BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions,research libraries, and research funders in the common goal of maximizing access to critical research.

A Comparative Analysis of Mitochondrial Genomes in Orthoptera(Arthropoda: lnsecta) and Genome Descriptions of Three Grasshopper SpeciesAuthor(s): Ling Zhao, Zhe-min Zheng, Yuan Huang and Hui-min SunSource: Zoological Science, 27(8):662-672. 2010.Published By: Zoological Society of JapanDOI: http://dx.doi.org/10.2108/zsj.27.662URL: http://www.bioone.org/doi/full/10.2108/zsj.27.662

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological,and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and bookspublished by nonprofit societies, associations, museums, institutions, and presses.

Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance ofBioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.

Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercialinquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

2010 Zoological Society of JapanZOOLOGICAL SCIENCE 27: 662–672 (2010)

A Comparative Analysis of Mitochondrial Genomes in Orthoptera

(Arthropoda: Insecta) and Genome Descriptions of

Three Grasshopper Species

Ling Zhao, Zhe-min Zheng, Yuan Huang* and Hui-min Sun

Institute of Zoology, Shaanxi Normal University, 199 South Chang’an Road,

Xi’an 710062, China

The complete sequences of mitochondrial DNA (mtDNA) from the three new grasshopper species,

Euchorthippus fusigeniculatus, Mekongiana xiangchengensis and Mekongiella xizangensis, consist-

ing of 15772 bp, 15567 bp, and 15885 bp, respectively, were analyzed and compared to mtDNAs from

other 19 Orthoptera species obtained from GenBank. The three mitochondrial genomes contain a

standard set of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes. and an

A+T-rich region in the same order as those of the other analyzed caeliferan species, but different

from those of the ensiferan species by the rearrangement of trnD and trnK. The putative initiation

codon for the cox1 gene is ATC in E. fusigeniculatus, CTG in M. xiangchengensis and CCG in M. xizangensis. All secondary structures of tRNA-Ser(AGN) in the three species lack a DHU arm. In this

study, we stressed the comparative analysis of the stem-loop secondary structure in A+T-rich

region of all Orthoptera species available to date, and report new findings which may facilitate

further investigation and better understanding of this secondary structure. Finally, we undertook a

phylogenetic study of all Orthoptera species available from GenBank to date based on three differ-

ent datasets using parsimony, maximum likelihood, and Bayesian inference. Our result showed that

protein-coding genes (PCG) and amino acid sequences (PCG_PROT) provided good resolution of

higher-level relationships within the Orthoptera, whereas ribosomal RNA genes (RIBO) perform

poorly under different optimality criteria.

Key words: Mitochondrial genome, Orthoptera, Caelifera, stem-loop secondary structure, A+T-rich

region, phylogeny

INTRODUCTION

Mitochondria are key energy generators in most eukary-

otic cells. Research on mitochondria has primarily focused

on the process of ATP generation, phylogeny, and evolu-

tionary origins. With the increase in the whole-genome

sequencing of eukaryote genomes, mtDNAs are inevitably

sequenced, and this has facilitated comparative studies and

phylogenetic analysis. Complete mitochondrial genomes are

increasingly being used as a simple model for comparative

genomics to date (Boore, 2006). Mitochondrial genomes

(mitogenomes) undergo some of the same genomic

changes that eukaryotic nuclear genomes undergo; genes

are rearranged, genes are lost or duplicated, and mutations

accumulate in some duplicated genes such that copies

become transformed into pseudogenes. In addition to the

nucleotide data, gene order and secondary structure of RNA

sequences have often been used as comparative characters

in phylogenetic inference (reviewed in Dowton et al., 2002;

Boore, 2006). However, the limited occurrence of gene rear-

rangements in most insect orders has led to mitogenomes

being used predominantly as large sources of sequence

data for phylogeneticists (see Nardi et al., 2003; Cameron et

al., 2004). With this large supply of sequence data, mitoge-

nomes are found to be effective at helping establish deep

relationships.

Comparative analysis of mitochondrial genomes has

been applied to the study of animal and fungal species in the

past few years, especially the yeasts in fungi (Cardazzo et

al., 1997; Bullerwell et al., 2003; Langkjaer et al., 2003;

Petersen et al., 2002). Recently an influx of mitogenomes

have provided new, large, and diverse data sets useful in

comparative analysis and deciphering phylogenetic relation-

ships. In 1995 there were only six insect mitogenomes

sequenced; today there are currently 187 hexapod mtgen-

omes available on GenBank, including 19 Orthoptera spe-

cies, with 10 from Caelifera and 9 from Ensifera. Of the 10

Caelifera species, 9 came from Acrididae and only one from

Pyrgomorphidae. To help remedy the lack of data, espe-

cially data of Pyrgomorphidae, for phylogenetic inferences,

and to facilitate comparative mitochondrial genome analy-

ses, we have sequenced mtDNAs from three Caelifera spe-

cies, the Euchorthippus fusigeniculatus, which belongs to

the subfamily Gomphocerinae, family Acrididae, superfamily

Acridoidea, suborder Caelifera, order Orthoptera, and the

Mekongiana xiangchengensis, and Mekongiella xizangensis,

both of which belong to subfamily Pyrgomorphinae, family Pyr-

* Corresponding author. Phone: +86-29-85307819;

Fax : +86-29-85310097;

E-mail: yuanh@snnu.edu.cn

doi:10.2108/zsj.27.662

Comparative Analysis of Mitochondrial Genomes 663

gomorphidae, superfamily

Pyrgomorphoidea, suborder

Caelifera, order Orthoptera.

All three species were

reported in recent years (Jin

and Zhang, 1983; Yin, 1984;

Zheng et al., 2008).

In this article, based on

the 19 sequences plus three

new complete grasshopper

mitochondrial genomes, we

present a comparative analy-

sis of Orthoptera mitoge-

nomes representing 2 subor-

ders (Caelifera and Ensifera),

6 families (Acrididae, Pyrgo-

morphidae, Gryllidae, Gryllo-

talpidae, Rhaphidophoridae,

Tettigoniidae), and 13 sub-

families in an effort to better

understand mitochondrial

genome evolution, structure,

and function, as well as the

similarities and differences between the two suborders.

Finally, we have performed phylogenetic analysis based on

three different datasets using parsimony, maximum likeli-

hood, and Bayesian inference to resolve deep relationships

within the order and to test the monophyly of Gomphocerinae

and Pyrgomorphidae.

MATERIAL AND METHODS

Specimen collection and DNA extraction

The specimen information for Euchorthippus fusigeniculatus,

Mekongiana xiangchengensis and Mekongiella xizangensis is

listed in Table 1. All specimens were preserved in 100% ethanol

and stored at –4°C. The voucher specimens have been deposited

in the College of Life Science, Shaanxi Normal University.

Total DNA was isolated from the leg muscle tissue using a rou-

tine phenol/chloroform method (Zhou et al., 2007). Before using, it

was diluted to 50 ng/μL with double-distilled water, and used as a

template in LA-PCR.

PCR amplification and sequencing

The entire mtDNAs of the three species were amplified using a

MyCyclerTM thermal cycler conducting long PCR on four fragments.

Primer sequence and location for each long PCR is listed in Table

2 (Liu et al., 2006). The cycling protocol consisted of 94°C for 2 min;

30 cycles of 92°C for 10 s, 49°C–52°C for 45 s, 68°C for 8 min in

foremost 15 cycles, and increased 20 s per cycle in aftermost 15

cycles; and a final extention step of 68°C for 7 min. The reaction

mixture contained 0.625 units LA Taq polymerase, 1.5 μL of 10 ×LA-PCR BufferII (Mg2+ free), 0.83 mmol/L dNTPs, 5 mmol/L MgCl2,

1 μmol/L primers, and 150 ng of genomic DNA in a final volume of

15 μL. LA-PCR products were purified with DNA Gel Purification Kit

(U-Gene) after separation by electrophoresis in a 1.0% agarose gel.

With each long PCR product, the full double-stranded

sequence was determined by Sub-PCR (primers were designed

from comparison of 12 hemimetabola sequences available in Gen-

Bank by Dr. Huimeng Lu, and upon request) with the following

cycling conditions: 94°C for 2 min; 30–35 cycles of 94°C for 10 s,

45–58°C for 30 s, and 72°C for 1–2 min; and a final elongation step

of 72°C for 7 min. All Sub-PCR amplifications were performed on

the MyCyclerTM thermal cycler with 0.625 units TaKaRa Taq poly-

merase (TaKaRa, Dalian, China), 10 × PCR Buffer (Mg2+ free),

0.2 mmol/LdNTPs, 2.5 mmol/L MgCl2, 0.8 μmol/L primers, and

50 ng of LA-PCR products in a final volume of 25 μL.

The Sub-PCR fragments were directly sequenced after separa-

tion and purification. Sequence primers used were the same as

those for Sub-PCR. Purified Sub-PCR products were used for direct

cycle sequencing from both strands using the ABI PRISM™ 3100-

Avant Genetic Analyzer. Cycle sequencing conditions were as fol-

lows: 96°C for 1 min, 35 cycles of 96°C for 10 s, 45–56°C for 1 min,

and 60°C for 4 min.

Sequence assembly, annotation and analysis

We used the Staden package (Staden et al., 2000) for

sequence assembly and annotation. PCGs and rRNA genes were

identified by sequence comparison with L. migratoria mitogenome

available in GenBank. The tRNAs were identified by tRNAscan-SE

Search Server v.1.21 (Lowe and Eddy, 1997). The putative tRNAs

that were not found by tRNAscan-SE were identified by sequence

comparison. Protein coding gene sequences were aligned using

ClustalX (Thompson et al., 1997). The aligned data were further

analyzed by MEGA version 3.0 (Kumar et al., 2004).

GenBank acc. Nos. for the three new genomes are listed in

Table 1.

Phylogenetic analyses

Using these new mtgenomes in addition to the previously

published 19 mtgenomes of Orthoptera, we reconstruct a preliminary

phylogeny of Orthoptera with Reticulitermes hageni as outgroup

under the analyses of parsimony (MP), maximum likelihood (ML) and

Bayesian (BA) inference to resolve deep relationships within the order.

MP analyses were conducted using PAUP, and bootstrap sup-

port was calculated from 1000 bootstrap replicates (Swofford,

2002). ML analyses were also carried out in PAUP* 4.0b10 using

GTR + I + G model with parameter values as estimated by ModelTest

(Posada and Crandall, 1998). Models for BA analyses were chosen

using AIC as implemented in ModelTest and all BA analyses were

performed with MrBayes V3.1.1 (Ronquist and Huelsenbeck, 2003).

Specifically, we created three datasets to carry out phyloge-

netic reconstruction: protein-coding genes alone (PCG), protein-

coding genes translated into amino acid sequences (PCG_PROT)

and ribosomal RNA genes alone (RIBO). In this way, we were also

Table 1. Collection and GenBank accession numbers for the taxa used in this study. * M. xiangchengensis

is the new species named by Zhe-min Zheng in 2008.

Family Species Locality Date Collector GenBank acc. No

Acrididae Euchorthippus fusigeniculatus Jin et Zhang

Helongjiang, China

Aug-07 Shu-juan Xu HM583652

Pyrgomorphidae Mekongiana xiangchengensis Zheng*

Sichuang, China

Aug-07 Zhi-jun Zhou HM583653

Pyrgomorphidae Mekongiella xizangensis Yin Tibet, China Jul-08 Zhi-jun Zhou HM583654

Table 2. Primers, sequence, and location of long PCRs.

Region Primer pair Location Sequence (5’→3’)

nd2→nd5 F01 944 GGACTACCACCATTWHTWGG

R21 6455 TTGATYWTGGTTGARKWGA

trnN→cytb F05 6065 AGAGAGGCGTATTACTGTTA

LP04 11240 AAAATWGCRTAWGCAAATARAAAATATCATTC

cytb→trnM LP05 11187 WACACCAGTTCATATTCAACCAGAATGATATT

R31 150 GGGGTATGAACCCAWTAGC

trnI→cox1 F32 19 TAAAGGRTTAYYTTGATAG

R29 2289 TACTGTAAATATATGRTGDGCTC

L. Zhao et al.664

able to study the the effect of different datasets on phylogenetic

reconstruction by comparing topology and nodal support values

within each of three phylogenetic inference methods.

RESULTS AND DISCUSSION

Genome structure and organization

The E. fusigeniculatus mitogenome was 15772 bp long;

the M. xiangchengensis mt genome was 15567 bp and the

M. xizangensis mitogenome was 15885 bp (Table 3). These

genome sizes are well within the observed range for insect

mitogenomes. Within the genome, each of the 37 genes typ-

ically found in most metazoans were discovered: 13 PCGs,

22 tRNA genes, two rRNA genes (lrRNA and srRNA) and

one A+T-rich region. The position and orientation of the

mitochondrial genes were the same as those found in the

putative ancestral insect mitogenome (Boore, 1999) except

tRNALys(K) and tRNAAsp(D), which have swapped to the

derived arrangement tRNAAsp–tRNALys. The position and

orientation of genes within the mitogenome and the ampli-

cons used in long PCR are shown in Fig. 1.

In the three species, we observed an A+T nucleotide

bias of 73.6% to 75.0% (Table 4), apportioned as follows:

72.8% to 74.4% in protein-coding genes, 74.8% to 75.9% in

rRNA genes, and 78.7% to 82.8% in the control region. The

A+T content is within the range of other hexapod sequences,

and similar to that of previously published Caelifera

sequences (Table 4). In addition to the above three species,

the 19 published Orthoptera available from GenBank to date

also show an A+T bias of 65.3% in Gampsocleis gratiosa

(Ensifera) to 76.2% in Acrida willemsei (Caelifera) (Table 4).

Compared to the Ensiferans, Caeliferans have an overall

higher A+T%, which is closer to the mean (mean 75.9% and

SD 0.037 for the 20 selected

species) observed in insect

mtDNA (Stewart and Becken-

bach, 2005). The nucleotide

skew statistics (Perna and

Kocher, 1995) for the whole

genome (measured from the

majority strand) reveal that all

species of Orthopterans in

Table 4, as for most insects,

is A and C skewed with the

highest A-skew of 0.212 in

Gastrimargus marmoratus

(Caelifera) and highest C-

skew of 0.306 in Gryllotalpa

pluvialis (Ensifera). Although

both Caeliferans and Ensifer-

ans show A and C skew, the

former exhibits much higher

level of A-skew than the lat-

ter, whereas the latter shows

much lower C-skew. This

indicates that Caelifera has

more excess of As than

Ensifera, while Ensifera has

much more excess of Cs. In

most insects, A-skew is usu-

ally close to 0. The highest A-

skew recorded for an insect

is for Reticulitermes virginicus

(0.303, Isoptera) (Cameron

and Whiting, 2007), and the

next is for Gastrimargus mar-

moratus (0.212, Orthoptera).

However, the nucleotide

composition shows that

Reticulitermes virginicus has

a much lower A+T% (65.6%).

The correlation between a

strong A-skew and an overall

lower A+T% has also been

found in several other insect

mitogenomes, including Tric-

holepidion (Zygentoma, 0.15

and 68.6%) and Triatoma

Table 3. Annotation of the mitochondrial genomes of Euchorthippus fusigeniculatus (Ef), Mekongiana

xiangchengensis (Mxc) and Mekongiella xizangensis (Mxz). J and N refer to the majority and minority

strand, respectively. Position numbers refer to positions on the majority strand.

Feature Strand Position Initiation codon/Stop codon

Ef Mxc Mxz Ef Mxc Mxz

trnI J 1–67 1–64 1–63

trnQ N 71–136 62–130 61–129

trnM J 140–208 130–200 129–198

nad2 J 209–1231 207–1226 205–1224 ATG/TAA ATC/TAA ATC/TAA

trnW J 1230–1297 1231–1305 1228–1293

trnC N 1290–1352 1298–1365 1286–1351

trnY N 1365–1431 1370–1436 1356–1423

cox1 J 1424–2968 1435–2973 1422–2960 ATC/TAA CTG/TAA CCG/TAA

trnLUUR J 2964–3029 2969–3033 2956–3020

cox2 J 3033–3716 3036–3719 3022–3702 ATG/ TAA ATG/TAA ATG/TAA

trnD J 3715–3779 3718–3781 3701–3766

trnK J 3782–3852 3784–3853 3769–3838

atp8 J 3868–4029 3867–4028 3854–4015 ATC/TAA ATC/TAA ATC/TAA

atp6 J 4023–4700 4022–4699 4009–4686 ATG/TAA ATG/TAA ATG/TAA

cox3 J 4705–5496 4695–5493 4691–5480 ATG/TAG ATT/T ATG/T

trnG J 5499–5565 5493–5559 5481–5544

nad3 J 5566–5919 5559–5912 5545–5898 ATT/TAA ATT/TAA ATT/TAA

trnA J 5920–5985 5912–5980 5900–5967

trnR J 5989–6054 5982–6046 5967–6033

trnN J 6057–6123 6049–6114 6036–6101

trnSAGN J 6124–6190 6115–6180 6102–6168

trnE J 6191–6258 6187–6253 6177–6246

trnF N 6259–6322 6252–6315 6251–6315

nad5 N 6323–8041 6306–8027 6306–8021 ATT/ TAA ATT/TAG ATT/TAG

trnH N 8057–8123 8043–8107 8037–8101

nad4 N 8128–9462 8108–9448 8102–9442 ATG/TAA ATC/TAG ATG/TAG

nad4L N 9456–9749 9436–9729 9430–9723 ATG/TAA ATG/TAA ATG/TAA

trnT J 9751–9818 9732–9800 9726–9789

trnP N 9818–9879 9801–9865 9790–9856

nad6 J 9884–10405 9871–10389 9859–10380 ATG/TAA ATA/TAA ATG/TAA

Cytb J 10414–11550 10393–11529 10384–11523 ATG/TAA ATG/TAA ATG/TAA

trnSUCN J 11562–11631 11529–11598 11523–11593

nad1 N 11653–12594 11601–12548 11616–12536 ATA/TAG ATA/TAG ATA/TAG

trnLCUN N 12598–12663 12552–12618 12540–12605

lrRNA N 12664–13978 12612–13942 12599–13925

trnV N 13978–14048 13935–14005 13918–13987

srRNA N 14048–14897 14007–14834 13989–14822

Control region J 14898–15772 14835–15567 14823–15885

Comparative Analysis of Mitochondrial Genomes 665

(Hemiptera, 0.17 and 69.57%).

However, we have not yet

observed this negative corre-

lation between A-skew and

A+T% in Orthoptera (Table

4).

Protein-coding genes

All PCGs of the E.

fusigeniculatus mitogenome

started with a typical ATN

codon, and the other two

mitogenomes also used the

typical ATN as their PCGs

start codon, with the excep-

tion of COI (Table 3). The

start codon for COI is highly

variable across insects, and

frequently uses noncanonical

start codons, which code for

amino acids other than M

(Cameron and Whiting,

2007). In the COI of M.

xiangchengensis and M.

xizangensis mtDNAs, the

rare but possible initiation

codons CTG and CCG are

found (Table 3), coding for L

and P, respectively. Both

have been reported as an

initiation codon of mtDNA

PCGs in other insects (Kim et

al., 2005). Irregular cox1 start

Fig. 1. Map of the mitochondrial genome of three grasshopper species, linearized between transfer

(t)RNA-Ile and the control region. Gene names are the standard abbreviations used in this paper; tRNA

genes are indicated by the single letter IUPAC-IUB abbreviation for their corresponding amino acid;

genome orientation is 5’→3’ on the majority strand, and genes coded on the minority strand are under-

lined. Long PCR fragments used to amplify the whole genome are shown above the genome map. Prim-

ers used to amplify long PCRs flank a box depicting the region that they amplify; open boxes amplify

regions straddling the arbitrary point at which the genome was linearized, and correspond to the open

box opposite.

Table 4. Mitochondrial genome composition for all available Orthoptera species obtained from GenBank, including the three newly

sequenced species in this study. a, b, c The three species are all from this study.

Suborder Family Subfamily Species Size (bp)Whole genome (majority strand)

AT % A-skew C-skew

Caelifera Acrididae Acridinae Acrida willemsei 15,601 76.22 0.165 0.163

Calliptaminae Calliptamus italicus 15,675 73.22 0.139 0.162

Gomphocerinae Chorthippus chinensis 15,599 75.11 0.141 0.142

Euchorthippus fusigeniculatusa 15,772 75.04 0.137 0.151

Phlaeoba albonema 15,657 74.11 0.15 0.165

Oedipodinae Gastrimargus marmoratus 15,924 75.18 0.212 0.226

Locusta migratoria 15,722 75.33 0.182 0.182

Locusta migratoria migratoria 16,053 75.53 0.186 0.19

Oedaleus decorus asiaticus 16,259 75.39 0.195 0.184

Oxyinae Oxya chinensis 15,443 75.89 0.123 0.132

Pyrgomorphidae Pyrgomorphinae Atractomorpha sinensis 15,558 74.29 0.161 0.175

Mekongiana xiangchengensisb 15,567 74.56 0.146 0.187

Mekongiella xizangensisc 15,885 73.55 0.157 0.212

Ensifera Gryllidae Gryllinae Teleogryllus emma 15,660 73.12 0.108 0.268

Myrmecophilinae Myrmecophilus manni 15,323 70.18 0.068 0.29

Gryllotalpidae Gryllotalpinae Gryllotalpa orientalis 15,521 70.49 0.045 0.301

Gryllotalpa pluvialis 15,525 72.2 0.042 0.306

Rhaphidophoridae Rhaphidophorinae Troglophilus neglectus 15,810 73.37 0.011 0.26

Tettigoniidae Bradyporinae Deracantha onos 15,650 69.24 0.036 0.287

Conocephalinae Ruspolia dubia 14,971 70.86 0.022 0.24

Tettigoniinae Anabrus simplex 15,766 69.44 0.03 0.276

Gampsocleis gratiosa 15,929 65.31 0.062 0.297

Fig. 2. The secondary structure of the tRNA-Ser(AGN) gene for the three Caeliferan species in this

study. It was drawn according to Ruspolia dubia (Zhou et al., 2007), Gampsocleis gratiosa (Zhou et al.,

2008), and the consensus secondary structure for the tRNA-Ser(AGN) gene (Sheffield et al., 2008).

L. Zhao et al.666

codons are also found in other Orthoptera species, such as

Atractomorpha sinensis (CCG), Anabrus simplex (CCG),

Locusta migratoria migratoria (CCG), Locusta migratoria

(ATTA), Ruspolia dubia (TTA), Teleogryllus emma (TTA).

Similarly, conventional termination codons could be

assigned to all putative protein sequences of the E.

fusigeniculatus mitogenome, 11 using TAA and 2 using

TAG. M. xiangchengensis and M. xizangensis both have

the same stop codons for each of their 13 protein-coding

genes, including 9 TAA, 3 TAG and 1 incomplete stop codon

T (Table 3). Each of the 4 genes in which the 3’ end abuts

another protein-coding gene (atp8, atp6, nad4L, and nad6)

has complete TAA stop codons. Eight of the 9 genes abut-

ting tRNA genes have a complete stop codon (5 TAA and 3

TAG). Only cox3 had a partial stop codon T abutting a tRNA

gene. It has been hypothesized that the tRNA genes serve

as sites for endonucleases of the immature polycistronic

messenger (m)RNA transcript (Ojala et al., 1980), and the

partial stop codons are polyadenylated to yield full TAA stop

codons in the mature mRNA, as observed in other animal

phyla (Anderson et al., 1981; Bibb et al., 1981; Ojala et al.,

1981; Okimoto et al., 1990; Lavrov et al., 2002). Incomplete

stop codons are a commonly noted feature of insect mitog-

enomes (Carapelli et al., 2006; Kim et al., 2006; Cha et al.,

2007; Zhou et al., 2008), ranging from 2 of 9 genes in

Gomphiocephalus hodgsoni (Collembola: Nardi et al., 2003)

and Ruspolia dubia (Orthoptera: Zhou et al., 2007) to 8 of

9 genes in Gryllotalpa pluvialis (Orthoptera: Cameron,

unpublished data) and Gryllotalpa orientalis (Orthoptera:

Kim et al., 2005). The three mitogenomes sequenced in this

study display the lowest level of incomplete stop-codon

usage by any insects to date. It is unknown what function, if

any, incomplete stop codons serve, although it is possible

that they are simply a product of the selective pressure to

reduce genome size noted in mitochondria (the race-for-

replication hypothesis, Rand, 1993, 2001). The low number

of partial stop codons may suggest that the three new mito-

genomes are under relaxed selective pressure to reduce

their size (Rand, 2001).

The A+T content of 13 PCGs

was 74.4% in the E. fusigeniculatus;

74.0% in M. xiangchengensis and

72.8% in M. xizangensis. Analysis of

base composition at each codon

position of the concatenated 13

protein-coding genes showed that

the third codon position (89.6% in E.

fusigeniculatus, 84.4% in M.

xiangchengensis and 83.5% in M.

xizangensis) was higher in A+T

content than the first (68.2% in E.

fusigeniculatus, 70.5% in M.

xiangchengensis and 69.3% in M.

xizangensis) and second (65.7% in

E. fusigeniculatus, 67.0% in M.

xiangchengensis and 65.7% in M.

xizangensis) codon positions as

shown in other Orthoptera insects

(data not shown).

In the three Caeliferan species’

mitochondrial proteins, leucine

(13.76% to 14.08%), isoleucine (10.20% to 10.65%), serine

(10.06% to 10.63%), and phenylalanine (9.15% to 9.65%)

are the most frequent amino acids. The total content of

these four amino acids is 43.6% in E. fusigeniculatus, 44.6%

in M. xiangchengensis and 44.4% in M. xizangensis. These

amino acids are most frequently utilized in other insects.

Transfer RNA and ribosomal RNA genes

Each of the three Caeliferan species sequenced in this

study has the standard complement of 22 tRNA genes

(Table 3), one for each amino acid and one additional iso-

type each for L and S, found in most animal mitogenomes.

The three Caeliferan species showed minor differences in

tRNA gene order from those reported for Ensifera species,

which contain a tRNA rearrangement from tRNALys(K)–

tRNAAsp(D), swapping to tRNAAsp(D)–tRNALys(K), which

confirmed that this rearrangement is a notable feature of this

suborder. Each tRNA has the typical cloverleaf secondary

structure found in most mitochondrial tRNA genes, except

for tRNA-Ser(AGN), which lacks a DHU arm (Fig. 2). The

tRNA-Ser(AGN) could not form a stable stem loop structure in

the DHU arm as shown in many other insects (e.g., Kim et

al., 2005, Cameron and Whiting, 2007, Wolstenholme,

1992) and many bilaterian animals (e.g., Kim et al., 2005,

2006). Garey and Wolstenholme (1989) proposed that the

missing D-stem in tRNA-Ser(AGN) evolved very early in the

evolution of Metazoa. Despite lacking this stem, however,

this tRNA is normally considered to be functional (Steinberg

and Cedergren, 1994; Stewart and Beckenbach, 2003). In

an in vitro study, Hanada et al. (2001) found that bovine

Fig. 3. Alignment of the polythymidine stretch (Zhang et al, 1995)

in the A+T-rich region of Schistocerca gregaria and Euchorthippus

fusigeniculatus. The poly (T) stretch runs from 15713 to 15751 (35

bp) in the E. fusigeniculatus mitogenome (5’→3’). Asterisks indicate

consensus in the alignment.

Fig. 4. Conserved sequence blocks in the control regions of E. fusigeniculatus and S. gregaria.

The seven blocks, A, B, C, D, El, E2, and F are indicated; within each block, nucleotides identical

in the two sequences are bottom-marked with asterisks. S.g., S. gregaria; E.f., E. fusigeniculatus.

Comparative Analysis of Mitochondrial Genomes 667

tRNA-Ser(AGN) (which lacks the D-stem) is functional,

although somewhat less effective than other cloverleaf-

shaped tRNAs. All anticodons of tRNAs were identical to

Drosophila yakuba (Clary and Wolstenholme, 1985) and L.

migratoria (Flook et al., 1995).

Unmatched base pairs occur in most of the tRNAs (33 in

E. fusigeniculatus, 38 in M. xiangchengensis and 45 in M.

xizangensis), and overwhelming majority of them are G-U

pairs, which form a weak bond. The number of mismatches

in the three species

tRNAs is somewhat

higher compared with

other Orthoptera

insects available; 24 in

L. migratoria (Flook et

al., 1995), 34 in

Gryllotalpa orientalis

(Kim et al., 2005), 21

in Anabrus simplex

(Fenn et al., 2007), 37

in Ruspolia dubia

(Zhou et al., 2007), 24

in Deracantha onos

(Zhou et al., 2009), 29

in Oxya chinensis

(Zhang and Huang,

2007), 27 in Gampso-

cleis gratiosa (Zhou et

al., 2008).

As in all other

sequenced mitoge-

nomes, two rRNA

genes were present in

all three species.

These were located

between tRNALeu

(CUN) and tRNAVal,

and between tRNAVal

and the A+T-rich

region, respectively

(Table 3). The lengths

of lrRNA and srRNA

were respectively

determined to be 1315

bp and 850 bp in E.

fusigeniculatus, 1327

bp and 834 bp in M.

xizangensis and 1331

bp and 828 bp in M.

xiangchengensis. The

length of the lrRNAs

was slightly longer (in

the size range from

1142 bp in Thrips

imaginis to 1378 bp in

Bombyx mori), and

that of the srRNAs

was also longer than

other insects. In the

22 available ortho-

pteran mitogenomes,

the size of lrRNA and srRNA ranges from 1236 (Ensifera:

Gryllotalpa pluvialis) to 1342 (Ensifera: Troglophilus

neglectus), and 718 (Caelifera: Acrida willemsei) to 882

(Ensifera: Ruspolia dubia), respectively. The A+T content of

the lrRNA gene was 77.7% in E. fusigeniculatus, 75.8% in

M. xizangensis and 77.3% in M. xiangchengensis. That of

the srRNA gene was 73.2% in E. fusigeniculatus, 73.3% in

M. xizangensis and 73.8% in M. xiangchengensis. These

values are lower than those of L. migratoria, but higher than

Fig. 5. Possible conserved secondary structures in the mitochondrial control regions of (A) E. fusigeniculatus,

(B) M. xizangensis and (C) M. xiangchengensis, and other 5 Caeliferan species. In A, B, and C, arrows indicate

the differences of the stem regions among the three species. In (E), arrows indicate the differences between

Acrida willemsei and Locusta migratoria.

L. Zhao et al.668

Comparative Analysis of Mitochondrial Genomes 669

those of Gryllotalpa orientalis.

A+T-rich region

The A+T-rich region in the three species is located in the

conserved position between srRNA and trnI. The length and

the A+T content of this region was 875 bp and 81.5% in E.

fusigeniculatus, 1063 bp and 78.7% in M. xizangensis, and

733 bp and 82.8% in M. xiangchengensis, respectively.

The size and the A+T content of the control region in all

22 Orthopteran mitogenomes available at the time of this

study range from 70 (Ensifera: Ruspolia dubia) to 1401

(Caelifera: Oedaleus decorus asiaticus), and 66.8%

(Ensifera: Troglophilus neglectus) to 87.3% (Caelifera: Acrida

willemsei). In earlier published literature, the control regions

of Schistocerca gregaria and Chorthippus parallelus are

752 bp and 1512 bp, respectively, with the presence of a

tandem repeat (CpR1 and CpR2) in C. parallelus. The A+T

content is 86.8% in S. gregaria and 85.1% in C. parallelus

(Zhang et al., 1995).

The control regions, including those of grasshoppers,

mosquitoes and possibly butterflies cannot be divided into

distinct conserved or variable domains, while tandem

repetition and conserved structural elements have been

observed (Zhang and Hewitt, 1997). In this study, E.

fusigeniculatus A+T-rich region contains a polythymidine

stretch that is highly conserved in Orthoptera and Diptera

(Fig. 3), which may be involved in transcriptional control or

may be the site for initiation of replication (Clary and

Wolstenholme, 1987; Lewis et al., 1994; Zhang et al., 1995;

Cha et al., 2007). Seven conserved sequence blocks have

been identified between E. fusigeniculatus and Schistocerca

gregaria: blocks A, B, C, D, El, E2, and F (Fig. 4). These

conserved blocks are spread through the whole A+T-rich

region and show high sequence similarity with blocks El and

F identical. In fact, block E1 is a part inverse repeat of block

E2; the sequences containing these two blocks can form a

stem and loop (or hairpin) secondary structure (Zhang et al.,

1995). The putative stem-loop secondary structure of E.

fusigeniculatus is shown in Fig. 5A. The stem of this highly

conserved secondary structure is formed by 16 nucleotide

pairs with only one mismatch, and the terminal loop is 16 nt.

In M. xizangensis and M. xiangchengensis, the correspond-

ing stems are formed by 17 nucleotide pairs and 16

nucleotide pairs respectively with only one mismatch in M.

xizangensis and two mismatches in M. xiangchengensis,

the terminal loops are 13 nt and 8 nt, respectively (Fig. 5B

and C). We also draw the following conclusions by compar-

ison of stem-loop secondary structure of all 15 Caeliferan

species available to date: (i) the stems of all 15 Caeliferan

species are composed of 16–17 nucleotide pairs (16 pairs

in 5 species and 17 pairs in 10 species) and the first 13

nucleotide pairs in the stem are almost identical in

sequence, while the remaining pairs are different. In 3

Pyrgomorphidae species (Atractomorpha sinensis, M.

xiangchengensis, and M. xizangensis), the remaining pairs

close to the loop are all A-T pairs, while in 12 Acrididae spe-

cies, there are 3 pairs in 3 species with 1 A-T pair and 2 C-

G pairs and 4 pairs in 9 species with 1 C-G pair and 3 A-T

pairs. In contrast to the conservation in the stems, the

sequences of the terminal loop are highly divergent (8–16 nt),

indicating that the loop region sequence in the conserved

secondary structure has less functional importance. In addi-

tion, it is noteworthy that the 5’ flanking sequences (“TATA”)

are identical in all Caeliferan species and more conserved

than the 3’ flanking sequences; (ii) Gastrimargus marmoratus,

Locusta migratoria, Locusta migratoria migratoria, and

Oedaleus decorus asiaticus are all in the subfamily Oedipo-

dinae and their stem-loop secondary structures plus flanking

sequences are completely identical. The stem is formed by

a perfect match of 17 nucleotide pairs, including the 4 pairs

next to the loop with 1 C-G pair and 3 A-T pairs, and the

terminal loop is 11 nt (5’ ATT ATT AGT GA 3’). Flanking

sequences are highly conserved with a 5’ consensus of

TATA and 3’ consensus of TAA AGA AAG AT (Fig. 5D).

Molecular phylogeny of Orthoptera also showed that the four

species consistently formed a monophyletic group with high

support (Fig. 6); (iii) Chorthippus chinensis, C. parallelus

and E. fusigeniculatus are in the subfamily Gomphocerinae

and they almost have the same stem-loop secondary struc-

tures. It can be observed that in these three species, all 16

nucleotide pairs, including the 3 pairs close to the loop (1 A-

T pair and 2 C-G pairs), with only one mismatch in the stem

are identical in sequence, and that the sequences of the ter-

minal loop also show high similarity. The stem-and-loop

structure in Phlaeoba albonema appears to be more closely

related to that found in Oedipodinae despite belonging to

Gomphocerinae (See Fig. 5F). Phylogenetic analyses based

on three different datasets showed Gomphocerinae was never

recovered, as monophyly with Phlaeoba albonema always

clustered into one clade with (Oxyinae + Calliptaminae) (Fig.

6); (iiii) Acrida willemsei is in the subfamily Acridinae and S.

gregaria in Cyrtacanthacridinae. Both secondary structures

show minor differences from Oedipodinae in the loop and

the 3’ flanking sequences (See Fig. 5E and Zhang et al.,

1995); (iiiii) Oxya chinensis and Calliptamus italicus are in

the subfamily Oxyinae and Calliptaminae, respectively. The

17 nucleotide pairs in both stems are identical (only one

mismatch in Calliptamus italicus) in sequence. Both loops

share polyadenine sequences close to 3’ end (See Fig. 5G

and H). All phylogenetic analyses indicated that Oxyinae

and Calliptaminae have close relationship (Fig. 6). Despite

of some differences, the conserved secondary structures in

these Caeliferan species are very similar. This can be seen

not only from the conformation of the stem and loop struc-

tures itself, but also from several other features such as the

similarities of sequences flanking them and their relative

locations in the control regions. This suggests that such a

secondary structure in the mitochondrial control regions may

be widely conserved in all Caeliferan species. In the 9

Ensifera species from GenBank, Putative stem-loop struc-

Fig. 6. Phylogenetic reconstruction of Orthoptera using different mtgenome datasets. (A) Parsimony results, (B) Maximumlikelihood results

and (C) Bayesian results based on the PCG dataset. (D) Parsimony results and (E) Bayesian results based on the PCG_PROT dataset. (F)

Parsimony results, (G) Maximum likelihood results and (H) Bayesian results based on the RIBO dataset. Numbers near nodes represent boot-

strap support (1,000 for MP and 100 for ML) and Bayesian posterior probability.

L. Zhao et al.670

tures have been identified in A+T-rich region of the Gamp-

socleis gratiosa (Zhou et al., 2008) and Ruspolia dubia

(Zhou et al., 2007). In earlier days, the stem-loop structures

of one cricket have been reported (Zhang et al., 1995). All

these secondary structures are completely different from

that of Caeliferan species not only in the conformation

(except the cricket) but also in the flanking sequences.

Phylogenetic analyses

All analyses based on the three datasets resulted in an

overall similar topology. When protein-coding genes (PCG)

are analyzed, a congruent topology is recovered (Fig. 6A–

C). The analyses based on PCG_PROT produced an iden-

tical topology to the PCG analyses, with the sole exception

of Teleogryllus emma moving closer to Myrmecophilus

manni (Fig. 6D and E). The analyses based on ribosomal

RNAs (RIBO) performed poorly compared to the other two

datasets, resulting in unique and incongruent Caelifera

topologies from each of the different inference methods.

Only the MP_RIBO analysis produced separate Pyrgomor-

phidae clade and Acrididae clade, which was completely

consistent with the PCG and PCG_PROT topology. All

RIBO analyses (MP_ RIBO, ML_ RIBO, BA_ RIBO) resulted

in a congruent Ensifera topology and recovered monophyl-

etic Grylloidea congruent with PCG_PROT topology (Fig.

6F–H).

Phylogenies derived using parsimony, maximum likeli-

hood, and Bayesian analyses were generally congruent.

The monophyly of the two suborders, Caelifera and

Ensifera, was consistently recovered in all analyses based

on the three datasets. Within Ensifera, Tettigonioidea was

always recovered as monophyletic, but Grylloidea formed a

monophyletic group only in PCG_PROT (Fig. 6D and E) and

RIBO analyses (Fig. 6F–H). In Tettigonioidea, we found

Rhaphidophoridae to be sister to monophyletic Tettigoniidae

(Conocephalinae+ (Bradyporinae + Tettigoniinae)) and that

this clade was sister to Grylloidea (Gryllotalpidae + Gryllidae)

in both PCG_PROT and RIBO analyses. In Grylloidea, two

families and three subfamilies were included, and the rela-

tionships among the three subfamilies were different in the

different datasets analyses. Myrmecophilinae was found

sister to Gryllinae, and this clade was sister to Gryllotalpinae

in RIBO analyses (Fig. 6F–H). However, both PCG_PROT

analyses and PCG analyses showed Gryllotalpinae was

more closely related to Myrmecophilinae than to Gryllinae.

Within Caelifera, the monophyly of the Pyrgomorphidae was

recovered in all analyses and Pyrgomorphidae was always

found the most basal group in Caelifera. In addition, the

relationships among the five subfamilies of Acrididae were

(Oedipodinae + (Acridinae + (Gomphocerinae + (Oxyinae +

Calliptaminae).))) were supported by most phylogenetic

analyses except for ML_RIBO (Fig. 6G) and BA_RIBO (Fig.

6H). Furthermore, the monophyly of Oedipodinae and its rel-

atively primitive position were highly supported by all analy-

ses. However, the monophyly of Gomphocerinae was never

recovered.

The three datasets, regardless of the phylogenetic anal-

yses used, all recovered the two monophyletic suborders,

Caelifera and Ensifera under the sampling used. This finding

corroborates with the generally accepted classification

schemes as well as molecular studies (Flook et al., 1999;

Jost and Shaw, 2006; Fenn et al., 2008; Ma et al., 2009).

Within Ensifera, Rhaphidophoridae was found sister to

Tettigoniidae and this clade was sister to Grylloidea

(Gryllotalpidae + Gryllidae) in PCG_PROT analyses and

RIBO analyses. The relationships within Ensifera are consis-

tent with traditional classification and recent studies

(Gwynne, 1995; Flook et al., 1999; Desutter-Grandcolas,

2003; Fenn et al., 2008; Ma et al., 2009), but the molecular

study by Jost and Shaw (2006) showed that Grylloidea was

more closely related to Rhaphidophoridae than to

Tettigoniidae. Furthermore, our study showed the relation-

ships among the three subfamilies of Tettigoniidae were

(Conocephalinae + (Bradyporinae + Tettigoniinae)).

Storozhenko (1997) and Gwynne and Morris (2002) also sug-

gested a sister relationship between Bradyporinae and Tet-

tigoniinae. In Grylloidea, three subfamilies are represented

and the majority of analyses indicated that Gryllotalpinae is

more closely related to Myrmecophilinae than to Gryllinae,

concordant with the study of Zhou et al. (unpublished data).

In his study, Grylloidea was never recovered as monophyl-

etic group, in line with our PCG analyses.

Within Caelifera, five acridid subfamilies and Pyrgomor-

phidae were included; Pyrgomorphidae occupies the most

basal position in the majority of analyses. Other work based

on more comprehensive taxa samples also identify the

Pyrgomorphidae as a monophyletic lineage basal to the

acridoids (Flook and Rowell, 1997; Flook et al., 1999; Flook

et al., 2000). The Acrididae branches of all the trees

obtained in our study contain the five subfamilies and the

phylogenetic relationships between them are (Oedipodinae

+ (Acridinae + (Gomphocerinae + (Oxyinae + Calliptaminae))),

congruent with the recent study by Ma et al. (2009) and

Zhou et al. (unpublished data). Noticeably, the Oedipodinae

are invariably separated from other clades and resolved as

a monophyletic group with uniformly high bootstrap values,

in accordance with their rather basal and isolated position

within the Acrididae, already noted in other analyses of the

mitochondrial sequences (Flook and Rowell, 1997; Flook et

al., 1999; Liu et al., 2008). However, no support for

Gomphocerinae monophyly was obtained from the present

analyses.

In this study, we also assessed how each dataset

influenced the phylogenetic reconstruction under the analyt-

ical regimens of parsimony, maximum likelihood, and

Bayesian inference. When PCG dataset and PCG_PROT

dataset were analyzed respectively, there was no effect on

topology between the parsimony and model-based analyses

and the topology of PCG_PROT analyses was the same as

that of PCG analyses, except for the placement of

Teleogryllus emma. These findings indicate that the signals

within the PCG_PROT dataset are the same stength as

those of the PCG dataset. Therefore, analysis using amino

acid sequences is suitable in the context of our taxon sam-

pling, although both Cameron et al. (2006) and Fenn et al.

(2008) found that recoding of the protein-coding genes into

amino acid sequences could introduce artificial resolution.

However, when ribosomal RNAs are analyzed under the dif-

ferent inference methods, different topologies were recov-

ered, especially highlighted in the caeliferan clade, in which

the placement of monophyletic Pyrgomorphidae is unstable

and different relationships among five acridid subfamilies

Comparative Analysis of Mitochondrial Genomes 671

were recovered according to different methods. Here, we

regard the analyses using PCG dataset and PCG_PROT

dataset as our best estimate.

CONCLUSION

Our study represents the first comprehensive compara-

tive analysis of Orthoptera mitogenomes. Based on the

comparison, especially the stem-loop secondary structure in

A+T-rich region, we obtain new findings that shed more light

on A+T-rich regions. Furthermore, the phylogenetic relation-

ships of the Orthoptera taxa available to date are recon-

structed and analyzed using different inference methods.

Our analysis supports a number of phylogenetic relation-

ships, including: (i) the monophyly of the two suborders,

Caelifera and Ensifer; (ii) sister relationships between

Rhaphidophoridae and Tettigoniidae, and between

Tettigonioidea and Grylloidea; (iii) a closer relationship

between Gryllotalpinae and Myrmecophilinae; (iiii) the

monophyly of the Pyrgomorphidae and its basal placement

in Caelifera; and (iiiii) the phylogenetic relationships of the

five acridid subfamilies as (Oedipodinae + (Acridinae +

(Gomphocerinae + (Oxyinae + Calliptaminae)))), with

Oedipodinae resolved as monophyletic group at the most

basal position within the Acrididae. Our findings also sug-

gest that analysis of protein-coding genes (PCG) and amino

acid sequences (PCG_PROT) enables solid phylogenetic

inferences.

ACKNOWLEDGMENTS

Shu-juan Xu, and Zhi-jun Zhou kindly provided specimens. This

research was supported by grants from the National Natural Sci-

ence Foundation of China (No.30670279).

REFERENCES

Anderson S, Bankier AT, Barrell BG, de Bruijin MHL, Coulson AR, et

al. (1981) Sequence and organization of the human mitochon-

drial genome. Nature (London) 290: 457−465

Bibb MJ, VanEtten RA, Wright CT, Walberg MW, Clayton DA (1981)

Sequence and gene organization of mouse mitochondrial DNA.

Cell 26: 167−180

Boore JL (1999) Animal mitogenomes. Nucleic Acids Res 27:

1767−1780

Boore JL (2006) The use of genome-level characters for phyloge-

netic reconstruction. Trends Ecol Evol 21: 439–446

Bullerwell CE, Leigh J, Forget L, Lang BF (2003) A comparison of

three fission yeast mitochondrial genomes. Nucleic Acids Res

31: 759–768

Cameron SL, Whiting MF (2007) Mitochondrial genomic comparisons

of the subterranean termites from the Genus Reticulitermes

(Insecta: Isoptera: Rhinotermitidae). Genome 50: 188−202

Cameron SL, Miller KB, D’Haese CA, Whiting MF, Barker SC (2004)

Mitochondrial genome data alone are not enough to unambigu-

ously resolve the relationships of Entognatha, Insecta and

Crustacea sensu lato (Arthropoda). Cladistics 20: 534–557

Cameron SL, Barker SC, Whiting MF (2006) Mitochondrial genom-

ics and the new insect order Mantophasmatodea. Mol Phylo-

genet Evol 38: 274–279

Carapelli A, Vannini L, Nardi F, Boore JL, Beani L, Dallai R, Frait F

(2006) The mitochondrial genome of the entomophagous

endoparasite Xenos vesparum (Insecta: Strepsiptera). Gene

376: 248−259

Cardazzo B, Rinaldi T, Frontali L, Carignani G, Palleschi C (1997)

Evolution of Mitochondrial Genomes in Yeast: A Study of

Mitochondrial Divergence in Two Closely Related Species,

Saccharomyces douglasii and Saccharomyces cerevisiae. Mol

Biol Evol 14: 200−203

Cha SY, Yoon HJ, Lee EM, Yoon MH, Hwang JS, Jin BR, Han YS,

Kim I (2007) The complete nucleotide sequence and gene

organization of the mitochondrial genome of the bumblebee,

Bombus ignitus (Hymenoptera: Apidae). Gene 392: 206−220

Clary DO, Wolstenholme DR (1985) The mitochondrial DNA mole-

cule of Drosophila yakuba: nucleotide sequence, gene organi-

zation, and genetic code. J Mol Evol 22: 252– 271

Clary DO, Wolstenholme DR (1987) Drosophila mitochondrial DNA:

conserved sequences in the A+T-rich region and supporting

evidence for a secondary structure model of the small ribo-

somal RNA. J Mol Evol 25: 116–125

Desutter-Grandcolas L (2003) Phylogeny and the evolution of

acoustic communication in extant Ensifera (Insecta,

Orthoptera). Zool Scripta 32: 525–561

Dowton M, Castro LR, Austin AD (2002) Mitochondrial gene rear-

rangements as phylogenetic characters in the invertebrates: the

examination of genome ‘morphology’. Invertebr Syst 16: 345–

356

Fenn JD, Cameron SL, Whiting MF (2007) The complete mitochon-

drial genome sequence of the Mormon cricket (Anabrus

simplex: Tettigoniidae: Orthoptera) and an analysis of control

region variability. Insect Mol Biol 16: 239–252

Fenn JD, Song H, Cameron SL, Whiting MF (2008) A preliminary

mitochondrial genome phylogeny of Orthoptera (Insecta) and

approaches to maximizing phylogenetic signal found within

mitochondrial genome data. Mol Phylogenet Evol 49: 59−68

Flook PK, Rowell CHF (1997) The phylogeny of the Caelifera (Insecta,

Orthoptera) as deduced from mtrRNA gene sequences. Mol Phy-

logenet Evol 8: 89–103

Flook PK, Rowell CHF, Gellissen G (1995) The sequence, organiza-

tion, and evolution of the Locusta migratoria mitochondrial

genome. J Mol Evol 41: 928–941

Flook PK, Klee S, Rowell CHF (1999) Combined molecular phyloge-

netic analysis of the Orthoptera (Arthropoda, Insecta) and

implications for their higher systematics. Systematic Biol 48:

233–253

Flook PK, Klee S, Rowell CHF (2000) Molecular phylogenetic analy-

sis of the Pneumoroidea (Orthoptera, Caelifera): molecular data

resolve morphological character conflicts in the basal Acrido-

morpha. Mol Phylogenet Evol 15: 345–354

Garey JR, Wolstenholme DR (1989) Platyhelminth mitochondrial

DNA: evidence for early evolutionary origin of a tRNAserAGN

that contains a dihydrouridine arm replacement loop, and of

serine-specifying AGA and AGG codons. J Mol Evol 28: 374–

387

Gwynne DT (1995) Phylogeny of the Ensifera (Orthoptera): a

hypothesis supporting multiple origins of acoustical signalling,

complex spermatophores and maternal care in crickets, katy-

dids, and weta. J Orth Res 4: 203–218

Gwynne DT, Morris GK (2002) Tettigoniidae. katydids, long-horned

grasshoppers and bushcrickets. Version 26 November 2002.

http://tolweb.org/Tettigoniidae/13298/2002. 11.26 in the tree of

life web project, http:// tolweb.org/.

Hanada T, Suzuki T, Yokogawa T, Takemoto-Hori C, Sprinzl M,

Watanabe K (2001) Translation ability of mitochondrial tRNAs-

Ser with unusual secondary structures in an in vitro translation

system of bovine mitochondria. Genes Cells 6: 1019–1030

Jin XB, Zhang FL (1983) A new species of genus Euchorthippus

Tarb. from China (Orthoptera: Acridoidea). Zoological Research

4: 377–380 (in Chinese)

Jost MC, Shaw KL (2006) Phylogeny of Ensifera (Hexapoda:

Orthoptera) using three ribosomal loci, with implications for the

evolution of acoustic communication. Mol Phylogenet Evol 38:

510–530

Kim I, Cha SY, Yoon MH, Hwang JS, Lee SM, Sohn HD, Jin BR

L. Zhao et al.672

(2005) The complete nucleotide sequence and gene organiza-

tion of the mitochondrial genome of the oriental mole cricket,

Gryllotalpa orientalis (Orthoptera: Gryllotalpidae). Gene 353:

155–168

Kim I, Lee EM, Seol KY, Yun EY, Lee YB, Hwang JS, Jin BR (2006)

The mitochondrial genome of the Korean hairstreak, Coreana

raphaelis (Lepidoptera: Lycaenidae). Insect Mol Biol 15:

217−225

Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for

Molecular Evolutionary Genetics Analysis and sequence align-

ment. Brief Bioinform 5: 150−163

Langkjaer RB, Casaregola S, Ussery DW, Gaillardin C, Piskur J

(2003) Sequence analysis of three mitochondrial DNA mole-

cules reveals interesting differences among Saccharomyces

yeasts. Nucleic Acids Res 31: 3081−3091

Lavrov DV, Boore JL, Brown WM (2002) Complete mtDNA

sequences of two millipedes suggest a new model for mito-

chondrial gene rearrangements: duplication and nonrandom

loss. Mol Biol Evol 19: 163−169

Lewis DL, Farr CL, Farquhar AL, Kaguni LS (1994) Sequence, orga-

nization, and evolution of the A+T region of Drosophila

melanogaster mitochondrial DNA. Mol Biol Evol 11: 523–538

Liu DF, Dong ZM, Zhang DY, Gu YZ, Guo PJ, Hua HR, Jiang GF

(2008) Molecular Phylogeny of the Higher Category of Acrididae

(Orthoptera: Acridoidea). Zoological Research 29: 585−591

Liu N, Hu J, Huang Y (2006) Amplification of grasshoppers complete

mitochondrial genomes using long PCR. Chin J Zool 41: 61−65

Lowe TM, Eddy SR (1997) tRNAscan-SE: A program for improved

detection of transfer RNA genes in genomic sequence. Nucleic

Acids Res 25: 955−964

Ma C, Liu C, Yang P, Kang L (2009) The complete mitochondrial

genomes of two band-winged grasshoppers, Gastrimargus

marmoratus and Oedaleus asiaticus. BMC Genomics 10: 156

Nardi F, Spinsanti G, Boore JL, Carapelli A, Dallai R, Frati F (2003)

Hexapod origins: monophyletic or paraphyletic? Science 301:

1482e

Ojala D, Merkel C, Gelfand R, Attardi G (1980) The tRNA genes

punctuate the reading of genetic information in human mito-

chondrial DNA. Cell 22: 393−403

Ojala D, Montoya J, Attardi G (1981) tRNA punctuation model of

RNA processing in human mitochondria. Nature 290: 470−474

Okimoto R, Macfarlane JL, Wolstenholme DR (1990) Evidence for

the frequent use of TTG as the translation initiation codon of

mitochondrial protein genes in the nematodes, Ascaris suum

and Caenorhabditis elegans. Nucleic Acids Res 18: 6113−6118

Perna NT, Kocher TD (1995) Patterns of nucleotide composition at

fourfold degenerate sites of animal mitochondrial genomes. J

Mol Evol 41: 353−359

Petersen RF, Langkjær RB, Hvidtfeldt J, Gartner J, Palmen W,

Ussery DW, Piskur J (2002) Inheritance and organisation of the

mitochondrial genome differ between two Saccharomyces

yeasts. J Mol Biol 318: 627–636

Posada D, Crandall KA (1998) Modeltest: testing the model of DNA

substitution. Bioinformatics 14: 817–818

Rand DM (1993) Endotherms, ectotherms, and mitochondrial

genome-size variation. J Mol Evol 37: 281−295

Rand DM (2001) The units of selection on mitochondrial DNA. Ann

Rev Ecol Syst 32: 415−448

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phyloge-

netic inference under mixed models. Bioinformatics 19: 1572–

1574

Sheffield NC, Song H, Cameron SL, Whiting MF (2008) A

comparative analysis of mitochondrial genomes in Coleoptera

(Arthropoda: Insecta) and genome descriptions of six new bee-

tles. Mol Biol Evol 25: 2499–2509

Staden R, Beal KF, Bonfield JK (2000) The Staden package, 1998.

Methods Mol Biol 132: 115−130

Steinberg S, Cedergren R (1994) Structural compensation in atypi-

cal mitochondrial tRNAs. Nat Struct Biol 1: 507–510

Stewart JB, Beckenbach AT (2003) Phylogenetic and genomic anal-

ysis of the complete mitochondrial DNA sequence of the

spotted asparagus beetle Crioceris duodecimpunctata. Mol

Phylogenet Evol 26: 513–526

Stewart JB, Beckenbach AT (2005) Insect mitochondrial genomics:

the complete mitochondrial genome sequence of the meadow

spittlebug Philaenus spumarius (Hemiptera: Auchenorrhyncha:

Cercopoidae). Genome 48: 46–54

Storozhenko SY (1997) Fossil history and phylogeny of orthopteroid

insects. In “The Bionomics of Grasshoppers, Katydids and Their

Kin” Ed by SK Gangwere, MC Muralirangan, M Muralirangan,

CAB International, Oxon, New York, pp 59–82

Swofford DL (2002) PAUP*. Phylogenetic analysis using parsimony (*

and other methods). Version 4. Sinauer Associates, Sunderland,

MA, USA

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG

(1997) The CLUSTAL_X window interface: Flexible strategies

for multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Res 25: 4876−4882

Wolstenholme DR (1992) Animal mitochondrial DNA: structure and

evolution. Int Rev Cytol 141: 173– 216

Yin XC (1984) Grasshoppers and locusts from Qinghai-Xizang Pla-

teau of China. Science Press, Beijing

Zhang C, Huang Y (2007) Complete mitochondrial genome of Oxya

chinensis (Orthoptera: Aridoidea). Acta Biochimica et Biophysica

Sinica 40: 7–18

Zhang DX, Hewitt FM (1997) Insect mitochondrial control region: a

review of its structure, evolution and usefulness in evolutionary

studies. Biochem Syst Ecol 25: 99–120

Zhang DX, Szymura JM, Hewitt GM (1995) Evolution and structural

conservation of the control region of insect mitochondrial DNA.

J Mol Evol 40: 382–391

Zheng ZM, Huang Y, Zhou ZJ (2008) New genus and new species

of grasshoppers from Henduanshan region, China (Orthoptera:

Acridoidea). Acta Zootaxonomica Sinica 33: 363–367

Zhou ZJ, Huang Y, Shi FM (2007) The mitochondrial genome of

Ruspolia dubia (Orthoptera: Conocephalidae) contains a short

A+T-rich region of 70bp in length. Genome 50: 855−866

Zhou ZJ, Shi FM, Huang Y (2008) The complete mitogenome of the

Chinese bush cricket, Gampsocleis gratiosa (Orthoptera:

Tettigonioidea). J Genet Genomics 35: 341−348

Zhou ZJ, Huang Y, Shi FM, Ye HY (2009) The complete mitochon-

drial genome of Deracantha onos (Orthoptera: Bradyporidae).

Mol Biol Rep 36: 7–12

(Received November 10, 2009 / Accepted March 16, 2010)