7. MOLECULAR IDENTIFICATION OF ALTERNARIA ALTERNATA BASED...
-
Upload
nguyenquynh -
Category
Documents
-
view
217 -
download
0
Transcript of 7. MOLECULAR IDENTIFICATION OF ALTERNARIA ALTERNATA BASED...
7. MOLECULAR IDENTIFICATION OF ALTERNARIA ALTERNATA
BASED ON RIBOSOMAL DNA (ITS) SEQUENCES AND
PHYLOGENETIC ANALYSIS
7.1. Introduction
Taxonomy is an essential discipline of the biological sciences simply
because it provides a frame work for the scientific community to facilitate
understanding and knowledge exchange (Rossello-Mora, 2005). The identification
of fungi involving biochemical and temperature testing, as well as observance of
their microscopic morphology using standard mycological manuals, which always
had an limitations. A major criticism of this approach is that it depends heavily
upon highly skilled laboratory personnel with training that is not readily available
in many laboratories. In addition, a significant number of fungi are not able to be
properly identified using these methodologies, mainly because they do not
sporulate in most of the commonly used fungal media (Davis, 2010). Most studies
on fungal strains and populations focused on phenotypic differences in
morphology, physiology and mating. However, these phenotypic features are often
difficult to observe, quantify, standardize, and or analyze.
In the last two decades, tremendous growth in the development and
application of molecular methods in the analyses of fungal species and
populations. Molecular methods are faster, more sensitive, more stable and less
dependent on external factors than morphological methods (Graser et al., 1998;
Faggi et al., 2001; Kim et al., 2001). The characterization of fungal DNA has been
employed to detect and differentiate fungi (Gil-Lamaignere et al., 2003).
Molecular approaches have been developed for the assessment of microbial
Molecular Identification Of Alternaria alternata
170
diversity in complex communities as well (Gonzalez and Saiz-Jimenez, 2005).
Methods based on DNA analysis can reveal fungal diversity in ecosystems, and
offer the potential benefits of highly sensitive and rapid detection (Saad et al.,
2004). The Internal Transcribed Spacer (ITS) region of the nuclear ribosomal
repeat unit has become the primary genetic marker for molecular identification and
other species-level pursuits in many groups of fungi (Seifert, 2009). The
identification of fungi to species level has been based mostly on the use of variable
ribosomal-DNA (rDNA) internally transcribed spacer (ITS) regions. The non-
coding ITS region consisting of ITS1, the 5.8S rDNA and ITS2, should produce a
highly sensitive assay as the target sequence for amplification, because of its high
copy number in the fungal genome as part of tandemly repeated nuclear rDNA.
However, this is one of the most frequently sequenced regions, ITS sequences
from well-identified fruiting bodies are estimated to be available for <1% of the
hypothesized number of fungal species (Nilsson et al., 2005). These ITS regions
benefit from a fast rate of evolution, which results in higher variation in sequence
between closely related species, in comparison with the more conserved coding
regions of the rRNA genes. As a consequence, the DNA sequences in the ITS
region generally provide greater taxonomic resolution than those from coding
regions (Lord et al., 2002; Anderson et al., 2003). Additionally, the DNA
sequences in the ITS region are highly variable and might serve as markers for
taxonomically more distant groups. The International Nucleotide Sequence
Database (INSD: GenBank, European Molecular Biology Laboratory (EMBL), and
DNA Database of Japan (DDBJ)) are the major open repository for sequenced data
(Benson et al., 2008).
Molecular Identification Of Alternaria alternata
171
For phylogenetic analysis, among species or higher taxonomic levels, the
most common genes to be sequenced and compared reside in the ribosomal RNA
(rRNA) gene cluster, including the internal transcribed spacer (ITS) regions ITS1
and 2, the intergenic spacer IGS, 5.8S rRNA, 18S rRNA, and 26S rRNA genes.
This is because these multi-copy genes are high conserved within a species but can
be quite variable among the species.
The genus Alternaria was established in 1817 with A. alternata (originally
A. tenuis) as the type isolate. In classic approaches, Alternaria alternata were
identified based on morphological characters according to descriptions of Simmons
(1995) and Ellis (1971). The absence of an identified sexual stage for the vast
majority of Alternaria species, this genus was classified into the division of
mitosporic fungi or the phylum Fungi Imperfecti. The classical key taxonomic
feature of the genus Alternaria is the production of large, multicellular, dark-
colored (melanized) conidia with longitudinal as well as transverse septa
(phaeodictyospores). These conidia are broadest near the base and gradually taper
to an elongated beak, providing a club-like appearance. They are produced in
single or branched chains on short with erect conidiophores. Alternaria forms
conidia that arise as protrusions of the protoplast through pores in the conidiophore
cell wall. At the onset of conidial development, apex of the conidiophore thickens
and a ring-shaped electron-transparent structure is deposited at the apical dome.
Identification of some Alternaria species still offers considerable difficulties owing
to their high variability and the polymorphism occurring even in pure culture.
Conidia from Alternaria fungi whose show the same size range could be sorted
into different taxa on the basis of the three-dimensional sporulation patterns. The
Molecular Identification Of Alternaria alternata
172
conidial features distinguish Alternaria from the closely related genera
Ulocladium, Stemphylium, Embellisia and Nimbya. The difficulty to distinguish
between species or even isolates is demonstrated by the presence of nearly one
thousand published species designations of Alternaria (Simmons, 1992).
Over 100 species occurring worldwide have been described. However,
errors in the taxonomy of Alternaria species have arisen due to the variability of its
morphological characters, which are not only affected by intrinsic factors but also
by environmental conditions. The molecular taxonomy of the genus Alternaria has
been recently reviewed and hypothetically, the difficulties in taxonomic
classification of species within the genus Alternaria are partly due to the lack of
sexual stages (Yu, 1992).
Hence, this chapter focuses the ITS regions of ribosomal DNA construction
that can be used to identify Alternaria sp. Further, comparisons of these isolates
with those representing known phylogenetic groups that are previously
characterized in this species complex were also attempted.
Molecular Identification Of Alternaria alternata
173
7.2. Materials and Methods
7.2.1. Requirements
DNA isolation reagent (SoluteReady® Genomic DNA purification kit)
PCR Master Mix
Agarose gel electrophoresis
Primers (HELINI Biomolecules, Chennai).
7.2.1.1. DNA extraction and purification buffers
Liquid Nitrogen
Tris, EDTA
100 μL lysozyme
Proteinase K
5 M NaCl
5 ml chloroform
10% SDS
PT Buffer: isopropanol mix
Wash buffer: 70% ethanol
TE Buffer: Tris and EDTA
7.2.1.2. PCR Master Mix
Taq DNA polymerase
10X Taq reaction buffer
0.2 mM dNTPs mix and PCR additives.
7.2.1.3. Agarose gel electrophoresis
0.7 % Agarose
50X TAE buffer
Molecular Identification Of Alternaria alternata
174
6X gel loading buffer
Ethidium bromide.
7.2.2. DNA extraction
Genomic DNA of the fungal culture was extracted by using the salting out
method (Neumann et al., 1992). 5 g of fungal mycelia was ground into a powder
using liquid nitrogen and suspended in 5 ml buffer containing 75 mM NaCl,
25 mM EDTA (pH 8.0) and 20 mM Tris (pH 7.5). 100 μl lysozyme (final
concentration-1 mg/ ml) was added to the above solution and incubated at 37ºC for
60 min. 140 μl of proteinase K (final conc. 0.5 mg/ ml) and 600 μl of 10% SDS
were added and incubated for 2 hrs at 55ºC with occasional mixing. 2 ml of 5 M
NaCl (final concentration 1.25 M) was added and the mixture was cooled to 37ºC.
5 ml chloroform was added and mixed for about 30 min at room temperature and
then the mixture was centrifuged for 20 min at 4,500 rpm. The supernatant was
transferred into a fresh tube and to it 0.6 μl of Isopropanol was added to precipitate
the DNA. The DNA was pelleted and washed twice with 70% ethanol, air dried
and dissolved in 100-200 μl of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) at
55ºC. The quality of the isolated DNA was checked on a 0.7% agarose gel stained
with ethidium bromide.
7.2.3. PCR amplification of ITS regions and 18S rDNA
18S rDNA and ITS regions from the fungal strain were amplified using
PCR with a final reaction mixture volume of 15 μl containing 0.4 μl fungal DNA
solution (40 ng), 1.5 μl 10X buffer, 4 μl (0.2 mM) dNTPs, 1 μl (1 μM) each of the
universal eukaryotic primers (forward primer) ITS1-
TCCGTAGGTGAACCTGCGG, (reverse) ITS2- TCCTCCGCTTATTGATATGC.
Molecular Identification Of Alternaria alternata
175
Thermocycling parameters were: Initial denaturation at 94ºC for 3 min, 30
cycles: Denaturation (94ºC/ 1 min); annealing (58ºC/1 min); final extension was at
72ºC for 10 min. The resulting PCR products were analyzed on 1% agarose gel
containing ethidium bromide. PCR fragments were eluted from gel with the help
of gel elution kit. DNA sequence was carried out using genetic analyzer (Applied
biosynthesis, USA).
7.2.4. DNA sequencing and phylogenetic tree construction
DNA sequencing of PCR products was done by the dideoxynucleotide
chain termination method (Sanger et al., 1977). The rDNA homology searches
were performed using the BLAST program through the internet server at the
National Center for Biotechnology Information (National Institutes of Health,
Bethesda, USA). Sequences and accession numbers for compared isolates were
retrieved from the GenBank database. Sequence pair distances among related and
different fungi of the isolate were scored with the Clustal X program and
phylogenetic tree analysis was performed with the MEGA-5 (Tamura et al., 1994)
software package (DNASTAR, Inc., Madison, USA). The evolutionary history
inferred using the neighbor joining method (Saitou and Nei, 1987) was carried out.
Molecular Identification Of Alternaria alternata
176
7.3. Results
The sequenced rDNA region of Alternaria alternata (Accession no:
KC906251) covered the internal transcribed spacer1, partial sequence; 5.8S
ribosomal RNA gene and ITS2, complete sequences; and 28S ribosomal RNA
gene, partial sequence (Table 18). The evolutionary history inferred using the
neighbor joining method (Saitou and Nei, 1987) and the combined data from all
isolates of the Alternata species-group were analyzed to produce a dendrogram
was shown in Figure 59. Stages of Alternaria alternata were shown in the
photoplate 9.
Table 18. ITS rDNA sequence of Alternaria alternata
Species name ITS rDNA sequence
Alternaria alternata
strain
HEPRA.KALAI
Genbank accession
number
(KC906251)
5´CTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGC
GTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC
ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATA
ATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA
GAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCA
GTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTC
CAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTG
CTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCT
TAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACA
AGTCGCACTCTCTATCAGCCAAGGTCTAGCATCCATTAAGCCTTT
TTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT
AAGCATATCATA 3´
Molecular Identification Of Alternaria alternata
177
BLAST search for similarities using Alternaria sp identification showed
that the percentage of similarity of the isolates ranged from 97%-99%. Therefore,
the species name assigned was according to the closest BLAST search. In the
constructed phylogenetic tree, the strains A. alternata (HQ014678), A. alternata
(JF746168), A. alternata (EF471931) and A. arborescencs (JF802119) were 98%
of similarities with A. alternata (KC906251). Exact match or 99% similarity with
isolates in A. alternata identification database found to be A. alternata (JF802094)
and A. tenuissima (JF802120). The isolates of Rhizoctonia bataticola (HQ392798)
formed a distinct clade that was clearly separated from the other isolates of
Alternaria in the neighbor-joining tree.
Fig. 59. Dendrogram showing relationships among 18 isolates of
Alternaria sp.
Molecular Identification Of Alternaria alternata
178
7.4. Discussion
Most extremophiles are difficult to culture under laboratory condition.
They contain genetic materials which could code for secondary metabolites that are
medicinally useful. Many fungal strains produce enzyme that have found
applications in the biodegradation of chemical warfare agents (Mulbry and
Rainina, 1999). Identification of such proficient fungi was consider as always a
risk task, thus rDNA-ITS have an unique potential for providing information about
an organisms.
DNA sequencing has greatly enhanced the ability to accurate and
reproducibly identifies the fungi. Fungal taxonomists have been using DNA
sequences for many years as a basis for the re-classification of all fungal taxa and
have more recently moved to ITS sequencing as the “Gold Standard” (Hall et al.,
2003). In this present investigation, the ITS region of halotolerant fungus was
sequenced and resulted the strain was identified as Alternaria alternata.
Kusaba and Tsuge (1995) reported that the species of Alternaria, which had
been distinguished morphologically, were clearly separated from one another on
the basis of variation in ITS of rDNA. In this study, Alternaria alternata showed
97-99% similarity with existing Alternaria species from different environments.
Further, this was highly harmony with Sharma et al. (2013) assessed the genomic
regions of 17 Alternaria sp. showing 99% - 100% sequence identity with
Alternaria alternata. Peever et al. (2002) reported that 26 genotypes were found in
sixty six A. alternata isolates sampled from citrus brown spot lesions using RAPD
markers. Adachi et al. (1993) stated low genetic variation of an A. alternata
Molecular Identification Of Alternaria alternata
179
population was observed, i.e. eight rDNA variants in 271 isolates based on RFLP
analysis.
In this study, the Alternaria alternata strain of HEPRA.KALAI (KC906251)
showed the maximum similarity with the references ITS, and the accession number
notified as HQ014678, JF746168, EF471931 and JF802119. Guo et al. (2004)
reported the three unknown isolates of Alternaria species were sequenced, results
indicated the best match had high similarity with A. alternata with some reference
ITS sequences, AF455537, AF455441, AF397233, AF397242, and AY160211.
The sequenced strain of halotolerant fungi was named as Alternaria
alternata strain of HEPRA.KALAI and made publically available in Genbank with an
assigned accession number KC906251.