2015 DNA % : 5' GCGAAAGCTCGACCTAG CAAGGGGACCACA3'*n...

2

Transcript of 2015 DNA % : 5' GCGAAAGCTCGACCTAG CAAGGGGACCACA3'*n...

Page 1: 2015 DNA % : 5' GCGAAAGCTCGACCTAG CAAGGGGACCACA3'*n …zy.yaozh.com/yaocai_bz/2015ydyc0309/dyb00117.pdf · 2015 dna % : 5' gcgaaagctcgacctag caaggggaccaca3'*n 5' caggctcctctaggttgtta
Page 2: 2015 DNA % : 5' GCGAAAGCTCGACCTAG CAAGGGGACCACA3'*n …zy.yaozh.com/yaocai_bz/2015ydyc0309/dyb00117.pdf · 2015 dna % : 5' gcgaaagctcgacctag caaggggaccaca3'*n 5' caggctcctctaggttgtta

CHAPTER 25 DNA Metabolism DNA replication DNA repair DNA recombination Key topics:

CHAPTER 25 DNA Metabolism DNA replication DNA repair DNA recombination Key topics:

Recombinant DNA TechnologyRecombinant DNA TechnologyRecombinant DNA TechnologyRecombinant DNA Technology ... enzyme. Restriction enzymesRestriction enzymes • bind to DNA at specificbind

Recombinant DNA TechnologyRecombinant DNA TechnologyRecombinant DNA TechnologyRecombinant DNA Technology ... enzyme. Restriction enzymesRestriction enzymes • bind to DNA at specificbind

12.1 and 12.2 DNA and DNA Replication - OAK PARK USD...12.1 and 12.2 DNA and DNA Replication DNA & DNA Replication Nucleotides ·monomers of DNA ·3 parts 5-carbon sugar phosphate

12.1 and 12.2 DNA and DNA Replication - OAK PARK USD...12.1 and 12.2 DNA and DNA Replication DNA & DNA Replication Nucleotides ·monomers of DNA ·3 parts 5-carbon sugar phosphate

DNA ( Deoxyribonucleic acid ) 1 DNA structure DNA replication DNA repair.

DNA ( Deoxyribonucleic acid ) 1 DNA structure DNA replication DNA repair.

DNA STRUCTURE & DNA REPLICATION

DNA STRUCTURE & DNA REPLICATION

LOGY DNA TOPO - iramis.cea.friramis.cea.fr/dna2006/lectures/Roca1.pdf · DNA TOPOLOGY DNA supercoiling DNA topoisomerases Topo II DNA preferences DNA knots Topo II mechanics DNA relaxation

LOGY DNA TOPO - iramis.cea.friramis.cea.fr/dna2006/lectures/Roca1.pdf · DNA TOPOLOGY DNA supercoiling DNA topoisomerases Topo II DNA preferences DNA knots Topo II mechanics DNA relaxation

Nuclear DNA and Mitochondrial DNA

Nuclear DNA and Mitochondrial DNA

DNA Gene Mitose DNA Replikation DNA Reparatur · Gliederung v. Genen auf einem ... • Nur etwa 1,5% der DNA kodiert für Proteine. Junk DNA. DNA-Replikation. Zellzyklus. Mitose.

DNA Gene Mitose DNA Replikation DNA Reparatur · Gliederung v. Genen auf einem ... • Nur etwa 1,5% der DNA kodiert für Proteine. Junk DNA. DNA-Replikation. Zellzyklus. Mitose.

Biotechnology. DNA technology DNA diagnostics DNA therapy.

Biotechnology. DNA technology DNA diagnostics DNA therapy.

2015 Dahuang RHEI RADIX ET RHIZOMA Rheum L. Rheum ...zy.yaozh.com/yaocai_bz/2015ydyc0309/dyb00032.pdf · 2015 Dahuang RHEI RADIX ET RHIZOMA Rheum L. Rheum tanguticum Maxim. ex Balf.

2015 Dahuang RHEI RADIX ET RHIZOMA Rheum L. Rheum ...zy.yaozh.com/yaocai_bz/2015ydyc0309/dyb00032.pdf · 2015 Dahuang RHEI RADIX ET RHIZOMA Rheum L. Rheum tanguticum Maxim. ex Balf.

DNA. Genetics & DNA DNA: Picture 51 B-DNA: The advent of modeling .

DNA. Genetics & DNA DNA: Picture 51 B-DNA: The advent of modeling .

DNA Fingerprinting. Content The structure of DNA History of DNA fingerprinting DNA Electrophoresis DNA fingerprinting application.

DNA Fingerprinting. Content The structure of DNA History of DNA fingerprinting DNA Electrophoresis DNA fingerprinting application.

1 ml É 0. 1 mg : 2.5: 2. o. 30 , , 2ml , Iml 0. 4mg ákJÌ ...zy.yaozh.com/yaocai_bz/2015ydyc0309/dyb00377.pdf · 2015 10—15go Fulingpi PORIAE CUTIS Poria (Schw. ) Wolf 7k 5} 15.

1 ml É 0. 1 mg : 2.5: 2. o. 30 , , 2ml , Iml 0. 4mg ákJÌ ...zy.yaozh.com/yaocai_bz/2015ydyc0309/dyb00377.pdf · 2015 10—15go Fulingpi PORIAE CUTIS Poria (Schw. ) Wolf 7k 5} 15.

DNA PROCESSES Transcription using DNA Vs. Replication of DNA.

DNA PROCESSES Transcription using DNA Vs. Replication of DNA.

DNA, RNA, & Protein Synthesis Discovery of DNA DNA Structure DNA Replication Protein Synthesis.

DNA, RNA, & Protein Synthesis Discovery of DNA DNA Structure DNA Replication Protein Synthesis.

DNA. DNA.

DNA. DNA.

Applications of Molecular Systematics. -Plants: chloroplast DNA, mitochondrial DNA and nuclear DNA -Animals: mitochondrial DNA and nuclear DNA Different.

Applications of Molecular Systematics. -Plants: chloroplast DNA, mitochondrial DNA and nuclear DNA -Animals: mitochondrial DNA and nuclear DNA Different.

University of Belgrade Specialized ... - pharmacy.bg.ac.rs · Recombinant DNA technology (DNA transfer, DNA sources, DNA and genome sequencing, DNA hybridization, polymerase chain

University of Belgrade Specialized ... - pharmacy.bg.ac.rs · Recombinant DNA technology (DNA transfer, DNA sources, DNA and genome sequencing, DNA hybridization, polymerase chain

Replication DnA Dna

Replication DnA Dna

Last lecture summary. recombinant DNA technology DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA) DNA cloning – vector.

Last lecture summary. recombinant DNA technology DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA) DNA cloning – vector.