1 The Dictyostelium discoideum GPHR ortholog is an...
Transcript of 1 The Dictyostelium discoideum GPHR ortholog is an...
1
The Dictyostelium discoideum GPHR ortholog is an ER and Golgi protein with roles 1
during development 2
3
Jaqueline Deckstein*, Jennifer van Appeldorn*, Marios Tsangarides*, Kyriacos Yiannakou*, 4
Rolf Müller, Maria Stumpf, Salil K. Sukumaran*, Ludwig Eichinger, Angelika A. Noegel+, 5
Tanja Y. Riyahi+ 6
7
Institute of Biochemistry I, Medical Faculty, Center for Molecular Medicine Cologne 8
(CMMC) and Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated 9
Diseases (CECAD), University of Cologne, 50931 Köln, Germany 10
11
Running title: D. discoideum GPHR 12
13
+corresponding authors: 14
Angelika A. Noegel 15
17
Tanja Y. Riyahi 18
20
21
*These authors contributed equally 22
23
24
EC Accepts, published online ahead of print on 7 November 2014Eukaryotic Cell doi:10.1128/EC.00208-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
2
Abstract 25
The Dictyostelium discoideum GPHR (Golgi pH regulator)/Gpr89 is a developmentally 26
regulated transmembrane protein present on the endoplasmic reticulum (ER) and the Golgi 27
apparatus. Transcript levels are low during growth and vary during development reaching 28
high levels during aggregation and late developmental stages. The Arabidopsis ortholog was 29
described as a G protein coupled receptor (GPCR) for abscisic acid present at the plasma 30
membrane whereas the mammalian ortholog is a Golgi-associated anion channel functioning 31
as Golgi pH regulator. To probe its role in D. discoideum we generated a strain lacking 32
GPHR. The mutant had different growth characteristics compared to the AX2 parent strain 33
and exhibited changes during late development and formed abnormally shaped small slugs 34
and fruiting bodies. An analysis of development specific markers revealed that their 35
expression was disturbed. The distribution of the endoplasmic reticulum and the Golgi was 36
unaltered at the immunofluorescence level. Likewise, their function did not appear to be 37
impaired since membrane proteins were properly processed and glycosylated. Also, changes 38
in the external pH were sensed by the ER as indicated by a pH sensitive ER probe as in wild 39
type. 40
41
Key words: GPHR/Gpr89, endoplasmic reticulum, Golgi, Dictyostelium discoideum 42
43
44
45
Introduction 46
The highly conserved GPR89 (G protein-coupled receptor 89), also known as GPHR (Golgi 47
pH regulator), has for a long time been thought to be an orphan GPCR (1, 2). In recent reports 48
the proteins from Arabidopsis, Drosophila and mouse were characterized with regard to their 49
role (3, 4, 5). The Arabidopsis orthologs GTG1 and GTG2 (GPCR-type G protein 1 and 2) 50
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
3
were identified as abscisic acid receptors. Mutants lacking GTG1 and GTG2 exhibit abscisic 51
acid hyposensitivity. GTG1 and GTG2 are unique among the GPR89 proteins as they harbor a 52
degenerate Ras GTPase-activating protein domain at their C-terminus and have GTPase 53
activity. The GFP-tagged Arabidopsis proteins GTG1 and GTG2 were detected at the cell 54
periphery of protoplasts (3). This localization contrasts with the one of the Drosophila and 55
mouse GPHR which were found at intracellular membranes (4, 5). Recently the view that 56
GTG1 and GTG2 have a GPCR-type structure has been challenged since they have more than 57
seven predicted transmembrane regions (6). 58
In mammalian cells the protein was identified in a search for a protein involved in pH 59
regulation. It was identified as an anion channel critical for acidification and functions of the 60
Golgi apparatus hence the name GPHR (Golgi pH regulator), a term which we will use for the 61
D. discoideum protein as well. GPHR could restore delayed protein transport, impaired 62
glycosylation and Golgi disorganization in mutant Chinese hamster ovary cells by re-63
establishing Golgi acidification. The authors also demonstrated a voltage-dependent anion-64
channel activity after reconstitution of the protein into planar lipid bilayers (Maeda et al., 65
2008). Earlier studies had identified the gene in a search for human genes that activate NF-κB 66
and MAPK signaling pathways (7). Expression analysis in the mouse showed a ubiquitous 67
presence. The inactivation of the single mouse gene by homologous recombination resulted in 68
lethality of the homozygous mutants whereas no notable phenotype was observed for the 69
heterozygous mice (8). A keratinocyte-specific GPHR knockout led to hypopigmented skin, 70
hair loss and scaliness. As underlying defect a diminished formation of lamellar bodies was 71
noted that resulted in an impaired skin barrier. Through the secretion of lamellar bodies lipids 72
and proteins are delivered to the extracellular spaces of the stratum corneum where they 73
establish the barrier functions (9). 74
The Drosophila GPHR (dGPHR) is associated with the endoplasmic reticulum (ER) and the 75
Golgi apparatus. Loss of the protein caused disorganization of these compartments and a 76
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
4
defective secretory pathway. At the organismal level it led to a growth defect and to death at 77
the late larval stages. Expression in neuronal or gut cells rescued the growth defect. The 78
authors suggested that this might be due to the restoration of the secretion of some unknown 79
factor(s) (5). 80
We analyzed the DdGPHR homolog by expressing the protein as GFP-fusion protein and 81
generating knockout cells. DdGPHR localized to internal membranes primarily of the ER and 82
accumulated also at the Golgi apparatus. Its loss led to a defect during growth in shaking 83
suspension and GPHR cells exhibited severe changes during late development which can be 84
explained by the developmental expression pattern of the gene. The morphology of the slugs 85
and of fruiting bodies was significantly altered as well as the expression pattern of 86
developmentally regulated genes where timing and abundance were affected. 87
88
Material and methods 89
Growth and development 90
Growth and development of D. discoideum strains and mutant generation. D. discoideum 91
strains used were AX2 (10), AX2 expressing GFP-LimD (11), a GPHR deficient strain 92
derived from AX2 (GPHR–), GPHR
– expressing GPHR-GFP (GPHR
rescue). Strains were 93
grown submerged at 22oC in axenic medium or on a lawn of Klebsiella aerogenes on SM agar 94
plates in order to obtain sufficient quantities of cells for experimental analysis (10). Growth 95
on E. coli B/r in shaking suspension (160 rpm) was done as described (12). Development was 96
initiated by resuspending cells in Soerensen phosphate buffer (17 mM sodium-potassium-97
phosphate, pH 6.0) at a density of 1x107 cells/ml and shaking at 160 rpm. Cells were sampled 98
at the indicated time points and used for protein analysis. These conditions allowed formation 99
of aggregates. For development on a solid substratum which allows development until fruiting 100
body formation 5x107 cells were spread onto Soerensen phosphate buffered agar plates (10 101
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
5
cm in diameter) and incubated at 22oC. Photographs were taken at identical times after plating 102
for comparison of the developmental stages. 103
The GPHR gene was amplified from genomic DNA derived from strain AX2 and cloned into 104
pGEM-T Easy (Promega). The sequence was verified and used for all further cloning steps. 105
For inactivation of the GPHR gene, a gene replacement vector was established. Nucleotides 7 106
to 630 and 866 to 1410 of the genomic DNA (A of the starting ATG is taken as position 1) 107
were cloned into pLPBLP vector (13). The plasmid was transformed into AX2, transformants 108
were selected using Blasticidin S (MP Biomedicals, Eschwege, Germany) at 1.5 µg/ml. Single 109
colonies were selected on a Klebsiella lawn, DNA was isolated from nuclei using 110
phenol/chloroform extraction and PCR analysis was carried out with primers that allowed 111
detection of the gene replacement event. For size determination of the PCR products a 100 bp 112
ladder (Bioline, Luckenwalde, Germany) was used. For expression of GPHR carrying a GFP 113
tag at its C-terminus (GPHR-GFP) the genomic DNA was cloned into p1ANeo8 (14). A 114
plasmid allowing expression of the ER marker calreticulin fused to ratiometric pHluorin 115
(calpHluorin) was obtained from dictybase (http://dictybase.org/index.html) (15). It was 116
transformed into AX2 and GPHR¯ cells. Selection of transformants was with G418 (2 µg/ml). 117
118
Fluorescence measurements. Excitation scans were generated using a Tecan fluorescence 119
plate reader. Cells were washed and starved for two hours in Soerensen phosphate buffer and 120
1x106 cells expressing calpHluorin were added per well of a 96 well plate. Excitation scans 121
were performed between wavelengths 340 nm to 490 nm. The emission was set at 510 nm. 122
For pH experiments cells were harvested, starved for two hours in Soerensen phosphate buffer 123
at a density of 1x107 cells/ml in order to reduce autofluorescence due to the medium that has 124
been taken up and resuspended in the appropriate buffer. To manipulate the intracellular pH 125
cells were harvested by centrifugation and the Soerensen phosphate buffer was replaced by 20 126
mM MES buffer, pH 6.0, containing 20 mM propionic acid or by 20 mM Tris/HCl, pH 8.0, 127
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
6
containing 20 mM NH4Cl. Both reagents, propionic acid and NH4Cl, diffuse through the 128
plasma membrane and dissociate in the cell where they alter the pH. For life cell microscopy 129
the pH was changed by adding MES buffer containing increasing concentrations of propionic 130
acid (10 to 30 mM) or NH4Cl (10 to 17.5 mM) (17). 131
132
Mutant analysis. Growth analysis, yeast phagocytosis, measurement of mannosidase activity, 133
analysis of cell motility and phototaxis were done as described (12). Mannosidase activity 134
was determined in cell pellets and in the supernatant. Cells were starved at a density of 1x107 135
cells/ml. At the beginning of the experiment (t0) and after 2, 4 and 6 hours 500 µl of cell 136
suspension were taken to measure mannosidase activity. For determination of secreted 137
enzyme 100 µl of the supernatant were mixed with 100 µl Na-citrate buffer, pH 5.0, and 200 138
µl substrate solution (2 µl p-nitrophenyl--D mannopyranoside (150 mM)). The substrate was 139
dissolved in DMF. The reaction was stopped after a 30 min incubation at 37°C by addition of 140
600 µl sodium borate (0.2 M, pH 9.8) and the product extracted into butanol. Nitrophenol 141
formation was estimated by measuring the absorbance at 405 nm. For determination of total 142
enzyme activity cells were lysed by addition of Triton X-100 (0.5%). 143
For chemotaxis analysis cells were starved in suspension (Soerensen phosphate buffer, pH 144
6.0) at a density of 1x107 cells/ml and taken for analysis of cell motility after 5 hours of 145
development. 25-30 μl of cell suspension were diluted in 3 ml of Soerensen phosphate buffer 146
and mixed well by pipetting (25-30 times with occasional vortexing) in order to dissociate 147
cells from aggregates. 1.5 ml of the diluted cells were then transferred onto a glass cover-slip 148
with a plastic ring placed on a Leica inverse microscope equipped with a 20x UplanFl 0.3 149
objective. Time-lapse image series were captured and stored on a computer hard drive at 30 150
seconds intervals with a JAI CV-M10 CCD camera and an Imagenation PX610 frame grabber 151
(Imagenation Corp., Beaverton, OR) controlled through Optimas software (Optimas Corp., 152
Bothell, Washington). Cells migrating towards an aggregation center were analyzed. The 153
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
7
DIAS software (Solltech, Oakdale, IA) was used to trace individual cells along image series, 154
it automatically outlined the cell perimeters and converted them to replacement images from 155
which the position of the cell centroid was determined. Speed and change of direction were 156
computed from the centroid position. 157
Development on phosphate agar was followed by visual inspection and determining the 158
expression of developmental markers by quantitative Real Time PCR (qRT-PCR) 159
experiments using the primers listed in Table 1 and western blot analysis probing for 160
development specific proteins. For qRT-PCR defined amounts of Dd annexin7 cDNA was 161
used as internal standard. RNA was isolated from AX2 and GPHR cells that had been 162
starved on phosphate agar plates (5x107 cells per plate) using phenol/chloroform extraction 163
after cell lysis with SDS (0.5%) and converted into cDNA using reverse transcriptase 164
(Promega) and random primers. GAPDH amounts were used for normalization. For spore 165
viability development was carried out on phosphate buffered agar plates, spores were 166
harvested, treated with or without Triton-X100 and colony formation was checked by plating 167
appropriate numbers of spores onto a lawn of Klebsiella (16). Spore and stalk cells were 168
assessed after staining with Calcofluor White stain (Fluka). They were incubated for one 169
minute in the solution prepared according to the data sheet and analyzed under UV light (16). 170
Calcofluor White binds to cellulose which is present around differentiated spore and stalk 171
cells. Development was also followed after neutral red staining of cells. Neutral red, a vital 172
dye, is specific for prestalk cells which have large acidic vacuoles. Cells were incubated for 1 173
min in an equal volume of 0.1% neutral red solution (in Soerensen phosphate buffer), 174
subsequently washed and plated onto phosphate agar. To analyze growth behavior under 175
stress, cells were grown in Petri dishes in axenic medium in the presence of 30 mM NaCl or 176
115 mM sorbitol. For statistical analysis the Student’s t-test was used. 177
178
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
8
Immunofluorescence, western blot analysis and antibodies used. For immunofluorescence 179
analysis methanol fixed cells were stained for actin with mouse monoclonal antibody (mAb) 180
act1 (18), tubulin was detected by rat mAb YL1/2 (19), CAP with mouse mAb 223-445-1 181
(20), protein disulfide isomerase (PDI) with mAb 221-135-1 (21), annexin 7 with mAb 185-182
338-1 (22), the nuclear envelope associated protein interaptin with mAb 260-60 (23). mAb 183
190-340 recognized the Golgi marker comitin (24), mAb 83-418 the 56 kDa D2 protein (25), 184
mAb 130-80 the 69 kDa crystal protein CP (25), mAb 70-11-1 the 30 kDa mitochondrial 185
porin (26), mAb 221-35-2 is directed against the vacuolar ATPase subunit vatA (27). For 186
detection goat anti mouse or goat anti rat antibodies coupled to Alexa Fluor 488 (Life 187
technologies) were used. Mitochondria were also stained using MitoTracker (Life 188
Technologies). Cells in medium were incubated for 15 minutes with MitoTracker (1:1000 189
dilution of a 1 mg/ml stock (in DMSO)) at room temperature and fixed with ice cold 190
methanol. Cells were then stained with mAb act1 to visualize the boundaries of the cells. 191
Analysis of fixed and living cells was done by laser scanning confocal microscopy using a 192
Leica TCS SP5 microscope equipped with a very sensitive hybrid detector (HyD). 193
Proteins were separated by SDS-PAGE (10% acrylamide), blotted onto nitrocellulose 194
membranes and probed with appropriate antibodies. GFP-tagged protein was detected with 195
mAb K3-184-2 (28), the cell adhesion molecule csA with mAb 33-294 (29). N- and O-196
glycosylation of csA was detected with mAb 123-353 which primarily recognizes N-197
glycosylated csA and mAb 24-210 detecting O-glycosylated proteins (29), and mAb 188-19 198
directed against cap32 (30) as loading control. The centrosome was labeled with mAb K68-199
332-3 detecting CP250 (31). In western blots proteins were detected with enhanced 200
chemiluminescence using horse radish peroxidase coupled secondary antibodies. 201
202
203
Results 204
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
9
205
Characterization of DdGPHR. DdGPHR (DDB_G0283855), a member of the 206
orphan vertebrate Gpr89 group, is highly conserved across eukaryotes. Its closest homologs 207
are an Acanthamoeba castellanii protein (1e-125, 41% identity) and Golgi pH regulator-like 208
isoform 1 from the marine mammal Trichechus manatus latirostris (3e-119, 41% identity). 209
The identity with the mouse protein is also 41% (3e-114) and with the Arabidopsis thaliana 210
receptors GTG1 and GTG2 32% (7e-85, 2e-82). A phylogenetic analysis also shows that 211
DdGPHR is evolutionary more closely related to the animal proteins than to the plant proteins 212
(Fig. 1A). The DdGPHR gene is located on chromosome 4 and harbors two small introns. It 213
encodes a 547 amino acids protein with a predicted molecular mass of 64,244 Dalton 214
containing eight predicted transmembrane domains, a DUF3735 domain and an ABA_GPCR 215
(Abscisic acid G-protein coupled receptor) domain (Fig. 1B). A similar domain structure is 216
predicted for all homologs. The mRNA is present throughout all stages of development. The 217
levels are lowest during the growth phase, they increase strongly during aggregation with a 218
peak at 8 to 12 hours after the start of starvation on phosphate agar plates (early aggregation 219
and aggregation). Then they fall and rise again during late development when slugs are 220
formed and culmination occurs (18 hour time point and onward) (Fig. 1C). 221
Since the antibodies we had generated against DdGPHR did not react with the protein 222
in western blots or immunofluorescence analysis we could not assess its abundance and 223
localization in D. discoideum. To localize DdGPHR in cells we ectopically expressed the 224
protein as GFP-tagged fusion protein in AX2 cells. GFP was fused to the C-terminus of 225
GPHR, the expression was under the control of the actin15 promoter which is active 226
throughout growth and development. The fusion protein is functionally active as described in 227
the rescue experiments below. DdGPHR-GFP staining was observed around the nucleus and 228
on a network throughout the cell (Fig. 1D). This network was identified in co-229
immunofluorescence studies as the ER because it overlapped with the ER marker protein 230
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
10
disulfide isomerase (PDI) (13). At the nucleus GPHR-GFP overlapped with interaptin which 231
is located at the nuclear envelope (23). The ER network emanates from the outer nuclear 232
membrane and extents throughout the cytosol. GPHR-GFP also co-localized with the Golgi 233
marker comitin detected by mAb 190-340 (24). Comitin strongly stained the Golgi 234
membranes in the vicinity of the nucleus and overlapped with the microtubule organizing 235
center from which microtubules labeled by mAb YL1/2 (19) originated and which was stained 236
with monoclonal antibodies recognizing centrosomal protein CP250 (31). The PDI specific 237
antibodies did not label the GPHR-GFP decorated membranes associated with Golgi 238
membranes (Fig. 1D). Staining for CAP (cyclase associated protein), an actin cytoskeleton 239
associated protein, was used to reveal the cell cortex (20). 240
241
Characterization of DdGPHR deficient cells. The single DdGPHR gene in strain AX2 was 242
inactivated using a gene replacement vector. Disruption of the gene in the transformants was 243
analyzed and confirmed by PCR using primers located outside the vector sequences (Fig. 2A). 244
A GPHR deficient clone (GPHR) was isolated and characterized with focus on the analysis 245
of growth and development and on processes that might be impaired by changes in membrane 246
trafficking based on the presence of GPHR on ER and Golgi membranes and the phenotype 247
described for the mouse ortholog. DdGPHR deficient cells had a similar appearance as AX2 248
cells, they were significantly smaller when grown on a plastic surface (9.91±1.40 µm in 249
diameter for GPHR vs ~11.44±1.77 µm in diameter for AX2; three independent experiments 250
with more than 200 cells analyzed per experiment and strain; P value is 0.018). A difference 251
was also observed for cells grown on a lawn of K. aerogenes where cells are in general 252
smaller. We found cell sizes of 8.80±1.08 µm for GPHR and 9.92±1.82 for AX2. In this case 253
the difference was not significant (P value, 0.23). Mutant and wild type cells were mainly 254
mono- and dinucleated. Growth in axenic medium in petri dishes which is also a measure of 255
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
11
pinocytosis activity was slightly slower as compared to the parental AX2 strain. Growth was 256
not impaired in the presence of NaCl (30 mM) and sorbitol (115 mM) which indicates that 257
stress resistance is normal. Cells did not grow in shaking suspension. On a lawn of K. 258
aerogenes growth was not significantly altered, however, we noted differences with regard to 259
plaque formation. At the same time point after plating, AX2, but not the GPHR strain, had 260
formed multicellular structures in the center of plaques (Fig. 2B). When grown on a 261
suspension of E. coli B/r the mutant cells had an extended lag phase, however, once growth 262
started they attained a similar duplication time as AX2 (~3 hours for AX2 and ~3.5 hours for 263
GPHR cells), consumed all the bacteria and formed aggregates. 264
To assay the phagocytic capability we performed yeast phagocytosis assays and quantified the 265
ingested yeast particles after 15, 30 and 45 minutes of incubation in the presence of yeast. We 266
found that the mutant had ingested fewer yeast particles at each time point and during 267
incubation with different concentrations of yeast. In the presence of 5x107 yeast particles per 268
1.4x106 cells only ~17% of AX2 cells did not contain yeast particles at the 45 min time point 269
whereas in case of GPHR ~72% of
the
cells had not ingested yeast indicating a severe 270
phagocytosis defect (Table 2). 271
272
Analysis of intracellular membrane compartments and of endoplasmic reticulum 273
dynamics. Because of the presence of GPHR-GFP on the ER we probed the integrity of 274
intracellular membranes at the immunofluorescence level using markers for the nuclear 275
membrane (interaptin), the centrosome (CP250), the ER (PDI), the Golgi apparatus (comitin), 276
the endo-lysosomal system and the contractile vacuole (vacuolar ATPase subunit A, vatA), 277
and mitochondria (porin). We did not observe differences in the localization and 278
morphological appearance of these organelles at the microscopic level except for 279
mitochondria. In AX2 they were present as well defined circular structures both after staining 280
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
12
with the porin specific mAb 70-11-1 and with MitoTracker, in GPHR the mitochondria had a 281
more diffuse appearance using both stainings (Fig. 2C, D). 282
GPHR in mammalian cells is a Golgi pH regulator which functions as a counter ion transport 283
channel in the acidification of the Golgi. The pH of the ER resembles the one of the cytosol. It 284
has been reported that the ER membrane is highly permeable to protons and that the pH of the 285
lumen is susceptible to alterations of the pH in the cytosol (32). We therefore expressed 286
calpHluorin in AX2 and GPHR in order to assess the pH of the ER in resting cells and to 287
follow the response to pH changes in living cells. CalpHluorin is a fusion protein composed 288
of calreticulin and ratiometric pHluorin, a pH sensitive GFP (15, 16). CalpHluorin was 289
distributed in an ER-like pattern in both strains confirming the unaltered ER morphology in 290
the mutant (Fig. 3B). We first performed excitation scans between 340 nm and 490 nm with 291
an emission set at 510 nm using the calpHluorin expressing cells. No difference between wild 292
type and mutant was observed for the resting stage pH. We then manipulated the pH by 293
adding propionic acid and ammonium chloride. Both substances are freely permeable and lead 294
to acidification and alkalinization of the cytosol, respectively. Propionic acid traverses the 295
membrane and dissociates in the cytosol into H+ and propionate and lowers the pH (17, 33). 296
The measurements revealed characteristic fluorescence changes depending on the pH in a 297
similar manner in wild type and mutant cells (data not shown). We further performed 298
ratiometric analysis at different pH determining the ratio by dual excitation at 410 and 470 nm 299
which normalizes the expression levels of the fluorescent proteins and obtained similar ratios 300
(Fig. 3A). We conclude that the pH in the ER is regulated in AX2 and the mutant in a similar 301
manner. 302
When we probed the response of the ER to changes in the cytosolic pH analyzing the cells by 303
live cell microscopy we observed that upon addition of propionic acid the ER membranes in 304
the cytosol collapsed into large patches in the cell periphery. For GPHR cells the collapse of 305
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
13
the structures was earlier apparent than in AX2 (Fig. 3B). When the pH was neutralized by 306
the addition of ammonium chloride the patches were disassembled and normal ER structures 307
appeared. The time course of disassembly and formation of normal structures was comparable 308
in both strains (data not shown). Similar results were obtained for AX2 and GPHR which 309
were fixed after the treatments and stained with PDI specific antibodies to reveal the 310
morphology of the ER (Fig. 3B, lower panel). It appears that the distribution of the ER in the 311
GPHR cells is more sensitive to acidification compared to AX2. 312
313
Protein modifications and secretory processes involving the endoplasmic reticulum 314
The ER is a biosynthetic organelle. In general, secreted proteins are synthesized as precursors 315
into the ER where they are proteolytically processed, folded, N-glycosylated, further modified 316
and then passed on to the Golgi apparatus for additional modifications. To assess the capacity 317
of the mutant GPHR to carry out ER-associated modifications we studied the post-318
translational modification of the contact site A (csA) protein. csA is an ~80 kDa glycoprotein 319
involved in the formation of EDTA-stable cell-cell adhesions during the aggregation stage of 320
development. It is synthesized as a 53 kDa protein and then modified in the ER and the Golgi 321
by N- and O-glycosylation, respectively, and converted from a 68 kDa intermediary product 322
into the mature ~80 kDa protein which is held in the plasma membrane by a phospholipid 323
anchor (29, 34, 35). We used mAb 33-294 directed against the protein part of csA to study the 324
protein in western blots. In AX2 and in mutant cells csA was detected when cells formed 325
aggregates and migrated as an ~80 kDa protein in SDS-polyacrylamide gels indicating that its 326
synthesis and processing was not noticeably altered (Fig. 4A). Antibodies detecting the N- 327
and O-glycosylated csA molecule (mAb 123-353 and mAb 24-210, respectively) also reacted 328
with the mature protein. The faint band below the 80 kDa csA is an incompletely glycosylated 329
form of the protein which can be frequently observed (36). Two more post-translationally 330
modified proteins, the D2 (56 kDa) and the crystal protein CP (69 kDa), were included in our 331
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
14
analysis (mAb 83-418 and 130-80, respectively). They are present in growth phase cells and 332
increase in amount during development where they are detected in crystalline inclusion bodies 333
hence the name. Both proteins are synthesized as precursors and secreted into vesicles that are 334
surrounded by an ER membrane (25). We observed an unaltered size and developmental 335
expression pattern of the proteins indicating correct synthesis and processing in the GPHR 336
strain (Fig. 4A). Also, crystals were detected by immunofluorescence analysis in aggregation 337
stage cells (Fig. 4B). From the results we conclude that protein transport through the 338
endomembrane system is not disturbed and that glycosylation is not impaired. 339
We further tested the secretion of α-mannosidase. α-Mannosidase is a lysosomal hydrolase 340
produced during growth and the first hours of development. The protein is post-translationally 341
modified on its way through the ER and Golgi to the late lysosomes before it is secreted (37). 342
During growth mannosidase activity is mainly found inside the cell and very little of the 343
enzyme is secreted. This changes during development and the amounts of the enzyme 344
secreted into the supernatant increase strongly. When we tested the mannosidase activity we 345
found that AX2, GPHR and GPHR
expressing GPHR-GFP (rescue) cells exhibited similar 346
total mannosidase activity during growth and development, however, their ability to secrete 347
the enzyme differed. For AX2 cells ~73% of mannosidase activity was present in the 348
supernatant at the 6 hour time point of development whereas GPHR secreted only 42% of the 349
enzyme. Expression of GPHR-GFP in the GPHR strain corrected the defect (Fig. 4C; Table 350
3). 351
352
Motile behavior. Cell motility is a characteristic feature of Dictyostelium amoebae during all 353
phases of growth and development. GPHR cells exhibited a severe defect. We tested 354
chemotactic motility of aggregation stage cells and found a significant alteration of their 355
migratory behavior. The speed was reduced from 14.22±2.0 µm/min for AX2 amoebae to 356
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
15
4.13±1.49 µm/min for GPHR. Furthermore the mutant cells changed the direction more 357
frequently and were less persistent (Table 4). 358
359
Developmental analysis. D. discoideum multicellular development is initiated upon 360
starvation and is controlled through extracellular signaling molecules that include cAMP. To 361
evaluate possible roles of GPHR during development, we followed aggregation by starving 362
cells in Soerensen phosphate buffer in shaken suspension and on phosphate buffered agar as 363
solid substratum. In suspension cells develop until the aggregation stage and form tight 364
aggregates, on a solid substratum they can undergo the complete developmental cycle which 365
results in the formation of fruiting bodies composed of a stalk and a spore head. We 366
monitored the development in suspension by following the decrease in the optical density at 367
600 nm due to aggregate formation. GPHR cells and AX2 cells formed aggregates in a 368
similar manner (Fig. 4D). The csA protein which mediates cell-cell contacts in the aggregates 369
was detected in a timely manner in both strains (38) (Fig. 4A). 370
When developed on phosphate agar plates the GPHR cells aggregated normally, however, 371
during later stages abnormalities were noted. Many of the slugs did not have the typical cigar 372
like shape with a smooth and even surface, instead, they often had a knobby appearance and 373
were of uneven thickness and irregular shape (Fig. 5A). 374
In order to analyze pattern formation during development we used the vital stain neutral red 375
(Fig. 5B). Neutral red stained tips were observed in aggregates of AX2 and GPHR In 376
GPHR
aggregates a significant number of neutral red stained cells was present throughout 377
the aggregate. In AX2 slugs the staining was retained at the tip where the prestalk cells reside 378
and in the back of the slug as reported previously (39). Neutral red positive cells, which 379
correspond to anterior-like cells (ALC), were also scattered throughout the prespore region. In 380
GPHR slugs neutral red stained cells were not strongly enriched at the tip but were present 381
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
16
throughout the slug. Towards the rear of the slug they were less prominent (Fig. 5B). We also 382
noted that mutant multicellular structures were smaller than those of AX2 (Fig. 5A). To 383
confirm the reduction in size we determined the numbers that were formed from identical 384
numbers of cells initially plated. We found that for AX2 a defined area contained ~6 slugs or 385
aggregates, whereas for GPHR we counted ~22 multicellular structures in a similar sized 386
area. The mutant slugs developed into small fruiting bodies, and the head contained viable 387
spores. Stalk cells and spores were fully differentiated as detected by Calcofluor staining (Fig. 388
5C). AX2 and GPHR stalk cells were large and had irregular shapes, spores from AX2 had 389
an elliptical shape and were of relatively uniform size. For GPHR spores we detected various 390
shapes from round to oval (Fig. 5C). Also, their sizes varied and the majority of them was 391
smaller than the spores of AX2 (Fig. 5D). 392
Slugs are motile and migrate towards light. In phototaxis experiments AX2 slugs migrated in 393
a highly oriented fashion towards the light source. Mutant slugs formed but migrated over 394
short distances only and less directed (Fig. 5E). The developmental defect was rescued by re-395
expression of DdGPHR-GFP (Fig. 5A) and by mixing mutant and wild type cells in a ratio of 396
70 to 30 (data not shown). When we mixed AX2 cells expressing a GFP-tagged protein 397
(LimD (11) with GPHR cells, multicellular structures were formed that contained both cells. 398
Also, the GFP-positive cells were distributed equally throughout the slug and did not show a 399
particular enrichment in a special area (data not shown). 400
To analyze development further we monitored the expression of developmental markers at the 401
mRNA level by quantitative real time PCR (Fig. 6). Development was on phosphate buffered 402
agar and RNA was isolated at the indicated time points. For early developmental markers we 403
studied the mRNA levels of cadA, carA and csA (38, 40, 41). CadA is a cadherin-like cell 404
adhesion molecule which is responsible for the formation of EDTA-sensitive cell adhesions, 405
carA is the cAMP receptor which senses cAMP signals during early aggregation, csA 406
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
17
mediates EDTA-stable adhesions. The highest mRNA levels for cadA, carA and csA were 407
reached in GPHR at the 12.5 hour time point which corresponds to the aggregation stage. 408
The levels were higher than those in AX2 at this time point. Maximum levels of carA and csA 409
transcripts were reached at 16.5 hours in AX2. Markers specific for later developmental 410
stages showed a different pattern. The mRNAs for ecmA and pspA, a prestalk and a prespore 411
specific gene, which encode structural components of the stalk and of spores (42), 412
respectively, showed maximum accumulation at 12.5 hours in AX2, in GPHR the levels 413
reached a maximum at 16.5 hours. Maximum levels of ecmA were comparable in both strains, 414
whereas maximum pspA levels were lower in the mutant. The product of the ecmB gene is a 415
marker for stalk cell differentiation and has a structural role in the stalk tube (39). The 416
corresponding transcript levels showed a similar pattern of accumulation in both strains, 417
however, the amounts were strongly reduced in GPHR. Dramatically lower transcript levels 418
were noted for the late developmental marker spiA in GPHR deficient cells (Fig. 6, please 419
note the logarithmic scale of the y-axis). SpiA is a marker of terminal differentiation. It is a 420
spore coat protein and the gene is expressed concomitant with the encapsulation of spores 421
(43). Taken together, the pattern of developmental gene expression, in particular of genes that 422
are expressed at the later developmental stages, is strongly disturbed in the mutant which may 423
lead to the morphological alterations. 424
425
Discussion 426
Dictyostelium GPHR is primarily an ER-associated protein with some accumulation at the 427
Golgi. This parallels the localization of the GPHR of Drosophila with which is shares the 428
highest homology. Since our results were obtained using GFP-tagged GPHR which was 429
expressed under the control of the actin 15 promoter we cannot exclude the possibility that the 430
distribution of the endogenous protein might differ. In the Drosophila studies an HA-tagged 431
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
18
protein was overexpressed and used for localization studies (5). GPHRs have been well 432
studied only in a few organisms so far, and functions ranging from abscisic acid receptor to 433
Golgi pH regulator have been identified for plants and mammalian cells, respectively (3, 4). 434
Ablation of the Drosophila ortholog disturbed the ER and Golgi organization and affected 435
growth (5). In D. discoideum we observed changes at the growth phase stage and during late 436
development. 437
Remarkable was the altered ER dynamics in response to acidification. The peripheral ER of 438
cells is highly dynamic and undergoes constant rearrangements. Furthermore, ER tubules are 439
retracted towards the cell center and extend outward again. This mechanism ensures correct 440
distribution of the peripheral ER. It involves the cytoskeleton, in yeast the actin cytoskeleton 441
and a type V myosin, in animal cells mainly the microtubule system (44). CalpHluorin 442
expression allowed us to follow the ER dynamics in response to pH changes in vivo. 443
Acidification by propionic acid caused the formation of ER patches in the cell periphery. In 444
GPHR this response occurred already at a concentration of 20 mM whereas for AX2 30 mM 445
propionic acid was needed. The regulation of ER dynamics in D. discoideum has not been 446
under extensive investigation. An involvement of the class I myosin MyoK in delivery of ER 447
membranes to the early phagosome has been reported, and a recruitment of calnexin-positive 448
ER to Legionella pneumophila containing vacuoles (45, 46). From the published data it is 449
reasonable to assume that the ER associates with the actin and the microtubule cytoskeleton in 450
D. discoideum. For the actin cytoskeleton pH-sensitive regulators have been described such as 451
α-actinin, hisactophilin and cofilin which have the capacity to influence the cytoskeletal 452
reorganization in a pH sensitive manner and thereby they may also influence the ER dynamics 453
(47-49). 454
Posttranscriptional processing and modifications of proteins was probed for the plasma 455
membrane protein csA and for D2 and CP, which are contained in membrane surrounded 456
structures in the cytosol. The modifications and trafficking occurred in a timely manner 457
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
19
during development in GPHR. These findings together with a similar response of the ER pH 458
sensor calpHluorin to pH changes in AX2 and GPHR may be an indication that pH 459
regulation in the ER is ensured by further proteins as has been suggested for Drosophila. 460
Multiple insurance of pH homeostasis seems to be essential for a free living unicellular 461
organism like D. discoideum which in its natural habitat is subjected to frequent 462
environmental changes such as changing pH and osmotic conditions. 463
By contrast, the secretion of mannosidase was impaired in the mutant. In AX2 the majority of 464
the protein was secreted during development reaching more than 70% of the total enzyme 465
activity, whereas in GPHR only about 40% of the enzyme activity was secreted. Differences 466
between wild type and mutant were also noted during late development. GPHR developed 467
timely, but the multicellular structures were smaller and the slugs and the stalks had aberrant 468
shapes. The slugs were of uneven thickness and the stalks were knobby. For the fruiting 469
bodies we noted a reduction in size and variability with regard to stalk shape and length. We 470
presume that this is due to the deranged expression pattern of developmental marker proteins 471
which may not allow timely synthesis of essential proteins for differentiation and 472
morphogenesis. A role in development is also suggested by the expression pattern of the 473
GPHR gene where we noted two maxima of expression, one during aggregation and a further 474
one in late development. 475
The slugs of the GPHR strain resemble those of strains carrying a mutation in Gα1 (Q206L) 476
converting it to a constitutively active molecule. Gα1 was proposed to be involved in 477
signaling pathways that play an essential role in regulating multicellular development by 478
controlling prestalk morphogenesis (50). Whether Gα1 and GPHR act in the same pathway is 479
not known and how GPHR regulates expression of developmentally regulated genes is 480
unclear at present. Regulation by the ER at the level of transcription occurs in the unfolded 481
protein response (UPR). With UPR a network of signaling pathways is described that 482
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
20
maintains the protein folding capacity of the ER. It is initiated by proteins in the ER 483
membrane that detect incompletely folded or unfolded proteins and activate a transcriptional 484
program which leads to correction of the defect. These sensors are normally present in the ER. 485
Upon stress they are cleaved and released into the cytosol. The cytosolic portion migrates into 486
the nucleus and functions as transcriptional regulator (51). A role in this response system 487
could be an intriguing possibility for GPHR. 488
489
Acknowledgements 490
This work was supported by the DFG and SFB 670. TYR had support from the 491
Professorinnen Programm of the University of Cologne. We thank Dr. C. S. Clemen for help 492
with fluorescence spectroscopy, Dr. S. Neumann and lab 14 members for help with figures, B. 493
Gaßen for providing monoclonal antibodies and dictybase for providing reagents. 494
495
496
References 497
498 1. Eichinger L, Pachebat JA, Glöckner G, Rajandream MA, Sucgang R, Berriman M, 499
Song J, Olsen R, Szafranski K, Xu Q et al. 2005. The genome of the social amoeba 500
Dictyostelium discoideum. Nature 435:43-57. 501
2. Heidel AJ, Lawal HM, Felder M, Schilde C, Helps NR, Tunggal B, Rivero F, John 502
U, Schleicher M, Eichinger L. et al. 2011. Phylogeny-wide analysis of social amoeba 503
genomes highlights ancient origins for complex intercellular communication. Genome 504
Res. 21:1882-1891. 505
3. Pandey S, Nelson DC, Assmann SM. 2009. Two novel GPCR-type G proteins are 506
abscisic acid receptors in Arabidopsis. Cell 136:136-148. 507
4. Maeda Y, Ide T, Koike M, Uchiyama Y, Kinoshita T. 2008. GPHR is a novel anion 508
channel critical for acidification and functions of the Golgi apparatus. Nat. Cell Biol. 509
10:1135-1145. 510
5. Charroux B, Royet J. 2014. Mutations in the Drosophila ortholog of the vertebrate 511
Golgi pH regulator (GPHR) protein disturb endoplasmic reticulum and Golgi 512
organization and affect systemic growth. Biol. Open 3:72-80. 513
6. Taddese B, Upton GJ, Bailey GR, Jordan SR, Abdulla NY, Reeves PJ, Reynolds. 514
CA. 2014. Do plants contain g protein-coupled receptors? Plant Physiol. 164:287-307. 515
7. Matsuda A, Suzuki Y, Honda G, Muramatsu S, Matsuzaki O, Nagano Y, Doi T, 516
Shimotohno K, Harada T, Nishida E et al. 2003. Large-scale identification and 517
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
21
characterization of human genes that activate NF-B and MAPK signaling pathways. 518
Oncogene 22:3307–3318. 519
8. Tang T, Li L, Tang J, Li Y, Lin WY, Martin F, Grant D, Solloway M, Parker L, Ye 520
W et al. 2010. A mouse knockout library for secreted and transmembrane proteins. Nat. 521
Biotechnol. 28:749-755. 522
9. Tarutani M, Nakajima K, Uchida Y, Takaishi M, Goto-Inoue N, Ikawa M, Setou M, 523
Kinoshita T, Elias PM, Sano S, Maeda Y. 2012. GPHR-dependent functions of the 524
Golgi apparatus are essential for the formation of lamellar granules and the skin barrier. 525
J. Invest. Dermatol. 132:2019-2025. 526
10. Harloff C, Gerisch. G, Noegel A A. 1989. Selective elimination of the contact site A 527
protein of Dictyostelium discoideum by gene disruption. Genes Dev. 3:2011-2019. 528
11. Khurana B, Khurana T, Khaire N, Noegel AA. 2002. Functions of LIM proteins in 529
cell polarity and chemotactic motility. EMBO J. 21:5331-5342. 530
12. Müller R, Herr C, Sukumaran SK, Omosigho NN, Plomann M, Riyahi TY, Stumpf 531
M, Swaminathan K, Tsangarides M, Yiannakou K. et al. 2013. The cytohesin paralog 532
Sec7 of Dictyostelium discoideum is required for phagocytosis and cell motility. Cell 533
Commun. Signal. 11:54. 534
13. Faix J, Kreppel L, Shaulsky G, Schleicher M, Kimmel AR. 2004. A rapid and 535
efficient method to generate multiple gene disruptions in Dictyostelium discoideum using 536
a single selectable marker and the Cre-loxP system. Nucleic Acids Res. 32:e143. 537
14. Gräf R, Daunderer C, Schliwa M. 2000. Dictyostelium DdCP224 is a microtubule-538
associated protein and a permanent centrosomal resident involved in centrosome 539
duplication. J. Cell Sci. 113:1747-1758. 540
15. Miesenböck G, De Angelis DA, Rothman JE. 1998. Visualizing secretion and synaptic 541
transmission with pH-sensitive green fluorescent proteins. Nature 394:192-195. 542
16. Prabhu Y, Müller R, Anjard C, Noegel AA. 2007. GrlJ, a Dictyostelium GABAB-like 543
receptor with roles in post-aggregation development. BMC Dev. Biol. 7:44. 544
17. Hanakam F, Albrecht R, Eckerskorn C, Matzner M, Gerisch G. 1996. Myristoylated 545
and non-myristoylated forms of the pH sensor protein hisactophilin II: intracellular 546
shuttling to plasma membrane and nucleus monitored in real time by a fusion with green 547
fluorescent protein. EMBO J. 15:2935-2943. 548
18. Simpson PA, Spudich JA, Parham P. 1984. Monoclonal antibodies prepared against 549
Dictyostelium actin: characterization and interactions with actin. J. Cell Biol. 99:287–550
295. 551
19. Kilmartin JV, Wright B, Milstein C. 1982. Rat monoclonal antitubulin antibodies 552
derived by using a new nonsecreting rat cell line. J. Cell Biol. 93:576-582. 553
20. Gottwald U, Brokamp R, Karakesisoglou I, Schleicher M, Noegel AA. 1996. 554
Identification of a cyclase-associated protein (CAP) homologue in Dictyostelium 555
discoideum and characterization of its interaction with actin. Mol. Biol. Cell 7:261–272. 556
21. Monnat J, Hacker U, Geissler H, Rauchenberger R, Neuhaus EM, Maniak M, 557
Soldati T. 1997. Dictyostelium discoideum protein disulfide isomerase, an endoplasmic 558
reticulum resident enzyme lacking a KDEL-type retrieval signal. FEBS Lett. 418, 357-559
362. 560
22. Döring V, Veretout F, Albrecht R, Mühlbauer B, Schlatterer C, Schleicher M, 561
Noegel AA. 1995. The in vivo role of annexin VII (synexin): characterization of an 562
annexin VII-deficient Dictyostelium mutant indicates an involvement in Ca(2+)-regulated 563
processes. J. Cell Sci. 108:2065-2076. 564
23. Rivero F, Kuspa A, Brokamp R, Matzner M, Noegel AA. 1998. Interaptin, an actin-565
binding protein of the alpha-actinin superfamily in Dictyostelium discoideum, is 566
developmentally and cAMP-regulated and associates with intracellular membrane 567
compartments. J. Cell Biol. 142:735-750. 568
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
22
24. Weiner OH, Murphy J, Griffiths G, Schleicher M, Noegel AA. 1993. The actin-569
binding protein comitin (p24) is a component of the Golgi apparatus. J. Cell Biol. 570
123:23-34. 571
25. Bomblies L, Biegelmann E, Döring V, Gerisch G, Krafft-Czepa H, Noegel AA, 572
Schleicher M, Humbel BM. 1990. Membrane-enclosed crystals in Dictyostelium 573
discoideum cells, consisting of developmentally regulated proteins with sequence 574
similarities to known esterases. J. Cell Biol. 110:669-679. 575
26. Troll H, Malchow D, Müller-Taubenberger A, Humbel B, Lottspeich F, Ecke M, 576
Gerisch G, Schmid A, Benz R. 1992. Purification, functional characterization, and 577
cDNA sequencing of mitochondrial porin from Dictyostelium discoideum. J. Biol. Chem. 578
267:21072-21079. 579
27. Jenne N, Rauchenberger R, Hacker U, Kast T, Maniak M. 1998. Targeted gene 580
disruption reveals a role for vacuolin B in the late endocytic pathway and exocytosis. J. 581
Cell Sci. 111:61-70. 582
28. Noegel AA, Blau-Wasser R, Sultana H, Müller R, Israel L, Schleicher M, Patel H, 583
Weijer CJ. 2004. The cyclase-associated protein CAP as regulator of cell polarity and 584
cAMP signaling in Dictyostelium. Mol. Biol. Cell 15:934-945. 585
29. Bertholdt G, Stadler J, Bozzaro S, Fichtner B, Gerisch G. 1985. Carbohydrate and 586
other epitopes of the contact site A glycoprotein of Dictyostelium discoideum as 587
characterized by monoclonal antibodies. Cell Differ. 16:187-202. 588
30. Haus U, Trommler P, Fisher PR, Hartmann H, Lottspeich F, Noegel AA, Schleicher 589
M. 1993. The heat shock cognate protein from Dictyostelium affects actin polymerization 590
through interaction with the actin-binding protein cap32/34. EMBO J. 12:3763–3771. 591
31. Blau-Wasser R, Euteneuer U, Xiong H, Gassen B, Schleicher M, Noegel AA. 2009. 592
CP250, a novel acidic coiled-coil protein of the Dictyostelium centrosome, affects 593
growth, chemotaxis, and the nuclear envelope. Mol Biol Cell 20:4348-4361. 594
32. Kim JH, Johannes L, Goud B, Antony C, Lingwood CA, Daneman R, Grinstein S. 595
1998. Noninvasive measurement of the pH of the endoplasmic reticulum at rest and 596
during calcium release. Proc Natl Acad Sci U S A. 95:2997-3002. 597
33. Williams GB, Elder EM, Sussman M. 1986. NH3 and propionate modulate the 598
morphological response of aggregation-competent Dictyostelium discoideum to cAMP. 599
Differentiation 31, 92-99. 600
34. Hohmann HP, Bozzaro S, Yoshida M, Merkl R, Gerisch G. 1987. Two-step 601
glycosylation of the contact site A protein of Dictyostelium discoideum and transport of 602
an incompletely glycosylated form to the cell surface. J. Biol. Chem. 262:16618-16624. 603
35. Stadler J, Keenan TW, Bauer G, Gerisch G. 1989. The contact site A glycoprotein of 604
Dictyostelium discoideum carries a phospholipid anchor of a novel type. EMBO J. 8:371-605
377. 606
36. Faix J, Gerisch G, Noegel AA. 1990. Constitutive overexpression of the contact site A 607
glycoprotein enables growth-phase cells of Dictyostelium discoideum to aggregate. 608
EMBO J. 9:2709-2716. 609
37. Cardelli JA, Schatzle J, Bush JM, Richardson J, Ebert D, Freeze H. 1990. 610
Biochemical and genetic analysis of the biosynthesis, sorting, and secretion of 611
Dictyostelium lysosomal enzymes. Dev. Genet. 11:454-462. 612
38. Noegel A, Harloff C, Hirth P, Merkl R, Modersitzki M, Stadler J, Weinhart U, 613
Westphal M, Gerisch G. 1985. Probing an adhesion mutant of Dictyostelium 614
discoideum with cDNA clones and monoclonal antibodies indicates a specific defect in 615
the contact site A glycoprotein. EMBO J. 4:3805-3810. 616
39. Jermyn KA, Williams JG. 1991. An analysis of culmination in Dictyostelium using 617
prestalk and stalk-specific cell autonomous markers. Development 111:779-787. 618
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
23
40. Yang C, Brar SK, Desbarats L, Siu CH. 1997. Synthesis of the Ca(2+)-dependent cell 619
adhesion molecule DdCAD-1 is regulated by multiple factors during Dictyostelium 620
development. Differentiation 61:275-284. 621
41. Klein PS, Sun TJ, Saxe CL 3rd, Kimmel AR, Johnson RL, Devreotes PN. 1988. A 622
chemoattractant receptor controls development in Dictyostelium discoideum. Science 623
241:1467-1472. 624
42. Early A, McRobbie SJ, Duffy KT, Jermyn KA, Tilly R, Ceccarelli A, Williams JG. 625
1988. Structural and functional characterization of genes encoding Dictyostelium prestalk 626
and prespore cell-specific proteins. Dev Genet. 9:383-402. 627
43. Richardson DL, Loomis WF. 1992. Disruption of the sporulation-specific gene spiA in 628
Dictyostelium discoideum leads to spore instability. Genes Dev. 6:1058–1070. 629
44. Du Y, Ferro-Novick S, Novick P. 2004. Dynamics and inheritance of the endoplasmic 630
reticulum. J. Cell Sci. 117:2871-2878. 631
45. Dieckmann R, Guého A, Monroy R, Ruppert T, Bloomfield G, Soldati T. 2012. The 632
balance in the delivery of ER components and the vacuolar proton pump to the 633
phagosome depends on myosin IK in Dictyostelium. Mol Cell Proteomics 11:886-900. 634
46. Weber S, Wagner M, Hilbi H. 2014. Live-cell imaging of phosphoinositide dynamics 635
and membrane architecture during Legionella infection. MBio 5:e00839-13. 636
47. Condeelis J, Vahey M. 1982. A calcium- and pH-regulated protein from Dictyostelium 637
discoideum that cross-links actin filaments. J. Cell Biol. 94:466-471. 638
48. Yonezawa N, Nishida E, Sakai H. 1985. pH control of actin polymerization by cofilin. 639
J. Biol. Chem. 260:14410-14412. 640
49. Scheel J, Ziegelbauer K, Kupke T, Humbel BM, Noegel AA, Gerisch G, Schleicher 641
M (1989). Hisactophilin, a histidine-rich actin-binding protein from Dictyostelium 642
discoideum. J. Biol. Chem. 264:2832-2839. 643
50. Dharmawardhane S, Cubitt A B, Clark AM, Firtel RA. 1994. Regulatory role of the 644
G alpha 1 subunit in controlling cellular morphogenesis in Dictyostelium. Development 645
120:3549-3561. 646
51. Jäger R, Bertrand MJ, Gorman AM, Vandenabeele P, Samali A. 2012. The unfolded 647
protein response at the crossroads of cellular life and death during endoplasmic reticulum 648
stress. Biol. Cell 104, 259-270. 649
52. Letunic I, Doerks T, Bork P. 2012. SMART 7: recent updates to the protein domain 650
annotation resource. Nucleic Acids Res. 40:D302-305. 651
53. Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott 652
C, Fong JH, Geer LY, Geer RC, Gonzales NR, et al. 2011. CDD: a Conserved 653
Domain Database for the functional annotation of proteins. Nucleic Acids Res. 39:D225-654
229. 655
656
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
24
Table 1 List of primers used for qRT-PCR. The numbers next to the gene name indicate the 657
position in the cDNA. 658
659
Primer Sequence (5'→3')
cadA-122-for TCATGTCATGTTTGGTTGGTTCAAATG
cadA-550-rev CTGTAACTTGGCCAGTTGTTGGGAGT
carA-515-for GGGCAATTTCAGCAGTATTGGTTGGTT
carA-977-rev TCGGAACTACATTGCACATCATCACCA
csa-476-for TCGTGCCAAATACAATCGCTGGTG
csa-960-rev TGGGCTTGAGGTTCCCCATGGTT
ecmA-4570-for TGCATCGAAGTCCCAATGAATTGTTACC
ecmA-5010-rev ACCAGTCTTGGAATCGCAACTATCAGC
ecmB-2710-for CCGAAGATAAATGTACTCAATCAGGTGGTG
ecmB-3140-rev TTCCAAATGTTTTGCATTGGGTCATTG
pspA-82-for GCCAATCAAAATCCAGTTTGTGCTTCA
pspA-499-rev GGGAAAGAATCATTGAGAAAATAATGAGTGA
spiA-221-for CTCCAGCAACTGCTCATCCAAGACAAG
spiA-674-rev ACAGTAGCCATGGCACCAACTGCATTA
660
661
662
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
25
Table 2 Yeast phagocytosis 663
% AX2 cells with indicated numbers of
yeast particles % GPHR
cells with indicated
numbers of yeast particles
0 1 2 3 0 1 2 3
15 min 49 23 14 14 90 8 2 0
30 min 30 16 20 35 82 15 2 1
45 min 18 18 17 45 75 18 5 4
664
1.4 x 106 cells were incubated with 5 x 10
7 yeast particles. 665
666
667
668
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
26
Table 3 Mannosidase secretion of (A) AX2 and GPHR and (B) AX2 and GPHR
expressing 669
GPHR-GFP (rescue) 670
(A) 671
% mannosidase secreted after total mannosidase activity
(µmol/ml/107
cells)
0 hours 2 hours 4 hours 6 hours 0 hours 2 hours 4 hours 6 hours
AX2 9.5 63.9 73.4 74.5 0.88 0.97 1.20 1.30
GPHR 9.9 20 32.5 42 1.41 1.46 1.31 1.34
672
The results represent the mean of three experiments. Standard deviations are indicated in the 673
graph (Fig. 4C). 674
675
(B) 676
% mannosidase secreted total mannosidase activity
(µmol/ml/107 cells)
0 hours 2 hours 4 hours 6 hours 0 hours 2 hours 4 hours 6 hours
AX2 12.75 50.35 60.41 66.93 1.40 1.47 1.73 1.95
rescue 7.29 41.52 54.33 66.63 1.88 2.22 2.27 2.35
677
The results represent the mean of two experiments. Standard deviations are indicated in the 678
graph (Fig. 4C). 679
680
681
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
27
Table 4 Analysis of cell motility. Cells were starved for five hours and then used for the 682
analysis. 683
strain # of cells Speed
(µm/min)
Direction
change
(deg)
Persistence
(µm/min-
deg)
AX2 6 12.91±0.835 13.80±4.48 5.647±1.16
10 13.667±2.86 15.287±9.326 5.505±2.51
6 16.51±2.45 15.43±2.258 5.338±0.84
7 13.829±1.88 14.19±3.589 5.54±1.81
29 14.229±2.0 14.676±4.91 5.50±1.58
GPHR 6 4.655±2.669 32.47±17.52 1.645±1.159
3 4.21±1.09 33.144±16.039 1.365±0.785
4 3.725±0.42 30.096±16.127 1.358±0.381
7 3.937±1.8 27.585±17.3 1.40±0.748
20 4.13±1.49 30.82±16.74 1.442±0.768 684
Data were obtained from four individual experiments. The differences in speed, direction 685
change and persistence were significant. P<0.0001. In bold are the combined results of all 686
experiments. The experiments were carried out together with the analysis of sec7 cells, hence 687
the data for AX2 were the same as in this analysis (12). 688
689
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
28
Figure legends 690
FIG 1 Evolutionary tree, GPHR domain structure, transcript accumulation during 691
development and subcellular distribution of GPHR-GFP. (A) Evolutionary tree for selected 692
GPHRs from fungi, plants, amoebozoa and animals. A CLUSTALX alignment of GPHR full 693
length protein sequences from different organisms was used to create a bootstrap N-J tree 694
with the TreeView program. The tree was rooted on the human serotonin receptor (NP 695
000515 Hs). Bootstrap values are provided at the node of each branch. The scale bar indicates 696
amino acid substitutions per site. The different clades are colour-coded in the tree: fungi – 697
blue, plants – green, amoebozoa – orange and animals – red. Genbank accession numbers are 698
provided to the right of the tree. Abbreviations for the different species are: Hs - Homo 699
sapiens, Np - Neofusicoccum parvum, Nc - Neurospora crassa, Mo - Magnaporthe oryzae, Sl 700
- Solanum lycopersicum, At - Arabidopsis thaliana, Os - Oryza sativa, Zm - Zea mays, Ac - 701
Acanthamoeba castellanii, Dd - Dictyostelium discoideum, Dp: Dictyostelium purpureum, 702
Dm: Drosophila melanogaster, Dr: Danio rerio, Gg: Gallus gallus, Ce: Caenorhabditis 703
elegans. (B) Conserved domains were identified using the SMART database (Simple Modular 704
Architecture Research Tool (http://smart.embl.de/)) and a search at the Conserved Domain 705
Database at NCBI (52, 53). Black bars represent transmembrane domains, the position of the 706
first amino acid is indicated. DUF, domain of unknown function. The ABA GPCR domain 707
has been identified in the Arabidopsis homolog. (C) Transcript accumulation during 708
development. RNA was isolated from AX2 undergoing starvation on phosphate agar plates at 709
the indicated time points, converted into cDNA and used for qRT-PCR. For quantification an 710
annexin7 plasmid was used as internal standard. Relative expression levels are given. The 711
amount detected at 0 hours was arbitrarily set to 1. (D) Distribution of GPHR-GFP followed 712
by immunofluorescence analysis. Cells were fixed with methanol and labeled with 713
monoclonal antibodies specific for the actin cytoskeleton associated protein CAP, the Golgi 714
marker comitin, the centrosomal protein CP250, the nuclear envelope protein interaptin, the 715
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
29
α-tubulin specific antibody YL1/2 and the ER protein PDI (protein disulfide isomerase). 716
Appropriate secondary antibodies were used. Nuclei were stained with DAPI. Size bar, 5 µm. 717
718
FIG 2 Generation and characterization of GPHR deficient cells. (A) Strategy of the knockout 719
vector and PCR analysis of AX2 and mutant DNA using the indicated primers. (a) PCR 720
product obtained with primer pair loxp-3’-for and gpcr-3’-rev, (b) 100 base pair ladder. (B) 721
Plaque morphology. AX2 and GPHR were spread onto SM agar plates with K. aerogenes. 722
Pictures were taken at the same time after plating. Size bar, 1000 µm. (C) 723
Immunofluorescence analysis of AX2 and GPHR cells. Strains grown on petri dishes in 724
axenic medium were used for the analysis. Fixation was with ice cold methanol. Monoclonal 725
antibodies recognizing proteins specific for distinct cellular compartments as indicated in the 726
results section were used. Nuclei were stained with DAPI. Size bar, 10 µm. (D) Mitochondria 727
were also stained with MitoTracker. The cell cortex was detected by mAb act1. 728
729
FIG 3 Response of the ER to pH changes. (A) Ratiometric analysis. CalpHluorin was 730
expressed in AX2 and GPHR. They were placed in a buffer containing propionic acid or 731
NH4Cl and analyzed in a plate fluorimeter by dual excitation at 410 nm and 470 nm with an 732
emission filter set at 510 nm. The ratios of 410 nm/470 nm are shown. (B) In vivo imaging of 733
CalpHluorin expressing AX2 and GPHR cells under varying pH conditions which allows to 734
follow the dynamics of the ER. Addition of propionic acid (PA) led to a clustering of the ER 735
in GPHR and AX2 cells. GPHR
responded with a clustering of the ER already at 20 mM 736
propionic acid whereas for AX2 cells this effect was seen at 30 mM propionic acid. The same 737
set of cells was followed over time. Fluorescence and bright field images are shown. Size bar, 738
10 µm. Lower panel, cells were treated with 20 mM propionic acid and fixed with methanol. 739
The ER was stained with PDI specific antibodies. 740
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
30
741
FIG 4 Posttranslational protein processing and modification of developmentally regulated 742
proteins and secretion of mannosidase. (A) Protein modification of developmentally regulated 743
proteins. Cells were starved in Soerensen phosphate buffer in shaken suspension and samples 744
taken for western blot analysis at the indicated time points. The blot was probed with 745
monoclonal antibodies recognizing the 80 kDa contact site A protein csA, mAb 33-294 which 746
is directed against the protein moiety, mAb 123-353 which detects N-glycosylated residues 747
and mAb 24-210 which detects O-glycosylated residues on the csA molecule, the 69 kDa CP 748
(mAb 130-80) and the 56 kDa D2 protein (mAb 83-418). Cap32 (mAb 188-19) was used as 749
loading control. The cap32 blot for mAb 33-294 staining is shown. (B) Crystal formation in 750
aggregation competent AX2 and GPHR cells as detected with mAb 83-418. Size bar, 5 µm. 751
(C) Bar graph showing mannosidase secretion for AX2, GPHR and GPHR
expressing 752
GPHR-GFP (rescue). Cells were starved in Soerensen phosphate buffer, pH 6.0, and at the 753
indicated time points the -mannosidase activity was determined. -mannosidase secretion in 754
percent and total -mannosidase activity in percent are shown. The -mannosidase activity 755
was determined in the medium and in the cell pellet at the indicated time points after the 756
beginning of starvation. The results represent the mean of three (AX2/GPHR) and two 757
experiments (AX2/rescue). (D) Cell-cell adhesion during starvation in suspension culture in 758
AX2 and GPHR. The optical density of the cell suspensions was determined at 600 nm at the 759
indicated time points. Aggregation is measured as a decrease in OD600. The OD600 at the 760
start of the experiment was set to 100%. 761
762
FIG 5 Analysis of late developmental stages. (A) Slugs and fruiting bodies of AX2, GPHR, 763
and GPHR expressing GPHR-GFP (rescue) are shown. Starvation was on phosphate buffered 764
agar. The photographs were taken at the same time after plating to allow for correct 765
on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
31
comparison of development. Size bar, 250 µm. (B) neutral red stained aggregates and slugs. 766
(C) Stalks and spores were stained with Calcofluor. (D) Distribution of the pore size. More 767
than 200 spores were evaluated. (E) Phototactic migration is defective in GPHR. Although 768
GPHR slugs were formed they traveled only over very short distances. The position of the 769
light source is indicated. 770
771
FIG 6 Transcript levels of late developmental markers as analyzed by qRT-PCR. Starvation 772
was on phosphate buffered agar plates (5x107 cells/plate). Cells were harvested at the 773
indicated time points. Evaluation of the developmental stage was determined by visual 774
inspection. The 12.5 h time points corresponded to the aggregation stage, at 16.5 h slugs had 775
formed and culmination started. RNA was isolated and used for qRT-PCR. Relative amounts 776
are given. Primers specific for the indicated markers are given in Table 1. Please note the 777
logarithmic scale for spiA expression. 778
779 on August 26, 2018 by guest
http://ec.asm.org/
Dow
nloaded from