I:2 1 3 50523668 52526535 2002.87 rs1467914 rs2240897 249
S154 CON 2 0|2 3 51655856 52526535 870.679 rs4687592 rs2240897 148
S154 UNION 2 0|2 3 50523668 52860936 2337.27 rs1467914 rs2276817 324
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
23
S155 FAM1 I:2 1 3 46783432 48064591 1281.16 rs6810260 rs9831180 131
S155 FAM1 I:1 1 3 47895705 49878652 1982.95 rs17290714 rs1317140 319
S155 CON 2 0|2 3 47895705 48064591 168.886 rs17290714 rs9831180 15
S155 UNION 2 0|2 3 46783432 49878652 3095.22 rs6810260 rs1317140 435
S156 FAM1 II:6 2 2 188656082 189783186 1127.1 rs13027479 rs13390882 165
S156 FAM1 II:7 1 2 188656082 189783186 1127.1 rs13027479 rs13390882 165
S156 CON 2 1|1 2 188656082 189783186 1127.1 rs13027479 rs13390882 165
S156 UNION 2 1|1 2 188656082 189783186 1127.1 rs13027479 rs13390882 165
S158 FAM1 II:1 2 1 208872494 218574789 9702.3 rs1166873 rs6703224 2656
S158 FAM1 II:8 2 1 205015284 229468906 24453.6 rs11240341 rs164037 6386
S158 CON 2 2|0 1 208872494 218574789 9702.3 rs1166873 rs6703224 2656
S158 UNION 2 2|0 1 205015284 229468906 24453.6 rs11240341 rs164037 6386
S159 FAM1 II:1 2 1 145762959 146813358 1050.4 rs2784410 rs2353984 143
S159 FAM1 II:4 1 1 145762959 146813358 1050.4 rs2784410 rs2353984 143
S159 CON 2 1|1 1 145762959 146813358 1050.4 rs2784410 rs2353984 143
S159 UNION 2 1|1 1 145762959 146813358 1050.4 rs2784410 rs2353984 143
S162 FAM1 II:8 2 1 61170302 65152941 3982.64 rs12038037 rs2375523 1185
S162 FAM1 II:1 2 1 61170302 65148312 3978.01 rs12038037 rs12081048 1183
S162 CON 2 2|0 1 61170302 65148312 3978.01 rs12038037 rs12081048 1183
S162 UNION 2 2|0 1 61170302 65152941 3982.64 rs12038037 rs2375523 1185
S163 FAM1 II:1 2 1 40827598 55147547 14319.9 rs3013462 rs1560854 3124
S163 FAM1 II:8 2 1 40827598 55147547 14319.9 rs3013462 rs1560854 3124
S163 CON 2 2|0 1 40827598 55147547 14319.9 rs3013462 rs1560854 3124
S163 UNION 2 2|0 1 40827598 55147547 14319.9 rs3013462 rs1560854 3124
S164 FAM1 II:8 2 1 18569510 29870454 11300.9 rs12566407 rs7418865 3029
S164 FAM1 II:1 2 1 18569510 20250730 1681.22 rs12566407 rs2233688 615
S164 CON 2 2|0 1 18569510 20250730 1681.22 rs12566407 rs2233688 615
S164 UNION 2 2|0 1 18569510 29870454 11300.9 rs12566407 rs7418865 3029
S165 FAM1 II:8 2 1 10808587 11810973 1002.39 rs2076492 rs4075034 272
S165 FAM1 II:1 2 1 6212870 11810973 5598.1 rs1883604 rs4075034 1498
S165 CON 2 2|0 1 10808587 11810973 1002.39 rs2076492 rs4075034 272
S165 UNION 2 2|0 1 6212870 11810973 5598.1 rs1883604 rs4075034 1498
S166 FAM1 II:1 2 1 6212870 11810973 5598.1 rs1883604 rs4075034 1498
S166 FAM1 II:8 2 1 6212870 10790797 4577.93 rs1883604 rs284277 1223
S166 CON 2 2|0 1 6212870 10790797 4577.93 rs1883604 rs284277 1223
S166 UNION 2 2|0 1 6212870 11810973 5598.1 rs1883604 rs4075034 1498
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
24
POOL, set of homozygous regions; FIID, family ID (FAM1 refers to W09-1008); IID,
individual’s ID as in Fig. 1; CHR, chromosome #; genomic position of the start (BP1) and the
end (BP2) of the homozygous regions; KB, size of homozygous region in Kb; SNP1, first
homozygous SNP of homozygous region; SNP2, last SNP of homozygous region; NSNP, # of
SNPs in the regions; CON, shared homozygous region; UNION, size in Kb of region from the
most extreme start and end points of the homozygous segments of all individuals in the pool
including non-overlapping segments. The pool of homozygous regions harboring FITM2 is
highlighted in grey.
Table S3. Homozygous regions in the genomes of family members as determined in
PLINK.
FID IID PHE NSEG KB KBAVG % of genome
FAM1 I:1 1 19 26248.3 1381.49 0.87
FAM1 I:2 1 24 30806.7 1283.61 1.03
FAM1 II:1 2 47 189012 4021.54 6.30
FAM1 II:2 1 38 179794 4731.42 5.99
FAM1 II:3 2 38 175861 4627.91 5.86
FAM1 II:4 1 36 159879 4441.08 5.33
FAM1 II:5 2 43 199189 4632.3 6.64
FAM1 II:6 2 39 153199 3928.19 5.11
FAM1 II:7 1 41 161960 3950.24 5.40
FAM1 II:8 2 42 254513 6059.83 8.48
The sibs in generation II have 5.11-8.48 % of their genome in homozygous segments (>1Mb)
as expected for first cousins (Woods et al. 2006). In the pairwise check for familial
relationships based on % of SNPs observed to be identical by state, I:1 and I:2 are estimated
to be first cousins which provides no indications for prolonged ancestral consanguinity
(Woods et al. 2006). FIID, family ID (FAM1 refers to W09-1008); IID individual’s ID, as in
Fig. 1; PHE, phenotype (1 healthy, 2 affected); NSEG, # of homozygous segments; KB,
combined size of homozygous regions in Kb; KBAVG, average size of homozygous regions
in Kb; % of genome represents the % of genome in homozygous segments.
Table S4. Filter steps applied on sequence variants identified in WES of the parents, I:1
and I:2, and two affected children, II:5 and II:6.
Filter step # variants
All variants present in I:1, I:2, II:5 and II:6 45747
Coding (including missense, silent, nonsense, indels, splice site) 31162
Nonsynonymous (including missense, nonsense, indels, splice site) 15963
Rare variants, MAF <5% across all 1000 genomes and EVS 1574
Segregate (heterozygous in each parent, homozygous in 2 affected
children) 5
Within linkage region 20q12-q13.2 2
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
25
Table S5. Variants homozygously present in cases II:5 and II:6 and heterozygously in
the parents (I:1 and I:2).
Chr
#
Position
GRCh37/
hg19 Gene Ref Var SNP Effect AA
Predicted effect on
splicing (Alamut1)
SIFT/
Mut.
Taster/
PPH2
(Alamut1)
7 112107983 IFDR1 GGTC AA rs796075669 p.R2Kfs42
Loss of a predicted
alternative splice
donor site
10 43615094 RET C T rs1800862 p.S836S No
14 38273954 TTC6 G A rs17768654 p.A81T No B/NA/NA3
17 4458515 MYBBP1A G T rs1171282114 p.F35L No B/B/D
17 6684003 FBXO39 C G rs17731806 p.S272S No
20 42939785 FITM2 C A NA p.E2* No
20 44751415 CD40 A G rs11699100 p.E141E No
20 47858357 ZNFX1 C T rs530509544 p.R1139H5 No B/B/B
20 56098746 CTCFL G A rs119070636 p.S172S
strengthening a
predicted splice donor
site
Except for the variants of FITM2, ZNFX1, CD40 and CTCFL all homozygous variants are
located in chromosomal regions that are excluded in linkage analysis (LOD score ≤-2). The
predicted effects on splicing are indicated as well as the predicted effects on protein function
for missense variants. The variant of CTCFL is only homozygously present in cases II:5 and
II:6 but not in the cases II:1, II:3, and II:8 (see table S3). The variant of IFDR1 was excluded
by segregation analysis (Fig. S3). 1Alamut version 2.7.1, Interactive Biosoftware;
2Only in
transcript uc003vgk.3; 3only present in nonRefSeq transcripts (uc001wuj.3, uc001wui.3,
uc001wuh.3) for which predictions cannot be performed in the software; 4Homozygous in 50
individuals in ExAC; 5Only present in transcript ENST00000371754. Prediction of effect on
splicing is performed in NNSplice version 0.9 (BDGP; http//www.fruitfly.org) as the
transcript was not represented in Alamut; Homozygous in 4 individuals in ExAC; 6Telomeric
of the 8.4 Mb homozygous region. AA, amino acid; B, benign; D, damaging; NA, not
applicable; Ref, reference sequence; Var, variant.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
26
Table S6. Variants compound heterozygously present in cases II:5 and II:6 and
heterozygously in their parents (I:1 and I:2).
Chr
#
Position
GRCh37/h
g19 Gene Ref Var SNP Effect AA
Predicted effect on
splicing (Alamut1)
SIFT/
Mut. Taster/
PPH2
(Alamut1)
17 10225011 MYH13 G A rs377339754 p.S609S No
17 10215943 MYH13 C T rs546103209 p.R1438H No D/B/D
19 4511860 PLIN4 G A rs79731243 p.L690L No
19 4513204 PLIN4 A G rs561692572 p.G242G
Loss of a predicted
alternative splice
donor site
The biallelic MYH13 and PLIN4 variants are not potentially associated with the syndrome.
Only the missense variant of the MYH13 is predicted to affect protein function. Also, the
variants neither affect canonical splice sites nor result in novel splice acceptor or donor sites.
Furthermore, PLIN4 and MYH13 are located in regions that are excluded by LOD scores ≤-2.
AA, amino acid; B, benign; D, damaging; Ref, reference sequence; Var, variant. 1Alamut
version 2.7.1, Interactive Biosoftware.
Table S7. Summary of the data collected in the island assays.
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 20 0 20 0 20 20 15 0 15 0 17 17
2 13 0 13 2 16 18 9 4 13 1 30 31
3 8 8 2 17 19 8 0 8 0 19 19
4 NA NA NA 2 17 19 NA NA NA 1 18 19
5 NA NA NA 2 17 19 NA NA NA 0 20 20
TOTAL 41 0 41 8 87 95 32 4 36 2 104 106
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 11 0 11 0 13 13 10 0 10 3 12 15
2 13 0 13 0 12 12 11 0 11 3 14 17
3 32 1 33 0 15 15 13 0 13 0 9 9
4 1 2 3 0 18 18 3 1 4 NA NA NA
5 16 0 16 0 17 17 NA NA NA NA NA NA
TOTAL 73 3 76 0 75 75 37 1 38 6 35 41
Experiment flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal
1 100.0 0.0 0.0 100.0 100.0 0.0 0.0 100.0 100.0 0.0 0.0 100.0 100.0 0.0 20.0 80.0
2 100.0 0.0 11.1 88.9 69.2 30.8 3.2 96.8 100.0 0.0 0.0 100.0 100.0 0.0 17.6 82.4
3 100.0 0.0 10.5 89.5 100.0 0.0 0.0 100.0 97.0 3.0 0.0 100.0 100.0 0.0 0.0 100.0
4 NA NA 10.5 89.5 NA NA 5.3 94.7 33.3 66.7 0.0 100.0 75.0 25.0 NA NA
5 NA NA 10.5 89.5 NA NA 0.0 100.0 100.0 0.0 0.0 100.0 NA NA NA NA
Average 100.0 0.0 8.5 91.5 89.7 10.3 1.7 98.3 86.1 13.9 0.0 100.0 93.8 6.3 12.5 87.5
SD 0.0 0.0 4.3 4.3 14.5 14.5 2.2 2.2 26.4 26.4 0.0 0.0 10.8 10.8 8.9 8.9
S.E.M 0.0 0.0 1.9 1.9 4.8 4.8 1.0 1.0 11.8 11.8 0.0 0.0 5.4 5.4 4.5 4.5One way-ANOVA
Tukey correction
Tub84b -GAL4
4 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
12 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
p<0,0001 p<0,0001 p<0,0001 p=0,0003
%4 days old 12 days old
Fitm RNAi-1A Control-1 Fitm RNAi-2 Control-2 Fitm RNAi-1A Control-1 Fitm RNAi-2 Control-2
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
27
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 20 0 20 0 20 20 19 0 19 0 19 19
2 14 0 14 3 15 18 8 0 8 1 3 4
3 20 0 20 NA NA NA NA NA NA NA NA NA
4 16 1 17 NA NA NA NA NA NA NA NA NA
5 8 0 8 NA NA NA NA NA NA NA NA NA
TOTAL 78 1 79 3 35 38 27 0 27 1 22 23
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 11 0 11 2 28 30 20 0 20 0 18 18
2 3 0 3 0 25 25 7 0 7 0 12 12
3 NA NA NA 1 14 15 5 0 5 0 10 10
4 NA NA NA 0 25 25 7 0 7 NA NA NA
5 NA NA NA NA NA NA 18 0 18 NA NA NA
TOTAL 14 0 14 3 92 95 58 0 58 0 40 40
Experiment flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal
1 100.0 0.0 0.0 100.0 100.0 0.0 0.0 100.0 100.0 0.0 6.7 93.3 100.0 0.0 0.0 100.0
2 100.0 0.0 16.7 83.3 100.0 0.0 25.0 75.0 100.0 0.0 0.0 100.0 100.0 0.0 0.0 100.0
3 100.0 0.0 NA NA NA NA NA NA NA NA 6.7 93.3 100.0 0.0 0.0 100.0
4 94.1 5.9 NA NA NA NA NA NA NA NA 0.0 100.0 100.0 0.0 NA NA
5 100.0 0.0 NA NA NA NA NA NA NA NA NA NA 100.0 0.0 NA NA
Average 98.8 1.2 8.3 91.7 100.0 0.0 12.5 87.5 100.0 0.0 3.3 96.7 100.0 0.0 0.0 100.0
SD 2.4 2.4 8.3 8.3 0.0 0.0 12.5 12.5 0.0 0.0 3.3 3.3 0.0 0.0 0.0 0.0
S.E.M 1.1 1.1 5.9 5.9 0.0 0.0 5.6 5.6 0.0 0.0 1.7 1.7 0.0 0.0 0.0 0.0One way-ANOVA
Tukey correction
4 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
12 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
mef2 _GAL4
%Control-1Fitm RNAi-1AFitm RNAi-1A Control-1 Fitm RNAi-2 Control-2
p<0,0001 p<0,0001
Fitm RNAi-2 Control-2
4 days old 12 days old
p<0,0001 p<0,0001
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 2 25 27 3 27 30 2 21 23 0 33 33
2 2 7 9 1 24 25 4 16 20 0 35 35
3 1 20 21 2 32 34 4 31 35 0 33 33
4 NA NA NA NA NA NA 4 31 35 NA NA NA
5 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 5 52 57 6 83 89 14 99 113 0 101 101
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 30 10 40 8 31 39 29 9 38 3 39 42
2 17 23 40 3 37 40 13 28 41 11 39 50
3 18 22 40 0 39 39 NA NA NA 4 31 35
4 40 54 94 1 19 20 NA NA NA NA NA NA
5 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 105 109 214 12 126 138 42 37 79 18 109 127
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 22 8 30 5 25 30 20 0 20 4 26 30
2 17 2 19 9 43 52 17 0 17 3 27 30
3 31 10 41 NA NA NA NA NA NA NA NA NA
4 NA NA NA NA NA NA NA NA NA NA NA NA
5 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 70 20 90 14 68 82 37 0 37 7 53 60
Experiment flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal
1 7.4 92.6 10.0 90.0 8.7 91.3 0.0 100.0 75.0 25.0 20.5 79.5 76.3 23.7 7.1 92.9 73.3 26.7 16.7 83.3 100.0 0.0 13.3 86.7
2 22.2 77.8 4.0 96.0 20.0 80.0 0.0 100.0 42.5 57.5 7.5 92.5 31.7 68.3 22.0 78.0 89.5 10.5 17.3 82.7 100.0 0.0 10.0 90.0
3 4.8 95.2 5.9 94.1 11.4 88.6 0.0 100.0 45.0 55.0 0.0 100.0 NA NA 11.4 88.6 75.6 24.4 NA NA NA NA NA NA
4 NA NA NA NA 11.4 88.6 NA NA 42.6 57.4 5.0 95.0 NA NA NA NA NA NA NA NA NA NA NA NA
5 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA
Average 11.5 88.5 6.6 93.4 12.9 87.1 0.0 100.0 51.3 48.7 8.3 91.7 54.0 46.0 13.5 86.5 79.5 20.5 17.0 83.0 100.0 0.0 11.7 88.3
SD 7.7 7.7 2.5 2.5 4.3 4.3 0.0 0.0 13.7 13.7 7.6 7.6 22.3 22.3 6.2 6.2 7.1 7.1 0.3 0.3 0.0 0.0 1.7 1.7
S.E.M 4.4 4.4 1.4 1.4 2.1 2.1 0.0 0.0 6.9 6.9 3.8 3.8 15.8 15.8 3.6 3.6 4.1 4.1 0.2 0.2 0.0 0.0 1.2 1.2One way-ANOVA
Tukey correction
C7 -GAL4
4 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
12 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
%4 days old 12 days old
Fitm RNAi-1A Control-1 Fitm RNAi-2 Control-2 Fitm RNAi-1A Control-1 Fitm RNAi-2
21 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
p=0,0002 p<0,0001
Control-2
p=0,7069 p=0,0524 p=0,0139 p=0,0692
21 days old
Fitm RNAi-1A Control-1 Fitm RNAi-2 Control-2
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
28
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 0 4 4 0 11 11 0 9 9 0 11 11
2 0 12 12 0 12 12 0 10 10 0 6 6
3 0 11 11 1 8 9 0 14 14 0 10 10
4 1 10 11 NA NA NA 0 10 10 0 3 3
5 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 1 37 38 1 31 32 0 43 43 0 30 30
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 4 13 17 0 10 10 1 12 13 0 12 12
2 3 5 8 1 7 8 0 9 9 0 15 15
3 2 5 7 1 7 8 3 5 8 0 10 10
4 1 7 8 NA NA NA 1 3 4 NA NA NA
5 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 10 30 40 2 24 26 5 29 34 0 37 37
Experiment flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL flightless normal TOTAL
1 9 27 36 0 6 6 5 9 14 4 8 12
2 4 12 16 1 7 8 1 4 5 1 11 12
3 6 12 18 1 12 13 3 17 20 2 10 12
4 3 10 13 3 14 17 3 15 18 1 9 10
5 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 22 61 83 5 39 44 12 45 57 8 38 46
Experiment flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal flightless normal
1 0.0 100.0 0.0 100.0 0.0 100.0 0.0 100.0 23.5 76.5 0.0 100.0 7.7 92.3 0.0 100.0 25.0 75.0 0.0 100.0 35.7 64.3 33.3 66.7
2 0.0 100.0 0.0 100.0 0.0 100.0 0.0 100.0 37.5 62.5 12.5 87.5 0.0 100.0 0.0 100.0 25.0 75.0 12.5 87.5 20.0 80.0 8.3 91.7
3 0.0 100.0 11.1 88.9 0.0 100.0 0.0 100.0 28.6 71.4 12.5 87.5 37.5 62.5 0.0 100.0 33.3 66.7 7.7 92.3 15.0 85.0 16.7 83.3
4 9.1 90.9 NA NA 0.0 100.0 0.0 100.0 12.5 87.5 NA NA 25.0 75.0 NA NA 23.1 76.9 17.6 82.4 16.7 83.3 10.0 90.0
5 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA
Average 2.3 97.7 3.7 96.3 0.0 100.0 0.0 100.0 25.5 74.5 8.3 91.7 17.5 82.5 0.0 100.0 26.6 73.4 9.5 90.5 21.8 78.2 17.1 82.9
SD 3.9 3.9 5.2 5.2 0.0 0.0 0.0 0.0 9.0 9.0 5.9 5.9 14.7 14.7 0.0 0.0 4.0 4.0 6.5 6.5 8.2 8.2 9.9 9.9
S.E.M 2.0 2.0 3.0 3.0 0.0 0.0 0.0 0.0 4.5 4.5 3.4 3.4 7.3 7.3 0.0 0.0 2.0 2.0 3.2 3.2 4.1 4.1 4.9 4.9
One way-ANOVA
Tukey correction
12 days old
Fitm -RNAi1-A
n-syb -GAL4
4 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
Control-1 Fitm RNAi-2 Control-2
Fitm RNAi-2 Control-2 Fitm RNAi-1A
21 days old
Fitm -RNAi1-A Control-1 Fitm RNAi-2 Control-2
%4 days old 12 days old 21 days old
p=0,9537 p>0.9999 p=0,2568 p=0,2424 p=0,0649 p=0,8601
Control-1 Fitm RNAi-2 Control-2 Fitm RNAi-1A Control-1 Fitm RNAi-2 Control-2Fitm RNAi-1A Control-1
The raw data (upper table) shows the number of flightless flies and flies with normal flight
response. The table is arranged according days of age after eclosion at the day of testing (4, 12
and where available 21 days). Each row represents an independent island assay. The lower
table represents the same data expressed as percentages of flightless and flying flies for each
independent experiment. The average, standard deviation and S.E.M of each condition are
depicted in the bottom rows. One-way ANOVA with Tukey’s correction was performed
independently with all conditions belonging to the same age and driver. P-values obtained
with Fitm RNAi-1A vs Control-1 and Fitm RNAi-2 vs Control-2 are depicted in the table.
Repeat flightless fly TOTAL flightless fly TOTAL flightless fly TOTAL flightless fly TOTAL
1 2 10 12 0 8 8 0 7 7 1 8 9
2 0 7 7 0 8 8 2 9 11 2 9 11
3 2 8 10 1 9 10 3 3 6 0 7 7
4 0 4 4 0 11 11 NA NA NA NA NA NA
5 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 4 29 33 1 36 37 5 19 24 3 24 27
Repeat flightless fly TOTAL flightless fly flightless fly TOTAL flightless fly TOTAL
1 1 10 11 2 5 7 2 8 10 0 11 11
2 3 8 11 0 5 5 1 9 10 0 8 8
3 3 4 7 1 9 10 4 10 14 3 12 15
4 2 20 22 1 5 6 2 6 8 1 5 65 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 9 42 51 4 24 28 9 33 42 4 36 40
Repeat flightless fly TOTAL flightless fly flightless fly TOTAL flightless fly TOTAL
1 6 24 30 2 7 9 7 22 29 5 8 13
2 8 21 29 3 9 12 3 14 17 5 19 24
3 2 8 10 1 10 11 4 11 15 2 10 12
4 1 12 13 NA NA NA 2 12 14 8 15 23
5 NA NA NA NA NA NA NA NA NA NA NA NA
TOTAL 17 65 82 6 26 32 16 59 75 20 52 72
Repeat flightless fly flightless fly flightless fly flightless fly flightless fly flightless fly flightless fly flightless fly flightless fly flightless fly flightless fly flightless fly
1 16,7 83,3 0,0 100,0 0,0 100,0 11,1 88,9 9,1 90,9 28,6 71,4 20,0 80,0 0,0 100,0 20,0 80,0 22,2 77,8 24,1 75,9 38,5 61,5
2 0,0 100,0 0,0 100,0 18,2 81,8 18,2 81,8 27,3 72,7 0,0 100,0 10,0 90,0 0,0 100,0 27,6 72,4 25,0 75,0 17,6 82,4 20,8 79,2
3 20,0 80,0 10,0 90,0 50,0 50,0 0,0 100,0 42,9 57,1 10,0 90,0 28,6 71,4 20,0 80,0 20,0 80,0 9,1 90,9 26,7 73,3 16,7 83,3
4 0,0 100,0 0,0 100,0 NA NA NA NA 9,1 90,9 16,7 83,3 25,0 75,0 16,7 83,3 7,7 92,3 NA NA 14,3 85,7 34,8 65,2
5 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA
Average 9,2 90,8 2,5 97,5 22,7 77,3 9,8 90,2 22,1 77,9 13,8 86,2 20,9 79,1 9,2 90,8 18,8 81,2 18,8 81,2 20,7 79,3 27,7 72,3
SD 9,2 9,2 4,3 4,3 20,7 20,7 7,5 7,5 14,1 14,1 10,4 10,4 7,0 7,0 9,2 9,2 7,1 7,1 6,9 6,9 4,9 4,9 9,1 9,1
Oneway-ANOVA
Tukeycorrection
21daysold
p=0,9490 p=0,6954 p=0,7717 p=0,5419 p> 0.9999 p=0,6516
Control-1 RNAi2 Control-2 RNAi1-A Control-1 RNAi2 Control-2RNAi1-A Control-1 RNAi2 Control-2 RNAi1-A
21daysold
RNAi1-A Control-1 RNAi2 Control-2
%4daysold 12daysold
12daysold
RNAi1-A
Elav-GAL4
4daysold
RNAi1-A Control-1 RNAi2 Control-2
Control-1 RNAi2 Control-2
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
29
Table S8. Raw data of the sholl analyses.
Raw data corresponds to the sholl analyses diagrams presented in Figure 4. The values
represent the sum of dendritic length in 10µm radius. Length is expressed in µm.
Table S9. Raw data corresponding to figures 4D-G.
Length is expressed in µm. For definition of the parameters, see Table S11.
Distance Neuron1 Neuron2 Neuron3 Neuron4 Neuron5 Neuron1 Neuron2 Neuron3 Neuron4 Neuron5
0-10 20 103.557 101.168 300.504 20 496.056 103.891 691.034 10.012 345.135
10-20 382.492 164.857 278.164 356.044 245.845 940.646 679.231 1.307.683 1.111.601 469.719
20-30 669.734 849.602 983.108 47.939 698.798 1.242.371 1.429.098 1.711.626 1.400.042 530.374
30-40 1.385.928 1.181.559 1.279.618 1.064.603 1.163.474 1.840.026 878.121 1.467.048 1.134.616 1.057.555
40-50 1.727.375 1.263.508 1.482.479 1.363.199 1.442.312 3.730.916 586.138 1.311.187 1.560.769 867.032
50-60 1.952.204 1.586.891 1.812.991 1.213.303 1.374.513 3.595.999 558.765 1.232.635 1.932.288 1.321.891
60-70 2.060.376 187.611 1.534.295 225.488 1.603.889 4.678.686 98.878 1.525.715 169.89 120.483
70-80 2.871.217 2.706.455 1.910.286 2.299.874 3.104.731 4.397.531 1.390.394 1.481.689 998.683 1.533.428
80-90 4.366.317 3.107.405 3.205.082 2.376.199 3.048.671 3.638.675 932.177 1.415.184 991.296 1.656.473
90-100 462.932 331.41 3.114.173 2.317.735 3.355.791 3.168.132 1.244.922 1.220.113 1.115.048 1.507.064
100-110 434.979 3.563.583 3.397.026 2.670.986 2.713.144 251.133 1.367.359 1.123.806 1.356.874 1.387.443
110-120 5.195.669 3.899.882 3.456.255 1.876.972 4.382.396 2.507.586 1.369.169 633.525 2.040.767 1.092.579
120-130 4.777.074 4.348.845 4.095.153 293.758 3.888.685 2.496.228 1.947.051 870.587 2.989.669 803.725
130-140 5.180.556 5.815.309 5.440.013 4.112.693 4.508.776 1.240.769 1.348.698 98.665 149.175 976.888
140-150 6.474.125 5.624.796 5.243.077 4.679.815 4.883.749 1.266.319 1.047.192 925.682 108.253 792.787
150-160 6.593.414 6.000.612 6.718.957 673.915 5.690.294 1.461.278 627.148 373.977 733.033 743.846
160-170 7.749.258 7.582.394 8.655.792 7.300.786 6.393.031 1.610.305 541.432 175.244 668.813 353.398
170-180 8.308.736 746.747 7.851.018 5.944.194 5.855.663 1.107.686 385.841 0 843.936 216.995
180-190 8.148.654 9.149.731 8.513.428 5.595.413 7.247.456 407.172 252.678 0 577.617 102.747
190-200 8.723.479 7.199.103 8.134.934 4.302.002 8.809.724 12.922 111.726 0 302.094 101.738
200-210 6.693.815 8.190.344 8.155.574 4.981.126 7.459.882 121.441 136.139 0 121.076 10.354
210-220 6.286.198 6.929.006 9.832.365 5.903.856 8.070.653 0 134.087 0 75.399 105.902
220-230 5.362.111 6.234.855 7.245.617 7.521.333 1.140.169 0 0 0 0 104.761
230-240 4.828.521 6.165.952 6.171.996 6.026.455 1.028.051 0 0 0 0 105.218
240-250 3.474.102 4.973.043 7.051.642 4.787.964 8.473.657 0 0 0 0 106.187
250-260 3.403.182 4.463.875 6.760.871 5.426.643 7.991.457 0 0 0 0 101.808
260-270 4.230.525 5.395.745 4.872.716 3.890.655 6.219.788 0 0 0 0 113.277
270-280 2.814.347 4.335.558 5.339.069 3.445.447 4.311.353 0 0 0 0 101.437
280-290 2.477.548 4.011.494 4.803.889 2.975.205 2.517.814 0 0 0 0 0
290-300 2.173.315 2.528.524 4.553.457 305.036 3.208.999 0 0 0 0 0
300-310 1.855.855 1.394.051 398.717 1.861.664 246.602 0 0 0 0 0
310-320 737.015 64.667 2.440.249 1.434.797 1.586.377 0 0 0 0 0
320-330 26.495 1.649.214 2.277.312 1.673.253 2.879.335 0 0 0 0 0
330-340 0 826.875 1.558.839 1.105.223 3.172.025 0 0 0 0 0
340-350 0 253.191 1.894.045 94.892 1.427.422 0 0 0 0 0
350-360 0 0 41.477 579.333 1.017.421 0 0 0 0 0
360-370 0 0 301.267 0 921.263 0 0 0 0 0
370-380 0 0 49.801 0 138.851 0 0 0 0 0
Control1 FitmRNAi-1A
Shollanalysisofpathlength
control 1 RNAi-1A control 1 RNAi-1A control 1 RNAi-1A control 1 RNAi-1A
Neuron 1 19.2396 14.4982 13121.4 4160.99 23 19 682 287
Neuron 2 14.8153 14.2639 15511.6 1811.52 36 16 1047 127
Neuron 3 14.8568 12.3941 13504.8 1784.75 23 18 909 144
Neuron 4 16.1647 11.5302 11590.1 2432.88 23 26 717 211
Neuron 5 16.6843 10.9166 15416.3 3427.82 21 22 924 314
branch path length (avg) path length (total) branch order (max) branches (total)
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
30
Table S10. Raw data corresponding to Figures S7C-F.
Length is expressed in µm. For definition of the parameters, see Table S11.
Table S11. Definition of dendritic parameters analyzed for ddaC multidendritic type lV
neurons.
Term used in paper Term used in L-measure Description
sholl analysis n/aSholl analysis reveals defects as a measure
of the soma distance
branch path length (avg) Branch_pathlength / N_branch
This function returns the sum of the length
of all compartments forming the
giveN_branch divided by This function
returns the number of branches in the given
input neuron. A branch is one or more
compartments that lie between two
branching points or between one branching
point and a termination point.
path length (total) Branch_pathlength
This function returns the sum of the length
of all compartments forming the
giveN_branch.
branches (total) N_branch
This function returns the number of
branches in the given input neuron. A
branch is one or more compartments that
lie between two branching points or
between one branching point and a
termination point.
branch order (max) Branch_OrderThis function returns the order of the branch
with respect to soma.
see: http://cng.gmu.edu:8080/Lm/help/index.htm n/a, not applicable.
control 2 RNAi-2 control 2 RNAi-2 control 2 RNAi-2 control 2 RNAi-2
Neuron 1 12.0978 9.1026 18291.8 14546 29 31 1512 1598
Neuron 2 13.7912 18025 29 1307
Neuron 3 13.955 16885.5 23 1210
Neuron 4 17.1011 15647.5 24 915
Neuron 5 15.5344 18408.3 23 1185
branch order (max) branches (total)path length (total)branch path length (avg)
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
31
Table S12. Antennal best frequencies (BF), mechanical amplification gains, and CAP
thresholds obtained from the hearing organs of Fitm knockdown flies and genetic
background controls.
The analysis includes individual values (N = 5 different flies/strain), respective means,
standard deviations (SD), and p-values determined using two-tailed Mann-Whitney U-tests
and, for multiple comparisons, corrected p-values after Bonferroni correction.
Driver
Tub-Gal4 Control 1 Fitm RNAi-1A Fitm RNAi-1B Control 2 Fitm RNAi-2BF (Hz) 198 513 388 306 413
258 454 388 286 438 348 441 355 281 429 344 572 484 263 376
208 504 531 352 477 Mean 271 497 429 298 427
SD 72 52 75 34 37
p-value 0.012 0.012 0.012 Corrected 0.024 0.024
Amplification gain 5.5 3.4 2.9 6.3 4.3
8.8 2.7 3.5 6.0 2.2
7.0 1.7 2.9 6.8 2.8 6.5 2.2 2.9 7.8 2.9 6.2 2.7 3.9 6.2 2.7
Mean 6.8 2.5 3.2 6.6 3.0
SD 1.3 0.6 0.5 0.7 0.8
p-value 0.012 0.012 0.012
Corrected 0.024 0.024
CAP threshold (mm/s) 0.05 0.13 0.06 0.08 0.09
0.08 0.15 0.08 0.09 0.08 0.06 0.12 0.07 0.09 0.08 0.06 0.10 0.08 0.05 0.11 0.07 0.11 0.14 0.09 0.03
Mean 0.07 0.12 0.08 0.08 0.08 SD 0.01 0.02 0.03 0.01 0.03
p-value 0.012 0.174 0.920 Corrected 0.024 0.348
Driver Elav-Gal4 Control 1 Fitm RNAi-1A Fitm RNAi-1B Control 2 Fitm RNAi-2BF (Hz) 290 326 353 213 341
293 347 386 213 368
288 303 341 124 348 210 345 438 240 344 208 348 425 213 478
Mean 258 334 389 201 376
SD 45 19 43 44 58 p-value 0.012 0.012 0.012
Corrected 0.024 0.024
Amplification gain 4.0 4.0 3.3 3.6 4.6
5.5 2.8 3.0 4.9 4.6 6.2 3.8 4.4 6.5 4.6
10.0 3.9 3.8 4.0 3.8
6.2 3.0 2.8 3.9 3.3 Mean 6.4 3.5 3.5 4.6 4.2
SD 2.2 0.6 0.7 1.2 0.6
p-value 0.016 0.021 0.675
Corrected 0.033 0.043
CAP threshold (mm/s) 0.06 0.08 0.06 0.08 0.10
0.10 0.24 0.10 0.24 0.05 0.05 0.09 0.05 0.09 0.09 0.03 0.28 0.03 0.28 0.10 0.07 0.10 0.07 0.10 0.10
Mean 0.06 0.16 0.06 0.16 0.09
SD 0.02 0.10 0.02 0.10 0.02 p-value 0.048 0.048 0.211
Corrected 0.095 0.095 0.422
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
Movie S1: The negative geotaxis test demonstrated locomotor deficits upon
downregulation of Fitm preferentially in skeletal muscle
Negative geotaxis assay for Fitm knockdown by the Mef2-GAL4 driver, preferentially
expressed in skeletal muscle, in the Fitm RNAi-lines 1A, 1B and 2. The capability of flies to
climb on the vial walls is reduced as compared to the respective genetic background controls
at 4 and 12 days after eclosion. The video was edited with iMovie (Apple). At least 50 flies
were tested per condition and the experiment was replicated twice.
Movie S2: Downregulation of Fitm in Drosophila melanogaster caused locomotor deficits
as demonstrated in an island assay
A video edited with Windows Live Movie Maker (0.5 X speed) of the island assay for Fitm
knockdown using Fitm RNA-1A under the Mef2-GAL4 promoter, preferentially active in
skeletal muscle. Flies were not able to clear the platform and they presented abnormal wing
and corpus movements compared to the appropriate background controls. The phenotype was
comparable for the two RNAi lines used (Fitm RNA-1A and Fitm RNAi-2) under the skeletal
muscle preferential (Mef2-GAL4), ubiquitous (αTub84B-GAL4), and fat body (C7-GAL4)
promoters.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n
32
REFERENCE
Woods C. G., Cox J., Springell K., Hampshire D.J., Mohamed M.D., McKibbin M.,
Stern R., Raymond F. L. , Sandford R., Sharif S., et al. (2006). Quantification of
homozygosity in consanguineous individuals with autosomal recessive disease. Am. J. Hum.
Gen. 78: 889–896.
Disease Models & Mechanisms 10: doi:10.1242/dmm.026476: Supplementary information
Dis
ease
Mo
dels
& M
echa
nism
s •
Sup
plem
enta
ry in
form
atio
n