14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker...
Transcript of 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker...
![Page 1: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/1.jpg)
Microsatellites
![Page 2: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/2.jpg)
What is microsatellite
• Simple Sequence Repeats (SSR)• 1-6 bp long
![Page 3: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/3.jpg)
Classification of Microsatellites
• Simple microsatelltes• Composite microsatellites
![Page 4: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/4.jpg)
Simplemicrosatellites
contain only one kind of
repeat sequences:
(GT)n (AC)n (AG)n
![Page 5: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/5.jpg)
Composite microsatellites
contain more than one type
repeats
![Page 6: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/6.jpg)
Molecular Basis of Microsatellite Polymorphism
Different by 3 repeats
• Slippage of DNA polymerase is believed to be the major cause ofmicrosatellite variation
• The mutation rate can be as high as 0.1 to 0.2% per generation
![Page 7: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/7.jpg)
Abundant and Even Distribution
![Page 8: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/8.jpg)
Abundant
• Abundance varies with species, but all species studied to date have miocrosatellites
• In well studied mammal species, one microsatellite exist in every 30-40 kb DNA.
![Page 9: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/9.jpg)
Even distribution
• On all chromosomes• On all segments of chromosomes• With genes• Often in introns• In exons as well• Trinucleotide repeats and human diseases:
Huntington disease, fragile X, and other mental retardation-related human diseases
![Page 10: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/10.jpg)
2
361
Small Locus sizes adapt them for PCR
PCR
![Page 11: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/11.jpg)
Microsatellites are co-dominant markers
AD BC
Allele A
Allele B
Allele C
Allele D
BD CD AC AB BD AC BD AB
AB CD BC CC
![Page 12: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/12.jpg)
Mendelian Inheritance of Microsatellites
Liu et al. 1999. Biochem. Biophys. Res Comm. 259: 190-194Liu et al. 1999. J. Heredity 90: 307-311.
Microsatellites are inherited as codominant markers according to Mendelian laws
![Page 13: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/13.jpg)
Advantages of Microsatellite Markers
Abundant Evenly distributed
Highly polymorphic
Small loci
Co-dominant
![Page 14: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/14.jpg)
Development of microsatellite markers
![Page 15: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/15.jpg)
Need
• SSR containing clones• Sequences of the flanking regions of SSR
![Page 16: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/16.jpg)
Genomic DNA
Microsatellites-enriched Small-insert DNA Libraries (I)
Digest with several 4-bp blunt enders
Gel fraction of 300-600 bp
Ligation to a phagemid vector
insert
Small insert3.4 kb
insert
Small insert3.4 kb
insert
Small insert3.4 kb
insert
Small insert3.4 kb
insert
Small insert3.4 kb
insert
Small insert3.4 kb
insert
Small insert3.4 kb
insert
Small insert3.4 kb
insert
Small insert3.4 kb
micro
Small insert3.5 kb
![Page 17: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/17.jpg)
insert
Small insert plasmids3.5 kb
insert
Small insert plasmids3.5 kb
insert
Small insert plasmids3.5 kb
in
micro
sert
Small insert plasmids3.5 kb
Conversion into single-stranded phagemids using helper phage
Single-stranded phagemids3.5 kb
Single-stranded phagemids3.5 kb
Single-stranded phagemids3.5 kb
micro
Single-stranded phagemids3.5 kb
Won’t be converted to dswill be degraded in WT host
Using dut/ung-CJ236 strain
u
uu
u
uu
uu
uu
u
uu
Microsatellites-enriched Libraries (II)
![Page 18: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/18.jpg)
micro
Single-stranded phagemids3.5 kb
Convert into ds
using (CA)15 (e.g.)
micro
3.5 kb
micro
ds plasmids
3.5 kb
u
u
u
Transform into WT E. coli
micro
ds plasmids3.5 kb
Microsatellite-enriched Libraries (III)
According to Ostrander et al., 1992: PNAS 89:3419
![Page 19: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/19.jpg)
Microsatellites-enriched Libraries
CAGATACGCTGT
CAACATCAGCACCGGCGTCGCCGA
...
4 bp 5 bp
![Page 20: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/20.jpg)
Characterization of Microsatellites
• Isolate plasmid DNA;
• sequence clones;
• Identify clones with enough sequences for primer design.
![Page 21: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/21.jpg)
PCR Optimization and PIC Analysis
• PCR products best <200 bp• PCR conditions: annealing temperature, Mg++, pH,
DMSO, etc.• Polymorphism information content• Polymorphism in reference families
![Page 22: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/22.jpg)
Disadvantages of microsatellites
• Previous genetic information is needed• Huge Upfront work required• Problems associated with PCR of microsatellites
![Page 23: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/23.jpg)
The concept of Polymorphic information content
• Measures the usefulness of a marker• Informativeness in specific families
![Page 24: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/24.jpg)
1. AA x AA
4. AA x AB
Not polymorphic
B segregates 1:1, A segregates with intensity 1:1
6. AØ x AB
2. AA x BB
5. AA x BØ
No segregation
A not segregateB segregates 1:1
A segregates 3:1, B segregates 1:1
3. AØ x ØØ Only 1 allele segregating 1:1
7. AB x AB A segregates 3:1, B segregates 3:1
Microsatellite Genotyping
![Page 25: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/25.jpg)
Microsatellite Genotyping
8. AØ x BØ
9. AB x ØØ
10. AA x BC
11. AØ x BC
12. AB x AC
13. AB x CD
A segregates 1:1, B segregates 1:1
A segregates 1:1, B segregates 1:1, A & B alternating
2 of the 3 alleles segregating 1:1
All 3 alleles segregating 1:1, 2 types with only 1 allele
2 of 3 alleles segregating 1:1, the other 3:1 with a single allele existing for some individuals
All 4 alleles segregating 1:1
![Page 26: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/26.jpg)
• PIC refers to the value of a marker for detecting polymorphism within a population
• PIC depends on the number of detectable alleles and the distribution of their frequency.
• Bostein et al. (1980) Am. J. Hum Genet. 32:314-331.
• Anderson et al. (1993). Genome 36: 181-186.
Polymorphic Information Content PIC)
![Page 27: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/27.jpg)
nPICi = 1-∑ Pij2
j=1
Where PICi is the polymorphic information content of a marker i; Pij is the frequency
of the jth pattern for marker i and the summation extends over n patterns
Polymorphic Information Content (PIC)
![Page 28: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/28.jpg)
nPICi = 1-∑ Pij2
j=1
Example: Marker A has two alleles, first allele has a frequency of 30%, the second allele has a frequency of 70%
PICa = 1- (0.32 + 0.72) = 1- (0.09 + 0.49) = 0.42
Polymorphic Information Content PIC)
![Page 29: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/29.jpg)
nPICi = 1-∑ Pij2
j=1
Example: Marker B has two alleles, first allele has a frequency of 50%, the second allele has a frequency of 50%
PICb = 1- (0.52 + 0.52) = 1- (0.25 + 0.25) = 0.5
Polymorphic Information Content PIC)
![Page 30: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/30.jpg)
nPICi = 1-∑ Pij2
j=1
Example: Marker C has two alleles, first allele has a frequency of 90%, the second allele has a frequency of 10%
PICc = 1- (0.92 + 0.12) = 1- (0.81 + 0.01) = 0.18
Polymorphic Information Content PIC)
![Page 31: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/31.jpg)
nPICi = 1-∑ Pij2
j=1
Example: Marker D has 10 alleles, each allele has a frequency of 10%
PICd = 1- [10 x 0.12] = 1- 0.1 = 0.9
Polymorphic Information Content PIC)
![Page 32: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/32.jpg)
Allele frequency and Forensics
• Say, we have 10 marker loci• We have done adequate population genetics to
know each one have a 10% distribution• Test of each locus can define certain level of
confidence as to what the probability is to obtain the results you are obtaining.
![Page 33: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of](https://reader034.fdocuments.us/reader034/viewer/2022042112/5e8e696d010e9373dd346b4c/html5/thumbnails/33.jpg)
Allele frequency and Forensics
• Locus 1, positive • You are included, but every one out of 10 people
has the chance to be positive• locus 2, positive• You are included, but every one out of 100
people has the chance to be positive at both locus 1 and locus 2
• …• Locus 10, also posive• ...