2012 UNC Asheville Men's Soccer Media Guide
-
Upload
matthew-pellegrin -
Category
Documents
-
view
238 -
download
6
description
Transcript of 2012 UNC Asheville Men's Soccer Media Guide
/// UNC ASHEVILLE BULLDOGS ///
1/// F E A R T H E D O G ///
General InformationMedia Information ..................................................................................................................2Primary Media Outlets ..........................................................................................................3
Season PreviewOutlook ................................................................................................................................. 4-5
PlayersDavid Parra ................................................................................................................................6Bobby Castro ............................................................................................................................7Sam Rossabi ...............................................................................................................................8Rob May .....................................................................................................................................9Kenneth Lingerfelt ..................................................................................................................10Hans Lohmeyer ......................................................................................................................11Dan Jackson/Alex Chu ..........................................................................................................12Stabler Cochrane/Quentin Reynolds .................................................................................13Joey Cutting/A.J. Iiames .........................................................................................................14Paul Egle/Patrick Phillip .........................................................................................................15Mick Giordano/Zak Davis ....................................................................................................16Newcomers ......................................................................................................................17-20
Coaching Staff Head Coach Matt Kern .......................................................................................................21Assistant Coach Joe Burnette ............................................................................................22Assistant Coach Shane Weems ...........................................................................................23
Records Section2011 Season Stats .................................................................................................................242011 Big South Final Standings ..........................................................................................25 Big South Tournament History ..........................................................................................26Game Records ........................................................................................................................27Team Records .........................................................................................................................28Year-by-Year Leaders .............................................................................................................29All-Time Letterwinners ..................................................................................................30-31All-Time Results ...............................................................................................................32-33UNC Asheville Hall of Fame ................................................................................................36The Big South Conference .............................................................................................37-38 The Big South Network .......................................................................................................39
UNC AshevilleThe University of North Carolina Asheville .............................................................40-43Dr. Anne Ponder, Chancellor ...............................................................................................44Janet R. ConeDirector of Athletics/Senior Administrator for University Enterprises .............45-46Support Staff ....................................................................................................................47-48Head Coaches .......................................................................................................................49Rocky .......................................................................................................................................50NCAA .....................................................................................................................................51The Bulldog Athletics Association .....................................................................................52
Bulldog Coaching Staff Head Coach..................................................................Matt Kern
............................................................................ (Hartwick, 1988)
Overall/years .................................................. 8-25-4/Third Year
at Asheville .................................................157-102-23/20 years
Conference ............................................................................2-6-0
Assistant Coach ........................................................ Joe Burnett
............................................................ (UNC Greensboro, 2009)
2011 Team Information2011 Record ....................................................................... 4-12-3
2011 Big South Record/Finish ................................... 3-5-1/8th
Starters Returning/Lost ........................................................ 6/5
Letterwinners Returning/Lost .......................................... 12/10
Soccer Support Staff Athletic Trainer .......................................... James Westfall, ATC
Athletics Communication ........................................Mike Gore
Greenwood FieldCapacity ................................................................................. 1,000
Press Box Phone ............................................... (828) 545-1121
Message To MediaThis edition of the 2012 UNC Asheville Soccer media
guide has been prepared for you as you cover the Bulldogs
during the season. For additional information, photographs,
interviews with players and coaches, please contact Matt
Pellegrin or Mike Gore in the Athletics Communication
Offi ce.
CreditsDesigner:
Matt Pellegrin
Editor
Mike Gore
Photographers:
Brett Whitsell, Blake Madden, Todd Drexler
UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.
UNC ASHEVILLE MISSION STATEMENT
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
2 /// F E A R T H E D O G ///
Athletics Media Communications
Mike Gore Associate Athletics Director for
External Affairs / Soccer ContactOffi ce Phone: (828) 251-6923Cell Phone: (828) 215-6387
Email: [email protected]
Matt PellegrinDirector of Athletics Media Communication
Offi ce Phone: (828) 251-6931Cell Phone: (828) 545-1121Email: [email protected]
Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com
Mailing Address:One University Heights
Justice Center, CPO #2600Asheville, N.C. 28804
COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.
Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.
Broadcasts: There are no phone lines at the Greenwood Field for radio and internet broadcasts. If you would like to broadcast a game please call well in advance to see what arrangements can be made.
Photographers: Photo passes are limited to working press photographers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.
Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every home soccer match. After the match, each media member will receive a box score of the match.
Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the women’s soccer coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Commincation representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.
Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communications Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.
Video Streaming: UNC Asheville will once again video stream all of its home soccer matches live on www.bigsouthsports.com. This is a pay per view service. Archives of each broadcast will be available the day after each match. For match highlights or more information video of matches please contact Matt Pellegrin
MEDIA INFORMATION
/// UNC ASHEVILLE BULLDOGS ///
3/// F E A R T H E D O G ///
NEWSPAPERS
Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585
Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319
The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665
The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506
WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078
TELEVISION
WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618
WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430
WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305
RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310
WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835
WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875
Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteArena (Capacity): Greenwood Field (300)Chancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneAssociate Athletics Director of External Affairs: Mike GoreAthletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904
PRIMARY ATHLETICS LOGO
SECONDARY ATHLETICS LOGOS
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
4 /// F E A R T H E D O G ///
The UNC Asheville men’s soccer team played 10 one-goal matches in 2011 and only won three of them. The Bulldogs hope to reverse that trend in 2012.
Asheville was a very competitive team a year ago but fi nished with a 4-12-3 overall record. The Bulldogs took top-ranked UNC Chapel Hill to overtime before falling and earned road wins over Big South Conference foes Radford and Winthrop. Throw in three ties, and Matt Kern’s club was so close to hav-ing a winning season.
“We were close to having a pretty good season,” admitted Kern. “We had 10 one-goal matches and three ties. A goal here, a goal there, and the record is a lot better.
“What we’re looking for in 2012 is simply to score a few more goals and give up a few less goals,” added Kern. “We want to score around 25 goals and only give up on average a goal a match. If we can do that, then I believe we can have a pretty good season.”
Asheville will have some work to do to replace the scoring it produced in 2011. The Bulldogs’ top two goal scorers – Jake Hagedorn (8) and Bryan George (5) – accounted for 13 of the Blue & White’s 21 goals. Both have graduated along with All-Conference goalkeeper Lassi Hurskainen. Kern’s club graduated eight seniors from last year.
“We graduated a great deal of skill on the fi eld along with leadership,” de-clared Kern. “The cupboard isn’t bare, but we’re going to need our returning players and newcomers to step up and make a difference right away.
“And I’m confi dent we can be better this year,” added Kern. “We have a nice core of leadership returning, plus we believe we have some talented new-comers coming into the program who are ready to make an impact.”
GOALKEEPER
The Bulldogs will miss Hurskainen, who was a four-year starter for Asheville and completed his career as the Big South’s all-time leader in saves with 408. His 11 shutouts are second best in school history. In three of his four years with the Bulldogs, Hurskainen played every minute of every match during that particular season.
But Asheville has some options in 2012. Start with sophomore Dan Jackson. He backed up Hurskainen last season and played in the Bulldogs exhibition matches. Jackson was Asheville’s starter in the spring.
“Dan had a good spring for us,” explained Kern. “He is a good communica-tor and has quick refl exes. Dan has the potential to be an excellent goal-keeper.”
Colgate transfer Zak Davis is one of two newcomers who will compete for playing time in goal. Davis is a native of Baltimore who didn’t play at Colgate last year but was part of a program that went to the NCAA Tournament.
“Zak is 6-1 and is quite strong,” commented Kern. “He comes from a great club program in Baltimore. Zak may have not played at Colgate last year but he was a part of a team that won a championship and played in the NCAA Tournament. He’ll battle for playing time this year.”
Freshman Jaron Bradley enjoyed a spectacular prep and club career in Char-lotte.
“Jaron is used to playing at a high level of soccer,” admitted Kern. “He’s good with his feet and has soft hands. Jaron will push for time along with Dan and Zak.”
Kern believes the goalkeeper spot is in good shape for 2012.
“You can’t replace Lassi. He was a tremendous player and leader,” said Kern. “However, I think we’re going to be fi ne here this season. The three goal-keepers we have are talented and going to do a great job. We have some real options here this season.”
DEFENSE
The Bulldogs were hit hard by graduation in the back but return some tal-ented returnees and have some newcomers who could make an impact.
Junior Bobby Castro will anchor Asheville’s defense in the back in 2012. Castro will serve as the Bulldogs’ captain this season and after enjoying an excellent summer playing club soccer.
“Bobby is quite versatile and can play anywhere,” admitted Kern. “He’ll play in the center of our defense and will be a big presence for us this year.”
Joining Castro in the back will be junior Hans Lohmeyer. He has improved with each season and will be counted on more in 2012.
“Hans is a good simple player who always seems to fi nd his way in the lineup,” declared Kern. “He’s someone who can play in the midfi eld or as a central defender.”
Sophomore Quentin Reynolds earned some experience last season and will be counted on this year.
“Quentin is another player who can play multiple positions,” explained Kern. “He’s a great athlete who plays hard when he’s in the game.”
Sophomore Alex Chu didn’t play last season but will get a chance to be on the pitch in 2012.
“Alex played every minute in the spring and proved to be a good communi-cator,” said Kern. “He just needs some more game experience, and he’ll be able to make a big contribution.”
Sophomore A.J. Iiames played 14 matches and started 10 times as a fresh-man. He did a solid job in the back but his status is questionable for this year. Iiames suffered an injury and may not be back this year.
“We’re just going to have to see if A.J. can play this year,” admitted Kern. “He played well as a freshman last season.”
The newcomers start with junior transfer Mick Giordano. The Greenville, N.C., native played at Greensboro College in 2009 before moving to Char-lotte in 2010. Giordano didn’t play for the 49ers before coming to Asheville last year. Due to NCAA transfer rules, he had to sit out last season.
“We’re glad to have Mick,” declared Kern. “He didn’t play in the spring, but he trained with us and we liked what we saw from him. Mick will play as an outside back this season. He’s a player who does a good job keeping the ball
Young Bulldog Squad Looking To Make A Name
Bobby Castro
/// UNC ASHEVILLE BULLDOGS ///
5/// F E A R T H E D O G ///
and then knows when to make a pass.”
Asheville has two freshmen who will get serious looks from the coaching staff for playing time this year.
Erik Casterline joins the Blue & White after a stellar club and prep career in High Point.
“Erik is a great two-way player who is quite comfortable playing in the back,” stated Kern. “We’re looking at him as a right back and someone who can make an immediate impact.”
Cole Schwietering will be Asheville’s tallest player this year at 6-3. He’s from Fuquay-Varina, N.C.
“Cole is another player we’ve signed with great high school and club experi-ence,” said Kern. “His height (6-3) is a real asset, and we’re confi dent he’ll compete for a starting spot right away as a freshman.”
MIDFIELD
The Bulldogs return a nice mixture of experience and newcomers in the midfi eld.
Start with junior Rob May. The Asheville native transferred to the Bulldog program last year after spending a year at national power Charlotte. He started for Asheville in the midfi eld, and Kern expects even more this year from the former Roberson standout.
“Rob is only going to be better this season after a year under his belt,” de-clared Kern. “We’re going to look to him to score more this year and be on the attack more.”
Junior Sam Rossabi has been a steady player for the Blue & White during his career.
“We were really pleased with Sam this spring as he did a great job in our matches,” explained Kern. “He is one of the hardest-working players I’ve ever been associated with. We think Sam is ready to have a big junior year.”
Stabler Cochrane didn’t play last season due to injuries. He did play in the spring and made an impression on Kern.
“Stabler played well for us in the spring and scored some goals,” said Kern. “We’re looking for similar production from him this year.”
Senior David Parra has enjoyed some solid moments for the Bulldogs during his career and should be one of Asheville’s senior leaders this year. However, he’s dealing with some injuries, and his health will be an ongoing concern in 2012.
“If David is healthy and ready to go, he’ll be a key player for us this season,” admitted Kern. “He’s a versatile player who we can play anywhere on the fi eld and be effective. But David didn’t play in the spring, and we just have to see how healthy he is this season.”
Patrick Phillip didn’t play much last fall as he appeared in four matches. In the spring, Phillip played much more and impressed the Bulldog coaching staff.
“Patrick showed his potential last spring and performed quite well,” said Kern. “He plays well in tight spaces and is strong with the ball. We just need to get Patrick some game experience, and he’ll help us.”
Joey Cutting is a sophomore who played in six matches in 2011.
“Joey is a good possession player,” stated Kern. “He played as a central mid-fi elder last year, and we expect him to play there this season, as well.”
Three talented freshmen will jockey for playing time in 2012.
Texas native Emil Gonzalvez comes to Asheville via an old Bulldog friend. He played at Shattuck-St. Mary’s in Minnesota for long-time Bulldog head coach Steve Cornish. Shattuck is one of the top prep programs in the nation.
“We’re really excited about Emil coming into our program,” declared Kern. “He’ll be our only left-footed player and can play in the back, as well. Emil played for Steve Cornish on a very high level. He is very, very good with the ball, and he’ll see some playing time this season.”
Kyle Lohn comes to Asheville via Union Academy in Indian Trail, N.C.
“Kyle is physically quite strong and a hard worker,” said Kern. “He has the engine to always look to move forward and get into an attack mode.”
Andrew Sotak enjoyed a great prep and club career in Fuquay-Varina, N.C. as a high school teammate of classmate Cole Schwietering.
“Andrew has a lot to offer,” admitted Kern. “He’s had a superb youth career and is used to playing at a high level of competition. Andrew is a good server, but he’s quite capable of scoring a lot of goals, as well.”
FORWARD
The Bulldogs appear to have some good talent returning up front plus some dynamic newcomers who could make this area a position of strength for Asheville in 2012.
Asheville native Kenneth Lingerfelt produced a solid sophomore campaign in 2011 with two goals and two assists. The Bulldogs hope for more in 2012.
“We’re looking for Kenneth to have a breakout season this year,” explained Kern. “He has a knack for putting the ball into the back of the net. We just need to keep him healthy this season.”
Sophomore Paul Egle can play as a central midfi elder or as a striker. He played in 15 matches last season and started in all of them.
“Paul will see playing time in both places this year,” said Kern. “He’s our best true passer and is fantastic in the open fi eld. We’re looking for a big season from Paul.”
The Bulldogs have added a local high school All-American to the mix up front in Trey Hemphill. The Roberson HS product enjoyed an amazing career for the Rams. He earned All-American status last season by scoring 30 goals as a senior.
“We’re pretty excited that Trey chose UNC Asheville to continue his playing career,” commented Kern. “He’s a fun player to watch. Trey can score goals, and he can also set up goals as a passer. He’s very crafty and creative with the ball.”
Rayon Gibbs is a freshman striker from Mississippi whom Kern is excited about.
“Rayon is an excellent attacker,” said Kern. “He’s a player who likes to run at other players and will have good chemistry teaming up with Kenneth Lingerfelt.”
David Parra
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
6 /// F E A R T H E D O G ///
DAVID PARRAMF • 6-1 • SR • THE WOODLANDS, TX
Overview: Talented senior midfi elder from Houston who made an immediate impact for the Bulldogs in 2009...earned a spot on the Big South All-Freshman team...attended the same high school, The Woodlands, as former Bulldog assis-tant coach Greg Garrison...fi rst name is pronounced Duh-vead 2011: Earned 15 starts on the year and played in 17 match-es...scored in close loss to Campbell (10-22)...took 11 shots. 2010: Played in six matches and started one time...started fi rst match of season vs. IUPUI (9-3). 2009: Played in all 20 matches and started 17 times...scored goal vs. High Point (10-3)...fi red 15 shots on the season. Before UNC Asheville: Earned second team all-district honors as a junior and senior at Woodlands...led team to district and area championship plus berth in regional title game as a senior...also played for Texas Rush Soccer Club where he was captain of the team last season...helped lead Texas Rush to three championships during his career.
11
/// UNC ASHEVILLE BULLDOGS ///
7/// F E A R T H E D O G ///
BOBBY CASTROD • 5-8 • JR • CARY, N.C.
Overview: Talented junior defender from Cary, N.C...Bob-by is a player who has really improved with each season...should be a key player for the Bulldogs in 2012.
2011: Played in all 19 matches and earned 18 starts...fi xture in the back and helped lead a defense that posted three shutouts with two in Big South Conference play...took four shots on the season and picked up one assist on game-tying goal at Appalachian State (9-27).
2010: Earned eight starts and appeared in 18 matches...took 16 shots...tallied fi rst career goal vs. VMI (10-23)...had three shots at Longwood (10-2)...started fi nal fi ve matches of the season.
Before UNC Asheville: Enjoyed a standout career for Mid-dle Creek where he was named All-Conference and All-Region as a senior...team MVP as a senior...scored seven goals and had two assists senior season...earned All-Con-ference honors as a sophomore...helped lead Middle Creek to state playoffs three times during his career...helped lead club team to 32-5-6 record in 2009-10...92 TFC Navy was a North Carolina fi nalist in the spring and was the regu-lar-season champion in the Premier League...ranked sixth in the Premier League in scoring with fi ve goals and 13 points.
2
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
8 /// F E A R T H E D O G ///
SAM ROSSABIMF • 5-8 • JR • CARY, N.C.
Overview: Hard-working junior midfi elder who could be an impact player for UNC Asheville in 2012. 2011: Started twice and competed in 14 matches...fi red four shots durng the season...picked up his fi rst collegiate point on an assist vs. College of Charleston (9-11). 2010: Played in 14 matches and earned 11 starts...took three shots on the season with one against Belmont (9-19), USC Upstate (9-22) and one in home loss to Wofford (10-30). Before UNC Asheville: Attended Green Hope HS and as a senior helped lead team to state championship game...played club ball for TFC Navy and that team advanced to state fi nals last spring.
3
/// UNC ASHEVILLE BULLDOGS ///
9/// F E A R T H E D O G ///
ROB MAYMF • 5-9 • JR • ASHEVILLE, N.C.
Overview: Talented transfer from Charlotte who stepped in and made an impact for the UNC Asheville program right away...will be a key player for the Bulldogs in 2012 and should compete for Big South All-Conference honors.
2011: Earned 17 starts and played in all 19 matches...fourth on club in shots taken with 19...scored one goal and had one assist...fi rst collegiate goal came at Winthrop (10-12) that sealed 2-0 victory over the Eagles...picked up assist in 3-0 victory over Brevard (9-19).
Charlotte: Played in just two matches for the 49ers...played the two matches in 2010 and red-shirted in 2009.
T.C. Roberson: Earned All-State honors as a junior and a senior...three-time All-Region selection as he scored 50 goals and dished out 43 assists in his career...three-time All-MAC Conference selection who earned league Player of the Year honors as a senior...played an integral role in helping TC Roberson win 83 games and two MAC Con-ference championships during his four-year career...ODP Regional Pool Player...played club soccer for the Highland Football Club.
5
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
10 /// F E A R T H E D O G ///
KENNETH LINGERFELTF • 6-0 • JR • WEAVERVILLE, N.C.
Overview: Junior from Asheville who has stepped up and become a key player the Bulldogs up front...named to Big South All-Freshman team in 2010...should compete for All-Conference honors in 2012.
2011: Stated in eight matches and played in 15 games...fi n-ished the year third on the club in scoring with two goals, two assists and six points...scored fi rst goal of the year in 3-0 win over Brevard (9-19)...tallied game-winning goal in Bulldog triumph at Winthrop (10-12)...earned fi rst career assist vs. Campbell (10-22)...also had assist in 4-2 victory over Presbyterian College (11-5)...had 13 shots on the sea-son with fi ve on target.
2010: Played in all 18 matches and started 11 times...scored game-tying goal at ETSU (9-25)...fi red 19 shots on the sea-son...had two shots in fi ve different matches.
Before UNC Asheville: Earned all-conference honors in 2009 for Asheville after scoring 20 goals and dishing out 14 assists...helped lead the Cougars to 17 wins and berth in the 3-A state playoffs...named to all-state and all-region team...was the 2008 Asheville-Citizen Times Player of the Year.
10
/// UNC ASHEVILLE BULLDOGS ///
11/// F E A R T H E D O G ///
HANS LOHMEYERD • 5-11 • JR • GIBSONVILLE, N.C.
Overview: Versatile player who can play in the back or as a midfi elder...earned valuable playing experience in 2010 and became a starter for the Bulldogs as a sophomore.
2011: Played in 17 matches and earned 14 starts..took one shot on the season.
2010: Appeared in six matches and started fi nal three games of the season...took two shots during the year.
Before UNC Asheville: Played at Page HS where he helped lead school to 4-A state championship as a senior...tallied seven goals and had 13 assists senior season...earned all-conference honors...junior year played in back and scored seven goals...played club soccer for Developmental Acad-emy in Greensboro where he scored fi ve goals in 2010...led Development Academy to state championship game in 2009.
22
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
12 /// F E A R T H E D O G ///
DAN JACKSONGK • 5-11 • SO • CHAPEL HILL, N.C.
Overview: Did not play as a freshman as he backed up All-Conference goalkeeper Lassi Hurskainen who played every minute of every match for the Bulldogs...played in exhibi-tion games and in the spring...will compete for starting job in 2012. 2011: Did not play
Before UNC Asheville: Went to East Chapel Hill HS and played for head coach Zach Haines... All Conference play-er his sophomore, junior, and senior seasons...earned All- Region honors junior and senior seasons...played his club soccer for Jeff Negalha and the Triangle United 93 Gold team...was selected to play in the East-West All-Star Game in Greensboro and the Clash of the Carolinas in Charles-ton, S.C.
1
ALEX CHUD • 5-11 • SO • CHARLOTTE, N.C.
Overview: Did not play last year but should compete for playing time in the back this season...enjoyed great prep and club career in Charlotte. 2011: Did not play.
Before UNC Asheville: Played his soccer at South Meck-lenburg High School under head coach Jim Lynch...named to the SW 4A All-Conference team and the All-Region team in his senior season...played for Charlie McGinty and the Charlotte Soccer Academy.
4
/// UNC ASHEVILLE BULLDOGS ///
13/// F E A R T H E D O G ///
STABLER COCHRANEMF • 5-11 • SO • WINSTON-SALEM, N.C.
Overview: Midfi elder from Winston-Salem who did not play in 2011 but should compete for playing time this year.
2011: Did not play
Before UNC Asheville: Enjoyed a standout career at West Forsyth HS where he played for head coach Scott Bilton...earned All-Conference, All-Region and All-County honors his senior year...played his club soccer for Scott Brittsan and a successful NC Fusion Elite team.
9
QUENTIN REYNOLDSD • 6-0 • SO • APEX, N.C.
Overview: Sophomore defender who should compete for starting spot in the back this year...played for very good prep and club program in Raleigh area.
2011: Played in eight matches and started twice.
Before UNC Asheville: Joined the Asheville program from Holly Springs HS where he played for head coach Davi Lanuti...played for the highly competitive FVAA Flash and Henry Gutierrez at the club level.
12
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
14 /// F E A R T H E D O G ///
JOEY CUTTINGMF • 5-10 • SO • MAGGIE VALLEY, N.C.
Overview: Local product from Tuscola High School...worked hard last season and in the spring and should give Bulldogs some depth in the midfi eld. 2011: Came off the bench in six different matches for Asheville.
Before UNC Asheville: Played under head coach Erik Mel-ville and was the team MVP and Haywood County Player of the Year in 2010..voted to the AAC All-Conference team and All Region WNC team his junior and senior seasons.
13
A.J. IIAMESD • 6-0 • SO • RALEIGH, N.C.
Overview: Sophomore defender who worked hard and became a starter for much of his freshman season...enjoyed standout prep career at Broughton HS in Raleigh...brother Ben played at Big South school Campbell. 2011: Earned 10 starts for the Blue & White and played in 14 contests...took four shots with one on goal.
Before UNC Asheville: Played for Izzy Hernandez at Broughton...senior year scored eight goals and had 10 as-sists...junior campaign had four goals and eight assists...helped lead Broughton to four consecutive conference tournament championships and three straight regular-sea-son titles...led team to 16-8-2 record.
14
/// UNC ASHEVILLE BULLDOGS ///
15/// F E A R T H E D O G ///
PAUL EGLEF • 6-1 • SO • ASHEVILLE, N.C.
Overview: Sophomore striker from local prep power T.C. Roberson...showed real promise as a freshman and should be one of the Bulldogs most dangerous forwards as a soph-omore.
2011: Started and played in 15 matches...took eight shots on the year with fi ve on goal...earned fi rst collegiate point vs. Brevard (9-19) when he assisted on a goal by Kenneth Lingerfelt.
Before UNC Asheville: Played for four years at Roberson under head coach Rob Wilcher...named Asheville Citizen-Times All-WNC Soccer Player of the Year in 2009...also named to the NCSCA All Region and All State teams three out of four years of his high school career, once with a 3A school (2008) and twice with a 4A school (2009, 2010)...played for Craig Conger and the North Mecklenburg U.S. Development Academy Team.
19
PATRICK PHILLIPMF • 5-10 • SO • DRIPPING SPRINGS, TX
Overview: Sophomore midfi elder from Texas who picked up experience as a freshman and should get more playing time in 2012.
2011: Competed in four matches as a freshman.
Before UNC Asheville: A three-year varsity player at Dripping Springs HS in Texas..earned honorable mention All-District honors as a junior, and was named to the All-District Second Team and the Academic All-District Team as a senior.
24
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
16 /// F E A R T H E D O G ///
MICK GIORDANOMF • 5-9 • JR • GREENVILLE, N.C.
Overview: Transfer who had to sit out last season due to NCAA transfer rules...began college career at Greensboro College before transferring to Charlotte where he did not play...played for the Bulldogs last spring...talented midfi elder who could make a difference for UNC Asheville in 2012.
Before UNC Asheville: Played one season at Greensboro College (2009) where he played both as a midfi elder and defender...played four years of soccer at D.H. Conley HS where he was an All-Conference selection for three con-secutive years...also played wide receiver and kicker on the football team...played on the 90 OCSA Coastal Crew Club team.
8
ZAK DAVISGK • 6-1 • SO • BALTIMORE, MD
Overview: Sophomore goalkeeper who transfers into UNC Asheville from Colgate...will compete for playing time in goal...did not play at Colgate but was a member of a team that won the Patriot League and advanced to the NCAA Tournament
Before UNC Asheville: Attended Boys Latin School in Baltimore...was a two-year captain in his junior and se-nior seasons...recorded 21 shutouts in his career, seven of which were his senior season...named his team’s Most
Valuable Player in 2009...his team won the MIAA B Confer-ence Championship his sophomore year...was selected to the 2009 and 2010 All-MIAA B Conference teams...played in the U.S. Soccer Developmental Academy with Baltimore Bays Chelsea...also lettered in hockey and baseball...baseball team won the MIAA B Conference Championship his fresh-man year...participated in the Coaches Cup for Teamwork and Leadership...member of the National Honor Society, the Laker Corps and was the Student Body President.
30
/// UNC ASHEVILLE BULLDOGS ///
17/// F E A R T H E D O G ///
TREY HEMPHILLF • 5-9 • FR • ASHEVILLE, N.C.
Overview: Local player from prep power T.C. Roberson...striker who could make an immediate impact for the Bull-dogs in 2012...brother Mark played soccer at Appalachian State with brother Mike playing at UNC Greensboro...fa-ther David played baseball at Florida State.
Before UNC Asheville: Senior year named as NSCAA High School All-American, All-South, All-Region, All-State and Asheville Citizen-Times WNC Player of the Year...played club soccer for North Meck Soccer Academy.
6
KYLE LOHNMF • 5-11 • FR • INDIAN TRAIL, N.C.
Overview: Freshman midfi elder from Indian Trail, N.C....played club soccer for Charlotte United Futbol and played high school soccer at Union Academy.
Before UNC Asheville: Named All-Conference and All-Re-gion in 2010...tabbed as the Charlotte United Player of the Year in 2010...also earned a spot on Region III pool team.
15
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
18 /// F E A R T H E D O G ///
EMIL GONZALVEZMF • 6-0 • FR • AUSTIN, TX
Overview: Texas native who played for former Bulldog men’s coach Steve Cornish at Shattuck-St. Mary’s School in Minneosta...can play in the back and in midfi eld.
Before UNC Asheville: Helped lead Shattuck to 2011 Min-nesota State championship...named to Region III Pool tea, in 2010...earned Forza FC Player of the Year honors in 2009 while playing in Austin, Texas.
16
ANDREW SOTAKMF • 5-8 • FR • FUQUAY-VARINA, N.C.
Overview: Joins Bulldog program along with high school and club teammate Cole Schwietering...can play both up front and in midfi eld...father John Sotak played college foot-ball at Clemson.
Before UNC Asheville: Attended high school at Fuquay Varina where he earned All-State honors as a senior and was named Offensive MVP...played club soccer for USSDA NC Fusion.
17
/// UNC ASHEVILLE BULLDOGS ///
19/// F E A R T H E D O G ///
JARON BRADLEYGK • 6-0 • FR • CHARLOTTE, N.C.
Overview: Freshman goalkeeper from Charlotte who will compete for starting spot right away.
Before UNC Asheville: Senior year attended Hough HS in Charlotte and prior to that, went to North Mecklenburg HS for three years...selected to play in 2012 Carolinas Clash Game in Charleston, S.C. which pits the top prep players from North and South Carolina...named to All-State team in 2011 and earned All-Conference and All-Region honors from 2009-11...played club soccer for USSDA Charlotte Soccer Academy.
18
COLE SCHWIETERINGD • 6-3 • FR • FUQUAY-VARINA, N.C.
Overview: Freshman defender from Fuquay-Varina, N.C....joins Bulldogs roster along with high school teammate An-drew Sotak.
Before UNC Asheville: Played at Fuquay-Varina HS and was named to All-Conference and All-Region team as a ju-nior and senior...excellent student...played club soccer for USSDA NC Fusion.
20
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
20 /// F E A R T H E D O G ///
ERIK CASTERLINED • 5-10 • FR • HIGH POINT, N.C.
Overview: Freshman defender from High Point, N.C. who will have a chance to play right away for the Bulldogs.
Before UNC Asheville: Played at Southwest Guilford in High Point and was a member of the USSDA N.C. Fu-sion team...named team defensive MVP at Southwest and served as co-captain senior year...earned All-Conference, All-Region honors...named Honorable Mention All-State...during club ball, he helped his team qualify for Finals Week 2011 in Milwaukee on the way to a fi nal national ranking of sixth.
21
RAYON GIBBSF • 5-11 • FR • LAUREL, MS
Overview: Mississippi product who can play either up front or in midfi eld.
Before UNC Asheville: Attended West Jones HS in Laurel, Miss....All-Star selection as a senior...named to All-District team and District MVP following senior year...earned All-District honors all four years he played in high school...excellent student...played club soccer for Central Jackson Soccer Organization
23
/// UNC ASHEVILLE BULLDOGS ///
21/// F E A R T H E D O G ///
MATT KERNHEAD COACH • THIRD SEASON • HARTWICK, 1988
Matt Kern, a former assistant coach for the UNC Asheville men’s and women’s soccer programs, is in his third year as head coach of the Bulldog men’s program.
Kern, who has worked as a head coach at the Univer-sity of the South and Wofford College, was hired in June 2010 after spending two years working in Asheville. He as-sisted both the Bulldog men’s and women’s soccer teams as their Goalkeeper Coach and was the Special Programs Director of Coaching with the Asheville Buncombe Youth Soccer Association.
He succeeded long-time men’s head coach Steve Cor-nish, who stepped down in the spring of 2010 to accept a coaching and teaching position at Shattuck-St. Mary’s Acad-emy in Minnesota.
Kern coached at Wofford College for six seasons from 2002 through 2007. The Terrier program steadily improved under his guidance and set a school record for wins in Divi-sion I in 2007. He left the program in good hands as Wof-ford won the Southern Conference championship in 2009. All 11 starters for the Terriers’ championship team were players Kern brought into the program.
He coached for 11 years at The University of The South (Sewanee) before going to Wofford. He was named South-ern Collegiate Athletic Conference Coach of the Year after the 2000 and 2001 seasons. Kern led the school to the 2001 SCAC championship and a trip to the NCAA Divi-sion III Tournament. The Tigers went 31-6-1 under Kern in his fi nal two years at Sewanee. He also coached the golf team and was Director of Intramurals during his tenure.
The Maryland native was an assistant coach at Spring-fi eld College for one year and helped the program set a school record for wins and a national ranking.
He enjoyed a standout collegiate career at Hartwick College from 1984-87. Kern was a four-year starter and helped lead the school to two Final Fours, three Elite Eight appearances and four Sweet 16’s. He graduated from Hart-wick in 1988. His wife Chapman is the Director of Athletics at Asheville School. They have two children, Brooks (17) and Emerson (13).
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
22 /// F E A R T H E D O G ///
JOE BURNETTTHIRD SEASON • UNC GREENSBORO, 2008
Former UNC Greensboro standout Joe Burnett is in his third year as an assistant soccer coach with the UNC Asheville men’s program. Burnett, a native of Winston-Salem, N.C., helped lead the Spartans to three appearances in the NCAA Tour-nament and was named the 2008 Southern Conference Tournament’s Most Valuable Player. “We are really fortunate to have Joe Burnett as part of the UNC Asheville soccer family,” said Kern. “He has been a real asset to our program the past two seasons.” The Spartans won three SoCon Tournament titles during Burnett’s tenure (2005, 2006, 2008), along with two regular season titles in 2005 and 2006. UNCG reached the SoCon Tournament fi nal in 2007, but fell to Furman in overtime of the championship game. During Burnett’s senior season he started in 22 of 23 contests, logging 1,713 minutes of playing time. That season the Spartans defeated Duke University 2-0 to advance past the fi rst round of the NCAA Tournament. UNCG then defeated Loyola (Md.) 2-1 to advance to the Final 16 before falling to South Florida on penalty kicks. In his fi rst two seasons, UNCG fi nished ranked 18th in the country by the National Soccer Coaches Associa-tion of America, compiling a 32-14-2 record over those two years. During his career the Spartans amassed 53 vic-tories overall with a 16-10-1 record in conference. Burnett spent the 2009 season as an assistant coach at West Forsyth High School in Clemmons, N.C.
Joe and his wife Tiffany reside in Asheville.
Joe Burnett at UNC Greensboro
/// UNC ASHEVILLE BULLDOGS ///
23/// F E A R T H E D O G ///
SHANE WEEMSTHIRD SEASON • COLLEGE OF CHARLESTON, 1994
Shane Weems, the Director of Coaching for Asheville-Buncombe Recreation Soccer Association, enters his third season as a volunteer assistant coach with Matt Kern and the Bulldogs’ men’s soccer program.
Weems, a former College of Charleston team captain, started four years for the Cougars and earned All-Trans-Atlantic Conference honors during his junior and senior campaigns. After fi nishing his collegiate career, Weems played professionally for the Charleston Battery and the Hampton Roads Mariners before suffering a career-ending injury. The Battery reached the Sizzling Nine Champion-ships in 1994, his fi rst season with the club.
He started his coaching career with the Hungryneck Soccer club while also working with the Mount Pleas-ant Youth Soccer Association, all while attending CofC. Weems came to Asheville in 1998 and began coaching with the Highland Football Club (HFC).
In 2005, the HFC and ABYSA merged and Weems was named to his current position with the association. Cur-rently he oversees the recreation soccer program, coach-es competitive level youth teams in various age groups and works with the academy program.
Weems also coaches the 97 Boys for the North Car-olina Olympic Development Program. He has previous experience working with South Carolina’s ODP as well. As a youth he was selected to the United States Youth Soccer Association’s Region III ODP team in 1987.
He currently holds a United States Soccer Federation Class A coaching license, a National Soccer Coaches As-sociation of America Advanced National Diploma and a USSF National Youth License.
He is a 1994 graduate of the College Charleston.
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
24 /// F E A R T H E D O G ///
2011 UNC ASHEVILLE SEASON STATISTICS
## Name GP-GS G A Pts Sh Sh% GW PK-ATT 20 HAGEDORN, Jake 19-18 8 1 17 31 .258 2 0-0 23 BARTELS, Bryan 18-15 5 3 13 40 .125 1 0-0 10 LINGERFELT, Kenneth 15-8 2 2 6 13 .154 1 0-0 9 LASSEN, Branden 18-13 2 0 4 20 .100 0 0-0 5 MAY, Rob 19-17 1 1 3 19 .053 0 0-0 7 WOOD, David 16-2 1 1 3 12 .083 0 0-0 21 PARRA, David 17-15 1 0 2 11 .091 0 0-1 11 GEORGE, Bryan 18-9 0 2 2 13 .000 0 0-0 19 EGLE, Paul 15-15 0 1 1 8 .000 0 0-0 3 ROSSABI, Sam 14-2 0 1 1 4 .000 0 0-0 2 CASTRO, Bobby 19-18 0 1 1 4 .000 0 0-0 14 MORROW, J.J. 16-13 0 1 1 2 .000 0 0-0 1 HURSKAINEN, Lassi 19-18 0 1 1 0 .000 0 0-0 24 KYNAST, Tim 10-3 0 0 0 5 .000 0 0-0 6 GROOMS, Kye 13-4 0 0 0 5 .000 0 0-0 15 IIAMES, A.J. 14-10 0 0 0 4 .000 0 0-0 22 LOHMYER, Hans 17-14 0 0 0 1 .000 0 0-0 27 PHILLIP, Patrick 4-0 0 0 0 0 .000 0 0-0 26 REYNOLDS, Quentin 8-2 0 0 0 0 .000 0 0-0 25 MORROW, Eli 1-1 0 0 0 0 .000 0 0-0 16 CUTTING, Joey 6-0 0 0 0 0 .000 0 0-0 4 STEMKOWSKI, Nick 2-1 0 0 0 0 .000 0 0-0 Total 19 21 15 57 192 .109 4 0-1 Opponents 19 34 29 97 346 .098 12 0-2
RECORD: OVERALL BIG SOUTH HOME AWAY NEUTRALALL MATCHES 4-12-3 3-5-1 2-3-2 2-6-1 0-3-0
TEAM STATISTICS AVL OPP
SHOT STATISTICS Goals-Shot attempts 21-192 34-346 Goals scored per game 1.11 1.79 Shot pct. .109 .098 Shots on goal-Attempts 83-192 161-346 SOG pct. .432 .465 Shots/Game 10.1 18.2 Assists 15 29 CORNER KICKS 76 146 PENALTY KICKS 0-1 0-2PENALTIES Yellow cards 19 22 Red cards 1 1 ATTENDANCE Total 1794 4146 Dates/Avg Per Date 7/256 9/461 Neutral Site #/Avg 3/159
2011 RESULTSDATE OPPONENT W/L SCORE ATT8/27 MERCER T 1-1 321 9/2 vs St. Bonaventure L 0-1 100 9/4 at James Madison L 1-4 367 9/9 at Furman L 2-3 1345 9/11 vs Coll. of Charleston L 1-2 181 9/19 BREVARD COLLEGE W 3-0 234 *9/25 at VMI L 1-2 231 9/27 at Appalachian State T 1-1 727 *10/1 at Radford WOT 1-0 271 10/4 at #3 North Carolina L 1-2 325 *10/8 HIGH POINT T 1-1 220 *10/12 at WINTHROP W 2-0 303 *10/15 COASTAL CAROLINA L 0-3 321 * 10/19 at Gardner-Webb L 0-1 215 * 10/22 CAMPBELL L 2-3 237 10/25 at Duke University L 0-3 362 *10/29 LIBERTY L 0-3 196 *11/5 PRESBYTERIAN W 4-2 265 11/10 vs #9 Coastal Carolina L 0-2 195
|-GOAL AVERAGE-| |-SAVES-|## GOALTENDERS GP Minutes GA Avg Sv Pct W L T Sho 1 HURSKAINEN, Lassi 19 1797:04 34 1.70 127 .789 3 12 3 3.0 TM TEAM 0-0 0:00 0 0.00 0 .000 1 0 0 0.0 Total 19 1797:04 34 1.70 127 .789 4 12 3 3 Opponents 19 1797:04 21 1.05 62 .747 12 4 3 6
GOALS BY PERIOD 1st 2nd OT OT2 TotalUNC Asheville 4 16 1 0 21 Opponents 9 23 1 1 34
SHOTS BY PERIOD 1st 2nd OT OT2 TotalUNC Asheville 68 116 5 3 192 Opponents 153 172 14 7 346
SAVES BY PERIOD 1st 2nd OT OT2 TotalUNC Asheville 63 58 5 1 127 Opponents 19 41 2 0 62
CORNER KICKS 1st 2nd OT OT2 TotalUNC Asheville 30 40 3 3 76 Opponents 68 70 4 4 146
FOULS 1st 2nd OT OT2 Total UNC Asheville 75 106 3 9 193 Opponents 83 99 6 2 190
/// UNC ASHEVILLE BULLDOGS ///
25/// F E A R T H E D O G ///
BIG SOUTH OVERALLTeam W L T Pts Pct W L T Pct Home Road Neu L10 Streakx-#12 Coastal Carolina 9 0 0 27 1.000 18 4 0 .818 9-2-0 6-1-0 3-1-0 8-2-0 L1Gardner-Webb 5 3 1 16 .611 9 8 4 .524 5-2-1 2-5-1 2-1-2 6-2-2 L1Campbell 5 4 0 15 .556 9 9 2 .500 4-3-1 3-5-1 2-1-0 5-4-1 L3y-Liberty 4 4 1 13 .500 11 6 3 .625 5-1-1 5-5-1 1-0-1 5-3-2 U3Radford 4 4 1 13 .500 9 8 2 .526 4-1-1 3-7-0 2-0-1 4-4-2 U2High Point 4 4 1 13 .500 9 9 3 .500 6-5-0 2-3-3 1-1-0 5-4-1 U5Winthrop 4 5 0 12 .444 7 12 0 .368 4-4-0 3-7-0 0-1-0 4-6-0 L2UNC Asheville 3 5 1 10 .389 4 12 3 .289 2-3-2 2-6-1 0-3-0 2-7-1 L1Presbyterian College 3 6 0 9 .333 3 14 0 .176 3-5-0 0-9-0 0-0-0 3-7-0 L3VMI 1 7 1 4 .167 1 15 2 .111 1-6-1 0-8-1 0-1-0 1-7-2 L3 x-Regular Season Champion y-Tournament Champion
2011 BIG SOUTH STANDINGS
FIRST TEAM ALL-CONFERENCEF - Ashton Bennett, Coastal Carolina
F - Darren Amoo, LibertyF - Iyiola Awosika, Radford
MF - Mitchell Cardenas, CampbellMF - Luis Faz, Coastal CarolinaMF - Shawn Sloan, High PointMF - Phillip Aseweh, Liberty
D - Cyprian Hedrick, Coastal CarolinaD - Pedro Ribeiro, Coastal Carolina
D - Jon Ole Reinhardsen, GWUD - Uriah Bentick, Liberty
GK - Scott Angevine, Coastal CarolinaT-AL - Kjartan Sigurdsson, Coastal
T-AL - Justin Portillo, Coastal
SECOND-TEAM ALL-CONFERENCEF - Chris Davis, Gardner-WebbF - Karo Okiomah, High Point
F - Bryan Bartels, UNC AshevilleMF - Justin Franz, Campbell
MF - John Sargent, Gardner-WebbMF - Adam Sewell, High Point
MF - Luis Grande, RadfordD - Travis Golden, Campbell
D - Jovan Ivanovich, Gardner-WebbD - Fejiro Okiomah, High Point
D - Alex Isern, WinthropGK - Lassi Hurskainen, UNC Asheville
AL - Aldo Macias, Radford
ALL-FRESHMAN TEAMRicky Garbanzo, Coastal CarolinaHenrick Robstad, Coastal Carolina
Kjartan Sigurdsson, Coastal CarolinaDenzel Clark, Gardner-WebbEric Yeager, Gardner-Webb
Josh Pacella, LibertyScott Sutarik, Liberty
Jonathan Ray, CampbellJhuvon Francis, CampbellDario Redondo, RadfordMelo Matutu, Winthrop
Grady Tremble, Winthrop
ACADEMIC ALL-CONFERENCEShawn Sloan, High PointMatt Horn, Winthrop
Bobby Keskey, Presbyterian CollegeRyan Taylor, Radford
Phillip Aseweh, LibertyJ.J. Morrow, UNC Asheville
Cyprian Hedrick, Coastal CarolinaEthan Hall, Campbell
Kyle Farmer, VMIChris Davis, Gardner-Webb
ATTACKING PLAYER OF THE YEARAshton Bennett, F, Coastal Carolina
FRESHMAN OF THE YEARKjartan Sigurdsson, D, Coastal Carolina
DEFENSIVE PLAYER OF THE YEARCyprian Hedrick, D, Coastal Carolina
SCHOLAR-ATHLETE OF THE YEARShawn Sloan, High Point
COACH OF THE YEARShaun Docking, Coastal Carolina
BIG SOUTH MEN’S SOCCER CHAMPIONSHIP
Thursday, Nov. 10 - Quarterfi nals#4 Liberty 0 ............................. #5 Radford 0
(LU advances 5-4 PKs)#1 Coastal Carolina 2 .......... #8 Asheville 0#6 High Point 3 .....................#3 Campbell 1#2 Gardner-Webb 2 ........... #7 Winthrop 1
Friday, Nov. 12 Semifi nals#4 Liberty 2 .............#1 Coastal Carolina 1#2 Gardner-Webb 0 ..........#6 High Point 0
(GWU advances 4-3 PKs)
Sunday, Nov. 14 Finals#4 LIBERTY 3 ......#2 GARDNER-WEBB 1
ALL-TOURNAMENT TEAMChris Phillips, Liberty (MVP)
Juan F. Nino, LibertyGreg White, LibertyScott Sutarik, Liberty
Scott Krotee, Gardner-WebbEric Asanin-Miroux, Gardner-WebbJon Ole Reinhardsen, Gardner-webb
Adam Sewell, High PointKaro Okiomah, High Point
Pedro Ribeiro, Coastal CarolinaKjarten Sigurdsson, Coastal Carolina
Alex Isern, WinthropMitchell Cardenas, Campbell
Lassi Hurskainan, UNC Asheville
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
26 /// F E A R T H E D O G ///
BIG SOUTH SOCCER RECORDS
Regular Season Championships
2001
The 2001 Big South Conference Regular-Season Champion, UNC Asheville Bulldogs compiled a 5-2-0 conference record.
Big South Tournament ResultsYear Opponent Round Score W/L Site 1984 Radford Quarterfi nals 0-9 L Radford, Va.1985 Winthrop Quarterfi nals 1-3 L Conway, S.C.1986 Winthrop Quarterfi nals 2-3 (OT) L Rock Hill, S.C.1988 Radford Semifi nals 0-2 L Buies Creek, N.C.1989 Coastal Carolina Semifi nals 1-2 L Asheville, N.C.1990 Augusta Quarterfi nals 5-0 W Asheville, N.C.1990 Coastal Carolina Semifi nals 1-2 (OT) L Asheville, N.C.1991 Davidson Quarterfi nals 1-0 W Davidson, N.C.1991 Winthrop Semifi nals 1-1 (9-10, PK) T Conway, S.C.1992 Charleston Southern First Round 0-3 L Charleston, S.C.1995 UMBC Quarterfi nals 1-3 L Conway, S.C.1996 Liberty Quarterfi nals 0-1 L Greensboro, N.C.1998 Liberty Quarterfi nals 0-4 L Radford, Va.1999 Coastal Carolina Quarterfi nals 0-0 (4-2, PK) T Conway, S.C.1999 Radford Semifi nals 0-1 L Conway, S.C.2000 Radford Quarterfi nals 2-3 L Lynchburg, Va.2001 High Point Quarterfi nals 0-2 L Rock Hill, S.C.2002 Radford Quarterfi nals 3-4 L Rock Hill, S.C.2003 Winthrop Quarterfi nals 1-5 L Radford, Va.2004 Winthrop Quarterfi nals 2-1 W Birmingham, Ala.2004 Coastal Carolina Semifi nals 0-1 L Birmingham, Ala.2005 Birmingham-Southern Quarterfi nals 0-2 L High Point, N.C.2006 Coastal Carolina Quarterfi nals 1-2 L Radford, Va.2007 Liberty Quarterfi nals 1-2 L Rock Hill, S.C.2008 Gardner-Webb Quarterfi nals 4-2 W Conway, S.C.2008 Coastal Carolina Semifi nals 0-1 L Conway, S.C.2009 Liberty Quarterfi nals 0-1 L Lynchburg, Va.2010 High Point Quarterfi nals 0-2 L High Point, N.C.2011 #9 Coastal Carolina Quarterfi nals 0-2 L Conway, N.C.
Big South Tournament Record By Round Win Loss Tie PctFirst Round 0 1 0 .000Quarterfi nals 4 15 1 .225Semifi nals 0 6 1 .000Finals 0 0 0 .000
Big South Tournament Record By Opponent Win Loss Tie .PctAugusta 1 0 0 1.00Birmingham-Southern 0 1 0 .000Charleston Southern 0 1 0 .000Coastal Carolina 0 6 1 .100Gardner-Webb 1 0 0 1.00Davidson 1 0 0 1.00High Point 0 2 0 .000Liberty 0 4 0 .000Radford 0 5 0 .000UMBC 0 1 0 .000Winthrop 1 3 1 .300Totals 4 22 2 .231
/// UNC ASHEVILLE BULLDOGS ///
27/// F E A R T H E D O G ///
Game RecordsGoals: 4, Mike Kachan vs. Warren Wilson, (8/30/02)Assists: 4, Mark Magee vs. Carson Newman (1988)Points: 10, Mark Magee vs. Carson Newman (1988)Shots: 11, Mat Lis vs. Toccoa Falls (1982) 11, Aytekin Yildiz vs. King (1982)
Season RecordsGoals: 20, Aytekin Yildiz (1982)Assists: 16, Mark Magee (1987)Points: 46, Aytekin Yildiz (1982)Saves: 233, Todd Cecchini (1977Shutouts: 10, Larry Cook (1983)
Career RecordsGoals: 53, Aytekin Yildiz (1981-84)Assists: 42, Mark Magee (1985-88)Points: 126, Aytekin Yildiz (1981-84)Shots: 269, Mark Magee (1985-88)Saves: 408, Larry Cook (1983-86) 408, Lassi Hurskainen (2008-11)Shutouts: 20, Larry Cook (1983)
Season Top 10Goals:1. Aytekin Yildiz 20 19822. Aytekin Yildiz 16 1983 Pat Britz 16 19884. Jimmy O’Neill 15 1984 Dan Dougherty 15 19906. Dan Dougherty 14 19897. Mark Magee 11 1986 Mike Neilson 11 19879. Scott Szymanski 9 20079. Scott Mosier 8 1991 Mark Aquista 8 1995 Kane Lawson 8 2000 Mike Kachan 8 2001 Barrett Locke 8 2002 Jake Hagedorn 8 2011
Assists:1. Mark Magee 16 19872. Jonathan Alexander 15 19893. Jimmy O’Neill 11 1983 Craig Kwiatkowski 11 19885. Ulrich Dietrich 9 1984 Mark Magee 9 1985 Jon Alexander 9 1991 8. Mike Eichner 8 1986 Dan Dougherty 8 199010. Colin Barnes 7 2000 Greg Yelverton 7 2004
Points:1. Ayetkin Yildiz 46 19822. Ayetkin Yildiz 40 19833. Pat Britz 39 19884. Dan Dougherty 38 19905. Dan Dougherty 37 19896. Jimmy O’Neill 36 19847. Mark Magee 32 19878. Mark Magee 29 19869. Scott Mosier 23 199110. Mark Aquista 22 1995 Kane Lawson 22 2000 Barrett Locke 22 2002
Saves:1. Todd Cecchini 233 1977 2. Lassi Hurskainen 127 20113. Larry Cook 126 19864. Al Winston 125 19875. Sean Gorbell 107 19946. Larry Cook 106 19847. Season Kelly 101 1982 Bill Owen 101 19899. Michael Pereira 96 200510. Al Winston 94 1988
Career Top 10Goals:1. Aytekin Yildiz 53 1981-842. Patrick Britz 37 1987-903. Mark Magee 35 1985-884. Dan Dougherty 29 1989-905. Jimmy O’Neill 25 1983-84 Kane Lawson 25 1997-20007. Mark Aquista 24 1993-968. Mike Kachan 23 2000-03 Barrett Locke 23 2002-06 Scott Szymanski 23 2005-08
Assists:1. Mark Magee 42 1985-882. Ulrich Dietrich 37 1981-843. Jonathan Alexander 30 1989-924. Patrick Britz 28 1987-905. Chip Pensa 25 1982-856. Aytekin Yildiz 20 1981-207. Matt Lis 18 1982-838. Jimmy O’Neill 17 1983-84 Dan Dougherty 17 1989-9010. Mike Eichner 16 1985-88
Points:1. Aytekin Yildiz 126 1981-842. Mark Magee 112 1985-883. Patrick Britz 102 1987-904. Dan Dougherty 75 1989-905. Jimmy O’Neill 67 1983-846. Mark Aquista 62 1993-96 Kane Lawson 62 1997-20008. Chip Pensa 53 1982-859. Mike Kachan 52 2000-0310. Mike Nielsen 51 1985-87
Saves:1. Larry Cook 408 1983-86 Lassi Hurskainen 408 2008-113. Sean Gorbell 269 1993-954. Al Winston 260 1985-885. Andrew Heath 249 1999-20026. Todd Cecchini 233 1977-807. Michael Pereira 178 2004-078. Phillip Horner 127 2004-079. Mark Robinson 123 1993-96
Shutouts:1. Larry Cook 20 1983-862. Andrew Heath 12 1999-20023. Lassi Hurskainen 11 2008-114. Sean Kelly 10 1980-825. Al Winston 8 1985-886. Ben Betsalel 7 2000-037. Sean Gorbell 6 1993-958. Mark Robinson 5 1993-969. Michael Pereira 4 2004-07
UNC ASHEVILLE RECORDS
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
28 /// F E A R T H E D O G ///
UNC ASHEVILLE TEAM RECORDSGoalsGame: 4, (3x) last by Mike Kachan vs. Warren Wilson, 8/30/02Season: 64, 1983
AssistsGame: 4, (3x) last by Mark Magee vs. Carson Newman, 1988Season: 97, 1983
PointsGame: 10, Mark Magee vs. Carson Newman, 1988Season: 46, Aytekin Yildiz, 1982
ShotsGame: 11, (2x) Mat Lis vs. Toccoa Falls, 1982, Aytekin Yildiz vs. King, 1982Season: 80, Aytekin Yildiz, 1982
WinsSeason: 14, 1984Consecutive: 5, 5x last 1996Conference: 5, 2001Consecutive: 3, 2001 and 2004
LossesSeason: 16, 1989, 1992Consecutive: 10, 2005Conference: 8, 1998Consecutive: 8, 1998
Ties4, 1974, 2008Season Winning Percentage.682 (14-6-2), 1984
Fewest Goals AllowedSeason: 15, 1982
Most Goals AllowedGame: 17, vs. Central Wesleyan, 1979Season: 84, 1981
Miscellaneous RecordsShutouts in a Season11, 1983
Largest Margin of Victory15-0, vs. Mars Hill, 2003
Largest Margin of Defeat17-0, vs. Central Wesleyan, 1979
Consecutive Games With At Least One Goal14 games, 1984
Consecutive Shutout Minutes670, 1982
Longest Unbeaten Streak10, 1984
Most Consecutive Home Wins7, 2000-01
Most Consecutive Shutouts7, 1982
Best Goals Against Average0.67, 1983
GoalKeeper RecordsSeasonMost Minutes: 2,012, Larry Cook (1984) Most Saves: 233, Todd Cocchini (1977)Best Goals Against Avg.: 0.70, Larry Cook (1983) Most Shutouts: 10, Larry Cook (1983)
CareerMost Minutes: 7,035, Larry Cook (1983-86)Most Saves: 408, Larry Cook (1983-86) 408, Lassi Hurskainen (2008-11) Best Goals Against Avg.: 1.47, Larry Cook (1983-86)Most Shutouts: 20, Larry Cook (1983-86)
Pat Britz (left) is UNC Asheville’s all-time DI leading scorer and was inducted into the UNC Asheville Hall of Fame in 2007.
/// UNC ASHEVILLE BULLDOGS ///
29/// F E A R T H E D O G ///
Year Goals Assists Points Saves1982 Aytekin Yildiz (20) Matt Lis (9) Aytekin Yildiz (46) Sean Kelly (101)1983 Aytekin Yildiz (16) Jimmy O’Neill (11) Aytekin Yildiz (40) Larry Cook (84)1984 Jimmy O’Neill (15) Ulrich Dietrich (9) Jimmy O’Neill (36) Larry Cook (106)1985 Mark Magee (6) Mark Magee (9) Mark Magee (21) Larry Cook (92)1986 Mark Magee (11) Mike Eichner (11) Mark Magee (29) Larry Cook (126)1987 Mike Neilson (11) Mark Magee (16) Mark Magee (32) Al Winston (125)1988 Pat Britz (16) Craig Kwiatkowski (11) Pat Britz (39) Al Winston (94)1989 Dan Dougherty (14) Jonathan Alexander (15) Dan Dougherty (37) Bill Owen (101)1990 Dan Dougherty (15) Dan Dougherty (8) Dan Dougherty (38) Eric Partin (90)1991 Scott Mosier (8) Jonathan Alexander (9) Scott Mosier (23) Steve McCullough (89)1992 Tony Kuster (5) Jonathan Alexander (3) Tony Kuster (10) Chris Williams (93) Greg Ives (3)1993 Glenn Nocik (7) Glen Nocik (6) Glen Nocik (20) Sean Gorbell (86)1994 Mark Acquista (5) Brad Northington (5) Mark Acquista (12) Sean Gorbell (107)1995 Mark Acquista (8) Mark Acquista (6) Mark Acquista 22) Sean Gorbell (75)1996 Joe Granack (6) Joe Granack (5) Joe Granack (17) Mark Robinson (72)1997 Kane Lawson (7) Kyle Payne (4) Kane Lawson (17) Jerry Hancock (73)1998 Kane Lawson (4) Colin Barnes (3) Kane Lawson (10) Jerry Hancock (81)1999 Kane Lawson (6) six players tied (2) Kane Lawson (13) Andrew Heath (57) 2000 Kane Lawson (8) Colin Barnes (7) Kane Lawson (22) Andrew Heath (56)2001 Mike Kachan (8) Colin Barnes (5) Mike Kachan (18) Andrew Heath (63)2002 Barrett Locke (8) Jordan Holthouser (5) Barrett Locke (22) Andrew Heath (73) Greg Yelverton (5)2003 Mike Kachan (5) Greg Garrison (4) Mike Kachan (12) Ben Betsalel (87) Jordan Holthouser (4) Greg Yelverton (4) 2004 Jordan Holthouser (5) Greg Yelverton (7) Jordan Holthouser (12) Michael Pereira (65)2005 Scott Szymanski (5) Daniel Bandoly (6) Daniel Bandoly (12) Michael Pereira (96)2006 Barrett Locke (6) Andrew Klerekoper (3) Barrett Locke (13) Phillip Horner (67)2007 Scott Szymanski (9) Ryan Haupt (3) Scott Szymanski (20) Phillip Horner (68) J.W. Gallagher (3)2008 Scott Szymanski (5) Caleb Alexander (3) Scott Szymanski (11) Lassi Hurskainen (77) Nate Neal (3)2009 Jake Hagedorn (3) Connor Holzinger (4) Connor Holzinger (10) Lassi Hurskainen (108) Connor Holzinger (3) Zachary Odum (3)2010 Jake Hagedorn (3) Colton Paschall (3) Connor Holzinger (5) Connor Holzinger (7) Lassi Hurskainen (96)2011 Jake Hagedorn (8) Bryan Bartels (3) Jake Hagedorn (17) Lassi Hurskainen (127)
All-Conference Performers
First Team
Jonathan Alexander (1990)
Colin Barnes (2000, 2001)
Kyle Britton (2001)
Andrew Delizio (1991)
Dan Dougherty (1989, 1990)
Greg Garrison (2001)
Arin Glass (1999)
Sean Gorbell (1995)
Mike Kachan (2001)
Kane Lawson (2000)
Mark Magee (1986, 1988)
Adam Stein (1995)
Greg Yelverton (2003, 2004)
Second Team
Anthony Cameron (1993)
Andrew Heath (2001)
Kane Lawson (1997, 1998, 1999)
Barrett Locke (2003)
Mike Mosley (1987)
Brad Patterson (2003)
Bernd Reichart (1998)
Nick Sands (2001)
Jeremy Shrader (2002)
Adam Stein (1996)
Jeremy Wisdo (1999, 2000)
Greg Yelverton (2002)
Edwin Wotortsi (2006)
Barrett Locke (2006)
Scott Szymanski (2007, 2008)
Edwin Wotortsi (2007)
Patrick Tate (2008)
Lassi Hurskainen (2010, 11)
Bryan Bartels (2011)
All-Tournament (Big South)
Dan Dougherty (1989, 1990)
Joe Granack (1998)
Andrew Heath (1999)
Craig Kwiatkowski (1990)
Kane Lawson (1999, 2000)
Barrett Locke (2002)
Rodney Levy (1996)
Scott Mosier (1991)
Michael Pereira (2004)Joe Srebalus (2004)Grant Gilmore (2005)Scott Szymanski (2007)Patrick Tate (2008)Alex Morrow (2008)Lassi Hurskainen (2010)
Big South Scholar Athlete Of The YearMike Roach (2001)
Jeremy Shrader (2002)
Big South Coach of the Year
Steve Cornish (1995, 2001)
Big South Rookie of the Year
Joe Granack (1996)
Kyle Britton (2001)
All-District Academic All-American
Mike Roach (2001)
First Team Academic All-AmericanMike Roach (2001)
Big South All-Rookie TeamMichael Periera (2004)Daniel Bandoly (2004)Scott Szymanski (2005)Lassi Hurskaine (2008)
J.J. Morrow (2008)
David Parra (2009)Zachery Odum (2009)Kenneth Lingerfelt (2010)
YEAR-BY-YEAR LEADERS
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
30 /// F E A R T H E D O G ///
•A•Mark Acquista 1993-96 Caleb Alexander 2005-08Jonathan Alexander 1989-92 Cameron Allison 2003-05 J. Bruce Anderson 1978
•B•Daniel Bandoly 2004-07Mike Balsamides 1984 Frank Balentine 2000 Colin Barnes 1998-01Gilbert Barrus 1976Bryan Bartels 2008-11David Basile 1997-98 David Bass 1987-88 Ben Batsalel 2000-04Tony Becvinovski Jaime Belmont 1993Bryan Benak 1985Jason Blanton 1993Mike Blanton 1976Robert Booth 1993-96 John Boshart 1986-88 John Bowman 1987 David Boyd 1994-96 Tim Branson 1980Enrique Breceda 1988Brett Breitschwerdt 2000-03 Kyle Britton 2001Pat Britz 1987-90Weston Brown 2008-11Andrew Bumgarner 2008Christopher Burn 2005-06Judson Byers 1998-99 Nicholas Baud 2004-07
•C•Ken Cagle 1980,84Anthony Cameron 1993-94Barry Campbell 1985Bobby Castro 2010-David Cave 1994-96Todd F. C. Cecchini 1978Sean Chambers 1993-94William Chamberlain 1978John Chapuis 2003-04 Scott Chesna 1993 Mark Collins 1997 Brent Connor 1978Larry Cook 1983-86John M. Councell 1976-78Shawn Culbertson 1994-96
•D•Jeff Dean 1988-89Mark DelPezzo 1982 Ulrich Dietrich 1982-84 Andrew DiLizio 1991Brian Domby 1998-2000J.J. Dore 2001-02
Dan Dougherty 1989-90 Derick Dubard 1991-92
•E•Amyt Eckstein 1979Mike Eichner 1985-88 Scott Eisenbraun 1990-91 Austin Englert 2001Josh Epstein 1999-00Rick Evans 1993-95 Brandon Eagle 2002-03
•F•Brian Fairchild 1996-99 Brad Falk 2000Hassan Farazian 1976 David Farren 1990-93 Craig Fiore 1987-90 Doug Fleck 1976
•G•Robert E. Gach 1976J.W. Gallagher 2006-08Greg Garrison 2000-03Jimmy Gentry 1987-89 Bryan George 2008-11Shelby Gibson 1990,92 James Gisborne 1997 Arin Glass 1997-00Aaron Glugover 1987 Nick Goodman 1998 Sean Gorbell 1993-95Joe Granack 1996-99Blake Griffi n 1998-2000Jim Grigsby 1976Grant Gilmore 2002-05Toby Grohne 1992Kye Grooms 2008-Karl Gunther 1984-85
•H•Jake Hagedorn 2008-11Wondwossen Haile 1978Mike Hammett 1983 Pete Hammett 1982-84Jerry Hancock 1997-98Marc Harding 1987Keith Harris 1976Aaron Harcz 2005Josh Hartmann 1997-00Ryan Haupt 2005-08John Hillman 2004-07Reagan Havens 1986Andrew Heath 1999-02Ryan Henry 1990John Heppler 1988-91Spencer Hines 1999Danny Holcomb 1989,91Walker Holcomb 1982 Norman Holland 1976Ben Hoskin 1989
Kevin Howard 1989-92 George Hudson 1980 Rodman Hughes 1978-80Lassi Hurskainen 2008-11Jeff Husel 1992Russell Hutchins 1976Jordan Holthouser 2002-04Conner Holzinger 2008-10Phillip Horner 2004-07
•I•Hasan Inan 1980-83Greg Ives 1991-95
•J•Reid Jackson 1992-94Matt Jacobs 2001-02Alex James 1983-85Cory Jarrett 1999Eric Johnson 1986Maynard Johnson 1978Harry Johnston 1978J.J. Jones 1982Nathan Jones 2006-07
•K•Mike Kachan 2000-03Frank Keller 1976-78 Max Keller 1994Seth Keller 1993Andrew Klerekoper 2004-06Alex Koslick 2010Joe Kuhn 1983-86Dan Kurtz 1987-88Tony Kuster 1992Steve Kurzer 1982 Chris Kwiatkowski 1989-92 Craig Kwiatkowski 1988-91D.J. Kwiatkowski 1994 Ryan Kohler 2003Tim Kynast 2010-11
•L•Yon Joseba Larrea 1976Branden Lassen 2008-11Chris Lawrence 1995-96Judd Lawrence 2006Kane Lawson 1997-00Kelsey Lenhardt 2005 George Lepper 1976 Rodney Levy 1995-96Kenneth Lingerfelt 2010-Andrew Linton 1978John Linton 1978Matt Lis 1982-83Jonathan London 2005Jonathon Long 2000-03Brad Lopez 1997-98Chance Lord 2005Cal Lovin 1990-93Jeff Low 1980
ALL-TIME LETTERWINNERS
/// UNC ASHEVILLE BULLDOGS ///
31/// F E A R T H E D O G ///
Barrett Locke 2002-06Hans Lohmeyer 2010-
•M•Mark Magee 1985-88Steve Magoon 1982-85 Keith Maney 1985 Ed Manning-Tano 1992-93Rico Martin 1992Alex Martin-Smith 2009 Will Matthews 2000-03 Mark Mays 1985 1987-89Benjamin Meyer 2005-08Tom C. McCartney 1978Steve McCullough 1991Doug McCurry 1976-78Thomas McMahon 1978Colby Miller 1993Alex Morrow 2006-08Eli Morrow 2010-11J.J. Morrow 2008-11Scott Mosier 1989-91Mike Mosley 1984-87James Mulder 1993-95John Murdoch 1982-84
•N•Michael Neilson 1985-87Andy Nicolson 1983-84Swan Nicolson 1984-86Patrick Noblitt 1992Glen Nocik 1993Brad Northington 1994-97Nathan Neal 2004-08Joseph Nixon 2002-03
•O•Zachary Odum 2009-10Robert Oetting 1989-91Jimmy O’Neill 1983-84Bill Owen 1989-90
•P•Keith Painter 1999-02Francisco Palalez 1987-89Paul Parce 1976-78Chris Parham 1992-94David Parra 2009-Eric Partin 1990-91Colton Paschall 2008-10Pete Paschall 1992-93Brad Patterson 2000-03Kyle Payne 1997-98Chip Pensa 1982-85Michael Pereira 2004-07David Pieniazkewicz 1996-97James Platt 1992John Pope 1982, 1984Jenkins Powell 1995-97Douglas Price 1978-80Kyle Proctor 2005
•R•Bobby C. Ransey 1978 Chris Ramsey 1976 Bernt Reichart 1998Tom Reynolds 1982 Neal Rhoades 1982-84Tyler Ridout 1996-97 Mike Roach 1999-01Matt Robbins 1999 Mark Robinson 1993-96Scott Rodriguez 1991 Markus Roeders 1987-88Chad Roland 1993Sam Rossabi 2010-Andy Rouse 1989 John Rudel 1993-96
•S•Gregg Sadelson 1982-83Nick Sands 1998-01 Trent Savidge 1987 Ben Saylor 2000-04 Steve Scheidon 1980 Jeremy Schrader 1999-01Adam Schwartz 2003-04Matt Scovil 2002-04 Frank Seidle 1982-84 Tieg Selburg 1995-97 Taylor Shanklin 2006-07David Sharpe 1976Jake Sides 2008-10 Clay Sills 1995-97Jose Siqueira 1983 Steve Sloan 1982-84Alex Smith 1982 Collin Smith 1986-88 Robbie Smith 1992 Andy Smitley 1989-92Dennis Snyder 1978-80 Jim Spratling 1987-88 John Spratling 1983-86Joe Srebalus 2002-04Jim Stahl 1978Brian Stamey 1992Adam Stein 1993-96Nick Stemkowski 2008-11Jeff Stewart 1976Shane Sullins 1986Scott Szymanski 2005-08
•T•Patrick Tate 2006-08Mike Taylor 1990Trent Thomas 1978Lance Thompson 1976Tracy Tymko 1993-96
•V•Pablo Vaca 1982David Verga 2004-07Marc Villegas 1995-99Damir Vrbljancevic 1995
•W• Brian Wade 1985Neal Wagner 1985-88Hardy Ward 1983-84Tye Warren 1991Brendan Wilbur 1994-96Chris Williams 1992-93Todd Williams 1997-98Ian Willmot 2005-06Al Winston 1985-88Jeremy Wisdo 1999-00Stephen Wiseman 1985David Wood 2009-11Steve Woody 1982-84Edwin Wotortsi 2006-07Greg Wynn 1982-83
•Y•Sho Yamagishi 2005-06Yenigan 1980Aytekin Yildiz 1982-84C. Rick Young 1978Greg Yelverton 2002-04
Current players in BOLD
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
32 /// F E A R T H E D O G ///
YEAR-BY-YEAR RESULTS SINCE 1988 1988 • Overall: 8-11-1 Big South: 3-3-09/1 at Duke L 0-89/3 at Winthrop* L 1-39/7 at Clemson L 1-89/10 at VMI L 2-59/17 Gardner-Webb W 9-19/18 Lenoir-Rhyne T 2-2 (OT)9/22 at Appalachian State L 0-29/24 Campbell* W 1-09/28 Milligan W 3-110/1 at Furman L 1-510/2 Jacksonville L 0-1 (OT)10/5 Warren Wilson W 3-010/8 Carson-Newman W 7-010/11 at Augusta* W 2-110/15 at North Georgia W 4-010/17 at The Citadel L 1-310/19 at Baptist* W 2-110/22 at Coastal Carolina* L 0-1 (OT)10/27 Radford* L 0-411/3 vs. Radford^ L 0-2 *Big South Matches^Big South Tournament Match
1989 • Overall: 6-16-0 Big South: 3-3-09/2 at Furman L 0-39/4 at Georgia State L 2-59/9 Catawba L 0-49/13 at UNC Greensboro L 1-79/16 at Davidson L 1-39/23 at USC Spartanburg L 1-29/24 Wofford L 0-39/30 at Western Kentucky L 1-510/1 vs. Central Michigan L 0-210/4 Appalachian State L 3-410/7 Coastal Carolina* L 0-310/10 at Mars Hill W 3-010/14 VMI W 6-110/15 Winthrop* W 3-010/18 at Campbell* L 1-210/21 at Baptist* W 5-110/22 The Citadel W 1-010/25 at Augusta* W 3-210/28 at Radford* L 0-210/29 at James Madison L 0-411/2 Coastal Carolina^ L 1-211/16 at Charleston L 1-2*Big South Matches^Big South Tournament Match
1990 • Overall: 9-9-2 Big South: 4-2-09/1 at Catawba L 1-29/2 Davidson W 2-19/7 vs. Morehead State W 7-19/8 at Liberty L 0-19/12 Georgia State L 0-29/15 Erskine L 1-49/19 at Appalachian State W 2-19/22 Campbell* L 1-69/26 at Augusta* W 6-39/30 at Winthrop* W 2-110/3 at Coastal Carolina* L 0-310/6 Baptist* W 2-010/7 UNC Greensboro L 2-310/10 at UNC Charlotte W 1-010/17 Charleston T 2-2 (OT)10/20 at Wofford L 1-310/23 Radford* W 2-110/24 Furman T 1-1 (OT)10/30 Augusta^ W 5-011/3 Coastal Carolina^ L 1-2 (OT)*Big South Matches^Big South Tournament Match
1991 • Overall: 9-11-1 Big South: 1-5-09/7 at Erskine L 0-29/9 Butler L 0-19/11 at Furman L 0-19/15 at Charleston L 0-19/18 at Radford* L 0-19/21 Liberty W 6-29/27 District of Columbia W 3-0 9/29 Winthrop* L 0-210/2 Appalachian State W 2-1 (OT)10/5 Coastal Carolina* L 0-210/8 at Belmont-Abbey L 0-1 (OT)10/10 at Gardner-Webb W 4-010/12 at Charleston Sou.* L 1-2 (OT)10/13 at The Citadel W 2-1 (OT)10/19 at Davidson* L 0-210//22 at Campbell* W 2-110/26 at UNC Greensboro L 2-410/28 at Georgia State W 3-211/3 Western Kentucky W 1-011/6 at Davidson^ W 1-011/9 vs. Winthrop^ T 1-1 (Winthrop wins PK’s 10-9)*Big South Matches^Big South Tournament Match
1992 • Overall: 4-15 Big South: 0-89/5 UMBC* L 0-39/7 Charleston L 1-29/12 Furman L 0-39/16 at Coastal Carolina* L 0-119/19 Campbell* L 0-29/23 at Appalachian State L 0-39/27 at Winthrop* L 0-210/1 Erskine W 2-110/3 Gardner-Webb W 2-010/4 vs. Georgia State W 2-110/7 vs. South Alabama L 0-810/10 Charleston Southern* L 1-210/11 Radford* L 1-310/16 Towson State* L 1-2 (OT)10/18 at Vanderbilt L 0-410/21 at Butler L 1-310/24 at Mercer L 1-410/28 at Liberty* L 0-411/5 Marshall W 3-1*Big South Matches
1993 • Overall: 6-12-0 Big South: 1-8-0 9/4 Appalachian State W 1-09/6 at Erskine L 3-49/11 UNC Greensboro* L 0-39/15 The Citadel W 5-19/18 at Georgia State W 3-09/19 vs. Georgia Southern W 2-19/26 Vanderbilt W 2-19/29 at Campbell* L 2-410/2 Mercer L 0-210/6 at Charleston Sou.* W 4-010/9 Liberty* L 0-210/13 Coastal Carolina* L 1-310/16 at Towson State* L 0-110/18 at UMBC* L 0-610/20 at Furman L 0-710/23 vs. Kentucky L 1-310/27 at Radford* L 0-110/31 Winthrop* L 2-3*Big South Matches
1994 • Overall: 4-12-1 Big South: 1-6-19/3 at Appalachian State L 0-19/5 Kentucky L 1-39/10 at Liberty* L 0-29/14 Georgia State W 3-09/17 Stetson L 0-39/21 Carson-Newman W 2-19/28 at UNC Greensboro* L 0-210/1 Towson State* W 3-110/3 UMBC* T 1-110/5 Charleston Southern* L 2-310/8 at Coastal Carolina* L 0-510/11 at North Carolina L 0-710/15 Radford* L 0-210/19 at N.C. State L 2-610/23 Lenoir-Rhyne W 3-110/26 at Clemson L 0-410/29 at Winthrop* L 1-3*Big South Matches
1995 • Overall: 9-11-0 Big South: 3-4-09/2 UNC Wilmington W 2-19/4 at Kentucky L 1-29/10 Wofford W 3-19/16 Coastal Carolina* W 2-19/20 Appalachian State W 1-09/23 at Stetson W 5-49/24 at Georgia Southern W 2-09/27 UNC Greensboro* L 0-19/30 at VCU W 1-010/2 at UMBC* L 1-210/7 at Radford* L 0-110/9 at Charleston Sou.* W 3-210/11 Liberty* L 0-210/14 Marshall L 3-410/16 at East Carolina L 0-210/17 at North Carolina L 0-410/21 Catawba L 1-310/25 at Georgia State L 1-210/28 Winthrop* W 1-011/2 vs. UMBC^ L 1-3*Big South Matches^Big South Tournament Match
1996 • Overall: 8-7-3 Big South: 2-2-39/1 at Clemson L 1-119/4 Georgia State L 0-29/9 Montreat W 8-09/15 Georgia Southern W 3-29/18 at Citadel W 3-29/20 East Carolina W 2-19/25 at Wofford W 4-29/28 at Coastal Carolina* L 0-210/2 North Carolina L 0-210/5 Charleston Southern* W 3-010/9 at Appalachian State W 3-110/11 Radford* W 1-010/15 at UNC Greensboro* L 2-510/19 UMBC* T 1-1 (OT)10/23 at UNC Charlotte L 0-110/27 at Winthrop* T 3-3 (OT)11/2 at Liberty* T 1-1 (OT)11/8 vs. Liberty^ L 0-1*Big South Matches^Big South Tournament Match
1997 • Overall: 6-11-0 Big South: 2-5-08/29 at Georgia State W 2-19/2 at Wake Forest L 0-19/6 vs. Cleveland State L 0-49/7 vs. Bradley L 2-3 (OT)9/13 Mars Hill L 1-49/16 Citadel W 4-0
/// UNC ASHEVILLE BULLDOGS ///
33/// F E A R T H E D O G ///
9/19 South Alabama* L 2-49/27 Liberty* L 1-310/1 at North Carolina L 0-210/4 Coastal Carolina* W 2-1 (OT)10/7 at Radford* L 0-310/10 Appalachian State W 1-010/13 Wofford W 3-210/18 at UMBC* L 0-210/22 at Charleston Sou.* L 1-310/25 Winthrop* W 1-010/29 at East Carolina L 0-1*Big South Matches
1998 • Overall 3-15-0 Big South 0-6-09/1 North Carolina L 0-39/5 at UNC Wilmington L 0-39/8 at Citadel L 2-39/16 at Appalachian State L 0-19/18 South Alabama* L 2-49/20 Georgia Southern L 0-59/16 at Liberty* L 0-39/30 East Carolina W 1-010/3 Radford* L 1-2 (OT)10/6 at Wake Forest L 0-710/10 Charleston Southern* L 2-310/13 Belmont-Abbey W 2-010/17 at Coastal Carolina* L 0-210/21 at High Point L 0-110/24 Elon W 1-010/28 at UNC Charlotte L 0-410/31 at Winthrop* L 0-211/5 vs. Liberty^ L 0-4*Big South Matches^Big South Tournament Match
1999 • Overall: 5-11-3 Big South: 1-5-19/4 at Wofford W 3-19/8 Warren Wilson W 4-09/11 at Evansville L 0-39/12 at Kentucky L 0-39/15 Georgia State L 0-49/22 Belmont-Abbey W 2-1 (OT)9/15 at VMI L 0-1 (OT)9/30 Appalachian State W 2-1 (OT)10/2 at Elon* W 2-1 (OT)10/6 High Point* L 0-110/9 Liberty* L 0-110/13 at Charleston Sou.* L 0-110/16 Coastal Carolina* L 0-110/20 North Carolina L 0-410/23 East Carolina T 0-0 (OT)10/27 Winthrop* L 1-310/30 at Radford* T 2-2 (OT)11/4 vs. Coastal Carolina^ W 0-0 (PK)11/5 vs. Radford^ L 0-1 (OT)*Big South Matches^Big South Tournament Match
2000 • Overall: 8-11-0 Big South: 3-4-09/3 at East Carolina L 1-2 (OT)9/4 Kentucky L 0-39/8 Warren Wilson W 7-09/10 VMI W 2-010/13 at Georgia State L 2-3 (OT)10/16 Charleston Southern* L 0-110/20 Citadel L 0-310/23 at Coastal Carolina* L 1-210/30 Elon* W 3-010/2 Belmont-Abbey W 4-110/4 at High Point* L 0-110/7 at Liberty* W 1-010/10 at Wake Forest L 0-710/14 Gardner-Webb W 4-1
10/18 Wofford W 2-110/21 at Georgia Southern L 3-4 (OT)10/25 at Winthrop* L 1-310/28 Radford* W 1-011/1 vs. Radford^ L 2-3 (OT)*Big South Matches^Big South Tournament Match
2001 • Overall: 9-8-0 Big South: 5-2-0 • Big South Regular Season Champs •8/31 Warren Wilson W 7-19/2 Evansville W 2-19/7 Army L 1-29/9 at Kentucky L 0-49/19 at Appalachian State L 0-59/25 at North Carolina L 0-39/29 BSC* W 6-110/3 at Wofford W 2-110/6 Liberty* W 2-110/9 at Gardner-Webb L 2-3 (OT)10/13 Coastal Carolina* W 3-110/20 at Winthrop* L 3-4 (OT)10/27 at Radford* W 2-010/31 High Point* W 4-011/3 at Charleston Sou.* W 1-011/6 at Elon* L 0-111/15 vs. High Point^ L 0-2*Big South Matches^Big South Tournament Match
2002 • Overall: 6-10-2 Big South: 3-4-18/30 Warren Wilson W 6-19/1 at Evansville L 0-29/6 vs. Western Kentucky L 0-29/8 at Louisville L 1-39/16 Gardner-Webb T 1-1 (OT)9/28 at BSC* L 3-410/4 at Liberty* W 2-1 (OT)10/6 at VMI W 2-010/9 at Furman L 0-210/12 at Coastal Carolina* L 1-2 (OT)10/14 Appalachian State L 0-310/19 Winthrop* L 2-310/23 at High Point* W 1-010/26 Charleston Southern* T 2-2 (OT)10/30 Elon* W 2-011/2 Wofford W 1-011/7 Radford* L 1-311/14 vs. Radford^ L 3-4*Big South Matches^Big South Tournament Match
2003 • Overall: 8-9-2 Big South: 4-3-08/29 at Wofford W 2-09/5 East Carolina T 1-1 (OT)9/7 Kentucky L 0-39/10 at Elon W 3-19/16 at Appalachian State L 0-29/19 Furman T 0-0 (OT)9/24 at Winthrop* L 0-29/27 at UNC Wilmington L 0-210/1 Coastal Carolina* W 2-110/4 at VMI* W 3-2 (OT)10/7 at Radford* W 1-010/10 BSC* L 0-310/12 Belmont L 0-110/18 Long Island W 2-1 (OT)10/23 Longwood W 1-0 (OT)10/29 Liberty* L 1-211/5 High Point* W 1-0 (OT)11/8 at Campbell L 2-3 (OT)11/13 vs. Winthrop^ L 1-5*Big South Matches
2004 • Overall: 7-10-2 Big South: 3-4-09/1 at Gardner-Webb W 2-0 9/4 Elon T 1-1 9/10 at Kentucky L 1-3 9/15 Radford* W 3-2 9/19 at East Carolina L 0-3 9/22 at High Point* W 3-1 9/26 UNC Wilmington L 0-2 9/28 at Coastal Carolina* W 2-1 10/6 at North Carolina L 0-3 10/9 VMI* L 0-2 10/16 at BSC* L 1-2 10/20 at Duke L 0-2 10/26 Winthrop* L 0-4 10/29 at Liberty* L 1-3 10/31 at Longwood W 1-0 11/3 Wofford W 4-1 11/6 Appalachian State T 1-111/11 vs. Winthrop^ W 2-111/13 vs. Coastal Carolina^ L 0-1*Big South Matches^Big South Tournament Match
2005 • Overall: 2-15-1 Big South: 1-6-09/9 Belmont T 2-2 (OT) 9/11 Lipscomb L 1-2 9/18 at UNC Wilmington L 3-6 9/21 at Appalachian State L 2-3 9/25 Birmingham-Southern* L 1-3 9/28 at Wofford W 1-0 10/1 at Charlotte L 0-3 10/5 High Point* W 3-0 10/8 at Radford* L 1-3 10/12 at Davidson* L 1-2 10/15 at VMI* L 1-2 (OT) 10/17 Campbell L 1-3 10/22 Coastal Carolina* L 0-1 (OT) 10/25 at Clemson L 0-5 10/29 Liberty* L 0-2 11/2 at Winthrop* L 0-4 11/5 Gardner-Webb L 0-211/10 vs. Birmingham-Sout.^ L 0-2*Big South Matches^Big South Tournament Match
2006 • Overall: 5-13-0 Big South: 2-5-08/25 Charlotte L 1-29/2 at Campbell L 1-39/6 Wofford W 5-09/9 Kentucky L 0-59/15 at Belmont L 0-39/17 at Lipscomb W 2-09/20 Appalachian State W 2-19/23 at Elon L 1-29/26 at Coastal Carolina* L 0-19/30 Radford* W 2-110/4 Winthrop* L 1-2 (OT)10/10 at High Point* L 2-3 (OT)10/14 at Liberty* L 0-210/18 at Clemson L 1-310/21 VMI* W 1-010/23 at Gardner-Webb L 0-110/28 at Birmingham-Sou.* L 0-111/2 vs. Coastal Carolina* L 1-2 *Big South Matches^Big South Tournament Match
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
34 /// F E A R T H E D O G ///
2007 • Overall: 4-12-1 Big South: 0-6-08/31 vs. IUPUI W 4-39/2 at Kentucky L 0-39/16 at Furman L 0-59/19 Elon L 0-29/22 Campbell L 1-2 (2OT)9/25 Presbyterian T 3-3 (2OT)9/29 High Point* L 0-1 (OT)10/3 Coastal Carolina* L 0-510/6 at VMI* L 0-210/9 Clemson W 2-1 (2OT)10/13 at Radford* L 0-210/15 at Wofford L 0-110/18 Liberty* L 0-210/31 at Winthrop* L 1-2 (OT)11/4 at Appalachian State W 2-111/7 Gardner-Webb W 4-011/15 vs. Liberty^ L 1-2*Big South Matches^Big South Tournament Match
2008 • Overall: 7-8-4 Big South: 3-3-29/6 Appalachian State L 0-19/12 at Elon L 0-1 (OT)9/14 vs. UNC Greensboro T 1-1 (2OT)9/16 Longwood W 3-29/19 vs. Belmont W 3-29/21 at Lipscomb L 1-39/27 Kentucky T 0-0 (2OT)9/30 at North Carolina L 1-210/4 VMI* W 2-1 (OT)10/7 at Presbyterian* W 2-110/11 Radford* L 1-210/15 Gardner-Webb* L 1-210/22 at Coastal Carolina* L 0-110/25 Winthrop* W 1-010/28 at High Point* T 1-1 (2OT)11/1 Wofford W 2-111/8 at Liberty* T 0-0 (2OT)11/13 vs. Gardner-Webb^ W 4-211/14 at Coastal Carolina^ L 0-1*Big South Matches^Big South Tournament Match
2009 • Overall: 6-12-2 Big South: 2-5-19/1 at #1 North Carolina L 0-5 9/4 BREVARD W 3-0 9/7 at Wofford T 0-0 (2OT)9/11 at Davidson L 0-2 9/13 vs Georgetown L 0-2 9/16 USC Upstate L 1-2 9/18 vs Lipscomb W 2-1 9/20 vs Belmont W 2-2 (2OT) 9/27 at #20 Kentucky L 1-3 9/29 ETSU W 1-0 9/03 HIGH POINT* L 1-2 10/6 PRESBYTERIAN* T 2-2 (2OT)10/10 at Radford* W 1-0 10/17 at VMI Keydets* W 2-1 10/24 at Winthrop* L 1-3 10/28 at Gardner-Webb* L 1-2 10/31 COASTAL CAROLINA* L 1-2 11/3 at Appalachian State L 0-2 11/7 LIBERTY* L 1-2 11/13 vs LIBERTY^ L 0-1 *Big South Matches^Big South Tournament Match
2010 • Overall: 4-13-1 Big South: 2-6-09/3 vs IUPUI L 1-3 9/5 vs Eastern Illinois W 3-0 9/8 BREVARD COLLEGE W 3-0 9/17 at Lipscomb L 0-2 9/19 vs Belmont L 1-2 9/22 at USC Upstate L 0-19/25 at ETSU L 1-2 (2OT) 9/29 GARDNER-WEBB* L 0-3 10/2 at Longwood T 1-1 (2OT) 10/5 at Presbyterian College* W 2-1 (OT) 10/9 RADFORD* L 1-4 10/13 at Coastal Carolina* L 0-1 (2OT) 10/16 at High Point* L 0-3 10/23 VMI* L 1-2 10/30 WOFFORD L 0-2 11/3 WINTHROP* W 1-0 11/6 at LIBERTY* L 0-2 11/11 vs High Point^ L 0-2 *Big South Matches^Big South Tournament Match
2010 • Overall: 4-13-1 Big South: 2-6-08/27 MERCER T 1-1 (2OT) 9/2 vs St. Bonaventure L 0-1 9/4 at James Madison L 1-4 9/9 at Furman L 2-3 9/11 vs Coll. of Charleston L 1-2 9/19 BREVARD COLLEGE W 3-0 *9/25 at VMI L 1-2 9/27 at Appalachian State T 1-1 (2OT) *10/1 at Radford W 1-0 (OT) 10/4 at #3 North Carolina L 1-2 *10/8 HIGH POINT T 1-1 (2OT) *10/12 at WINTHROP W 2-0 *10/15 COASTAL CAROLINA L 0-3 * 10/19 at Gardner-Webb L 0-1 * 10/22 CAMPBELL L 2-3 10/25 at Duke University L 0-3 *10/29 LIBERTY L 0-3 *11/5 PRESBYTERIAN W 4-2 ^11/10 vs #9 Coastal Carolina L 0-2*Big South Matches^Big South Tournament Match
Lassi Hurskainen starred for the Bulldogs in goal from 2008-11 and is tied for fi rst in career saves with 408.
/// UNC ASHEVILLE BULLDOGS ///
35/// F E A R T H E D O G ///
ALL-TIME RESULTSTeam W L T Last MeetingAppalachian State 7 11 2 Sept 27, 2011 Army 0 1 0 Sept. 7, 2001 Augusta 4 0 0 Nov. 1990 Belmont 2 3 1 Sept. 19, 2010 Belmont Abbey 3 0 0 Oct. 2, 2000 Birmingham-Southern 1 6 0 Oct. 28, 2006 Bradley 0 1 0 Sept. 7, 1997 Brevard 3 0 0 Sept. 19, 2011Butler 0 1 0 Oct. 1992 Campbell 1 7 0 Sept. 22, 2007 Carson-Newman 2 0 0 Sept. 21, 1994 Catawba 0 3 0 Oct. 21, 1995 Central Michigan 0 1 0 Oct. 1989 Charleston, College of 0 3 1 Sept. 11, 2011 Charleston Southern* 6 6 1 Oct. 26, 2002 Charlotte 1 4 0 Aug. 25, 2006 Citadel 3 2 0 Oct. 20, 2000 Clemson 1 5 0 Oct. 9, 2007Cleveland State 0 1 0 Sept. 6, 1997 Coastal Carolina 5 23 1 Nov. 10, 2011 Davidson 1 2 0 Sept. 11, 2009 Duke 0 3 0 Oct. 25 2011 East Carolina 2 3 2 Sept. 19, 2004 East Tennessee State 1 1 0 Sept. 25, 2010Eastern Illinois 1 0 0 Sept. 5, 2010 Elon 5 4 1 Sept. 12, 2008 Erskine 1 1 0 Oct 1, 1992 Evansville 1 2 0 Sept. 1, 2002 Furman 0 6 1 Sept. 9, 2011 Gardner-Webb 6 7 1 Oct. 19, 2011 Georgetown 0 1 0 Sept. 13, 2009Georgia Southern 2 2 0 Oct. 21, 2000 Georgia State 3 6 0 Oct. 13, 2000 High Point 5 9 2 Oct. 8, 2011 IUPUI 1 1 0 Sept. 3, 2010Jacksonville 0 1 0 Oct. 2, 1988 James Madison 0 2 0 Sept. 19, 2011 Kentucky 0 10 1 Sept. 27, 2009
Team W L T Last MeetingLenior-Rhyne 1 0 1 Oct. 23, 1994 Liberty 3 18 2 Oct. 29, 2011 Lipscomb 2 3 0 Sept. 17, 2010Long Island 1 0 0 Oct. 18, 2003 Longwood 3 0 1 Oct. 2, 2010 Louisville 0 1 0 Sept. 8, 2002 Marshall 1 1 0 Oct. 14, 1995 Mars Hill 1 1 0 Oct. 13, 1997 Mercer 0 1 1 Aug. 17, 2011 Milligan 1 0 0 Oct. 1988 Montreat 1 0 0 Sept. 9, 1996 Morehead State 1 0 0 Sept. 1990 North Carolina 0 9 0 Oct. 4, 2011 North Carolina State 0 1 0 Oct. 19, 1994 North Georgia 1 0 0 Oct. 1988 Presbyterian 3 0 2 Nov. 5, 2011Radford 9 16 1 Oct. 1, 2011 St. Bonaventure 0 1 0 Sept. 2, 2011South Alabama 0 3 0 Sept. 18, 1998 Stetson 1 1 0 Sept. 23, 1995 Towson State 1 1 0 Oct. 1, 1994 UMBC 0 4 2 Oct. 18, 1997 UNC Greensboro 0 5 1 Sept. 14, 2008 UNC Wilmington 1 3 0 Sept. 26, 2004 USC Upstate^ 0 3 0 Sept. 22, 2010 Vanderbilt 0 1 0 Oct. 1994 Va. Commonwealth 1 0 0 Sept. 30, 1995 VMI 7 6 0 Sept. 25, 2011 Wake Forest 0 3 0 Oct. 10, 2000Warren Wilson 5 0 0 Aug. 30, 2002Western Kentucky 0 2 0 Sept. 6, 2002Winthrop 8 15 1 Oct. 12, 2011 Wofford 11 4 1 Oct. 30, 2010
Bold indicates 2009 Opponents
*Formally Baptist College^Formally USC Spartanburg
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
36 /// F E A R T H E D O G ///
UNC Asheville’s Athletics Hall of Fame was established in 2003 and has had fi ve classes inducted. A total of 24 athletes and administrators have been enshrined. Of those 24 inductees, three are former men’s soccer players: Ulrich Dietrich, Patrick Britz, and Aytekin Yildiz.
Ulrich Dietrich (1981-84)Inducted in 2005
Ulrich Dietrich was a four-year letterman on the men’s soccer team from 1981-84. He was a starter in the midfi eld his entire career and helped lead the Bulldogs to three straight winning seasons. Dietrich was an All-South and All-District performer for three years and was a NAIA All-American nominee. He fi nished his career second all-time in assists with 37 and ninth in points with 51.
Patrick Britz (1987-90)Inducted in 2007
Patrick Britz was a four-year letterman for the men’s soccer team and is UNC Asheville’s Division I leader in goals with 37 and points with 102. He was nationally ranked in goals scored (16) and points (39) in 1988. Britz was an all-conference selection as a sophomore and was a Big South All-Academic selection for four consecutive years. He was an Academic All-American nominee for three years. Britz is currently the commissioner of the South Atlantic Conference.
Aytekin Yildiz (1982-84)Inducted in 2008
Aytekin Yildiz is UNC Asheville’s all-time offensive leader for men’s soccer with 53 goals and 126 points. He holds the single-season record for goals with 20 and points with 46. He was an NAIA All-District selection in 1982 and 1983 and helped lead the Bulldogs to the District 26 title game in 1984. Yildiz is a Hotelier and Hospitality Specialist in the Charlotte area.
UNC Asheville Hall of Fame Herb Coman, Football Coach/ADBob Hartman, MBB CoachJim McElhaney, Men’s BasketballSheila Ford Duncan, WBB BasketballIlona Fekete Thimmer, VolleyballEd Harris, Men’s Basketball CoachJerry Green, Men’s Basketball CoachKim Duncan, Women’s BasketballBrian Shehan, BaseballTom Hunnicutt, Athletics DirectorJenee Cross Daniely, Women’s TennisUlrich Dietrich, Men’s SoccerMickey Gibson, Men’s BasketballMike Grace, Men’s BasketballPatrick Britz, Men’s SoccerDanielle Meyer Harrison, VolleyballJill Young Booth , Women’s SoccerPaul Allen, Men’s BasketballDave Hart, ContributorElissa Mount, VolleyballRebecca Gallaher, Track and FieldBamford Jones, Men’s BasketballTrish Wyatt, Women’s BasketballAytekin Yildiz, Men’s SoccerMarc Rosenbalm, BaseballJosh Pittman, Men’s BasketballLorelee Smith, VolleyballHelen Carroll, Women’s BasketballGeorge Gilbert, Men’s BasketballMackenzie McCoy, Women’s SoccerTy Wiggington, Baseball
UNC ASHEVILLE HALL OF FAME
A
A
A
/// UNC ASHEVILLE BULLDOGS ///
37/// F E A R T H E D O G ///
Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”
The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.
During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.
In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.
Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.
In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.
In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.
Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.
The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.
THE BIG SOUTH CONFERENCE
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
38 /// F E A R T H E D O G ///
BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100
Charlotte, NC 28226Phone: (704) 341-7990
Fax: (704) 341-7991www.BigSouthSports.com
Founded 1983
PresidentPenelope W. Kyle, Radford University
Vice PresidentDr. Frank Bonner, Gardner-Webb University
SecretaryDr. Anne Ponder, UNC Asheville
CommissionerKyle B. Kallander
Associate CommissionerJames Companion
Associate CommissionerDawn Turner
Assistant Commissioner - Public RelationsMark Simpson
Assistant Commissioner - MarketingChad Cook
Director of Multimedia DevelopmentMark Bryant
Offi ce ManagerTerri Ballard
Assistant Director of MarketingMatt VanSandt
Assistant Director of Public RelationsNic Bowman
Assistant Director of ComplianceSherika McLean
Marketing AssistantMelissa Estepp
Public Relations AssistantBriana Mayes
Administration/Multimedia AssistantEarl Laing
Coordinator of Football Offi cialsDoug Rhoads
Coordinator of Men’s Basketball Offi cialsJoe Forte
Coordinator of Women’s Basketball Offi cialsCharlene Curtis
Coordinator of Baseball UmpiresTony Thompson
Coordinator of Softball UmpiresBetsy Kidd
Coordinator of Men’s Soccer Offi cialsPaul James
Coordinator of Volleyball Offi cialsDaniel Leake
Member Institutions (12): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Longwood University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University
Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (4) – Liberty University, Longwood University, Radford University, Virginia Military Institute
Associate Members: Stony Brook University (football), Davidson College (women’s lacrosse)
Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Women’s Lacrosse, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball
Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; Marge Connelly, Longwood; Dr. Claude Lilly, Presbyterian; Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop
BIG SOUTH QUICK FACTS
/// UNC ASHEVILLE BULLDOGS ///
39/// F E A R T H E D O G ///
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
40 /// F E A R T H E D O G ///
/// UNC ASHEVILLE BULLDOGS ///
41/// F E A R T H E D O G ///
ABOUT THE UNIVERSITY As the University of North Carolina at Asheville celebrates eighty years of excellence in higher education, the campus community welcomes new challenges and greater successes as one of the nation’s leading liberal arts colleges. From its beginnings as Buncombe County Junior College, where 86 students enrolled in 1927 to further their educations beyond high school, the University has valued liberal arts ideals and community engagement. Its special commitment to student learning and undergraduate education was reaffi rmed when it joined the University of North Carolina system in 1969 as the University of North Carolina at Asheville. The University maintains its liberal arts imperative, as the designated undergraduate liberal arts University of the 17-campus University of North Carolina system.
Vision
UNC Asheville students, within a diverse and inclusive community, experience liberal arts education at its best.
Mission
UNC Asheville is distinctive in the UNC system as its designated liberal arts university. Our practice of the liberal arts emphasizes the centrality of learning and discovery through exemplary teaching, innovative scholarship, creative expression, co-curricular activities, undergraduate research, engaged service, and practical experience. Primarily undergraduate, UNC Asheville offers a liberal arts education characterized by high quality faculty-student interaction. We offer this challenging educational experience to all promising students who are committed to liberal learning and personal growth.
Our liberal arts educational approach emphasizes life skills including critical thinking, clear and thoughtful expression, and honest open inquiry. Students undertake concentrated study in one area while simultaneously developing an understanding of the connections among disciplines. We encourage students to clarify, develop and live their own values while respecting the views and beliefs of others. In addition, we cultivate an understanding of the dimensions of human diversity while recognizing the common humanity of all. We believe a quality liberal arts education enables our graduates to be lifelong learners and to lead successful, fl ourishing lives as leaders and contributors to their communities.
At UNC Asheville, we respond to the conditions and concerns of the contemporary world both as individuals and as a university. We incorporate economic, social and environmental sustainability into our institutional practices and curriculum. With a range of associated centers, partnerships, and initiatives, we fulfi ll our public responsibility to address the needs of our community through a continuum of learning. We develop a commitment to continuing service characterized by an informed, responsible, and creative engagement with the Asheville area, the southern Appalachian region, the state of North Carolina, and a diverse and increasingly connected world.
Alma Mater
In 2000 the university community set about the task of writing a new Alma Mater—the offi cial anthem of UNC Asheville, sung at all ceremonial events—to replace the one from the 1960s. In Latin, alma mater means “nourishing mother,” and it also refers to the school one attended.
Hail Our Alma Mater, Hail UNCA.
Learning be your watchword,Greatness be your way.
High upon the mountains,In the Land of Sky,
Stands our Alma Mater,Lift your voices high.
Noble Alma Mater,Hear our words of praise.
May we love and honor you,Until the end of days.
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
42 /// F E A R T H E D O G ///
WWWWWiWWiWiWiWWWWiWiWiWiWWW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCNCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC A AA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhshs eveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn ss s s ssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuuppppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt tttttttttttheheheheheheheheheheheheheheheheheheehehhheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolina a a a a syssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 333 3 3330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarrartststststststststststststststssssssss, , , , , , , ,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscssccieieieieieieei ncnce e eaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillilililiiiiiiiiilibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....
HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s
AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 2020202020202020
MoMoMoM ststst P Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchhhhhhchc oooololoololooolooololololooolololooo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititititittererererereere atatataturururureeee,e,ee,e, EEEEEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnnonnnnnnnnnnno mmmemememeeeeeememeememeeeem ntntntntntnntntntnntnntnnnnnnntnntnn alalalalalallalalalalaallllalallallalalaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuutututututututtututututututtuuutuuuudididdidididididdidddididdididdididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,, HeHeHeHeHeealthth &&&& &&&& W W WWWWWWWWWWWWWWWele lnnesess ssPrPrromomommotototo ioioioionn,n, aaandndndd A A A AAAAAAAAAAAAAAAAAAAAAAArtrtrttttrtrtrtrtrtrttrtrtrrrtrtrtrtrtrttrrtrtt
FuFuFuF llbllbblbblblbbbbbbblllllblbllbbl riririgghgghghghghhhhghghhgggghhgghgghhgg t t AAAAAwAwwwwwAwAAwAAAA arararardsdsdssssssssssssdssss: ::: ::: :::: 37373737373737773773773737377773737373737373737373377 s s tttutututut ddddeeeeeeeeeeeeeed ntntntntntntntntnnnn s s hhavev reeeeeececececceceieiiiiieieieiieivvvveveved ddddddd ddd ddd ththththhhhhhhhhe e prprprprprprprrprpprrrprprrp eseseseseseseseseesesesseseseeesttitititttttttttt gigigigiououououous s s s awaaawawawawawawawwawawawawawawawawawawawwawararaararrrrrarrarararaararraarara ddd
UnUnUnUnUnUUnnnnnUnnnUnddddedededddddededdergrgrgrgrggrgrgggrggrgrgrgrggrggggraraaaaaaaaaaaaddduduuududduatatatatatatataaate eeeeee e ReReReRReReReRR seseseseseeararararchchchhc :: ::::::: MoMooooreree tt thahahan hhhahahahaahahhhhalfffflfflffff oo oof f fffffff ststsstststtstsstuuududdudududdu eeeeneeneneneeneee tststsststss ccc c c ccc c cccccccccccc cccccomomomo plpplplpp eteetetetettetettetettette eeeeeeeee eeeee eeeeeeee orooororrorrrorrororororrrrrroooo igigggginininininininininininiinii aaaaaaaalalaaalalaaa r rrrrrrrrrrrrrrreeeseeseesessssseseesseeesseeeaeeaeaeaeaeaeaeaaae rcrrcrrrcrcrcrcrcrcrcr hhhhhhhhh h hh hhhhhhhhhhhhhh iniinininininnnininininniininiinnniiinnninniinnninnnn t ttt ttttt tttttttttttttttttttttthhhhhhhehehehhhehhhehheh iriririrrr fi fi fi fififififi e ee e e eeeldldlddld o oooof f f fffffff stststststttudududududududduddy y y yyy yy y ythththrorougugh hh thththhhthhthhhthhheeeeeeeee e UnUnUnUnUnUnUnUnUnUUnUUnnivivivivivivivviviviiverererererererereerersisisisisss tytytyyyyyyyyyyyy’s’s’s’s nnnnnnnnn nnaaaatataatioioionananalllllly y y rrrrrerererr cooooococcoooogngngnnngngngngggggg izizziziiizizzizizi edededdedededededddeddedddd U U UUUUU UU UUUUU UUUUUUUUUUUUUndndndndndndndnndndndnddnndndnddndndnddndndndddddderereeereererererereeeeerereeereeeerereeerereee grgrgrgrrgrgrgggggggg dadadadadadduuauuuauauauauauuuauaaaauaaaateteteteteteeeteteteeeteeeetetetttttttttteee R Reeeseseseseseseseseseseesesseeseeseeseseeseesseeseeseseseesseeeeeeaeaeaaeeeaeaeeeeeeeeaeeeae rrrcrcrcrcrcrcrcrccrccrcrcrrrrccrcrccchhhh hh hhhhhhhhhhhhh hhhhhh hhhhhhhhhhhhh PrPrPrPrrrrrrPrPrPPPPrrrP ogooogogogogogogogogogogooogoooggogoogoogogggoogogogogooggoo rararaaarararararararaaararararararaaraaraarraaraaarararaaaar mm.mmm.m.mm.m.mmmmmmmmmm.mmmmmm.mmmmmmmmm UUUU NCNCCCC AAAA A AAAAshshshshhhhhevevevvvililillililllelelelelelelee ffofoooooooof unundeeeeeeeeed d ttththhthhhheeee e NaNaNaNaNaNNNaNaNaNaaaaaNaaaatitititititit onononononnonoono lallalalllla CC CCCCCCCCCCCCCCCononononnonononooo fefefefeferrerer ncnce e e onoo UUUUUUUUndndndndnndndndndnnnn errrrererrrrggrgrgggg aadadaadadadddadaa uauauuuauauaaaauauuaauaaaauaaauaauatttttteteteteetttetttttt R R RRR RRRRR RRRRReseseeeesesesesesessssesesseseseseeseeeeee eaeaeaeaeaeeaeaeaeaeaeaeaeaeaeaeaeaeaeearcrcrccccrcrcrrcrcr hhhhhhhhhhh h h hhhhh mmomore tthahan n 25222222225255552522522222522525255555222 yy yyyeaeeeaeaeaeeaeaeeaeeaeeeeeaeeeeeeaearsrrrsrsrsrsrssrsrssrsrsrssrrrrsrsrssrrrsrssrssssss aaaaaaaa aaaaaaaaaaaaaa gogggggggogogogogoggogogggogogogoggogogggggggggggg .
StStStStSStStStStS udddududududddduuduudududyy yyyyyy yy yyyyyy yyy AbAbAAA roorooooooooooaaaaaadddda a aaaaaaaaaaaaaaaaaandndndndddndddddddndndndndndndndnndnnndnnddndn SSS SSSSSS SSSSSSSSSSSttuttuututututututututttt dddydydyddyddydddydyyddydyy A AA A AAAAwawwaww y:y: 1 17 77 pepepeeeeeercrrr eeeeeenenneenee t t tt oofofffooooooo s sssssssssstutututuuuuuuuudddddddddededdddedddddddddddddddd ntnnnnnnntntnnnnnnnnnnnnnntn sssss ssssssss tatatatatataaaatataataaaaaaaaaaakekekekkekekekekekekekekekekeke a aaa aaaa aaadddddddvdvdvvvvvdddvvdvvvvvanananannanannnnnnanananananannanaa tatatatatatatatatataaaaaaaaaagegegegegegegegegegegegegegegegegeegegegeee o oooo oo o o o o oo oooooff ff ff f ff f fff f ff leleleleleeelelellelelellleeeleeeleeleeeleleeararararararararaararaaa ninininininininnininnininnnnniniiin ngngngnnngngngngngngnnnngngnngngngnnngnnnngnnnngnnnnnnnnggnnggggngg ooooooo oooooooooooopppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp ororooooooooooooooo tututututtttutuutuuutttutttttutututuutuutuuuuutuututuunininininininn titititttt esessssss i i in nnn n n nototoototottototoototo heheheheheeheheeheeh r r rrrrr ststststststtststtsttatatatatatttatatatttteseseseeseseeseseeeee aaaanndndddddddddndddddddddddd ccccc cccccccccccccccccccoououoooooo ntntnnntntnttntntntntnttrrriririrrrrirrriirirriir esesess w whihihilele e enrnrnrololollllllllelelelellleeeleel ddd ddddddddddddd atatataatatattat UUUU UUUUU UU UUNCNCNNCNNCNCCCCNCNCNCNNCNCNCNCC A A AAAAAA AAAAAAAA AAAAAAAAAAA Ashshshshhshshhhhshhshshshhhshshhhhhshhsshs evevevevevevevevevvevevevvvevevvveveveeveve ililililillllliillililiiililleleleleleleleleeleleleelee... .
StStS ududenenenenenenttt ttttt AAAtAtAAtAtAthlhlhlhlhlhlhlh eteeetteettte e eee GGGrGrrGGGrrG adadadadadadaaduauuauauauauauaaaaaatititititititiititittitit ononononoono RRRRR R RR Ratatattttttattattatatattttattteeeeee::ee:eeeee:ee:ee UUUUU U UNCNNCNNCNNCNCNCNCNC AAAAA AA Ashshsshshshshevevevevevevvililililili lellellelele s sssss stututudeddentnnnntnnntnnnnnnnnnnnnn -a-aaththtththhthththhhthhthhhhlleleleleeeelelelelleeleletetetetetetetetetetetetettteteeeeteteeteteteetessssssssssssssssss s sss hahahahahahahhahahahahahahhahaahahahahhahahhhhahahaahhh vevevevevevevvevvevveveveveveveevev o oo ooooonenennn o of f hththe e hihighghg esest t grgrrgrgrgrgrgrrgrrradadadadadaadaaaada uauauuatitittionononon rararrarrraatetetetetet ss s sss iiniiininininnin tt t t ttthhhehehehehe NNNNN NN NCACACACACACACACAA.A.A.A.A.A.A.AAA O O OOOOurururururururu ssssss sstutututututudedededededentntntntntntnn aa-a-a-athththtthleleleteteetes s sss ononononon a a a aaththleleetitiiititicc c scscscscscscscchohohoohohoohohooooooholalalalllallalalalalaarrsrsrsrsrsrsrshihhihihhhhihihhhihih pspsps wwhoho p plalay yy alalalaa ll fofofooofourururrurururrururrurrurur yyyyy yyy yyyeaeaeearsrs aaattt UNUNCC C AsAsAsAsAshehehhevivivilllllle e hahahahavevevve a aaa 9 9 9 99 9 9 pepepepepeercrcrcrcrcrcenenenene tt ttt grgrgradadadadaaduauauauauatiitititioonon rrratatate.e..
FaFaFaFaFaFaFaFaFFFFFFFaFacuccucucuucuc ltltltltlltl y:y:y:y:yyyyyyy 222222 2 210101001000010101010 fffff ffulululluluullll-l-l-l--l-l-ll titititititit memememememememeeeeee ff fffffffffacacacacacacaaaaculululullululultytytytytytytytyyyyyy mm m m m mmmmmmmemememememememmememeeee bebbebebebbebbebeersrsrsrrsrsrssrsr , , , ,, 84848484484848484848484%%%%%%%% % % wiwiwiwithththtththhht ttt tttttereeerererererrrmimimimimimmmimiminanaaal l l dedededededeedegrgrggrgrgggrgrggg eeeeeeeeeeeeees s
COCOPLAC: UNUNC C AsAshehevivilllle isiis t thhehe hh heaeadqddquauauartrtereers s s fofor the e CCoununcicil l of PPububblilicc c Liberal l Artsts C Coolleges, aa 2727-mmemembeber r orgagaaninizazazattition of state-supppporteed libebeberall arts collegegeges that rrrececogogninizeze tt theee immpmportancncncee e ofoff liberal l arartsts a andnd s sccicieneenceccess ededucucattiion fof r succesee s ss innn aa comom lplexex g gloloobabab l sosocicietetety.
CCCCaCaCaCaCaCCCCCaCCCCaCaCampmpmpmpmpmpmpmpmpmpmpmpmpppppus LifeRReReReReReReReReResisisisisisiiisisidededededededeedeeencncncccccncccnccncncncnnce e eeeeeeeeee Haalllls:s: AAboboutut oonene-t-thihirdrd o of f ststududenentsts l livive e onon c camampupus,s, w whiiiileleleeeeeeeeeleleleeleelelee a a a a aaa a aa aaaa aaaaaaannonononnnononononnooonoononnoonnnononnnonnn ththththththththththththththththththtthththhthhhththhherererererererererererererererererererereeerrerrrr t t t tt tt t t t tt t ttt t ttttt tt ttt tthihihhihihihihihihihihihihihihihihihhhhhhhihhihiih rdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrdrdrdrdrdrdrdrddr ll l ll l ll ll l lll l ll l lliviviviviiiivivivivivivivivivivive withthinin aa one-mile rarararaaadididididddiddd usususususus o o o ooffff ff ff cacacacacacaaaaaaccaaacccc mpmpmmmmmmmmmm usus.
AtAtAtAAAAAthlhlhlhlhlhlletetetee icicicics:s:s:ss:s:: 1 115 5 5 5 NCNNNCNCNCNCNCNCNCCCCCCCCCCCCCNCAAAAAAAAAA D Divviision 1 1 tetetetetetetetetetetetetetetttttteteteteamamamamamamammamamamamamamamaaaaaaaaaaaa sss
StStStStStStSttStStStStududududdududududududeneneneneeneneneneenenene ttttttttttt t GrGrGrGGrGrGGrGrGrGrGrouououououououououououpspspspspsppps:: :: MoMoMoMoMooMoMoMoMoMooorrererrererereeererereererrerererrerrererererr t t t t t tttthahahhahahahahahahaaahahahahahaahaaan n n nnnnnnnn 60606060606060600000 c ccccccccccccccccccccclulululuululululululuulululuuuululululullubsbsbsbsbsssbsbssssbssbsbsbsbsbsbsbssbsbsbsb a a aaaaa aa aa a aaaaaaaanddndndndndndndndndndnddddddndndddnd ooo oooooo oo o oo oooooo ooooooorgrgrgrgrgrgrgrgrgrgrgrrgrgrgrrgrgrgrgggananizzata ioionss, raaaaaaaangngngngngngngngngngnggngngnngngnngnggngngng ninininininininininininninininininiiininniinnggg g ggg ggg g g gggggggg ggg g ggggggggggg g frfrfrfrfrfrfrfrrfrfrfrfrfrfrrfrfrffrfrrfrffrfrrrrromomomoomomomomomomomomomomomoomomommommomoooomoommomomomomo hh hhh h hh hhononononononoroorororororo s s s s ssococococococieieieieietititititiesesesess ttttttttttto o o oo oo iniinininnninintrtrtttrtrtrrtrrrrrttrrrtrrrrrrrrramamamamamamamamaaaamamaaamaaaaa urururururuuururururruruururururururrrrruralalalalalaaallalalalalalalalalalaaaa spspspspspspspsporororororroortstststst
Innnnnntttteteeercrculululuuullultutututuutututturararaaaararal CeCeCeCeCeCCeCeCeCeCentntnttntttttttttterererererererererererererererere & & &&&&&&&&&&&&&&&&& O OO OOOOO O OOOOOOOOffiffiffiffififfiffiffiffiffiffifffifffiffi cccccc cc e e eee ofooofofofofoooo M MMMMMMululululuullultititittitititicucuucucucucuucultltltltlttlttttururururururururururalalalalalaalalal S SS S SS S SSS S SStutututututututututtuudededededededededededeeeedentntntntntntntntntntnnntntntt P PPPPPPPPPP P Prororororoororoororoororogrgrgrgrgrgrggrgrgrggrgrggrrgrrrg amamamamamamamamaamams:ss Thee Inttttererererererererccucucucuuuucucuultltltltll uuururrurrrrrurrralalalalalalalalalalaal C C CC C C C enenenenteteteteteteteteteterr r r rrrrrrr hhohohohohohohohohohoh uuusususususususususususususussussuusuuseseesesesesesesesesesesesesseesseseseessssssesssseessssesessss cocococooococoococococooccococc fmfmfmfmfmfmfmfmfffmfmfmfmfm ororrrororororororororororortttttatatatataattaablblbbblblbblblbb e eee spspspspsppaaaaaacccca esesesesesesesessesessesesses ff f f fff f f f f f ffffff ororororororororororororororororor mm mmmmmmmmmmmmm m mmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeetitititititititititititit ngngngngngngngggggngggngngngngn s,s,s,s,s,s,s,s,s,ss,s,ss,s s s s s ssssooco ial evevevenenenene tstststt a aa aaaannddndndnddnd p p p p ppp ppp pppror grgrrgrgrrrramamamamamsss sss ininininvovovovovooooovoovovvov lvlvlvll ininnininingggggg g susususususususususususususuuuuchchchchchchchchchchchcchchcc d ddd d dd d dd ddivivivvivvvvvi ererererereeerrsssssesessssssee groupppppsss sss asasasasasasasasasasas A AA AA A AA AAAA Alllllllliaiaaaaai nnnncncncnccccccncncncncncnncncncnncnncnccccccnnnce,e,e,e,e,ee,e,e,e,e,e,e,e,e,ee,,e,ee,eee,eee,eeeeeeee,,ee,,, BBBBlllBBBBBlB aacacacacacaacaaaa k k k k StSStttttSttttttudududududuududeneneneneennenennentstststststssssss A A AA A AAAAAAAsssssssssssssssococococococococococococococococociaiaiaiaiaiaaiaiaiaiaiaiaiaiaiaiatitittititittititititititititittitiononononononononononononononon, ,, ,,,, ,, , , , InInInInInInInInInIInInnnInntetetetetetetetetetetttetteteternrnrnrnrnnrnnrrrrnrr aattaaaaaaaaaaa ioionanaaaaal l l ll SSStStStStStStSStStSS ududududududduddduudeneneenennenennenne ttt t tt t tttt AAAsAsAsAsAsAsAAAAsAsA sososossosososssssociiciciciciiciiiiatatatatataatattatatattatiioioioiooioioooioiooiioionn,n,nnn,, A A AAAAAAsisisisssisisisis anannanananananananannnnaa SSSSS S Stut deddddedeeeeeeeeeeeenntntnttnttttttntntntttnn ssss s ininnnnnnn A AAAAAAshss eveveveevevevevevevevevevilille, , HHeHeHeHeHHeHHHHeHeHHHHH rmrmrrmanananananan@s@@@s@s@s@s@s@s@s@s@s@s@@s@s@s@@s@s@s@s@s@s@s@s@s@s@s@s@s@s@s@@s@s@@@s@@@s@ss@ss@@@s@@ OOrOrOOOrOrOOrOOrOOOrgugugugugugulllllll ooooooosososos@@@@@ssss@@@@@ eeeeeen n n n nn LLLaLaLaLaLaLaLL s s s ssssssssssss s AmAmAmAmAmAmAmAmAAmAmAmAmAmAAmAmAmererererererererererererereereerrericicicicicccicicicicicicicicicicasasasasasasasasasasasasasas (( ( (( (( ( ((( ( ( ( ( ((HOHOHOHOHOHOHOHOHOHOHOHOOHOHOHOHOHOH LALALLLALAALALALAL ))))))) anannanananananananand d ddddd d d dd d d HiHiHiHHHiHiiHiHiHiHiHHiHiHH llllllllllllllllllllllllll elelellleeeleee . .
TTTTTThThThThThThThThThTThTTTTTTThThThThe eee eeeee SShShShShShShShShShShSShShShererererererererererrririiiriririririirilllllllllllllll C CCCCCC CCCCCCenenenenenenenene teteteteeeteteeteteeer:r:r:r:r:r:r:r:r:rr:rr WiWiWiWiWiWWWiWiWiWiWiWiWiWiWiWillllmlmlmlmlmmlmlmlmlmlma a aaaaaaa aaaa a MM.M.MMM.MMMMM.MMMMM SS SSSSSSSSSSShehheheeeehheheheeehheheheherrrrrrrrrrrrrrrrrrrrrrrrrrililiiliilililiilili lllll CCCCeCeC ntntntntereree i iis ththhththt eeeeeeee e unuununununununuuuunnunnniviviviviviiiviiivviviverrerererererrererer isisisiisisisisiisisisisisisisisisisityttytytytytytytytyytytyttytytyttytytytytyttytyy’s’s’s’s’’s’s’s’s’s’s’s’s’s’sssssss n nn n n nn nnnn nnn nnnnnnneweweweweweweweweweweweewewwweweeewwwesesesesesesesseseseseseeeseesessessttt tt tttt ttt aaaanaaannannd d d lalaargrgrgrgr esesessssssssessssst t t t t tttt fffafafafaaaaaafaaaf cccccciiciccccccccccccciliiiitytytyty, , , oofffffffffffffffffffefefffffeeeeeffeffffefefferiirrr ngnngngngngnngngngngnggngngngngngngngngnggnggnggnggggg a a rarangngggge e e ofoff a a acacacadededeeemimiimimimimic c c c c c ananananannnndd d d d d dd ouououoououtrtrtrtrtrtreaeaeaeaeaeaeachchcchchchchchhhh p p prrorogrgramams s fofocucusesed d ononononnn hhh hh h h hh heaeaeaeeaaaeaeaaaaltltltltlttthyhyhyhyhyhyhyhhyhhhyhyyy lllll l l ll liviviviiviviviivvivvinininininiiinngg g gg g ggg ananananananananananananand ddddd dddd d dd weweweweweweeeweewwweww lllllllllllllllllllneneneneneneneneneneneneneessssssssssssssssssssssssssssssss pppp p p ppppp pp pppp p prororrrororororoororrrororororroroooomomomomommmmmmm titititionnnnnnnnnnnnnnnnnnnnnoo .. . ... ThThhhhhhhhhhhhhhhhhhhhhhheeeee e ee eeeeeeeeeeeeeeeecececececeececccccc nntntntn ererere i i iiis s s hohohomemmmemee tt ttooooo o thththhhththeeeeee e acaacacaacaca adadadadaddada ememememmemiciciciciciccic DDDDDDDepeepppararara tmttmeeeneent t fof HHHHHHH HHeaeaeaeaaltltttthh hhhh ananana d d WeWeWeWWWWWWeWWWWWeWWWW llllllllllllllllll nenenn sss, withhhhhhhhhth cclalalassssroroomomommms,ss, dddd dddededededeeedediciccciccciiicatatatttttedededddededededed ssssss s ss spapapapapapapapapapapapacececececececececececcecececceccececcececeeeece ffofoff r r unundedergrgr rar duate researchh, a hiighghghghghg -tech tttet acachingngngnngng/ddeemmmonoonstststtrararar titiononnn kkitittttchchchchchchhchhchhhchchc eneeeenennnnnenennnnnn, , ,, , , , , ,, ,,,, ananand ddd rereeeseseseseseeeeararararararararaaaarraraaaarararraararaa chchchchhhhhhhhcch aaaaa aa aaaaandndndndndnndn lleaearnnininnng gg g gglalalalallal bsb .Theee S Sherrrrrriliiiiii l CeCeCeeeeeenter includededededeeeeeeeeeeeeeeessss sssssss ss sss ananna ee expxpxpxxx ananansisisiveve fififi fifi t ttnenenessssss c ccenenenennneeennntttetetetetetetetteteeerrrrr,rrrrrrr,rrr,rrrr aaa a a a b b bbioioioioiooiooioiooooioioffefefeffefefefefffffefefeeeededededededededdededeededdde bababababababababbababababbabaaackckccckckckkcckckkckcckckkckckcckckcck ll l l ll l ababbababababaabababbbb a a a a a aa nnndndd mmmmmmmmmmmmmmedededdedddededdddddddddedddditiiitttitittiitttitttatatatatata ioioiooion nn rrrrrrrororrrrrrorrrrror omoomomomommomomomoomommomoooooomooooooo , , , anaananaa d tththththththhtththht eee eeeee WWWWWeWeWeWWWWWW lllll neneneeeeessssssssssssss CCCCCCCCCCCCCCCCCCCCCCCafafafafaaafé.éééééé
KiKiKKiKK mmmmmmmmmmmmmmelelelelelelelel A A AA A AAA A AAAArererereerrrenananananana: : : : : ThThThThThThe e e ee neneneneneew w w w w KKiKKKK mmmmmmmmmmmmmmmmmmmmmeleleeleleleleleelee A A AAA A AAAAAAArerereenanana, , wwwhich isssi p pararara tttt t ofofofofofofofofofofooff t t t ttttt tthehehhehehhheh SSS hheherrrrrrr iiililll CeCeCeCeCeeCeeCentntntntnttntntntntnterererereeererr, ,, , , caccccacacacacaccccann n nnn n seseseseseesess atataatatatatataaaatat uu uuu u u upp p p ppp tottotooooooooo 3 3 33,8,8,8,8,8888,8,88888, 00000000000000000000000 peopoppppppopoppleleeeleelellellelle f f f ff f ffffforororororororoor cccccc conononononncececececertrtrtrtrtr s,s,ss,s, ccc cccomomomomomommmememmmmencncncncncncnccncnccemeeememememememeemememenenenenennenennennentstststs, , , cocooc nnvvocatttioioiooonsnnn , , , leleleectctctctctttttctttctururururururururu eeseseses,, ,, , ,, iinininiiii teteetercrcrcr oloolleeelelegigiggiiig ataatatatatatatataaaattaa e e e eeee e ee e mememememmememeememenn’n’n’n’nnnnnn s ss s sss ananananananannndd dd d ddd wowowowowwowwww mememmememeeeen’n’n’n’nnn’nn s s ss ss bababbabbabababababababbbaabaassss-----s-sss-ssketbbbbbbbbbbalalalalaalalallaa l lll l l l ll gagagagagagagagagagggagamememmememeemmmes,s,s,s,sss h h hh h heaeaeaeaeaealtltltltltlth h h h h h fafafafafaf iriririririrs,s,sss,s a aa andndddddddd c c c c c c cc cc cccccomomomoomomomomomomomomo mmmmumumumummmmm nininityyytty eeeeventtts..s.AsAAshehehevvvvviviiiilllllllllle e eee ee e e e cocooocoooocococooommmmmmmmmmmmmm unu ity.
/// UNC ASHEVILLE BULLDOGS ///
43/// F E A R T H E D O G ///
KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKKuKuKuKuKuKKKuKuKKuKKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAAAsAsAsAAAsAAsAAssssheheheheheheheheehehehheeeeeheheheeeeeevivivvvivivivivivivivivvivivviv lllllllllllllllllle ee eee e eeee ofofofofofofofooooffffo fefefefefefefefeffeeeeeeeeeeeeeeeefersrsrrrrrsrsrssrsrssrrrrsrssrssrssrsr a a a a aaaaaaaaaaaaaa ““““““““““ ““ttotototototttotottooooot p-p-p-p-p-p-p-p-pppp nononononononnonoononononooonotctctctttctctttttccttcctt hhh h hhhhhhhh hh acacacacaccacacacacacaacaaaa adadadadaddadadadaddadadaddadddda ememememememememeememememeemeememememmmmicicicicicicccicicccccicici e e e ee ee xpxpxpxpxpxpxpxpxpxxxppxxpxxpxppxppeerereeeereerereereeeerrre ieieieieieeeeiei ncncnnccccccncncnccnn eee,e,e,e,eeeeeee,,,, ”” ””” ””””” anananananananananananananana d,ddd,d,d,dddddd,ddddd,d,d,d,d,d,d,dddddd b bbb b b bbbb bbbasaasasasasasaaaa edededededededededededeeeeddeeedee o oooooo oo ooon nnnnnn n nnn nnnnn sstststststststststsststsssssttudududududududududdududuuuuuuuddenenenenenenenneneeneneeennnnennennnnnntttt t t ttttt tttttt t ttt ssususususussssss rvrvrr eyeyyyeyyyyyyyyyyyyyy r rrrrrrrrrrrrreseseeseseeseeeee popopopopopoppppppp nsnsnssn esesesesesesssesssssss, , , , , , ,,,,,AsAsAsAsAAsAsAsAsAAsAsAsAsAsAAsAsAssssAshehehehheheheheeeehehheehehehehevivivivivivivivvivivivivvvivvvvillllllllllllllllllllleeeee eee eeeeeee e isisisisiisisisississss rr r r rrrrrrr rananannanananannanaaananaanaanaaaankekekekekekekekekekekekekeekekekekeekeeedddddddd dddd dddd d d d 111111111111111111111111111111thtthththththththtththththththhththttttttttt i ii ii iiii nnnnnnnnnnnnn nnn n ththththththththththththhththhthththt eeeeeee ee nanaaaatitititttiititittitiitititt onn o on n ththee “c“colollelegege c citty y gegetss hhigighh mamarkrks” lisst. - TThehe PPrir ncncetetonon R Re-e-viviviviv ewewewewewwewwwwwwwwwwwwwwww’s’ss’ssssss’sssssss ““““““ “ “ ThThThThThThThTThee ee ee e e e BeBeBBeBeBeeeeBeBeBeBBeeeBBBeB ststststststttsststststststtstststttstssts 3 33 3 3 3 333 333333337777777777777777777777777777777777777777 C C C CC C C C CC CC CCColololololooolollooololoooololollelelelegegegegegggggggggggg ss s - 2022020201313131333 E EE E dididititititittiononononn”” (A(A(A(AA(((((((((((( ugugugguguggggggggggggusususussu ttt tt tt 20202020202201212121222)))))))))))))
UNUNUNUNUNUNNNUNUNUNUUNUNU C CC CCCCCCC AsAsAsAsAsAsAAsAsAsAsAsAsAsAAssshehehehhheehehheeeheheeheviviviviviviivivivvvvvv lllllllllllllllleee e e eeee e rarararararararrrarrrarar knknknknknknknkkknknknkknknkkknnkkkkedededededededddeee 2 2 222222 2 222221st in the nnnaataa ion n as aaa “BeBB sts Buy C C Colololololleeeegegegegeg ,” based on n quququalalitty y ofofo teaeaching, carareeeerr prprprprprprrrprprrpppppp osososososospepepepepepeeeeepp ctctcttttctcccccccccccccc ss,s,s,s,s,ssss,ss, g g ggg ggggg ggrararrararaaaaaararaarrar duddududududududududududududududduuuuuataatatatatatataatataaaaaaa iiiioioioiooiiioioi n n n nn nnn rrrraaaararaaaaatett s,s and sstututudedededed ntn debebe t leveel..Off theeehe e e igigiggghththhththhh uniiveerssititieies s inin N NNoororthth C CCararolo inina a a aaa a aa ththhththththththththththtththatataatttataatattatatattat mmamamamamamamamamamaammamaamm dededededeededeedededdd ttttttttttttt ttthhehhhehheeeeeheheheehehehhhheeheehehhhee ll llllll llllisissssssssississsissssisssst,t,t,t,t,t,t,ttt,tt,t,tt,t,tt,ttt oo o o o oooooonlnnnlnlnlnlnnlnlnlnlnlnlnlllllln yyy yyy y y yyyyy y yyy y yy yyy UNUNUNUNUNUNNUNNUUNUNUNUNNUNNCCCCCCCC-C-CCCCC-ChChChapapappelll H Hilll,l, aat 13313133tht , , raraaaaanknknknknkeded higiggheher r thhthhananaa U UUNCNCNNN AAshheveve ilillele. . RaRaRanknkininngsgsgs p prerereeeepapapapapapapapapapaaap rerererererreerererererrrred d d dddd d ddd dd dddd bybybybybybybybybybybybbybybybybybyy thththththththhthhttt eeee e eee CeCeCeCeCeCeCeCeCeCeCeeeeeCeeeeeeentnntntntntntnnnnnnnnnnnterererrrrrerrrrr fff fffffff fffff oroorooorororrrrororroroorororoooo CCCCCCCCCC CCCCCCCCCCCCoooolololololooloooo leeeeeleleeleegegegeggegeegege AAAAAAAAAffffffffffffffffffffffffororororororororororororrorrrdadadadadadadadadadadadaddadadadaabibibibibibibiiibiiilililililillllllllll tytytytyttytytytytytytytytytyttyy a a a a a a a aaaaaandndndddndndndndndnddnndndndn PPP PP PPPPP PPPPPPPPPPrororororororororororoorooooorodudududududududdududududududududduuuuctctctctctctctccctcttcttttcc iviviviviviviviviivivivivivvvi itittttttty.y.y.y.y.y.y.y.y.y.yyyy.yyyyy. - --- - - F FF Forororororoororororororroorroro bebebebebebebebebebebebebebebbbeb s ss s ssss s s ss MaMaMaMaMaMaMaMaaMaMMaMaMaaMaMaMaaM gagaagagagagagagagagagagagagaggagaggaaazizizizziineneneneneneneneenenenee ( ( ( ((( ( (( (((AuAuAAuAuAuAuAAuAuAuuuuAAuuAA guguguguguguguguuguguguuguguustststsstststssss 22 2 2 2222222201010100000000000 2)2)2222222222222
“U“U“U““U“U“U“U“U“U“U“U“U““U“U““U“UU“U“U“U“U“UUUUNNNCNNCCNCNNNCNNNNCNCNNCCCNNCNCNNN A AA AAAAAAA A AAAAAshshshshshshsshsshshshsshshs evevevevevvvvvveveeevvvvvviiilililililililililiiiillllii leleleleleeeeeeeleleeee aa a aaaaaaaaaaa aaaaandndndndndndndndndndndndndnndndndndnnndn ttttt tttttttthehhheheheheeeeehhehheehee c cccccccititititittitity yyyyyyy ofofofofofffofoofoffoff A AAA AAAAAAAAAA Ashshshhshshhhhhhhshshhheveveveeeeveevevevevee ililililillililllillelelelelelelleeele aaaaa a arererererreererere sssss s steteeteteeeeteeteteeeepepepepeepepepepepepeppeppe ededddededededeededdedd iiiii i innnnn n nn whwhititewewwatata ererer c ccululultututurerer m mororore ee ththanan a anynyyywhwhwhwhwhwhwhwhwhwhwhwwhwhwhwhwhw eerererererereereee e e e eeeeeeeeeee elelelelelelleleleleleele sesesese ininininininnnnninnninninnnn tt t t ttttttheheheheheheheheheheheheheheehhheeeeheh www ww w worororororororo ldlldldlddddddlldldldlldldlddddddldddlddd.................. . AsAAsAsAsAsAsAsAAsAAAsAAAsAAss didididdidididididdididdddididdiddiddiii e eeeeeee fffrfrfrfrfrfffffrfrfrffffrffffff ooooooomomomomomoooo t theeheirir l llonononoong g g g lilil ststttt oof f fi rsrst t dedeeeescscs enentsts a andddndnd r racace ee iiiwiwiwiw nsnsnsss, , UNUNUNUNUNUUNNCCCCCC C AAsAsAsAAAsAAsAAshehehehhhehehehevivivvvvvvv lll e e alalalalalallalalalalaalalla umummummumummumummu s ss s ssssss ss sss anananananananannndddddd d dddprprpppprprprppp ofoffesesee sosorsrs a aaaaaaaaaaaaaaaaaalslslslslsslslsooooo o ooooooooo giggiigigivevvevvvvevevevvvv b baaaaaccacacaccccccaaack kk k toto ttttheheh p padadddldldldlininii g ggg cocommmmmmmm ununititty.yyy.”-”---”- “““ ““HHHoH nnonon r r RoRollll: : ThThhe e BeBeeB stst O Oututu dododooror SSchchoooooooooooolslslslslslslsllsslsl i ii ii i i ii i i iiiiinnnnnnnn n n n n nnnn ththththththththththhhththhe ee ee e e eeeeeeeeeBlBlueueueueueeue RRididgege,”,”””””””””””””” B B B B Blllluullllllll e e RiRidgdgggggee eeeeeeeeeeee e OuOuOuOuOOOOOOuOOuOOOOOO tdtdtdtdtdttdttdooooooooooorsrsr ( ( (((((AuAuA gugugugggggggggggg stst 2 2 222010100112)2)
UNUNUUUU C C AsA hehevvvvivviviviviiivvvivvvivvvvvv lllllllllllllleeeeee eeeeeeeeeeeee isisisisisissisisiisisisssissiissssssss “““““““““““““ ononononnonoooononooonnnnnnnnonoonoo eeeeeee ee e ofofofofofofofofofofofooffoofofoofoooo tttttttttttt t ttthehehehehehhehehehehhehehhehheeheehhe bbbb b bbbbbbbb eseeseseseseseesesessseseseesssessssttt t t t ttt t tt t edededededeeedeeee ucucucucatatioiooonanan ll babargrgaiainsns i inn ththe e cocoununtrtry.y.” ” FoForr nininene c cononononoooononononononoonooononnnnnno seseessesesesecucucucucucuccuutiiitiiiititititititiiit veveveveveveveee y yyyy y yyeaeaeaaaeearsrssssrsrsrsrs,, ,UNUNC C AsAshehevivillllllllllllllllllllllleeeee’e’e’’e’eee’eeee’eeeeeeee s s sssss ss ss EnEnEnEnEEnnEnvivivivivivviviviv roroorororooonmnmmnmnmnnmn enenenennentatataatatallll StStSStStttStStudududuuduuuduuuu ieieieieeees s s s ss ss s PPrPrPrPrPrPPPrrP ogogogogogogoggrarararararararaaam mm mmmmmmmm hhhahhhahhhhahahhhhhahahaas s s ssssss bebebeebebebebebebebeeebebebeebebebeeeenenenneeneneneneeenene nnnnnnnnnnn nnnn nnnnnnnamamammamamamamamaamamammmmmamamamammeddedededededeedededeeededededded ttttttttt tt tttt ttooo ooo oo o ooo o oo ththththththththththththththththhthheeeee eeee eeeeeeeeeeeee lililillliistststststststststttttttttt ooo oo o o oo of ff ff prprppppp e-e-prprofofofoffoffffffofffffffffffffo eeseseseseseseseesseeeeeee sisisisisisisiononononoononnno alalaalaalaall ppp p ppprorororrororrororo--ggrgramams s wiwithth u unuuuunususususssusususususususuususuuualalallaaalalaalallalalalalaala ssssss ssstrrtrtrtrtrtrtrttrtrtrtrtrtrtrtrtrrrrreneenenennnenenenennnnnenenenne gtgtgtgtgggtgtgtggttgtgthhhhhhhhhhhhhhhhh h ininninininiiinininininninnnnnn p ppp p pppppp p p p prererererererereeeereeeeeepapapapapapapapapapapapapapapapapap ririririririririririririrrririrrringngngngngngngnggngngngngnnggngngngnnnggn sssssssssss s ssss sstutututututtututtuutututuutututuututudedededeededeeedededededeeeeedeentntntntntnnttntntnttntntnnntnn sssssssssss s ss fofofofofoffofofoofofff r r rrr rr cacacacacaaccaccaarererererererereererererereerrs.s.sss. - -- - T TTTT TTThehehehehhehehh F F FFFFFFFFFFisisisisisisisssskekekekekkekkkekeke G GGGGuiuuiuuu dedddedeededeee t t tttt ttt to o ooooo CCoCoCCCCCoCoCoCCoolllllllllllllllllll egegegegegegeggegeegegeggesesesesssesesessesseses, 202020202020200202020001313333 EdEditioi n n (J(Jululy y 20012122)))
UNNC C AsAshevillee is listed amamong AmA erica’s “green” ccollllegeges andnd uuniniversrsittiees.s - TThehe PPririncncettonon RRevevieiew’w’ss ““G“Guide to 3222 Grreeenn Colllegegese for 2012” (April 2020112))
UUNC Asheevivillllee is among jjusu t 75 iinsn titutions nationwiw dee nnoteded aas s a a “B“Beest VaV lue”e” ppubublic coollegge. - TThee PPrinceton Reevieww’s’s “20011 BBest Value CoC lleges” (Februuarry y 22012)
UUNC Asheevville e isis o onene o of f ththe e nanatitionon’s’s 5 0 bebest values inn ppppppp bubububbblililic cccc coollllegggggess, , iwithth t thehe fi fif fththhhh l lowowowowowesestt tototatall cost of f faattendinnnnnnnngg gg g g gggg pepepepepepepepp rrr rrr yeyeyeyeyyeyy arararararara , , ,,,,, annananananddddd d thththththe ee eeee eieieighghghgg ththth l l lowowowesesest t t t avavavavererereragagagagaggggee e e e dededededd btbttbttbt a aa a amomomomooomomomomonnngngnngngnggg g gg ggrrarar duduatatatatateses. . -- Kiplppppp inininnii gegeer’’s ss s PePP rsrsrssr onalalalal F Financee MMagazinene ( ( (((((((JaJaJJaJaanunuuuunun arararararra yyyy y y yyy 2022020202022202020121222212122212))))))
UNUNUNUNUNUUNUNNC C C CCCCCCCC AsAsAsAsAsAsAsAsAsAsAsshehehehehehheeheh viviviviviv llllllllllee e e ee rarararaaaararaararaanknknknknknkkkknkkkssssss s s eeeiiiieeieighghhghghhhhhhghghgg tththththththhhthth i i in nnn ththttthtththeeeee e ee nanananananananann tititititititititt ononoooonnooono a aaaa aaa aamomomomomomomoomm ngngngngng PPPPubububbblililil ccc c c LiLiLiLLLiLiLiLLL beebeebeeeeebbbbb raalll l AAArrrrtstststststststs C CCCCCCCCCC ooooololoololo lleeeeeleleegegegegegeeegeg s,s,s,s,s,s,s,s, aa nnndnnnndndnd i i issss ss ss tththhhhhhhe eeeeeee oononono lyyyyy N N NN NNorrth CaCaCaCaCaCaCaCaCaCaCaarororrororororororororor lililiililiililinananannanaaaanana ii iiiiinsnsnsnsnssnsnsn tititttitiitttitittit tutututuuuuuutt titititittititiononnnnnnononnnnnoonon lllll lll ll isisisiiisiisi tetetettteetttt ddd d ddd d ddd aaamamamamamaaamononononnnonnnnongg g gggg NaNaNaNNNNaNNNaNaN ttitititttiiiononononooo alalalla L L L LLibibibibbbibibbererererererererereraalalalaaaa AAAA AArtrtrtrttsss ssss CoCoCoCoCoCoCoCCoColllll egegegegeseeseseseeses whooooooooooseseseseesesesse sssssssstutututuuuututut denntttttttsss s s ggrrrrrgrrrrgg aaaaadddaddddduauauauauauauau tteteete wwwwwwittttti h hhh h ththththththttht e eeeeeeleleeeleleeeeeasasaaaaasaaasasasasastt ttt t t t ttt t tttt amamamamamamammmaaamamaamououououououountntnttntntnn ooooooof fff ff dedededededededdd btbtbbtbtbtbbtbtt... - - - U.U.U.UUUUUU S.S.S.S.SSSS. N NN NNNNewewewwws ss & &&&&&&&& & WoWWoWoWoWoWorlrlrlrrlrr d d dddddddd ReReReReReReReReReR popopopopopooorrrtrtrtrtrtttrtrr ’ssss’s’’s’’s’s’ “““AmAAmAmAmAmmmmAmmeeeeere ica’s Best Colleges” ((SeSeptpteemmmmmbebebbebebeb rrrr 2000000011111111111))))))))
UNUNUNUNUNNNNNNNNC C C C C AsAsAsAsAsAsAsAsAssAsAsAsssAsA hehehhehehehheheheheehehheeeevivivivivvvivvivvivivivillllllllllllllllllle ee eee iiiiiiisisisisis o oo o onenenneneenenneeeee ooooo oo ooooffffff fff ff f AAAAAmAmAmAmAmAmAmAmAmAmAmerererererrerreriiiiiiciccic ’’’’’’’a’’a’aaa sss ss “1“1“1“1““1“1“1“1“1110000 000 0000 0000 BBBBeBeBeBeBeBeBeBeBeBeBe tststststststtstststss CCC C C CCCCCCCCCCCCC lllolololoololololoolololo lllleleleeeeleelelelleegegegegeggegegegegegegeegegges ss s fofoof r r hthhhthe e e MoMMoMooMMoMooMoonnneneeeeenen y.y.y.yyyy.yyyyy”””” ” ---- - BaBaBaBaBaaaBaBaBaBaBBBaBaBaaBanknknknknkknknnnknknknnknknnkrarararararararr teteeeeteteteteeteee.cccccc.cc.ccc.c.c.comomomommmmommmmomm, a aaaaa lelelll adadadadadaddadadddddinininnnninggg gggg g g g gg g g gggg gg ooononononononoonnlilililililineeneneneenene sosososoosoososourururuururuuururururururrrrururrurrcecececcececececcecceccececececececececeececececcecee o ooo oo o o o oo o offffff f f fff ff f fifififi fi fifi fifi fi fifififi fi fi fifififififinananananananananananannannanananannnanaaaancncncncnncncncncncncncnnncnnn iaiaiaiaaiaiaaiaiaaaaaaial ll ll ll llllllll ininninnnfofofooofooooooooooormrrmrmrmrmrmmmmrmrrmmmrmmmmmrr atatatattatataataaaatatattattataaa iooioioooiooooioioioooioiooooi nnnn nn nnn nnnnnnn (J(J((J(J(J((J(J(J(((J(J(J(J(Junununnnnunnuunununnnunnununneeee e eee e eeeee e eee 20202020202020202202020202002220222201111111111111111111111))))))))))))))))
AdAdAdAdAdAdAdAdAdAdAdAdmimimimimimimimmmmimmimimmimmiisssssssssssssssssssssssssss ioioioioioioioioioiiioioioiooioioooonsnsnsnsnnnsnnssnnsnnnssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 5555555 555 50%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshsssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 111100900090909009090900900909099990-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 1211122212222221111221212121221221121250500505050500050500505000505050550050505555555050000 ( (((((( ( ((((( ((( (((FFFFaFaaFFaFFFaFaFaFaaFaFaFaaFaFaaaaallllllllllllllllllllllllllllllllllllllllll 2222222222 2 2 22222 2 222222 010100101101010101010100110100010101010100101011010110110 1)1)1)111)1)))1)111))1))))111)1))1)1
AnAAAAAAAnAAnAAAnAnAnAnAnAAAAAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $5$5$5$55$ ,3,33,3,333333,333333333333393933939393939939939939999939999 (((((( ( ((((((( (((((202020202020202020202020202222222 11111111111111111111111--1111-1-1-1-1-1-1-1-- 2)2)2)2)22))))22)2)2))
AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 9999999999,9999999999,9,00020202022002002020020200020202020200020022000002222202202000020255555555555 5555 5 5555555555 (((2(2(2(2(2(2(2(2(2001010111111-1-1-1-11-11-11 122212122222222222))))))))))))) ))) )
AvAAAAAvererererererraaggggagagagagaaaagaggggee e eeee e AAnAnAnAnnununununnnnnn alalalalallllllllll HHHHHHHHH ououuusisisisiingngngng a aaaaaa anndnddddddndddddddnddndndnddd MMM MMMMMMMMMMMMMMM MM MMMMM Meaeaaaeaeaeaaeaaaeaeaeaaaeaeaeallllllll l llll PlPlPlPlPlPlPPPPPP ananan FFFFFFFFFFFFeeeeeeeeeeeeeeeeeeeees:s:s:s: $$$$ $$$$$$$$$$ $$ $$$$7,7,7,7,30330303 222 2 2 2 (2(2(222(22(222(2222(22222(( 0000001011010000 1-11111 1212121221222) )
FiFiFFFFFFFiFFiFFFFiFiFiF nananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvvivivivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennttttststststttststts’ ’’ fi fi finannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
44 /// F E A R T H E D O G ///
Dr. Anne Ponder became the sixth Chancellor of the University of North Carolina at Asheville in October 2005. She began her tenure by leading a campuswide collaboration to create a dynamic and viable fi ve- to seven-year strategic plan and revised mission state-ment.
With this focus, UNC Asheville has made major strides as a national leader in the liberal arts and has become a one of the top choices for students seeking a rigorous and multi-faceted educational experience.
During her tenure, the university was chosen as the fi rst national headquarters for the Council of Public Liberal Arts Colleges and several majors in Religious Studies and Anthro-pology have been added to the curriculum. Dr. Ponder has encouraged innovative collabo-ration that resulted in a UNC-Chapel Hill satellite pharmacy education program. Building new partnerships with local governments, scientifi c agencies and non-profi t organizations have resulted in agreements with Mission Hospital Systems, the City of Asheville, the Re-naissance Computing Institute and others for enhanced learning and research opportuni-
ties for students and faculty. This emphasis on collaboration, one of Chancellor Ponder’s hallmark traits, also led to the cultivation, with other campus and community leaders, of some of the largest multi-million donations in the university’s history.
Chancellor Ponder oversaw the largest building projects in UNC Asheville’s history, including New Hall classroom building; Sam Millar Facilities Management Complex; Zeis Science and Multimedia Building; and the Wilma M. Sherrill Center, which houses the North Caro-lina Center for Health & Wellness and the Kimmel Arena. In each of these projects, environmental sustainability has been a key feature, as dictated by the university’s strategic plan. These green efforts – combined with count-less others across campus – have earned the university a host of awards, including repeated recognition as one of the lowest energy consuming agencies in the state.
A strong advocate for community service, Dr. Ponder is a member of the Mission Hospitals Audit Committee, the Asheville Community and Economic Development Alliance, the Children’s Welfare League and the WNC Community Foundation’s Women for Women. She also is a board member for the non-profi t Kendal Corporation.
Before becoming Chancellor at UNC Asheville, Dr. Ponder served for 10 years as president of Colby-Sawyer College, a private liberal arts col-lege in New Hampshire. Prior to that appointment, she held teaching and administrative posts at Elon College (now Elon University), Guilford Col-lege and Kenyon College.
Chancellor Ponder, who holds a doctorate in English from UNC-Cha-pel Hill, is a nationally known expert on institutional effectiveness, stra-tegic planning, and fundraising and resource development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education and wrote the chapter on strategic planning in the American Council on Education’s book “Leading America’s Branch Campuses.”
A native of Asheville, Chancellor Ponder is the daughter of the late Eleanor and Herschel Ponder, both of whom trace their Asheville family roots to the 1780s. She is married to award-winning writer and publisher Christopher Brookhouse.
DR. ANNE PONDERCHANCELLOR - UNC ASHEVILLE
/// UNC ASHEVILLE BULLDOGS ///
45/// F E A R T H E D O G ///
Janet R. Cone is in her ninth year as Director of Athletics at UNC Asheville. She also serves the school as Senior Administrator for University Enterprises. This past year was highlighted by the men’s basketball team’s winning the Big South Conference championship for the second year in a row. The Bulldogs set a school record for conference and overall wins. Asheville advanced to the NCAA Tournament where it nearly pulled off one of the greatest upsets in NCAA history when the 16th-seeded Bulldogs lost a close game to top-seeded Syracuse. In addition, the school successfully hosted the Big South Conference men’s basketball tournament with a national television audience and sellout crowd watching the championship game in the school’s brand-new Kimmel Arena. Cone oversaw the successful opening of the Wilma Sherrill Center which houses the Kimmel Arena. She worked to bring the top-ranked UNC Chapel Hill men’s basketball team to open Kimmel against the Bulldogs in a game that was nationally televised. That game was also sold out. The Sherrill Center had more than 100,000 visitors the past year as its hosted various events
from concerts to graduation.
Other successes included the men’s tennis team’s fi nishing in second place in the Big South Conference, its highest league fi nish ever, the volleyball team’s advancing to the semifi nals of the Big South Tournament for the eighth time in the last nine years, and the women’s tennis, men’s tennis and women’s track and fi eld teams being honored for their work in the classroom.
Cone guided the athletic department through a successful certifi cation process by the NCAA. In addition, she brought back women’s swimming as a varsity sport for the fi rst time in more than 35 years.
In the 2010-11 year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.
Three years ago, Chancellor Anne Ponder appointed Cone to the position of Senior Administrator for University Enterprises. In this position, Cone oversees the Sherrill Center, manages specifi c community relationships and serves as a member of UNC Asheville’s major gifts team. She is a member of the Chancellor’s Senior Staff.
In 2009, Cone helped to create the Asheville Buncombe Regional Sports Commission to bring athletic events to the Asheville area. Her leadership helped secure the return of the Southern Conference men’s and women’s basketball tournament to Asheville in March 2012.
Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club which recognizes student-athletes who make a 3.0 or better grade point average each semester. More than 900 student-athletes have made the club during Cone’s nine years, and in 2009-10, a record number of student-athletes earned that distinction.
During that same time period, more than 800 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes earned this impressive academic distinction.
Cone has overseen construction projects that have dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center/Kimmel Arena was completed in the spring of 2011. Funded partly through a $35 million state appropriation, Cone helped raise more than $ 7 million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation, attract major speakers and performances, and have a new home for the men’s and women’s basketball teams. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that were completed in the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past three seasons, and this past spring hosted the Big South Conference men’s and women’s tennis championships for the fi rst time in school history.
JANET R. CONEDIRECTOR OF ATHLETICS • SENIOR ADMINISTRATOR FOR UNIVERSITY ENTERPRISES
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
46 /// F E A R T H E D O G ///
Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends. In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi t from each and every day.”
In 2006-07, three different UNC Asheville teams won Big South Conference championships and advanced to the NCAA Tournament. In May 2006, the baseball team completed an amazing run with its fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against topseed UNC Chapel Hill in the College Cup. In March 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.
The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics website, and the implementation of internet broadcasts and video-streaming for six different sports.
Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September 2008, she began a four-year term on the NCAA Division I Leadership Council.
Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.
In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.
Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.
Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach beginning in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.
Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.
Cone was born and raised in Summerville, S.C. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame in 2007. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.
A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.
/// UNC ASHEVILLE BULLDOGS ///
47/// F E A R T H E D O G ///
TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS SENIOR WOMEN’S ADMINISTRATOR
Terri Brne is in her seventh year of service to the UNC Asheville Athletics Department. She serves as Associate Director of Athletics for Internal Affairs and as Director of Compliance and Sport Oversight. She joined the UNC Asheville Athletic Department in the fall of 2006. In the summer of 2011, Terri became the school’s Senior Woman Administrator. Brne is responsible for the interpretation of rules by the NCAA and Big South Conference and is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. Brne serves as the Game Administrator for men’s and women’s basketball. Terri also oversees men’s and women’s soccer plus baseball and assists with men’s and women’s basketball. In addition, she works with the Big South Conference whenever UNC Asheville hosts a league tournament. This past year saw Brne help the athletic department pass its NCAA certifi cation and host both the men’s basketball and men’s and women’s tennis Big South tournaments. The Illinois native was an assistant basketball coach at both South Dakota and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance for all sports. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her masters’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.
MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS FOR EXTERNAL AFFAIRS
Mike Gore is in his 27th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.
UNC ASHEVILLE SUPPORT STAFF
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
48 /// F E A R T H E D O G ///
Judith BohanBusiness Manager
James WestfallAssistant
Athletic Trainer, ATC
Harmon TurnerTicket Manager
Tim WhiteHead
Athletic Trainer, ATC
Lydee BenoitAssistant Volleyball
Coach
Mary CaseyAssistant Women’s
Soccer Coach
Dr. Herman HoltFaculty AthleticsRepresentative
Rebecca Nelms-KeilDirector of Student
Athlete Affairs
Erin Punter-SpenceDirector of Marketing
and Promotions
Matt PellegrinDirector of Athletics
Media Communications
ASHEVILLE SUPPORT STAFF
Eric LinnellAssistant
Athletic Trainer, ATC
Brett CareyAssistant Men’s
Basketball Coach
Aaron SandersDirector of Sherrill
Center
Joe Burnette Assistant Men’sSoccer Coach
Tom HandAssistant
Tennis Coach
Janell CraytonAssistant Women’s Basketball Coach
Russ GardinerAssistant Women’sBasketball Coach
Nick McDevittAssistant Men’s
Basketball Coach
Joel WilliamsAssistant Track & Field
Coach
Adam PuettAssistant Cross Country Coach
Honey BrownAssistant Women’sBasketball Coach
Donna PeekAdministrative
Assistant
Brady BurreshDirector of Facilities
Jim WallaceAssistant
Athletic Trainer, ATC
Omar AhmadHead Strength &
Conditioning Coach
/// UNC ASHEVILLE BULLDOGS ///
49/// F E A R T H E D O G ///
Brenda Mock KirkpatrickWomen’s Basketball
1st year as head coach
Michele DemkoWomen’s Soccer
3rd year as head coach
Matt KernMen’s Soccer
3rd year as head coach
Tom SmithBaseball
4th year as head coach
Jesse NormanCross Country/Track
6th year as head coach
Elizabeth LykinsWomen’s Swimming
1st year as head coach
Lise GregoryTennis
6th year as head coach
Eddie BiedenbachMen’s Basketball
17th Year as head coach
Frederico SantosVolleyball
2nd year as head coach
UNC ASHEVILLE HEAD COACHES
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
50 /// F E A R T H E D O G ///
Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.
In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.
The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.
In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.
In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.
UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.
1990-2003
2004-Present
ROCKY
/// UNC ASHEVILLE BULLDOGS ///
51/// F E A R T H E D O G ///
Important NCAA Terms
A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):
(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)
Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.
Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.
Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.
Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.
Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.
Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.
Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.
Frequently Asked Questions
What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.
What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.
Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.
What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.
This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.
THE NCAA
/
// U
NC A
SHEV
ILLE
BUL
LDOG
S /
//
52 /// F E A R T H E D O G ///
For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:
Champions in Athletics, Leaders in Life.
For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics
Justice Center, CPO #2600One University Heights
Asheville, NC 28804Phone: (828) 251-6459
Fax: (828) 251-6386www.uncabulldogs.com
“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”
--Rich Davis ’93, Jan Davis Tire Store
“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”
--Pat Britz ’90; former men’s soccer player
BULLDOG ATHLETICS ASSOCIATION
Aug. 15 @ Elon (Exhibition) 6 p.m. Aug. 18 DAVIDSON (Exhibition) 2 p.m. Aug. 25 BREVARD 2 p.m. Aug. 27 USC UPSTATE 3 p.m.p.m. Aug. 30 APPALACHIAN STATE 4 p.m. Sept. 02 UNCG 2:30 p.m. Sept. 09 LONGWOOD* 2:30 p.m. Sept. 14 vs. Marshall (RU Inv.) 4:30 p.m. Sept. 16 vs. Marist (RU Inv.) 1 p.m. Sept. 22 @ High Point* 7 p.m. Sept. 26 @ Mercer 6 p.m. Sept. 29 WINTHROP* Noon Oct. 03 @ Presbyterian College* 7 p.m. Oct. 06 @ Coastal Carolina* 7 p.m. Oct. 10 GARDNER-WEBB* 4 p.m. Oct. 13 RADFORD* 2:30 p.m. Oct. 20 VMI* 2:30 p.m.p.m. Oct. 27 @ Campbell* 7 p.m.7 p.m. Nov. 02 @ Liberty* 7 p.m.7 p.m. ALL CAPS - HOME GAMES * - BIG SOUTH CONFERENCE GAME ALL TIMES EASTERN
2012 SCHEDULE2012 SCHEDULE