A Gain-of-Function Mutation in the Arabidopsis Pleiotropic ...presence of two ABC-type transporter...

A Gain-of-Function Mutation in the ArabidopsisPleiotropic Drug Resistance Transporter PDR9Confers Resistance to Auxinic Herbicides1

Hironori Ito and William M. Gray*

Department of Plant Biology, University of Minnesota-Twin Cities, St. Paul, Minnesota 55108

Arabidopsis (Arabidopsis thaliana) contains 15 genes encoding members of the pleiotropic drug resistance (PDR) family of ATP-binding cassette transporters. These proteins have been speculated to be involved in the detoxification of xenobiotics, however,little experimental support of this hypothesis has been obtained to date. Here we report our characterization of the ArabidopsisPDR9 gene. We isolated a semidominant, gain-of-function mutant, designated pdr9-1, that exhibits increased tolerance to theauxinic herbicide 2,4-dichlorophenoxyacetic acid (2,4-D). Reciprocally, loss-of-function mutations in PDR9 confer 2,4-Dhypersensitivity. This altered auxin sensitivity defect of pdr9 mutants is specific for 2,4-D and closely related compounds asthese mutants respond normally to the endogenous auxins indole-3-acetic acid and indole-butyric acid. We demonstrate that2,4-D, but not indole-3-acetic acid transport is affected by mutations in pdr9, suggesting that the PDR9 transporter specificallyeffluxes 2,4-D out of plant cells without affecting endogenous auxin transport. The semidominant pdr9-1 mutation affects anextremely highly conserved domain present in all known plant PDR transporters. The single amino acid change results inincreased PDR9 abundance and provides a novel approach for elucidating the function of plant PDR proteins.

Auxin regulates numerous aspects of plant growthand development including embryogenesis, lateralroot formation, vascularization, and tropic growthresponses (Woodward and Bartel, 2005). While endog-enous auxin plays a critical role in normal plantgrowth and development, the application of highdoses results in phytoxicity. This observation led tothe development of several synthetic auxins, including2-4-dichlorophenoxyacetic acid (2,4-D) as the first suc-cessful selective herbicide. 2,4-D and other auxinicherbicides are largely specific to dicots, however, themechanisms underlying this selectivity are poorlyunderstood. Some 60 years after its discovery, 2,4-Dremains the most widely used herbicide worldwide(www.epa.gov). While recent decades have seen thedevelopment of several herbicide-resistant crop vari-eties that have profoundly altered agricultural prac-tices, such is not the case for 2,4-D and other auxinicherbicides. This is complicated in part by the essentialrole of endogenous auxin (indole-3-acetic acid [IAA])in plant growth and development. Mutant or trans-genic varieties resistant to 2,4-D also display alteredresponse to IAA and consequently exhibit abnormal

development. Insight into the mechanism underlyingthis phenomenon was recently provided by the dem-onstration that IAA and 2,4-D bind a common receptorto regulate auxin signaling (Dharmasiri et al., 2005a;Kepinski and Leyser, 2005).

Common strategies to achieve herbicide tolerancethrough genetic and transgenic approaches are typicallyaimed at identifying mutant target proteins unaf-fected by the herbicide or the metabolic detoxification/degradation of the compound. An additional approachwas recently suggested by Windsor et al. (2003) involv-ing herbicide detoxification by efflux facilitated by plantATP-binding cassette (ABC) transporters. These pro-teins, which are found in all living organisms, mediatethe translocation of a wide range of structurally unre-lated molecules across biological membranes (Higgins,1992). All functional ABC transporters have a basicstructural organization consisting of two hydrophobictransmembrane spanning domains (TMDs) and twohydrophilic nucleotide-binding domains (NBDs). TheNBDs contain a highly conserved 200-amino acid regionconsisting of the Walker A and Walker B boxes (Walkeret al., 1982), separatedbyapproximately 120aminoacidscontaining the ABC signature motif (Bairoch, 1992).Members of ABC transporter family are categorized bythe configuration of TMDs and NBDs, and are referredto as half-size or full-size transporters based on thenumber (one or two) of TMD/NBD modules they con-tain (Higgins, 1992).

In Arabidopsis (Arabidopsis thaliana), approximately130 genes encoding ABC transporters have been iden-tified in the completed Arabidopsis genome (Sanchez-Fernandez et al., 2001;Martinoia et al., 2002; Schulz andKolukisaoglu, 2006). Fifty four of these genes belong tothe full-size category and are classified into three

1 This work was supported by the National Institutes of Health(grant no. GM067203 to W.M.G.) and a Japanese Society for thePromotion of Science Postdoctoral Fellowship for Research Abroad(to H.I.).

*Corresponding authors e-mail [email protected]; fax 612–625–1738.

The author responsible for distribution of materials integral to thefindings presented in this article in accordance with the policydescribed in the Instructions for Authors (www.plantphysiol.org) is:William M. Gray ([email protected]).

www.plantphysiol.org/cgi/doi/10.1104/pp.106.084533

Plant Physiology, September 2006, Vol. 142, pp. 63–74, www.plantphysiol.org � 2006 American Society of Plant Biologists 63

https://plantphysiol.orgDownloaded on May 8, 2021. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

https://plantphysiol.org

groups: P glycoproteins (PGPs; also referred toas multidrug resistance [MDR] transporters), MDR-associated proteins (MRPs), and pleiotropic drugresistance (PDR) transporters (Theodoulou, 2000;Sanchez-Fernandez et al., 2001; van den Brule andSmart, 2002; Crouzet et al., 2006). Arabidopsis MRP1,MRP2, and MRP3 transport glutathione conjugates ofendogenous and artificial substrates into vacuoles (Luet al., 1997, 1998; Tommasini et al., 1998), andMRP4 andMRP5 have been implicated in the complex regulationof stomatal aperture and guard cell ion flux (Gaedekeet al., 2001;Klein et al., 2003, 2004). Themajority of plantPGP/MDRs characterized to date have been impli-cated in the transport of auxin (Multani et al., 2003;Geisler and Murphy, 2006). Recently, ArabidopsisPGP1 and PGP19 have been reported to mediate theATP-dependent cellular efflux of natural and syntheticauxins as well as oxidative auxin breakdown productsin Arabidopsis protoplasts and whole plants (Geisleret al., 2003, 2005). Additionally, Arabidopsis PGP4 hasbeen suggested to function primarily in the uptake ofredirected or newly synthesized auxin in epidermalroot tip cells (Santelia et al., 2005; Terasaka et al., 2005).

In contrast to the PGP class of ABC transporters, theplant PDR subfamily has received considerably lessattention. Genetic studies on Arabidopsis PDR12 andits likely homologs in Nicotiana plumbaginifolia andSpirodela polyrrhiza have implicated this transporter inthe efflux of sclareol, an antifungal diterpene (Jasinskiet al., 2001; van den Brule et al., 2002; Campbell et al.,2003; Stukkens et al., 2005). An additional connectionbetween PDR-type transporters and defense responseis provided by recent studies of atpdr8 mutants, whichexhibit increased cell death associated with the hyper-sensitive response following pathogen infection (Kobaeet al., 2006; Stein et al., 2006). AtPDR12 has also recentlybeen implicated in lead detoxification (Lee et al., 2005).

Here we report our characterization of the Arabidop-sis PDR9 transporter. We identified the semidominantpdr9-1mutation as conferring increased 2,4-D tolerancein a genetic screen to isolate mutations enhancing therelatively weak auxin response defect conferred bythe tir1-1 mutation (Gray et al., 2003; Chuang et al.,2004; Quint et al., 2005). Reciprocally, recessive loss-of-function alleles ofPDR9 result in 2,4-Dhypersensitivity,indicating that pdr9-1 is a gain-of-function mutationconferring increased activity to the protein. Furtheranalysis demonstrated that PDR9 is involved in thetranslocation of not only 2,4-D but also other membersof the phenoxyalkanoic acid family of herbicides aswellas the polar auxin transport inhibitor, napthylphthala-mic acid (NPA). In contrast, we find that PDR9 is notinvolved in the transport of the native auxin, IAA.

RESULTS

Identification of the eta4 Mutation

We have previously described a genetic screendesigned to identify mutations that enhance the rela-

tively weak auxin resistance phenotype of tir1-1 seed-lings. Several enhancer of tir1-1 auxin resistance (eta)mutants were isolated in this screen, including ETA3/SGT1b (Gray et al., 2003), ETA2/CAND1 (Chuang et al.,2004), and ETA1/AXR6/CUL1 (Quint et al., 2005),all three of which encode components of SCFTIR1

pathway. The eta4 tir1-1 M2 plant was backcrossedto Columbia (Col) and eta4 single mutants isolatedby PCR-based genotyping of TIR1. When eta4/eta4TIR11/TIR11 plants were backcrossed again to Col,233/317 F2 seedlings displayed resistant root growthon 0.075 mM 2,4-D, indicating that the eta4 mutationconfers a dominant auxin-resistant phenotype (1:3;x2 5 0.85). The amount of 2,4-D-mediated inhibition ofroot growth varied considerably among the resistantprogeny, and 2,4-D dose-response studies revealedthat eta4 actually behaves in a semidominant fashion(Fig. 1, A and B).

Despite the finding that eta4/eta4 seedlings exhibitstronger 2,4-D resistance than tir1-1 mutants (Fig. 1B),unlike tir1-1, the eta4 mutation did not confer a reduc-tion in lateral root development (Fig. 1C). Furthermore,eta4 mutants did not exhibit any of the auxin-relateddevelopmental defects, such as reductions in statureand apical dominance characteristic of many auxin-response mutants (Woodward and Bartel, 2005). In-stead, eta4 plants appeared indistinguishable fromwild-type controls at all stages of development (datanot shown).

The finding that the eta4 mutation conferred 2,4-D-resistant root growth but no detectable auxin-relatedphenotypes, suggested that the eta4 defect may bespecific to the synthetic auxin, 2,4-D. While no auxin-response mutants have been described that discrimi-nate between native and synthetic biologically activeauxins, there are well-characterized differences in thetransport of IAA, 2,4-D, and naphthylacetic acid(NAA; Morris et al., 2004). For example, while 2,4-Dand IAA are taken up by the putative influx carrierAUX1 (Marchant et al., 1999), only IAA is an efficientsubstrate for the efflux carriers of the polar auxintransport system (Morris et al., 2004). We comparedthe effects of exogenous 2,4-D, IAA, and NAA on rootgrowth of eta4 seedlings and found that eta4 auxinresistance was entirely 2,4-D specific (Fig. 1D). Like-wise, whereas IAA and NAA promoted lateral rootdevelopment equally well in eta4 and wild-type seed-lings, eta4 mutants exhibited a striking reduction in2,4-D-induced lateral root formation (data not shown).The 2,4-D-specific auxin resistance of eta4 was alsoexamined at the level of gene expression using theauxin-responsive reporter construct, BA-b-glucuroni-dase (GUS; Oono et al., 1998). Homozygous Col[BA-GUS] and eta4[BA-GUS] seedlings were treated with1 mM auxins for 6 h. As reported in Oono et al. (1998),strong induction of GUS activity was observed in theproximal region of the root elongation zone when Colseedlings were treated with auxins (Fig. 1E). Whileeta4 seedlings exhibited a wild-type-like response toIAA and NAA, only faint GUS staining was detected

Ito and Gray

64 Plant Physiol. Vol. 142, 2006



when eta4 seedlings were treated with 2,4-D (Fig. 1E),further demonstrating the 2,4-D-specific nature of theeta4 mutant.

ETA4 Encodes the PDR9 Protein

A map-based cloning strategy was used to isolatethe ETA4 gene. The eta4mutationwas initially mappedbetween nga162 and nga6 on the south end of chro-mosome 3. Additional mapping narrowed the locationof eta4 to an approximately 200 kb interval. Inspectionof candidate loci within this interval revealed thepresence of two ABC-type transporter genes, one

exhibiting similarity to yeast (Saccharomyces cerevisiae)PDR5 (At3g53480), and a second related to the humanbreast cancer resistance protein, BCRP (At3g53510).Our finding that the eta4 defect is 2,4-D specific,together with recent findings implicating ABC trans-porters in auxin transport (Noh et al., 2001; Geisleret al., 2005; Santelia et al., 2005), and studies in yeastdemonstrating that loss of pdr5 results in 2,4-D hyper-sensitive growth arrest (Teixeira and Sa-Correia, 2002),led us to sequence the coding regions of these twogenes from eta4 plants. We detected no sequencedifference between eta4 and wild type for At3g53510,but we did identify a 1-bp substitution (G to A) in the

Figure 1. Characterization of the eta4mutant. A, Seedlings were grown onunsupplemented nutrient medium for4 d and then transferred to mediumcontaining 0.075 mM 2,4-D and grownfor an additional 4 d. Asterisks indicatethe position of the root tip at the time oftransfer. Genotypes were confirmed bysequencing of PCRproducts. Size bar55 mm. B, Inhibition of root elongationby increasing concentrations of 2,4-D.Data points reflect themean of 10 seed-lings. Standard deviations for all datapoints were#10% of the mean. C. Lat-eral root (LR) initiation was assessed in10-d-old seedlings grown on unsup-plemented nutrient medium (n 5 10).D, Inhibition of root elongation byincreasing concentrations of IAA andNAA. Data points represent the meanfrom 10 seedlings. E, Auxin-dependentGUS expression in Col and eta4 seed-lings carrying the BA-GUS reporterconstruct. Each homozygous BA-GUSline was incubated in liquid ATS me-dium with or without 1 mM auxins for6 h and then stained for 16 h.

Characterization of Arabidopsis Pleiotropic Drug Resistance9

Plant Physiol. Vol. 142, 2006 65



18th exon of At3g53480 (Fig. 2A). At3g53480 has beendesignated as PDR9 among 15 PDR genes identified inArabidopsis genome (van den Brule and Smart, 2002).Thus, we designated eta4 as pdr9-1. PDR9 contains 23exons and encodes a 1,450-amino acid protein.

A search of the SALK Institute’s SIGnAL T-DNAdatabase (Alonso et al., 2003) identified multiple linescontaining a T-DNA insertion within the PDR9 locus(Fig. 2A).We confirmed the T-DNA insertion site in thethird exon of SALK_050885, which we designated aspdr9-2. RNA gel-blot analysis detected a 4.5 kb tran-script present in RNA prepared from wild-type seed-

lings and absent from homozygous pdr9-2 samples,suggesting that pdr9-2 is a likely null allele (Fig. 2B).We next examined the affect of 2,4-D on root growth ofpdr9-2 seedlings. As shown in Figure 2C, pdr9-2 plantsshowed clear hypersensitivity to 2,4-D, with rootgrowth almost completely inhibited at 0.01 mM. Con-sistent with this finding, pdr9-2 seedlings also ex-hibited increased sensitivity to the 2,4-D-inducedexpression of the DR5-GUS (Ulmasov et al., 1997)reporter of auxin-regulated gene expression (Fig. 2D).IAA-mediated DR5-GUS expression, however, wasunaffected in the pdr9-2 mutant (Fig. 2D). The con-trasting 2,4-D phenotypes conferred by the semidom-inant pdr9-1 mutation and recessive pdr9-2 nullmutation demonstrate that pdr9-1 is a gain-of-functionmutation. Like the pdr9-1 mutant, however, pdr9-2plants exhibited no detectable growth or developmen-tal phenotype.

PDR proteins are characterized by the possession oftwo predicted cytosolically oriented NBD domainslinked to two multiple-pass hydrophobic TMDs inthe arrangement NH2-NBD1-TMD1-NBD2-TMD2-COOH. A search of the ARAMEMON database pre-dicted that PDR9 contains two sets of six-pass TMDs(Fig. 3A). The mutation identified in pdr9-1 causes anAla to Thr substitution at position 1,034 within thehighly conserved plant PDR signature sequence adja-cent to the Walker B motif of NBD2 (Fig. 3B). TheWalker A and Walker B motifs, which are needed forATP binding and hydrolysis, are highly conserved,even in distinct types of ABC transporter family mem-bers. The entire adjacent 12-amino acid PDR signaturemotif encompassing the Ala-1,034 residue affected inpdr9-1 (Fig. 3B) is absolutely conserved in all 15 Arabi-dopsis PDR proteins as well as in nearly all other plantPDR proteins present in available databases including20 of the 23 rice PDRs. In contrast, this domain is nothighly conserved between plant PDRs and other typesof plant ABC transporters, or even between plant andfungal PDR proteins (Fig. 3B). This extreme sequenceconservation strongly suggests that this motif plays animportant role in plant PDR function.

Expression Analysis of PDR9

We next analyzed PDR9 expression patterns byRNA gel-blot analysis of RNA prepared from variousorgans. The PDR9 mRNAwas exclusively detected inroots (Fig. 4A). It has been reported that the expressionof some ABC transporters, including the previouslycharacterized Arabidopsis PDR12, is strongly inducedby the application of their putative substrates (van denBrule and Smart, 2002; Lee et al., 2005). We thereforetested the possibility that PDR9 expression is inducedby auxins (Fig. 4B). However, PDR9 expression wasnot affected by 2,4-D, IAA, or NAA treatments. Theeffect of auxin treatment was confirmed by the clearinduction of IAA5 (Fig. 4B). We also examined thetissue-specific expression of PDR9 using transgenicplants carrying the PDR9 promoter fused with the

Figure 2. ETA4 encodes PDR9. A, Mutation sites of pdr9-1 and pdr9-2.Exons are indicated as boxes and introns are indicated as lines. B, RNAgel-blot analysis using total RNA prepared from Col and pdr9-2 seed-lings. Ten micrograms of total RNA was loaded per lane. Ethidium-bromide-stained RNA is shown as a loading control (rRNA). C, Effects of2,4-D on the root growth in pdr9-2. Data points are averages from 10seedlings. Standard deviations for all data points were #10% of themean.D,Auxin-dependent expressionof theDR5-GUS reporter inwild-type and pdr9-2 roots. Seven-day-old seedlings were transferred toauxin-containing media for 4 h and then stained for 4 h to detect GUSactivity. pdr9-2 is on the left and wild type on the right in each image.

Ito and Gray




GUS reporter. Strong GUS activity was observedthroughout the root, with expression highest in thecells of the lateral root cap and epidermal cells at theroot tip (Fig. 4, C and D). The only shoot expressionthat was detectable was in the stipules (Fig. 4C, inset).Consistent with our reverse transcription (RT)-PCRstudies, exogenous auxins did not result in increasedPPDR9-GUS expression (data not shown).

Characterization of the PDR9 Protein

To characterize the PDR9 protein, we raised poly-clonal antisera against a recombinant 6xHis fusionprotein containing the N-terminal 98 amino acids ofPDR9. The a-PDR9 antisera detected a single band ofapproximately 160 kD in wild-type and pdr9-1 extractsprepared from Arabidopsis roots (Fig. 5A). This bandwas completely absent in pdr9-2 microsomal extracts,confirming that the antiserum recognizes the PDR9protein and that pdr9-2 is a likely null allele. Consistentwith a predicted membrane localization, PDR9 wasonly detected in microsomal fractions. Interestingly,we observed a slight but consistent increase in PDR9abundance in microsomal extracts prepared frompdr9-1 roots than from wild type (Fig. 5, A and B).Analysis of western blots of four independent sets ofmicrosomal membrane preparations indicated that

pdr9-1 roots contain approximately 1.8- 6 0.2-foldmore PDR9 protein than wild-type controls. In con-trast, we could detect no difference in PDR9 mRNAlevels between wild type and pdr9-1 (Fig. 5B), suggest-ing that the mutation might confer increased proteinstability, which could potentially account for its semi-dominant nature.

To further investigate the subcellular localization ofPDR9, microsomal extracts were subjected to aqueoustwo-phase partitioning. PDR9 fractionated almost ex-clusively to the plasma membrane (PM) enrichedupper phase (Fig. 5C), as did the known PM proteinPGP4 (Terasaka et al., 2005). In contrast, the endoplas-mic reticulum-associated protein, SEC12, was highlyenriched in the lower phase. We obtained identicalresults in two-phase fractionations with pdr9-1 micro-somes, suggesting that the mutant protein is notaltered in its membrane localization (data not shown).

Figure 3. The pdr9-1 mutation affects a highly conserved residue inNBD2. A, Schematic presentation illustrating PDR9 secondary struc-ture and topology modified from the output from the ARAMENONdatabase (see http://aramenon.botanik.uni-koeln.de) using 11 proteinmodeling algorithms. Double line indicates lipid bilayer. B, Amino acidalignment of the subregion of NBD2 surrounding the pdr9-1 mutationsite (asterisk). The ABC signature, Walker B, and PDR signature 3 motifs(van den Brule and Smart, 2002) are overlined. Amino acid identity andsimilarity to AtPDR9 are indicated by black and gray shading, respec-tively. The second and third lines represent sequences from all15 Arabidopsis and 22 rice PDR family members. Two dots indicateresidues conserved in the majority of PDR proteins but with conserva-tive substitutions in one or more family members. Single dots indicateresidues conserved in the majority of PDR proteins but with noncon-servative substitutions in one or more family members. ScPDR5 is aPDR protein from yeast. AtCER5 and AtPGP4 are two non-PDRmembers of the Arabidopsis family of ABC transporters.

Figure 4. Expression analysis of PDR9. A, Organ-specific expression ofPDR9. Ten micrograms of total RNA were loaded per lane. Ethidium-bromide-stained RNA is shown as a loading control (rRNA). B, Effect ofIAA, NAA, and 2,4-D on PDR9 expression. RT-PCR was performedusing total RNA prepared from Col seedlings treated with or without10 mM IAA, NAA, or 2,4-D for 6 h. Expression of IAA5was assessed as apositive control for the auxin treatment. ETA2 (Chuang et al., 2004) wasused as a loading control. C and D, Localization of PPDR9-GUS inArabidopsis seedlings. C, Seven-day-old seedling. Inset indicates theexpression in stipules. D, Root tip of 7-d-old seedling.





Effects of Additional Auxinic Compoundson pdr9 Mutants

The finding that ETA4 encodes a PDR-type ABCtransporter that localizes to the PM and affects sensitiv-ity to 2,4-Dbutnot the endogenousauxin IAAsuggestedthat PDR9 might be involved in the cellular detoxifica-tion of xenobiotics. This led us to test the effects ofseveral additional herbicides on our pdr9 mutants tofurther examine specificity. Because of its widespreadusage in the agricultural and horticultural fields, several2,4-D-related compounds have been developed that ex-hibit auxin-like activities. For example, 2,4-D, 4-chloro-phenoxy-acetic acid, 4-chloro-2-methylphenoxy aceticacid, and 2,4,5-trichlorophenoxyacetic acid all sharea 4-chloro-phenoxy ring, but differ in terms of thenumber of chloride or methyl groups present. Asobserved with 2,4-D, the gain-of-function and loss-of-function pdr9 alleles conferred opposing pheno-types in root growth inhibition assays with these2,4-D-related herbicides (Fig. 6, A–C). In contrast,wild-type and the pdr9mutants exhibited similar sensi-tivity toward p-chlorophenoxyisobutyric acid, whichhas a 4-chloro-phenoxy ring with an isobutyric ratherthan an acetic acid group at position 1. This findingsuggests that the acidic side chain may be an importantdeterminant of specificity, however, it should be notedthat the concentration of p-chlorophenoxyisobutyricacid necessary to inhibit root growth is considerablyhigher than these other auxins (Fig. 6D).

We also examined sensitivities to the IAAderivativesindole-butyric acid, 4-Cl-IAA, and 4,5-Cl-IAA. Theresponsiveness to these IAA-related compounds inpdr9-2 plants was essentially the same as wild type,suggesting that PDR9 is not involved in their transport.However, while pdr9-1 plants responded normally toIAA and indole-butyric acid, they were slightly resis-tant to 4-Cl-IAA and evenmore so to 4,5-Cl-IAA (Fig. 6,E–H). These results suggest that the gain-of-functionpdr9-1mutation might affect substrate recognition andconfer a broader range of substrate specificity. We alsotested several concentrations of NAA, dicamba, piclo-ram, abscisic acid, cycloheximide, Cu21, Co21, andZn21, but detected no significant differences betweenthe pdr9 mutants and wild type (data not shown).

pdr9-2 Is Hypersensitive to NPA

Although neither pdr9 allele conferred any change insensitivity to IAA or NAA, we wanted to furtherexamine the possibility that PDR9 might be involvedin auxin transport since several recent studies haveimplicated PGP/MDR subfamily members of ABCtransporters in polar auxin flow (Geisler et al., 2003,2005; Terasaka et al., 2005). We analyzed the gravi-tropic response of both pdr9 alleles by plate rotationand root curling assays, but could detect no significantchanges from wild type in the gravitropism response(data not shown). However, when pdr9-2 seedlingswere grown in the presence of the polar auxin trans-port inhibitor NPA, we observed a dramatic increasein sensitivity compared to wild type. pdr9-2 seedlingsexhibited agravitropic root and hypocotyl growth onconcentrations of NPA as low as 0.05 mM, whereaswild-type and pdr9-1 seedlings were largely unaffectedat this concentration (Fig. 7, A–F). We also examinedthe effect of NPA on root growth in quantitative rootinhibition assays. pdr9-2 seedlings exhibited an ap-proximately 100-fold increase in sensitivity comparedto wild type and pdr9-1 (Fig. 7G).

Altered 2,4-D and NPA Accumulation in pdr9 Mutants

To confirm that the physiological responses observedin the pdr9mutants were due to the altered transport of2,4-D orNPA,we conducted accumulation assays using[14C]-2,4-D and [3H]-NPA. Based on the expressionanalysis of PDR9 (Fig. 4), root tips (apical 5 mm) werecollected from5-d-old seedlings and incubated inbuffercontaining labeled 2,4-D orNPA for 60min. Following abrief rinse, the root tipswere collected and radioactivitylevels measured by liquid scintillation counting. Con-sistent with our physiological assays indicating thatthepdr9mutationsconferaltered2,4-Dsensitivitybutdonotaffect IAAsensitivity,weobservedsignificanthyper-accumulation and hypoaccumulation of [14C]-2,4-D inpdr9-2 and pdr9-1 roots, respectively (Fig. 8A), but nodifference in [3H]-IAA accumulation (Fig. 8B). Whenincubatedwith [3H]-NPA, pdr9-2 roots accumulated dra-matically more label than wild-type roots (Fig. 8C).

Figure 5. Characterization of the PDR9 protein. A, Western-blotanalysis of microsomal and supernatant fractions prepared from 8-d-old Arabidopsis roots. Eight micrograms of extract were loaded/lane. B,Western-blot (top) and RT-PCR (bottom) analyses of PDR9 levels. Forthe western blots, lanes 1 and 2 contain 8 mg of root microsomalextract, whereas lane 3 contains 4 mg. a-SEC12 was used as a loadingcontrol. For RT-PCR, 1 mg of total RNAwere used to generate cDNAs inreverse transcriptase reactions. One microliter of the cDNAs were thenused as template in lanes 1 and 2, while 0.5 mL was used in lane 3(PDR9, 27 cycles; ETA2, 26 cycles). C, Aqueous two-phase fractiona-tion of Arabidopsis microsomes prepared from wild-type roots. Crudemicrosomes (cMS): upper phase enriched in PMs; lower phase enrichedin other membranes (OM).

Ito and Gray




pdr9-1 root tips exhibited a slight, albeit statisticallyinsignificant, reduction in [3H]-NPA. However, thisminor difference between wild type and pdr9-1 wasalso seen with shorter labeling periods (15 or 30 min;data not shown), suggesting that NPA transport mayalso be affected by the pdr9-1 mutation.

DISCUSSION

Mutations in PDR9 Alter 2,4-D, But Not IAA Sensitivity

In the past 20 years, numerous mutants exhibitingaltered auxin sensitivity have been described. Sinceboth IAA and the synthetic auxin 2,4-D are recognized

Figure 6. Inhibition of root elongation by various auxin-related compounds. Seedlings were grown on unsupplemented nutrientmedium for 4 d and then transferred to medium containing various compounds as indicated and grown for an additional 4 d. Thestructures of chlorophenoxyl compounds are superimposed on graphs (A to D). Data points are averages from 10 seedlings. SDsfor all data points were #12% of the mean.





by the same receptors, the TIR1/AFB family of F-boxproteins (Dharmasiri et al., 2005a, 2005b), all auxinsignaling mutants described to date exhibit alteredresponse to both of these auxins. In contrast, severalstudies have demonstrated that major differences existin the transport of IAA and 2,4-D, with the latter beinga poor substrate for the polar auxin transport system(Delbarre et al., 1996; Morris et al., 2004). Our com-plementary findings with gain- and loss-of-functionalleles of PDR9 indicate that this PDR-type ABCtransporter specifically affects 2,4-D transport, result-ing in altered sensitivity without affecting transport orsensitivity to the endogenous auxin, IAA.

Using several physiological and molecular assays,we demonstrate that the pdr9-1 gain-of-function mu-tation specifically confers increased 2,4-D resistance.Reciprocally, the pdr9-2 null mutation confers 2,4-Dhypersensitivity. These findings correlate preciselywith [14C]-2,4-D accumulation assays that demonstratethe gain- and loss-of-function pdr9 mutants accumu-late less or more 2,4-D, respectively, than wild-typecontrols. Given these findings, together with the likelyPM localization of PDR9 suggested by our microsomefractionation studies, it is likely that PDR9 acts as a 2,4-Dpump capable of effluxing 2,4-D out of plant cells.While our 2,4-D accumulation assays do not directlydiscriminate between 2,4-D influx and efflux, since thepdr9-2 null mutant hyperaccumulates 2,4-D resultingin increased sensitivity to the herbicide, one wouldneed to invoke a mechanism whereby PDR9 normallynegatively regulates a protein that imports 2,4-D inorder for influx to be altered in the pdr9mutants. 2,4-Dcan enter plant root cells via the putative auxin influxcarrier AUX1 (Marchant et al., 1999). However, PDR9-mediated negative regulation of AUX1 activity seemshighly unlikely given that [3H]-IAA accumulation wasidentical in wild type and the pdr9 mutants.

We attempted to demonstrate that PDR9 can directlytransport 2,4-D by expression in heterologous systems,but these experiments were unsuccessful, largely dueto technical complications. First, we expressed PDR9in yeast to try and complement the 2,4-D hypersensi-tivity conferred by a pdr5 mutation. However, PDR9expression was somewhat toxic to yeast, conferring asevere slow-growth phenotype that made complemen-tation difficult to ascertain. Additionally, membranefractionation studies and expression of a PDR9-GFP

Figure 7. pdr9-2 plants are hypersensitive to NPA treatment. A to F,Effects of NPA on seedling growth. Seedlings were grown in dark for 5 dwith (B, D, and F) or without (A, C, and E) 0.05 mM NPA. A and B, Wildtype. C and D, pdr9-1. E and F, pdr9-2. Size bar5 1 cm. G, Inhibition ofroot elongation by NPA. Seedlings were grown on unsupplementednutrient medium for 4 d and then transferred to medium containingdifferent concentration of NPA and grown for an additional 4 d. Datapoints are averages from 10 seedlings. SDs for all data points were,10% of the mean.

Figure 8. Altered transport of 2,4-D and NPA in pdr9mutants. Root tipsfrom 5-d-old Arabidopsis seedlings were excised and incubated inbuffer containing radiolabeled [14C]-2,4-D (A), [3H]-IAA (B), or [3H]-NPA (C), rinsed briefly, and analyzed by scintillation counting. Valuesare the means from four or five independent experiments, each per-formed in duplicate.

Ito and Gray




construct both indicated that PDR9 did not localize tothe PM properly in yeast. Other investigators haveencountered similar difficulties in expressing plantPDR proteins in yeast (van den Brule et al., 2002;Crouzet et al., 2006). We also expressed PDR9 inXenopus oocytes. Although we did observe a lowlevel of PDR9 expression, we were unable to convinc-ingly demonstrate any difference in 2,4-D efflux be-tween injected and uninjected oocytes.Several recent findings have implicated members of

the PGP/MDR subfamily of ABC transporters in polarauxin transport. However, none of our findings sug-gest that PDR9 plays a role in this important process.The pdr9 mutants exhibit normal IAA sensitivity, andare unaffected in auxin-mediated processes such aslateral root development and tropic growth responses.Furthermore, we show that the pdr9 mutations specif-ically affect the transport of 2,4-D and closely relatedsynthetic auxins without altering IAA transport. Al-though the pdr9-2 mutant exhibits heightened sensi-tivity to the polar auxin transport inhibitor NPA, thisis almost certainly due to the fact that this mutanthyperaccumulates NPA as we demonstrate in uptakeassays with [3H]-NPA. This latter finding also demon-strates that plants can transport NPA and should beconsidered by those employing this inhibitor in auxintransport studies.

What Is the Cellular Role of PDR9?

A significant unresolved question from our studyregards the normal cellular function of PDR9. Neitherthe pdr9-1 nor pdr9-2 mutants exhibit any growth ordevelopmental phenotype. We addressed the possibil-ity that this might be attributable to genetic redun-dancy by examining T-DNA insertion mutants of themost closely related Arabidopsis PDR family member,PDR5. Like the pdr9 mutants, neither pdr5 mutant(SALK_002380 and SALK_035106) exhibited a discern-ible growth phenotype (H. Ito and W.M. Gray, unpub-lished data). However, unlike pdr9-2, the pdr5 mutantsdid not exhibit altered sensitivity to 2,4-D or NPA.Furthermore, pdr5 pdr9-2 double mutants behaved ex-actly like pdr9-2 single mutants in 2,4-D dose-responseassays, suggesting the two proteins are functionallydistinct (H. Ito and W.M. Gray, unpublished data).Several recent findings have implicated AtPDR8,

AtPDR12, and NpPDR1 in plant defense responses(Campbell et al., 2003; Stukkens et al., 2005; Kobaeet al., 2006; Stein et al., 2006). These studies suggestthat these transporters may extrude secondary metab-olites with antimicrobial activity as part of the plant’sresponse to pathogen infection. Most notably, atpdr8/pen3 mutants were isolated in a genetic screen formutations conferring reduced resistance to the barleypowdery mildew Blumeria graminis, while NpPDR1-silenced tobacco (Nicotiana tabacum) plants exhibitreduced resistance to Botrytis cinerea (Stukkens et al.,2005). Such studies suggest that PDR9 might also beinvolved in defense responses. We note that numerous

cis-acting elements implicated in defense responses,including nine putative WRKY transcription factor-binding sites, are present within 650 bases of sequenceupstream of the PDR9 transcription start site (W box;http://www.dna.affrc.go.jp/PLACE/). Strong expres-sion in the lateral root cap and epidermis also suggeststhat PDR9 might function in communication processesbetween plant roots and other organisms in the rhizo-sphere.Additionally,PDR9has been identified as beingstrongly inducible by the defense elicitor salicylic acid(https://www.genevestigator.ethz.ch; Zimmermannet al., 2004), however we were unable to verify thisresult in RT-PCR assays orwith our PPDR9-GUS reporterlines (H. Ito and W.M. Gray, unpublished data).

If the ability to act as a transporter of 2,4-D andrelated phenoxy acids is indicative of the endogenoussubstrate of PDR9, several phenolic secondary me-tabolites with antimicrobial activity including trans-cinnamic, ferulic, o-coumaric, and vanillic acid have allbeen identified in Arabidopsis root exudates followingtreatmentwith various pathogen elicitors (Walker et al.,2003). All of these compounds inhibit root growth atmicromolar concentrations, however, we could detectno significant difference in response between wildtype and the pdr9 mutants (H. Ito and W.M. Gray,unpublished data). Unfortunately, the root-specificexpression pattern of PDR9 combined with the ab-sence of an established quantitative assay for suscep-tibility to root-invading pathogens preclude us fromreadily examining the pdr9 mutants for altered path-ogen resistance.

The Gain-of-Function pdr9-1 Mutation

The gain-of-function pdr9-1 mutation is highly in-triguing given that it affects a domain that is extremelyhighly conserved in all plant PDR proteins identifiedto date. The proximity of this domain to the Walkermotifs in the second NBD suggests that the mutationmight act by increasing ATP binding or hydrolysisrates. We attempted to address this possibility usingEscherichia coli expressed recombinant NBD2 in ATPhydrolysis assays as described for other ABC proteins(Jha et al., 2003). However, we could detect no activitywith either the wild-type or mutant proteins.

An alternative explanation was suggested by oura-PDR9antibody studies, inwhichweobserved amod-est (approximately 1.8-fold) but consistent increase inPDR9 protein abundance in microsomal extracts pre-pared from pdr9-1 roots compared to wild type. Al-though the precise mechanism by which the pdr9-1mutation acts requires further study, this result sug-gests that the mutation may confer increased proteinstability. It should be noted that several ABC trans-porters, including the closely related yeast PDR5p, arerelatively short-lived proteins subject to ubiquitin-mediated vacuolar proteolysis (Egner et al., 1995;Egner and Kuchler, 1996). Thus, an increase in PDR9protein levels due to enhanced stability could accountfor the increased 2,4-D resistance observed in pdr9-1.





Overexpression of AtPDR12 and its putative Spirodelaortholog, SpTUR2, in Arabidopsis confer increasedresistance to the potential substrates lead and sclareol,respectively (van den Brule et al., 2002; Lee et al.,2005). We attempted to overexpress PDR9 from thecauliflower mosaic virus 35S promoter to further ad-dress this possibility but were unable to recover anytransgenic lines expressing elevated levels of PDR9(data not shown).

Regardless of the mode of action of the pdr9-1 mu-tation, the fact that it occurs in the extremely highlyconserved PDR signature sequence suggests that thegain-of-function affects might be transferable to otherplant PDR transporters. If so, this could provide anovel means for engineering plants with increasedxenobiotic resistance. Such an approach may be par-ticularly effective if transporter activity can be in-creased to an even greater extent by more dramaticmutations of the PDR signature motif and/or in con-junction with overexpression.

Recently, the ABC transporter encoded by theAtWBC19 gene was shown to confer kanamycin resis-tance when overexpressed in plants (Mentewab andStewart, 2005). The authors noted that the develop-ment of AtWBC19 as a selectable marker provides analternative to the bacterial-derived nptII gene, thusreducing the potential of horizontal transfer of resis-tance genes. The dominant nature of the pdr9-1 muta-tion suggests the potential for PDR9 to be similarlydeveloped as a plant-derived selectable marker for2,4-D resistance, as well as the development of cropsresistant to the phenoxyalkanoic acid class of herbi-cides, yet which exhibit normal sensitivity to endog-enous auxin. Little is known regarding the function ofthe vast majority of plant ABC transporters. As more islearned regarding the natural substrates of these trans-porters as well as their capacity to mobilize variousxenobiotics, this family of proteins may develop intoan important genetic resource for engineering plantswith increased resistance to contaminated soils andpotentially for the development of phytoremediationstrategies.

MATERIALS AND METHODS

Plant Materials and Growth Conditions

All Arabidopsis (Arabidopsis thaliana) lines used in this study are in the Col

ecotype. Seedlings were grown under sterile conditions on ATS nutrient

medium (Lincoln et al., 1990) under long-day lighting. Conditions for the

mutagenesis and screen for eta2 mutants have been previously described

(Gray et al., 2003). Chemicals used in root growth assays were purchased from

Sigma-Aldrich and dissolved in ethanol or dimethylsulfoxide as 1,0003

stocks. For root growth assays, seedlings were grown on ATS nutrient media

for 4 to 5 d, transferred to ATS media containing 2,4-D, NPA, 4-chloro-2-

methylphenoxy acetic acid, etc., the position of the root tip marked, and then

incubated an additional 4 d. The amount of root growth was measured and

percent inhibition calculated versus growth on unsupplemented media.

Map-Based Cloning of PDR9

Since the eta4/pdr9-1 mutation was semidominant, a total of 237 2,4-

D-sensitive F2 seedlings from a cross between the mutant and ecotype

Landsberg erecta (Ler) were used tomap the eta4/pdr9-1mutation using cleaved

amplified polymorphic sequences and simple sequence length polymorphism

markers. The mutation was initially mapped to an interval between markers

nga162 and nga6 (http://www.arabidopsis.org). Additional markers were

generated using the Cereon Arabidopsis polymorphism collection (Jander

et al., 2002). Markers defining our final mapping interval were CER470292,

which amplifies 144 and 135 bp fragments from Col and Ler, and CER470334,

which amplifies 101 and 116 bp fragments from Col and Ler, respectively.

Northern-Blot Analysis and RT-PCR

Total RNAwas isolated from various Arabidopsis organs as described by

Chomczynski and Sacchi (1987). For RT-PCR, total RNA was extracted from

seedlings using RNeasy plant kits (Qiagen) according to the manufacturer’s

instructions. Northern blots were performed with 10 mg total RNA/sample

using standard techniques. For RT-PCR analysis, first-strand cDNA synthesis

was performed using 1 mg RNA and M-MLV-RTase (Promega) following the

manufacturer’s instructions. Gene-specific primers were designed to allow

detection of amplification products from contaminant genomic DNA using

primers spanning one or more introns. The specific primers used in this study

were PDR9-F4: GCGAAACTCAGAGCTTGTGA; PDR9-R1: AATGATGATT-

GATGAAGACT; ETA2-7F: GTGCTGTTGGTTACCGGTTTGGC; and ETA2-

14R: CAGGAGGCGCATGTGATGCCAA.

GUS Histochemical Staining

A 2.3 kb fragment containing genomic sequence from upstream of the

PDR9 locus through the first 33 bp of coding sequence was cloned in frame

with the GUS coding sequence of pBI101.2 (CLONTECH). Seedlings were

stained for GUS activity as previously described (Stomp, 1991).

Antibodies

A cDNA fragment encoding PDR9 amino acids 1 to 98 was cloned as an

EcoRI-XhoI fragment into the pET30A Escherichia coli expression vector (Nova-

gen). Expressionwas inducedwith isopropylthio-b-galactoside and the fusion

protein purified on nickel-nitrilotriacetic acid agaroseusing standardprotocols

(Gray et al., 1999). The recombinant protein was eluted with imidazole and

used to immunize aNewZealandwhite rabbit (CocalicoBiological). SEC12 and

PGP4 antibodies were kindly provided by Drs. Tony Sanderfoot (University of

Minnesota) and Angus Murphy (Purdue University).

Microsomal Purification and Immunoblot Analysis

Five hundred milligrams of root tissue from 8-d-old seedlings were homo-

genized on ice in 2mL of buffer (250mM sorbitol, 50mM Tris-HCl, pH 8.0, 2 mM

EDTA, 7 g/L polyvinylpyrrolidone, 5 mM dithiotoreitol, 0.53 proteinase

inhibitor mix [Calbiochemistry], and 1 mM phenylmethylsulfonyl fluoride;

Stukkens et al., 2005). The homogenate was centrifuged for 5 min at 10,000g at

4�C and the supernatant centrifuged again under the same conditions to

remove cell debris. The resulting supernatant was spun 1.5 h at 20,000g at 4�C,and the final pellet suspended in 100 mL resuspension buffer (5 mM potassium

phosphate buffer, pH 7.8, 330 mM Suc, 3 mM KCl, 0.53 proteinase inhibitor

mix, and 1 mM phenylmethylsulfonyl fluoride). For the aqueous two-phase

partitioning experiments, microsomes were prepared from 10-d-old roots

(5g fresh weight) and fractionated according to Larsson et al. (1994). For

immunoblotting, 5 mg of each protein sample solubilized for 15 min at 37�C in

SDS sample buffer were subjected to SDS-PAGE (7.5% polyacrylamide) and

transferred electrophoretically to nitrocellulose membranes (Amersham).

Immunoblot procedures have been described previously (Gray et al., 1999).

The antibody dilutions were 1:4,000 for a-PDR9, 1:4,000 for a-AtSEC12, and

1:3,000 for a-PGP4 antisera. Where indicated, quantification of immunoblots

was performed using ImageJ with enhanced chemiluminescence exposures on

preflashed autoradiography film.

Labeling Assays

Root tips (apical25 mm) were excised from 5-d-old Arabidopsis seedlings

and preincubated in uptake buffer (20 mM MES-KOH, pH 5.6, 10 mM Suc,

0.5 mM calcium sulfate). Then, tips were incubated in uptake buffer containing

250 nM [14C]-2,4-D, 250 nM [3H]-IAA, or 34 nM [3H]-NPA, respectively. After

Ito and Gray




60 min incubation, root tips were rinsed with same buffer and placed directly

into liquid scintillation fluid. [5-3H]-IAA (20 Ci/mmol), [ring-14C (U)]-2,4-D

(80 mCi/mmol), and [2,3,4,5-3H]-NPA (58 Ci/mmol) were obtained from

American Radiolabeled Chemicals.

Sequence data from this article can be found in the GenBank/EMBL data

libraries under accession number BK001008 (PDR9).

ACKNOWLEDGMENTS

We thank Cereon Genomics for access to its Arabidopsis Polymorphism

Collection, Dr. John Ward, the Salk Institute Genomic Analysis Laboratory,

and the Arabidopsis Biological Resource Center for providing seed stocks,

Drs. Anthony Sanderfoot and Angus Murphy for providing antibodies,

technical advice, and thoughtful discussion. We are also grateful to Drs. Neil

Olszewski, Paul Overvoorde, and John Ward for helpful comments on the

manuscript.

Received June 2, 2006; accepted July 26, 2006; published July 28, 2006.

LITERATURE CITED

Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson

DK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide

insertional mutagenesis of Arabidopsis thaliana. Science 301: 653–657

Bairoch A (1992) PROSITE: a dictionary of sites and patterns in proteins.

Nucleic Acids Res 20 (Suppl): 2013–2018

Campbell EJ, Schenk PM, Kazan K, Penninckx IA, Anderson JP, Maclean

DJ, Cammue BP, Ebert PR, Manners JM (2003) Pathogen-responsive

expression of a putative ATP-binding cassette transporter gene con-

ferring resistance to the diterpenoid sclareol is regulated by multiple

defense signaling pathways in Arabidopsis. Plant Physiol 133:

1272–1284

Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation

by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal

Biochem 162: 156–159

Chuang HW, Zhang W, Gray WM (2004) Arabidopsis ETA2, an apparent

ortholog of the human cullin-interacting protein CAND1, is required for

auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell

16: 1883–1897

Crouzet J, Trombik T, Fraysse AS, Boutry M (2006) Organization and

function of the plant pleiotropic drug resistance ABC transporter family.

FEBS Lett 580: 1123–1130

Delbarre A, Muller P, Imhoff V, Guern J (1996) Comparison of mecha-

nisms controlling uptake and accumulation of 2,4-dichlorophenoxy

acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in

suspension-cultured tobacco cells. Planta 198: 532–541

Dharmasiri N, Dharmasiri S, Estelle M (2005a) The F-box protein TIR1 is

an auxin receptor. Nature 435: 441–445

Dharmasiri N, Dharmasiri S, Weijers D, Lechner E, Yamada M, Hobbie L,

Ehrismann JS, Jurgens G, Estelle M (2005b) Plant development

is regulated by a family of auxin receptor F box proteins. Dev Cell 9:

109–119

Egner R, Kuchler K (1996) The yeast multidrug transporter Pdr5 of the

plasma membrane is ubiquitinated prior to endocytosis and degrada-

tion in the vacuole. FEBS Lett 378: 177–181

Egner R, Mahe Y, Pandjaitan R, Kuchler K (1995) Endocytosis and

vacuolar degradation of the plasma membrane-localized Pdr5 ATP-

binding cassette multidrug transporter in Saccharomyces cerevisiae.

Mol Cell Biol 15: 5879–5887

Gaedeke N, Klein M, Kolukisaoglu U, Forestier C, Muller A, Ansorge M,

Becker D, Mamnun Y, Kuchler K, Schulz B, et al (2001) The Arabi-

dopsis thaliana ABC transporter AtMRP5 controls root development

and stomata movement. EMBO J 20: 1875–1887

Geisler M, Blakeslee JJ, Bouchard R, Lee OR, Vincenzetti V,

Bandyopadhyay A, Titapiwatanakun B, Peer WA, Bailly A, Richards

EL, et al (2005) Cellular efflux of auxin catalyzed by the Arabidopsis

MDR/PGP transporter AtPGP1. Plant J 44: 179–194

Geisler M, Kolukisaoglu HU, Bouchard R, Billion K, Berger J, Saal B,

Frangne N, Koncz-Kalman Z, Koncz C, Dudler R, et al (2003) TWISTED

DWARF1, a unique plasma membrane-anchored immunophilin-like

protein, interacts with Arabidopsis multidrug resistance-like trans-

porters AtPGP1 and AtPGP19. Mol Biol Cell 14: 4238–4249

Geisler M, Murphy AS (2006) The ABC of auxin transport: the role of

p-glycoproteins in plant development. FEBS Lett 580: 1094–1102

Gray WM, del Pozo JC, Walker L, Hobbie L, Risseeuw E, Banks T, Crosby

WL, Yang M, Ma H, Estelle M (1999) Identification of an SCF ubiquitin-

ligase complex required for auxin response in Arabidopsis thaliana.

Genes Dev 13: 1678–1691

Gray WM, Muskett PR, Chuang HW, Parker JE (2003) Arabidopsis SGT1b is

required for SCF(TIR1)-mediated auxin response. Plant Cell 15: 1310–1319

Higgins CF (1992) ABC transporters: from microorganisms to man. Annu

Rev Cell Biol 8: 67–113

Jander G, Norris SR, Rounsley SD, Bush DF, Levin IM, Last RL (2002)

Arabidopsis map-based cloning in the post-genome era. Plant Physiol

129: 440–450

Jasinski M, Stukkens Y, Degand H, Purnelle B, Marchand-Brynaert J,

Boutry M (2001) A plant plasma membrane ATP binding cassette-type

transporter is involved in antifungal terpenoid secretion. Plant Cell 13:

1095–1107

Jha S, Karnani N, Dhar SK, Mukhopadhayay K, Shukla S, Saini P,

Mukhopadhayay G, Prasad R (2003) Purification and characterization

of the N-terminal nucleotide binding domain of an ABC drug trans-

porter of Candida albicans: uncommon cysteine 193 of Walker A is

critical for ATP hydrolysis. Biochemistry 42: 10822–10832

Kepinski S, Leyser O (2005) The Arabidopsis F-box protein TIR1 is an

auxin receptor. Nature 435: 446–451

KleinM, Geisler M, Suh SJ, Kolukisaoglu HU, Azevedo L, Plaza S, Curtis

MD, Richter A, Weder B, Schulz B, et al (2004) Disruption of AtMRP4, a

guard cell plasma membrane ABCC-type ABC transporter, leads to

deregulation of stomatal opening and increased drought susceptibility.

Plant J 39: 219–236

Klein M, Perfus-Barbeoch L, Frelet A, Gaedeke N, Reinhardt D, Mueller-

Roeber B, Martinoia E, Forestier C (2003) The plant multidrug resis-

tance ABC transporter AtMRP5 is involved in guard cell hormonal

signalling and water use. Plant J 33: 119–129

Kobae Y, Sekino T, Yoshioka H, Nakagawa T, Martinoia E, Maeshima M

(2006) Loss of AtPDR8, a plasma membrane ABC transporter of

Arabidopsis thaliana, causes hypersensitive cell death upon pathogen

infection. Plant Cell Physiol 47: 309–318

Larsson C, Sommarin M, Widell S (1994) Isolation of highly purified plant

plasma membranes and the separation of inside-out and right-side-out

vesicles. Methods Enzymol 228: 451–469

Lee M, Lee K, Lee J, Noh EW, Lee Y (2005) AtPDR12 contributes to lead

resistance in Arabidopsis. Plant Physiol 138: 827–836

Lincoln C, Britton JH, Estelle M (1990) Growth and development of the

axr1 mutants of Arabidopsis. Plant Cell 2: 1071–1080

Lu YP, Li ZS, Drozdowicz YM, Hortensteiner S, Martinoia E, Rea PA

(1998) AtMRP2, an Arabidopsis ATP binding cassette transporter able to

transport glutathione S-conjugates and chlorophyll catabolites: func-

tional comparisons with Atmrp1. Plant Cell 10: 267–282

Lu YP, Li ZS, Rea PA (1997) AtMRP1 gene of Arabidopsis encodes a

glutathione S-conjugate pump: isolation and functional definition of a

plant ATP-binding cassette transporter gene. Proc Natl Acad Sci USA 94:

8243–8248

Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann

C, Bennett MJ (1999) AUX1 regulates root gravitropism in Arabidopsis by

facilitating auxin uptake within root apical tissues. EMBO J 18: 2066–2073

Martinoia E, Klein M, Geisler M, Bovet L, Forestier C, Kolukisaoglu U,

Muller-Rober B, Schulz B (2002) Multifunctionality of plant ABC

transporters—more than just detoxifiers. Planta 214: 345–355

Mentewab A, Stewart CN Jr (2005) Overexpression of an Arabidopsis

thaliana ABC transporter confers kanamycin resistance to transgenic

plants. Nat Biotechnol 23: 1177–1180

Morris DA, Friml J, Zazimalova E (2004) Auxin transport. In PJ Davies, ed,

Plant Hormones: Biosynthesis, Signal Transduction, Action! Kluwer

Academic Publishers, Dordrecht, The Netherlands, pp 437–470

Multani DS, Briggs SP, Chamberlin MA, Blakeslee JJ, Murphy AS, Johal

GS (2003) Loss of an MDR transporter in compact stalks of maize br2

and sorghum dw3 mutants. Science 302: 81–84

Noh B, Murphy AS, Spalding EP (2001) Multidrug resistance-like genes of

Arabidopsis required for auxin transport and auxin-mediated develop-

ment. Plant Cell 13: 2441–2454





Oono Y, Chen QG, Overvoorde PJ, Kohler C, Theologis A (1998) Age

mutants of Arabidopsis exhibit altered auxin-regulated gene expres-

sion. Plant Cell 10: 1649–1662

Quint M, Ito H, Zhang W, Gray WM (2005) Characterization of a

novel temperature-sensitive allele of the CUL1/AXR6 subunit of SCF

ubiquitin-ligases. Plant J 43: 371–383

Sanchez-Fernandez R, Davies TG, Coleman JO, Rea PA (2001) The

Arabidopsis thaliana ABC protein superfamily, a complete inventory.

J Biol Chem 276: 30231–30244

Santelia D, Vincenzetti V, Azzarello E, Bovet L, Fukao Y, Duchtig P,

Mancuso S, Martinoia E, Geisler M (2005) MDR-like ABC transporter

AtPGP4 is involved in auxin-mediated lateral root and root hair devel-

opment. FEBS Lett 579: 5399–5406

Schulz B, Kolukisaoglu HU (2006) Genomics of plant ABC transporters:

the alphabet of photosynthetic life forms or just holes in membranes?

FEBS Lett 580: 1010–1016

Stein M, Dittgen J, Sanchez-Rodriguez C, Hou BH, Molina A, Schulze-

Lefert P, Lipka V, Somerville S (2006) Arabidopsis PEN3/PDR8, an

ATP binding cassette transporter, contributes to nonhost resistance to

inappropriate pathogens that enter by direct penetration. Plant Cell 18:

731–746

Stomp A-M (1991) Histochemical localization of b-glucuronidase. In SR

Gallagher, ed, GUS Protocols. Academic Press, London, pp 103–113

Stukkens Y, Bultreys A, Grec S, Trombik T, Vanham D, Boutry M (2005)

NpPDR1, a pleiotropic drug resistance-type ATP-binding cassette trans-

porter from Nicotiana plumbaginifolia, plays a major role in plant

pathogen defense. Plant Physiol 139: 341–352

Teixeira MC, Sa-Correia I (2002) Saccharomyces cerevisiae resistance to

chlorinated phenoxyacetic acid herbicides involves Pdr1p-mediated

transcriptional activation of TPO1 and PDR5 genes. Biochem Biophys

Res Commun 292: 530–537

Terasaka K, Blakeslee JJ, Titapiwatanakun B, Peer WA, Bandyopadhyay

A, Makam SN, Lee OR, Richards EL, Murphy AS, Sato F, et al (2005)

PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin trans-

port in Arabidopsis thaliana roots. Plant Cell 17: 2922–2939

Theodoulou FL (2000) Plant ABC transporters. Biochim Biophys Acta 1465:

79–103

Tommasini R, Vogt E, Fromenteau M, Hortensteiner S, Matile P, Amrhein

N, Martinoia E (1998) An ABC-transporter of Arabidopsis thaliana has

both glutathione-conjugate and chlorophyll catabolite transport activity.

Plant J 13: 773–780

Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ (1997) Aux/IAA proteins

repress expression of reporter genes containing natural and highly

active synthetic auxin response elements. Plant Cell 9: 1963–1971

van den Brule S, Muller A, Fleming AJ, Smart CC (2002) The ABC

transporter SpTUR2 confers resistance to the antifungal diterpene

sclareol. Plant J 30: 649–662

van den Brule S, Smart CC (2002) The plant PDR family of ABC trans-

porters. Planta 216: 95–106

Walker JE, Saraste M, Runswick MJ, Gay NJ (1982) Distantly related

sequences in the alpha- and beta-subunits of ATP synthase, myosin,

kinases and other ATP-requiring enzymes and a common nucleotide

binding fold. EMBO J 1: 945–951

Walker TS, Bais HP, Halligan KM, Stermitz FR, Vivanco JM (2003)

Metabolic profiling of root exudates of Arabidopsis thaliana. J Agric Food

Chem 51: 2548–2554

Windsor B, Roux SJ, Lloyd A (2003) Multiherbicide tolerance conferred

by AtPgp1 and apyrase overexpression in Arabidopsis thaliana. Nat

Biotechnol 21: 428–433

Woodward AW, Bartel B (2005) Auxin: regulation, action, and interaction.

Ann Bot (Lond) 95: 707–735

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004)

GENEVESTIGATOR: Arabidopsis microarray database and analysis

toolbox. Plant Physiol 136: 2621–2632

Ito and Gray




A Gain-of-Function Mutation in the Arabidopsis Pleiotropic ...presence of two ABC-type transporter...

Documents

Transcript of A Gain-of-Function Mutation in the Arabidopsis Pleiotropic ...presence of two ABC-type transporter...