SHORT COMMUNICATIONS

A DNA probe mix for the multiplex detection of tenartichoke viruses

Serena Anna Minutillo & Tiziana Mascia &

Donato Gallitelli

Accepted: 25 June 2012 /Published online: 14 September 2012# KNPV 2012

Abstract Artichoke Italian latent virus (AILV), Ar-tichoke latent virus (ArLV), Artichoke mottled crinklevirus (AMCV), Bean yellow mosaic virus (BYMV),Cucumber mosaic virus (CMV), Pelargonium zonatespot virus (PZSV), Tomato infectious chlorosis virus(TICV), Tobacco mosaic virus (TMV), Tomato spot-ted wilt virus (TSWV) and Turnip mosaic virus(TuMV) are damaging to artichoke. We have devel-oped a protocol enabling the simultaneous detection ofthese artichoke viruses by non-isotopic dot blothybridisation with DNA probes. The probe mixdetected all viruses with high specificity and identicalto that obtained using individual probes. The approachis proposed for the routine assessment of phytosani-tary status for certified nursery production of globeartichoke.

Keywords Globe artichoke . Plant viruses . Multiplediagnosis .Molecular hybridization . DIG-DNA probe

Globe artichoke (Cynara cardunculus var. scolymusL.) is a perennial species of the family Compositeae(Asteraceae) grown for its large fleshy immatureinflorescences (flower heads). Production is mainlyconcentrated in Mediterranean countries, but extensivecropping also takes place in the Near East, SouthAmerica, USA, and China (FAO 2010).

The lack of active selection for mother plants with agood sanitary status has led over time to severalviruses accumulating in the crop entailing its progres-sive degeneration. Most of the 25 viruses currentlyreported from Cynara species were found in Europeand Mediterranean Basin, where they constitute seri-ous threats to the artichoke industry (Martelli andGallitelli 2008; Gallitelli et al. 2012). Economicallyrelevant RNA viruses infecting globe artichoke in-clude among others Artichoke latent virus (ArLV),Artichoke Italian latent virus (AILV), Artichoke mot-tled crinkle virus (AMCV), Bean yellow mosaic virus(BYMV), Cucumber mosaic virus (CMV), Pelargoni-um zonate spot virus (PZSV), Tomato infectious chlo-rosis virus (TICV), Tobacco mosaic virus (TMV),Tomato spotted wilt virus (TSWV) and Turnip mosaicvirus (TuMV). Mixed infections of these viruses arecommon in globe artichoke, thus making symptom-based diagnosis almost impossible. Most of the plants,

Eur J Plant Pathol (2012) 134:459–465DOI 10.1007/s10658-012-0032-3

S. A. Minutillo : T. Mascia (*) :D. GallitelliDipartimento di Biologia e Chimica Agroforestale edAmbientale, Università degli Studi di Bari Aldo Moro,Via Amendola 165/A,70126 Bari, Italye-mail: tiziana.mascia@uniba.it

S. A. MinutilloAgritest S.r.L.,ValenzanoBari, Italy

T. Mascia :D. GallitelliIstituto di Virologia Vegetale del CNR, U.O.S. di Bari,Via Amendola 165/A,70126 Bari, Italy

even when infected by a single virus, do not showdistinctive symptoms, either because infections arelatent or because varietal reactions, environmentalconditions, agronomic practices and plant age influ-ence symptom expression. Despite the latency, lossesof production are economically relevant.

The damaging effects of virus infections on thequantity and quality of the yield highlight that newartichoke fields must be planted with virus-free prop-agation material. Its availability would allow a greatincrease in productivity and make nursery production,which should originate from virus free and true-to-type mother plants, conform to the current EU legis-lation (Directives 93/61/CEE and 93/62/CEE). This, inturn, requires availability of easy-to-use diagnostickits for routine tests.

ELISA kits for many of the viruses found inartichoke are commercially available but there arefew reports of their use for direct detection inartichoke sap (Cugusi et al. 1991; Pasquini et al.2004). The rapid oxydation of artichoke sap givesborderline results, especially when the antigen con-centration is low (Pasquini et al. 2004; D. Gallitelli,unpublished results), therefore background readingsprevent differentiation of infected from healthy sam-ples. Consequently, ELISA is often used for virusidentification after transmission to herbaceous hosts.

Accurate diagnosis combined with rapid and earlyvirus detection can be carried out using nucleic acid-based tests and among these, dot blotting and tissueprinting represents a suitable assay for routine screen-ings and sanitary certification schemes. The objectiveof this study was to evaluate the use of a mixture ofdigoxigenin (DIG)-labelled DNA probes for the si-multaneous detection in a single test of the abovementioned 10 RNA viruses infecting globe artichoke.

Primers were designed to amplify fragments in therange of 500–700 bp (with the exception of TMV)from recombinant plasmids containing cloned seg-ments of the genome of the ten viruses, already avail-able in our lab (Table 1). Both unlabelled DNAcontrols and the corresponding DIG-labelled DNAprobes were synthesized from 20 or 40 ng, respective-ly, of the same plasmid preparation blotted onto aWhatman FTA card (Whatman FTA kit pK/1, GEhealthcare life Sciences, Germany) as suggested bythe manufacturer and used as template in a PCR mixcontaining virus-specific forward and reverse primers.PCR reactions were carried out using the PCR DIG

Probe Synthesis Kit (Roche, Germany) followingmanufacturer’s protocol. For the synthesis of positivecontrols, DIG-dUTP was omitted from the reaction.Reaction conditions were: 4 min denaturation at 94 °Cfollowed by 35 cycles of 30 s denaturation at 94 °C,30 s annealing at 60 °C for TMV, 55 °C for CMV,TSWV and TICV; 52 °C for AMCV and 50 °C forArLV, AILV, BYMV, PZSV and TuMV and 20 s syn-thesis at 72 °C. Final elongation step was for 7 min at72 °C. At the end of the reaction, amplicon purity andsize was estimated by electrophoresis in 1.2 % agarosegel in TBE buffer (90 mM Tris, 90 mM boric acid,1 mM EDTA) and gel-red staining.

The synthesis of either DIG-labelled DNA probesor unlabelled DNA controls obtained from plasmidsfixed onto FTA cards yielded very clean preparationsof a unique amplicon of the expected size for each ofthe ten viruses (Fig. 1). This approach eliminated crosshybridization signals between some probes and heter-ologous controls we originally had (not shown), whilereduced costs for post-amplification cleaning of PCRproducts and DNA losses during gel elution. Addi-tionally a 200 bp fragment was used for TMV due to aweak signal of cross hybridization with heterologousviruses experienced with larger size amplicons (notshown). The average yield was 2 μg of either DIG-labelled probes or unlabelled DNA.

To test probe specificity, about 1 ng DNA in 7-μlaliquots of each of unlabelled positive controls wasspotted onto a positively charged nylon membrane(Roche, Germany) pre-wetted with 50 mM NaOH,2.5 mM EDTA and air-dried for few minutes beforespotting. Eleven replica membranes were prepared totest the probes singly or in mixture. After 2 min UVexposure, membranes were hybridized overnight at50 °C in 150 μl/cm2 of DIG Easy Hyb solution(Roche, Germany) containing either a single probe ora mixture of the ten at a concentration of 50 ng/mleach. After hybridization, probe excess was removedby four washes of 15 min each at 65 °C in 300 mMNaCl, 30 mM sodium citrate (2 X SSC), 0,1%SDS andhybrids revealed using the DIG luminescent detectionkit and CDP-star as substrate (Roche, Germany). Blotswere evaluated by densitogram analysis with theQuantity One software in a Chemi-Doc apparatus(Bio-Rad Laboratoires). Figure 2 shows that eachprobe was specific for its corresponding virus withoutcross-hybridization signals with the controls of heter-ologous viruses.

460 Eur J Plant Pathol (2012) 134:459–465

We also tested the specificity of the individualprobes to detect the 10 viruses in RNA preparationsextracted from tissues of infected plants. Because ofunavailability of infected artichoke plants for the 10virus species, total RNA was extracted with Tri-reagent® (Sigma) from 10 mg of infected dry tissue(about 100 mg fresh leaf tissue) from our collection.The extraction was made following the manufacturer’sprotocol. RNA preparations were suspended in 20 μlRNase-free distilled water and concentration adjustedto 1 μg/μl. Total RNA extracted from a healthy Nico-tiana benthamiana dry tissue was used as negativecontrol. To mimic tests with plants collected fromfield, 2 μl of each RNA preparation was mixed with6 μl healthy artichoke sap extracted in 50 mM NaOH,2.5 mM EDTA and 7 μl of the mixture were spottedonto a positively charged nylon membrane. Ten repli-ca membranes were hybridized separately with eachprobe, while another was tested with the 10-probe

mixture. Hybridization and hybrid detection was car-ried out as previously described. In separate tests eachprobe hybridized specifically with its homologous vi-rus in total nucleic acids preparations, since no hybrid-ization signal was detected in the extracts infectedwith non-related viruses (Fig. 2) while the probe mix-ture yielded a signal with all 10 viruses without loos-ing sensitivity (Fig. 3).

The limit of detection and probe specificity wereassessed using the infected plant material available inthe field at the time this work was carried out. Infectedplants were identified first by the 10 probes mixtureand then by hybridization with single probes (notshown). The hybridization with single probe showedthat AILV was the only virus present in 20 artichokesamples collected from the field and therefore we usedthis material to estimate the limit of detection of themethod. For this purpose, we prepared a dilution seriesfrom 100 mg of three naturally infected plant tissue

Table 1 List of primer pairs used to amplify fragments in the range of 500–700 bp from recombinant plasmids containing clonedsegments of the genome of the 10 viruses considered in this study

Virus Accessionnumber

Primer sequence (5′ → 3′) Positiona ORF Ampliconsize

Artichoke Italian latentnepovirus (AILV)

X87254 fwd ATTCACTAGTCCCTATTTAG 175–194 Coat protein 769 bprev GGTCTGGGGTGCCCGTGGCG 924–943

Artichoke mottled crinkletombusvirus (AMCV)

X51456 fwd ATGGCAATGGTAAAGAGAAA 79-98 Coat protein 553 bprev CCGAATCTTTATCAAAGTACATAGCC

606–631

Artichoke latentpotyvirus (ArLV)

X87255 fwd TTGTTCATAAGGGAGCGCGT 10–29 NIa 499 bprev CTCAAGCTCTCGAACTAACT 489–508

Bean yellow mosaicpotyvirus (BYMV)

AB041972 fwd ACACAAGCACAGTTTGAAGC 277–296 Coat protein 700 bprev AGATCAAGCTCACACGAGG 963–981

Cucumber mosaiccucumovirus (CMV)

D00355 fwd GTTTATTTACAAGAGCGTACGG 1–22 2a protein 637 bprev GGTTCGAA(AG)(AG)(AT)ATAACCGGG 618–637

Pelargonium zonate spotanulavirus (PZSV)

AJ272329 fwd ATGCCCCCTAAGAGACAG 1619–1636 Coat protein 625 bprev ACAGAGGTATATACTCTGC 2225–2243

Tomato infectiouschlorosis crinivirus(TICV)

NC013259 for TCAGTGCGTACGTTAATGGG 757–776 Similar toheat shockprotein 70

500 bprev CACAGTATACAGCAGCGGCAG 1237–1257

Tobacco mosaictobamovirus (TMV)

AB369276.1 for CTTACAGTATCACTACTCCATCTCAGTTCG

5716–5745 Coat protein 222 bp

rev CCGCATTGTACCTGTACACCTTAAAGTC

5910–5937

Tomato spotted wilttospovirus (TSWV)

AB010996 fwd GA(AG)GAACATCTTCCTTTGG 284–303 Nsm 679 bprev CCTCTTCTTCTTCAACTGATC 942–962

Turnip mosaicpotyvirus (TuMV)

AF071526 fwd AT(TC)CT(GA)TACAC(GCT)CC(GA)GAGCA

130–150 Coat protein 473 bp

rev GCGCCACGCAGTGCTG 587–602

a Figures represent fragments of the sequences covered by each primer pair are indicated

Eur J Plant Pathol (2012) 134:459–465 461

crushed in 600 μl of 50 mM NaOH, 2.5 mM EDTA.Dilutions were made in healthy artichoke sapextracted in the same alkaline solution. Undilutedand diluted samples were spotted as three replicas of7 μl each and hybridized with either AILV probe orthe 10-probe mixture. Figure 4 shows that the limit ofdetection was between 45 and 5 μg of infected tissueand that the same limit was obtained with the tenprobes mix.

For the large-scale testings required by nurs-eries or field surveys, tissue prints allow theanalysis of multiple samples, thus saving time,

space and transport of infected plant material tothe laboratory. Young artichoke leaves of plantsgrown in a commercial artichoke field were cuttransversally and the exposed surface quicklypressed onto a nylon membrane pre-wetted withthe akaline solution and air-dried. Membraneswere hybridized with the 10-probe mix showinghigh specificity in discriminating between healthyand infected samples (not shown). AILV was theonly virus detected by the tissue print methodduring a survey carried out in the early 2011autumn.

Fig. 1 Agarose gel electro-phoresis of the ampliconsyielded by PCR using pla-mid preparations spottedonto Whatman FTA cards,as template. The sameamplicon was synthesised asa native or DIG-labelledmolecule to be used as pos-itive control and probe, re-spectively. The differentmigration rate between na-tive and DIG-labelled mole-cules was due to the DIGmoiety included during thesynthesis. M.W. marker 0molecular weight markerXIV (Roche, Germany).Figures on the left indicatethe bp size of some mol. wtmarker bands

462 Eur J Plant Pathol (2012) 134:459–465

On the basis of our recent experience, it is expectedthat the new available vegetatively propagated globeartichoke germplasm sanitized by thermotherapy andmeristem-tip culture (Acquadro et al. 2010) will elicitan increase in the demand of nursery production forthe new plants. Seed propagation has been equallyregarded as an attractive means to make virus-freeplants however, most artichoke-infecting viruses areseed- and pollen-transmitted and, in particular, AILVand ArLV have been detected in artichoke seed coatsand fully expanded cotyledons (Bottalico et al. 2002).Thus, procedures to detect seed-transmitted virusesmust be also applied for seed-based nursery produc-tion. Additionally, caution must be paid before

declaring either vegetatively propagated or seed-based nursery productions of globe artichoke asvirus-free because it is necessary to repeat the screen-ing at least two times (Acquadro et al. 2010) prior tocommercialisation of phytosanitary certified stocks.On the whole this matter will disclose a quite newfield of application of phytosanitary certification re-quiring the timely and quick processing of a largenumber of samples with a rapid, sensitive and easy-to-use detection method.

Molecular hybridisation with non-radioactive probesfor the simultaneous detection of multiple plant virusinfections is accumulating interest for the needs of suchlarge-scale testings (reviewed in James et al. 2006).

Fig. 2 Validation of the specificity of each DIG-labelled DNAprobe against positive controls (see Fig. 1) of heterologousviruses (virus acronyms in black) and total RNA preparations(virus acronyms in red) extracted from 10 mg of infected drytissue of different hosts from our collection. Two μl of each RNA

preparation (1 μg/μl) was mixed with 6 μl healthy artichoke sapextracted in 50mMNaOH, 2,5 mMEDTA and 7 μl of the mixturewere spotted onto the membrane. healthy 0 total RNA extractedfrom an healthy Nicotiana benthamiana dry tissue and used asnegative control

Eur J Plant Pathol (2012) 134:459–465 463

Mixtures of DIG-labelled riboprobes have been appliedto viruses infecting tomato (Saldarelli et al. 1996), orna-mentals (Sanchez-Navarro et al. 1999; Ivars et al. 2004)

and stone fruits (Saade et al. 2000). The most recent andpromising format is the so-called polyprobe approach,which consists in the cloning in tandem of different

Fig. 3 Validation of the specificity of each DIG-labelledDNA probe. Nylon membranes containing total RNA prep-arations (virus acronyms in black) described in Fig. 2 werehybridized with a mix of probes of increasing complexity.

Virus acronyms listed on top of each membrane correspondto the probe mixture used in the hybridization. A represen-tative of four membranes out of the ten prepared and testedis shown

Fig. 4 Comparison of thesensitivity between single(top) and 10 DIG-DNAprobe mixture (bottom) indetecting AILV in naturallyinfected artichoke samples.The limit of the detectionwas determined by usingserial dilutions in the alka-line solution of the sapextracted from three differ-ent plant samples. Figuresindicate the amount ofinfected tissuecorresponding to each spot.Virus acronyms of positivecontrols (described in Fig. 1)are in red

464 Eur J Plant Pathol (2012) 134:459–465

viruses (Herranz et al. 2005). This allows the synthesisof a single probe with the same potentiality and speci-ficity of probes mix, while reducing costs. A polyprobeapproach has been applied to the simultaneous detectionof four viroids infecting citrus (Cohen et al. 2006) andsix tomato viruses (Aparicio et al. 2009). After our firstpositive experience with multiplex riboprobes (Saldar-elli et al. 1996), we moved to a DNA probe-basedapproach because of the higher stability of the DNAmolecules in terms of shelf-life, transportation and han-dling, which are prerequisites for any kit that could beexploited for commercialisation.

Results of this study validated the simultaneousdetection of 10 viruses infecting artichoke with theDIG-labelled DNA probe mixture format as an alter-native and reliable method to single hybridizations.This is the first time that the approach is applied toglobe artichoke and therefore we think that the proce-dure devised fullfils the actual needs of nursery pro-ductions and virological studies of this plant species.Finally, none of the viruses detectable by the 10-probemixture described in this paper is specific for artichoke(Gallitelli et al. 2012) and therefore the same mixturecan be also used for the screening of vegetables andornamental plants (Spanò et al. 2011a, b).

Acknowledgements S.A. Minutillo was in receipt of an Apu-lian Regional Government fellowship for the development of adiagnostic kit for artichoke viruses (P.O. PUGLIA per il F.S.E.2007/2013, Call 19/2009). This work was partially supported byCEGBA (Centro di Eccellenza di Genomica in campo Biome-dico e Agrario), University of Bari “Aldo Moro” research linen.7.

References

Acquadro, A., Papanice, M., Lanteri, S., Bottalico, G., Portis,E., Campanale, A., et al. (2010). Production and genotyp-ing of virus-free plants in a reflowering globe artichokevarietal type. Plant Cell Tissues and Organ culture, 100,329–337.

Aparicio, F., Soler, S., Aramburu, J., Galipienso, L., Nuez, F.,Pallás, V., et al. (2009). Simultaneous detection of six RNAplant viruses affecting tomato crops using a singledigoxigenin-labelled polyprobe. European Journalof PlantPathology, 123, 117–123.

Bottalico, G., Padula, M., Campanale, A., Finetti-Sialer, M. M.,Saccomanno, F., & Gallitelli, D. (2002). Seed transmission

of Artichoke Italian latent virus and Artichoke latent virusin globe artichoke. Journal of Plant Pathology, 84, 167.

Cohen, O., Batuman, O., Stanbekova, G., Sano, T., Mawassi,M., & Bar-Joseph, M. (2006). Construction of a multiprobefor the simultaneous detection of viroids infecting citrustrees. Virus Genes, 33, 287–292.

Cugusi, M., Foddai, A., & Idini, G. (1991). Detection of Arti-choke latent virus by an indirect Dot-ELISA. Journal ofPhytopathology, 132, 265–272.

FAO. (2010). http://faostat.fao.org/site/339/default.aspx.Gallitelli, D., Mascia, T., Martelli, G. P. (2012). Viruses in artichoke.

In G. Loebenstein and H. Lecoq (Eds.), Advances in VirusResearch, vol. 84 (pp. 289–324). Burlington: Academic Press.

Herranz, M. C., Sanchez-Navarro, J. A., Aparicio, F., & Pallás,V. (2005). Simultaneous detection of six stone fruit virusesby non-isotopic molecular hybridization using a uniqueriboprobe or ‘polyprobe’. Journal of Virological Methods,124, 49–55.

Ivars, P., Alonso, M., Borja, M., & Hernandez, C. (2004).Development of a nonradioactive dot-blot hybridisationassay for the detection of Pelargonium flower break virusand Pelargonium line pattern virus. Eurpean Journal ofPlant Patholology, 110, 275–283.

James, D., Varga, A., Pallas, V., & Candresse, T. (2006). Strat-egies for simultaneous detection of multiple plant viruses.Canadian. Journal of Plant Patholology, 28, 16–29.

Martelli, G. P., & Gallitelli, D. (2008). Viruses of Cynara. In G.P. Rao, S. M. P. Khurana, & S. Lanardon (Eds.), Charac-terization, diagnosis & management of plant viruses, vol 1:Industrial crops (pp. 445–479). Texas: Studium Press.

Pasquini, G., Lumia, V., & Barba, M. (2004). Diagnosis ofArtichoke latent virus (ArLV) and other relevant virusesin "late" Artichoke germplasm. Acta Horticulturae, 660,497–500.

Saade, M., Aparicio, F., Sanchez-Navarro, J. A., Herranz, M. C.,Myrta, A., Di-Terlizzi, B., et al. (2000). Simultaneousdetection of the three ilarviruses affecting stone fruit treesby nonisotopic molecular hybridisation and multiplexreversetranscription polymerase chain reaction. Phytopa-thology, 90, 1330–1336.

Saldarelli, P., Barbarossa, L., Grieco, F., & Gallitelli, D. (1996).Digoxigenin-labelled riboprobes applied to phytosanitarycertification of tomato in Italy. Plant Disease, 80, 1343–1346.

Sanchez-Navarro, J. A., Cañizares, M. C., Cano, E. A., & Pallás,V. (1999). Simultaneous detection of five carnation virusesby non-isotopic molecular hybridization. Journal of Viro-logical Methods, 82, 167–175.

Spanò, R., Mascia, T., Minutillo, S. A., & Gallitelli, D. (2011).Disease note: first report of Tomato infectious chlorosisvirus from tomato in Apulia, Southern Italy. Journal ofPlant Pathology, 93(4 supplement), S4.64.

Spanò, R., Mascia, T., De Lucia, B., Torchetti, E. M., Rubino,L., & Gallitelli, D. (2011). Disease note: first report of aresistance-breaking strain of Tomato spotted wilt virusfrom Gerbera jamesonii in Apulia, southern Italy. Journalof Plant Pathology, 93(4 supplement), S4.63.

Eur J Plant Pathol (2012) 134:459–465 465