14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker...

33
Microsatellites

Transcript of 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker...

Page 1: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Microsatellites

Page 2: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

What is microsatellite

• Simple Sequence Repeats (SSR)• 1-6 bp long

Page 3: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Classification of Microsatellites

• Simple microsatelltes• Composite microsatellites

Page 4: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Simplemicrosatellites

contain only one kind of

repeat sequences:

(GT)n (AC)n (AG)n

Page 5: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Composite microsatellites

contain more than one type

repeats

Page 6: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Molecular Basis of Microsatellite Polymorphism

Different by 3 repeats

• Slippage of DNA polymerase is believed to be the major cause ofmicrosatellite variation

• The mutation rate can be as high as 0.1 to 0.2% per generation

Page 7: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Abundant and Even Distribution

Page 8: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Abundant

• Abundance varies with species, but all species studied to date have miocrosatellites

• In well studied mammal species, one microsatellite exist in every 30-40 kb DNA.

Page 9: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Even distribution

• On all chromosomes• On all segments of chromosomes• With genes• Often in introns• In exons as well• Trinucleotide repeats and human diseases:

Huntington disease, fragile X, and other mental retardation-related human diseases

Page 10: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

2

361

Small Locus sizes adapt them for PCR

PCR

Page 11: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Microsatellites are co-dominant markers

AD BC

Allele A

Allele B

Allele C

Allele D

BD CD AC AB BD AC BD AB

AB CD BC CC

Page 12: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Mendelian Inheritance of Microsatellites

Liu et al. 1999. Biochem. Biophys. Res Comm. 259: 190-194Liu et al. 1999. J. Heredity 90: 307-311.

Microsatellites are inherited as codominant markers according to Mendelian laws

Page 13: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Advantages of Microsatellite Markers

Abundant Evenly distributed

Highly polymorphic

Small loci

Co-dominant

Page 14: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Development of microsatellite markers

Page 15: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Need

• SSR containing clones• Sequences of the flanking regions of SSR

Page 16: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Genomic DNA

Microsatellites-enriched Small-insert DNA Libraries (I)

Digest with several 4-bp blunt enders

Gel fraction of 300-600 bp

Ligation to a phagemid vector

insert

Small insert3.4 kb

insert

Small insert3.4 kb

insert

Small insert3.4 kb

insert

Small insert3.4 kb

insert

Small insert3.4 kb

insert

Small insert3.4 kb

insert

Small insert3.4 kb

insert

Small insert3.4 kb

insert

Small insert3.4 kb

micro

Small insert3.5 kb

Page 17: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

insert

Small insert plasmids3.5 kb

insert

Small insert plasmids3.5 kb

insert

Small insert plasmids3.5 kb

in

micro

sert

Small insert plasmids3.5 kb

Conversion into single-stranded phagemids using helper phage

Single-stranded phagemids3.5 kb

Single-stranded phagemids3.5 kb

Single-stranded phagemids3.5 kb

micro

Single-stranded phagemids3.5 kb

Won’t be converted to dswill be degraded in WT host

Using dut/ung-CJ236 strain

u

uu

u

uu

uu

uu

u

uu

Microsatellites-enriched Libraries (II)

Page 18: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

micro

Single-stranded phagemids3.5 kb

Convert into ds

using (CA)15 (e.g.)

micro

3.5 kb

micro

ds plasmids

3.5 kb

u

u

u

Transform into WT E. coli

micro

ds plasmids3.5 kb

Microsatellite-enriched Libraries (III)

According to Ostrander et al., 1992: PNAS 89:3419

Page 19: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Microsatellites-enriched Libraries

CAGATACGCTGT

CAACATCAGCACCGGCGTCGCCGA

...

4 bp 5 bp

Page 20: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Characterization of Microsatellites

• Isolate plasmid DNA;

• sequence clones;

• Identify clones with enough sequences for primer design.

Page 21: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

PCR Optimization and PIC Analysis

• PCR products best <200 bp• PCR conditions: annealing temperature, Mg++, pH,

DMSO, etc.• Polymorphism information content• Polymorphism in reference families

Page 22: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Disadvantages of microsatellites

• Previous genetic information is needed• Huge Upfront work required• Problems associated with PCR of microsatellites

Page 23: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

The concept of Polymorphic information content

• Measures the usefulness of a marker• Informativeness in specific families

Page 24: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

1. AA x AA

4. AA x AB

Not polymorphic

B segregates 1:1, A segregates with intensity 1:1

6. AØ x AB

2. AA x BB

5. AA x BØ

No segregation

A not segregateB segregates 1:1

A segregates 3:1, B segregates 1:1

3. AØ x ØØ Only 1 allele segregating 1:1

7. AB x AB A segregates 3:1, B segregates 3:1

Microsatellite Genotyping

Page 25: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Microsatellite Genotyping

8. AØ x BØ

9. AB x ØØ

10. AA x BC

11. AØ x BC

12. AB x AC

13. AB x CD

A segregates 1:1, B segregates 1:1

A segregates 1:1, B segregates 1:1, A & B alternating

2 of the 3 alleles segregating 1:1

All 3 alleles segregating 1:1, 2 types with only 1 allele

2 of 3 alleles segregating 1:1, the other 3:1 with a single allele existing for some individuals

All 4 alleles segregating 1:1

Page 26: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

• PIC refers to the value of a marker for detecting polymorphism within a population

• PIC depends on the number of detectable alleles and the distribution of their frequency.

• Bostein et al. (1980) Am. J. Hum Genet. 32:314-331.

• Anderson et al. (1993). Genome 36: 181-186.

Polymorphic Information Content PIC)

Page 27: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

nPICi = 1-∑ Pij2

j=1

Where PICi is the polymorphic information content of a marker i; Pij is the frequency

of the jth pattern for marker i and the summation extends over n patterns

Polymorphic Information Content (PIC)

Page 28: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

nPICi = 1-∑ Pij2

j=1

Example: Marker A has two alleles, first allele has a frequency of 30%, the second allele has a frequency of 70%

PICa = 1- (0.32 + 0.72) = 1- (0.09 + 0.49) = 0.42

Polymorphic Information Content PIC)

Page 29: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

nPICi = 1-∑ Pij2

j=1

Example: Marker B has two alleles, first allele has a frequency of 50%, the second allele has a frequency of 50%

PICb = 1- (0.52 + 0.52) = 1- (0.25 + 0.25) = 0.5

Polymorphic Information Content PIC)

Page 30: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

nPICi = 1-∑ Pij2

j=1

Example: Marker C has two alleles, first allele has a frequency of 90%, the second allele has a frequency of 10%

PICc = 1- (0.92 + 0.12) = 1- (0.81 + 0.01) = 0.18

Polymorphic Information Content PIC)

Page 31: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

nPICi = 1-∑ Pij2

j=1

Example: Marker D has 10 alleles, each allele has a frequency of 10%

PICd = 1- [10 x 0.12] = 1- 0.1 = 0.9

Polymorphic Information Content PIC)

Page 32: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Allele frequency and Forensics

• Say, we have 10 marker loci• We have done adequate population genetics to

know each one have a 10% distribution• Test of each locus can define certain level of

confidence as to what the probability is to obtain the results you are obtaining.

Page 33: 14. Marking the genome-microsatellites - Auburn University...• PIC refers to the value of a marker for detecting polymorphism within a population • PIC depends on the number of

Allele frequency and Forensics

• Locus 1, positive • You are included, but every one out of 10 people

has the chance to be positive• locus 2, positive• You are included, but every one out of 100

people has the chance to be positive at both locus 1 and locus 2

• …• Locus 10, also posive• ...