1-s2.0-S1055790304000326-main
Transcript of 1-s2.0-S1055790304000326-main
-
7/28/2019 1-s2.0-S1055790304000326-main
1/18
Distribution of introns in the mitochondrial gene nad1 in landplants: phylogenetic and molecular evolutionary implications
Olena Dombrovska and Yin-Long Qiu*
Department of Ecology and Evolutionary Biology, University of Michigan, 830 North University Avenue, Ann Arbor, MI 48109-1048, USA
Institute of Systematic Botany, University of Zurich, Zollikerstrasse 107, 8008 Zurich, Switzerland
Received 22 July 2003; revised 17 December 2003
Available online 27 February 2004
Abstract
Forty-six species of diverse land plants were investigated by sequencing for their intron content in the mitochondrial gene nad1. A
total of seven introns, all belonging to group II, were found, and two were newly discovered in this study. All 13 liverworts examined
contain no intron, the same condition as in green algae. Mosses and hornworts, however, share one intron by themselves and
another one with vascular plants. These intron distribution patterns are consistent with the hypothesis that liverworts represent the
basal-most land plants and that the two introns were gained in the common ancestor of mosseshornwortsvascular plants after
liverworts had diverged. Hornworts also possess a unique intron of their own. A fourth intron was found only in Equisetum L.,
Marattiaceae, Ophioglossum L., Osmunda L., Asplenium L., and Adiantum L., and was likely acquired in their common ancestor,
which supports the monophyly of moniliformopses. Three introns that were previously characterized in angiosperms and a few
pteridophytes are now all extended to lycopods, and were likely gained in the common ancestor of vascular plants. Phylogenetic
analyses of the intron sequences recovered topologies mirroring those of the plants, suggesting that the introns have all been
vertically inherited. All seven nad1 group II introns show broad phylogenetic distribution patterns, with the narrowest being in
moniliformopses and hornworts, lineages that date back to at least the Devonian (345 million years ago) and Silurian (435 million
years ago), respectively. Hence, these introns must have invaded the genes via ancient transpositional events during the early stage of
land plant evolution. Potentially heavy RNA editing was observed in nad1 of Haplomitrium Dedecek, Takakia Hatt. & Inoue,
hornworts, Isoetes L., Ophioglossum, and Asplenium. A new nomenclature is proposed for group II introns.
2004 Elsevier Inc. All rights reserved.
Keywords: Genomic structural characters; Group II introns; Intron nomenclature; Land plant phylogeny; Mitochondrial DNA;nad1; RNA editing
1. Introduction
Evolution of land plants (embryophytes) fundamen-
tally altered the terrestrial ecosystem and set the stage
for evolution of other land-dwelling life (Gensel and
Edwards, 2001; Graham, 1993; Kenrick and Crane,
1997a). A large number of paleobotanical, morpholog-
ical, and molecular studies have been devoted to un-
derstanding this important event in the history of life on
earth. However, our knowledge on radiation of early
land plants remains incomplete, and in particular several
key questions regarding basal land plant phylogeny are
still controversial. These include: what represents the
first lineage of land plants, which bryophyte group is
sister to vascular plants, and how are several extant
pteridophyte lineages related to each other (Edwards
et al., 1995; Hedderson et al., 1998; Kenrick and Crane,
1997b; Lewis et al., 1997; Mishler et al., 1994; Nickrent
et al., 2000; Nishiyama and Kato, 1999; Pryer et al.,
2001; Qiu et al., 1998; Renzaglia et al., 2000; Samigullin
et al., 2002; Taylor, 1995; Wellman et al., 2003)? Clearly,
more data are needed to resolve these issues.
The mitochondrial genome in land plants is a rich
source of information to investigate plant phylogeny
(Beckert et al., 1999, 2001; Qiu et al., 1998, 1999; Vange-
row et al., 1999). Two sets of introns have been found in
angiosperms (Kubo et al.,2000; Notsu et al.,2002; Unseld
et al., 1997) and the liverwort Marchantia polymorpha
(Oda et al., 1992), respectively. Most of the angiosperm
* Corresponding author. Fax: 1-734-764-0544.
E-mail address: [email protected] (Y.-L. Qiu).
1055-7903/$ - see front matter 2004 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2003.12.013
Molecular Phylogenetics and Evolution 32 (2004) 246263
MOLECULAR
PHYLOGENETICS
AND
EVOLUTION
www.elsevier.com/locate/ympev
http://mail%20to:%[email protected]/http://mail%20to:%[email protected]/http://mail%20to:%[email protected]/ -
7/28/2019 1-s2.0-S1055790304000326-main
2/18
introns are now known to extend their presence to gym-
nosperms, pteridophytes, and even hornworts, mosses, or
liverworts (Beckert et al., 1999, 2001; Gugerli et al., 2001;
Hashimoto and Sato, 2001; Malek and Knoop, 1998;
Malek et al., 1997; Pruchner et al., 2001, 2002; Qiu et al.,
1998). Theintrondistributionpatternscan be used to infer
phylogenetic relationships among basal lineages of landplants, given that conservative genomic structural
changes have proven to be informative markers in re-
solving difficult phylogenetic issues (Manhart and Pal-
mer, 1990; Raubeson and Jansen, 1992).
The plant mitochondrial gene nad1 contains four
group II introns in angiosperms (Chapdelaine and Bo-
nen, 1991; Conklin et al., 1991; Kubo et al., 2000; Notsu
et al., 2002; Unseld et al., 1997; Wissinger et al., 1991),
but none in Marchantia (Oda et al., 1992) nor in several
green algae that have been sequenced for their mito-
chondrial genomes: Prototheca wickerhamii(Wolff et al.,
1994), Chlorogonium elongatum (Kroymann and Zet-
sche, 1998), Nephroselmis olivacea and Pedinomonas
minor (Turmel et al., 1999), Scenedesmus obliquus (Kuck
et al., 2000; Nedelcu et al., 2000), Mesostigma viride
(Turmel et al., 2002a), Chaetosphaeridium globosum
(Turmel et al., 2002b), Chara vulgaris (Turmel et al.,
2003), and Chlamydomonas reinhardtii [M.W. Gray,
unpublished data (GenBank Accession No. U03843);
one group I intron has been reported in Chlamydomonas
eugametos nad1 (Denovan-Wright et al., 1998)]. The first
three angiosperm introns have been shown to be present
in a few basal pteridophytes (Gugerli et al., 2001; Malek
and Knoop, 1998), and the last one is present
throughout land plants except liverworts (Qiu et al.,1998). An additional group II intron, located upstream
of the first angiosperm intron, has been found in the
moss Ceratodon purpureus (Malek and Knoop, 1998).
However, the information on the full intron content in
nad1 across land plants, especially in bryophytes, is still
lacking. It would be desirable to obtain this information
to trace origins of these introns, to test whether they
follow vertical inheritance or undergo horizontal trans-
fer, and to examine their frequency of secondary losses.
Understanding evolution of these introns will not only
ensure their proper use as phylogenetic markers, but
also will help us to gain insight into their role in shaping
evolution of the mitochondrial genome in land plants.
In this study, we carry out a broad survey of intron
distribution in nad1 in land plants by sequencing the
nearly entire length of the gene, with particularly dense
taxon sampling in liverworts, mosses, and hornworts.
We aim to uncover phylogenetically informative intron
distribution patterns to resolve relationships among
basal land plant lineages. We also seek to understand
the tempo and mode of intron evolution in mitochon-
drial genomes of early land plants, as a relatively large
body of data is now available from both mitochondrial
genome sequencing studies and evolutionary surveys.
2. Materials and methods
2.1. DNA extraction, gene amplification and sequencing,
intron secondary structure modeling
Materials for 46 representatives of all major non-
flowering land plant lineages, including 12 liverworts, 19mosses, four hornworts, two lycopods, eight monili-
formopses (sensu Kenrick and Crane, 1997b, including
Equisetum, Psilotaceae, and ferns), and one gymno-
sperm were collected in the field or greenhouses, care-
fully identified, and properly vouchered (Table 1). All
bryophytes were cleaned and checked under a dissecting
scope to avoid contamination. The voucher information
and GenBank accession numbers are given in Table 1.
The green algae (see Figs. 1 and 2) were used as out-
groups for comparing intron content and timing the
evolutionary origins of the introns in nad1. Total cellu-
lar DNAs were extracted using the cetyltrimethylam-
monium bromide (CTAB) method (Doyle and Doyle,
1987), with 2% polyvinyl pyrrolidone, 0.1% diet-
hyldithiocarbamic acid (sodium salt), and 0.1% ascorbic
acid added, or alternatively using the Plant DNAeasy
kit (Qiagen) according to the manufacturers protocol.
Multiple sets of primers were tested to circumvent any
potential problems caused by direct and reverse RNA-
editing at priming sites, and they are listed in Table 2.
Where possible, a single amplicon was recovered for the
gene. In some species, where the size of nad1 (including
both exons and introns) exceeded the capacity of con-
ventional PCR methods, the gene was amplified and se-
quenced in several overlapping fragments and the nad1gene contig was assembled subsequently. PCR amplifi-
cation reactions contained approximately 10 ng template
DNA, 10 mM Tris/HCl (pH 8.85), 25 mM KCl, 5 mM
(NH4)2SO4, 2 mM MgSO4, 200 lM each dNTP, 0.20 lg
each primer, and 2.0 U Taq DNA polymerase (Qiagen) in
a final volume of 50 ll. The reactions were carried out
using 30 cycles, each consisting of 30 s denaturation at
94 C, 30 s annealing at 52 C, and 14 min extension at
72 C. The first cycle was preceded by an initial denatur-
ation step (4min, 94 C), and the last one was followed by
a 12 min extension step at 72 C. Alternatively, for am-
plifying fragments larger than 3.5 kb, the Expand Long
Template PCR-System (BoehringerMannheim) was
used, following the protocol supplied by the manufac-
turer. PCR fragments, depending on their size, were
cloned with TA-TOPO or XL-TOPO cloning kits (Invit-
rogen). Positive clones were sequenced in both directions
using ABI Prism BigDye Terminator Cycle Sequencing
Ready Reaction Kits on an ABI377 sequencer (both from
Applied Biosystems). M13 universal primers and those
designed to match internal sequences of cloned fragments
(Table 2) were used during sequencing. Sequence
processing and contig assembly were done using the
Sequencher program (Gene Codes Corporation).
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 247
-
7/28/2019 1-s2.0-S1055790304000326-main
3/18
Table 1
Plant material used in this study, intron presence (+) or absence ()) in the mitochondrial gene nad1, and GenBank accession number of the sequence
Species Vouchera Accession No.
nad1, one
accession #
nad1i258 nad1i287 nad1i 348 nad1i394 nad1i
GymnospermsCycas revoluta Thunb. Qiu94051 + AY
Moniliformopses
Asplenium nidus L. Qiu94081 AY354954 + ) ) + )
Adiantum sp. Qiu95118 AY354953 + ) ) + )
Osmunda regalis L. Qiu96171 + AY
Ophioglossum lusitanicum L. Qiu98097 +AY354943 ) AY354943 ) AY354943 ) AY354943 + AY
AY35
Marattia attenuata Lab. Qiu96169 +AY354948 ) AY354948 ) AY354948 +AY354948 + AY
Angiopteris evecta (G.Forst.) Hoffm. Qiu96170 +AY354947 ) AY354947 ) AY354947 +AY354947 + AY
Equisetum arvense L. Qiu94003 AY354940 + ) ) + )
Psilotum nudum (L.) P.Beauv. Qiu94002
Lycopods
Isoetes sp. Qiu96272 AY354939 ) ) ) + )
Huperzia lucidula (Michx.) Trevis. Qiu94173 AY354938 ) ) ) + +
Hornworts
Notothylas breutelii (Gottsche) Gottsche Qiu97078 AY354981 ) + + ) )
Phaeoceros carolinianus (Michx.) Prosk. Qiu97002 AY354980 ) + + ) )
Megaceros tosanus Steph. Qiu97001 AY354979 + ) )
Anthoceros agrestis Paton Qiu99112 AY354978 ) + + ) )
Mosses
Hypnum cupressiforme Hedw. Qiu99079 AY354976 ) + ) ) )
Brachythecium rutabulum (Hedw.) BSG. Qiu94071 AY354975 ) + ) ) )
Thuidium recognitum (Hedw.) Lindb. Qiu94174 AY354974 ) + ) ) )
Anomodon viticulosus (Hedw.) Hook. & Tayl. Qiu99066 AY354973 ) + ) ) )
Hedwigia ciliata (He dw.) P.Beauv. Qiu99056 AY354972)
+) ) )Rhizogonium paramattense (Mull. Hal.) Qiu98069 AY354971 ) + ) ) )
Reichardt
Bartramia halleriana Hedw. Qiu99062 AY354970 ) + ) ) )
Leucobryum albidum (Brid.) Lindb. Qiu94075 AY354969 ) + ) ) )
Dicranum scoparium Hedw. Qiu94073 AY354968 ) + ) ) )
Mnium sp. Qiu94097 AY354935 ) + ) ) )
Gymnostomum rucurvirostrum Hedw. Qiu94072 AY354936 ) + ) ) )
Fissidens dubius P.Beauv. Qiu99069 AY354967 ) + ) ) )
Tetraphis pellucida Hedw. Qiu00001 AY354956 ) + ) ) )
Polytrichum juniperum Hedw. Qiu94176 AY354966 ) + ) ) )
-
7/28/2019 1-s2.0-S1055790304000326-main
4/18
Sequence alignment was performed using ClustalX
program (Thompson et al., 1997). Secondary structure
models of group II introns were inferred according to
the consensus model of Michel et al. (1989) on Foldalign
server (Mathews et al., 1999; Zuker et al., 1999). Manual
adjustments were made after computer-assisted folding
analysis.
2.2. Group II intron nomenclature
Because there is a great deal of confusion on intron
names in literature due to lack of a standard nomen-
clature, we develop a system here for group II introns
that is similar to what has been proposed for group I
introns in ribosomal DNA (Johansen and Haugen,
2001), which has been adopted for archael introns
(Nakayama et al., 2003). The intron name in our system
will be composed of: (1) gene name, (2) the letter i for
intron, and (3) insertion site in the orthologous gene of
M. polymorpha, and it will always be italicized. For
example, nad1i728 refers to an intron located in the gene
nad1 of a given species at the M. polymorpha nucleotide
position 728 (an alignment of the exon sequence of the
species and that of M. polymorpha will be necessary to
identify the intron insertion site).
Compared to the group I intron nomenclature, our
system has omitted use of the species name acronym and
the genome (chloroplast, mitochondrial, or nuclear)
designation letter as part of the formal intron name. In-
stead, we recommend that all that information as well as
other information such as trans-splicing (Malek and
Knoop, 1998), presence of ORF (Zimmerly et al., 2001),status within a twintron (Hallick et al., 1993), and intron
phase (Sharp, 1981) be amended to the formal intron
name in particular studies when the need of incorporating
such information arises. Thus, this system has advantages
of being flexible and convenient in communication.
Marchantia polymorpha is chosen as a reference spe-
cies because its mitochondrial and chloroplast genomes
have been sequenced (Oda et al., 1992; Ohyama et al.,
1986) and they contain most of the genes that have been
found so far in organellar genomes of land plants and
other photosynthetic eukaryotes. In cases where
M. polymorpha lacks an ortholog, or orthologous part
due to deletion, of the gene in which an intron has been
found in one or several species, the exon sequence of the
species in which the intron was first discovered will be
used as the reference. The insertion site in this species
will be used with a superscript asterisk followed by
the species name in a parenthesis. For example,
ycf66i106(Chaetosphaeridium globosum) refers to an
intron present at position 106 in the chloroplast gene
ycf66(which is absent in M. polymorpha) and it was first
discovered in C. globosum, which has been used as the
reference species. For introns located in the 50 and 30 un-
translated regions, a ) and + sign will be usedAtrichumangustatum(Brid.)BSG.
Qiu94074
AY354934
)
+
)
)
)
)
+
Diphysciumfoliosum(Hedw.)Mohr
Qiu99083
AY354933
)
+
)
)
)
)
+
SphagnumrecurvumP.Beauv.
Qiu94175
AY354932
)
+
)
)
)
)
+
Takakiaceratophylla(Mitt.)Grolle
Qiu97125
AY354937
)
+
)
)
)
)
+
TakakialepidozioidesHatt.&Inoue
Qiu97126
AY354977
)
+
)
)
)
)
+
Liverworts
Frullaniadilatata(L.)Dumort.
Qiu99058
AY354962
)
)
)
)
)
)
)
Radulacomplanata(L.)Dum.
Qiu99075
AY354961
)
)
)
)
)
)
)
Plagiochilaasplenioides(L.)Dum.
Qiu99064
AY354960
)
)
)
)
)
)
)
Lophocoleaheterophylla(Schrad.)Dum
.
Qiu98007
AY354959
)
)
)
)
)
)
)
Marsupellaemarginata(Ehrh.)Dumor
t.
Qiu99077
AY354958
)
)
)
)
)
)
)
Pelliasp.
Qiu95001
AY354964
)
)
)
)
)
)
)
MetzgeriatemperataKuwahara
Qiu98008
AY354931
)
)
)
)
)
)
)
MetzgeriaconjugataLindb.
Qiu99080
AY354965
)
)
)
)
)
)
)
Conocephalumsp.
Qiu94096
AY354957
)
)
)
)
)
)
)
Ricciocarposnatans(L.)Corda
Qiu97153
AY354929
)
)
)
)
)
)
)
Blasiapusilla(Micheli)L.
Qiu99108
AY354963
)
)
)
)
)
)
)
Haplomitriummnioides(Lindb.)Schust.
Qiu97127
AY354930
)
)
)
)
)
)
)
a
ThevoucherswithnumbersbetweenQiu94001and97999aredepositedatIndianaUniversityHerbarium(IND,Bloomington
,IN,USA),andthosewithnumbersbetwee
nQiu98001and00999
atUniversityofZurichHerbarium(Z,Zurich,Switzerland).
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 249
-
7/28/2019 1-s2.0-S1055790304000326-main
5/18
Fig. 1. The exon phylogeny of the mitochondrial nad1 from 64 species of land plants and green algae (Nephroselmis olivacea (AF110138) was used as
the outgroup). Shown here is a maximum likelihood tree ()Ln likelihood 14993.51076). The branch length difference is contributed by both the
divergence level and length of the sequences analyzed. Asterisks mark the nodes collapsed in the strict consensus tree of 25,941 most parsimonious
trees (length: 3106 steps, CI (consistency index): 0.4858, and RI (retention index): 0.6863). The only difference between the likelihood and parsi-
monious trees concerns placement ofOphioglossum, Psilotum, and Osmunda. Bootstrap values higher than 50% are shown above the branches. The
taxa with sequences from the GenBank are underlined:Prototheca (NC_001613), Mesostigma (AF353999), Pedinomonas (NC_000892), Scenedesmus
(AF204057), Chlorogonium (Y13644), Chlamydomonas (U03843), Chaetosphaeridium (NC_004118), Marchantia (NC_001660), Ginkgo (AF227466,
AF227470), Gnetum (AF227467, AF227471), Pinus (AF160261), Arabidopsis (Y08501, Y08502), Petunia (X60400-X60403), Oenothera (AH003143),
Beta (NC_002511), Oryza (AB076665), and Triticum (X57965-X57968).
250 O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263
-
7/28/2019 1-s2.0-S1055790304000326-main
6/18
Fig. 2. Intron distribution in the mitochondrial nad1 of land plants and green algae. The species are arranged into phylogenetic groups. The coding
sequences (gray boxes) are drawn to an approximate scale, with all intron positions marked. Rectangular boxes denote complete coding sequences;
triangle-edged boxes indicate partial coding sequences.Trans-spliced introns are represented by shifted exon boxes. Species with data from literature
are underlined. The numbers in parentheses after intron names indicate intron phases. *For nad1i728, (1) all mosses except Takakia (both species)
and Sphagnum have lost the matR, (2) splicing status in Psilotum and Ophioglossum is unknown due to the partial sequences obtained, (3) presence of
the cis-spliced intron in the four gymnosperms (except in Pinus where splicing status is unknown) has been demonstrated by Southern hybridizations
(Qiu and Palmer, in press) and matR sequencing (Qiu et al., 1999), and (4) trans-splicing in Beta, Petunia, Triticum, and Oryza evolved independently
(Qiu and Palmer, in press).
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 251
-
7/28/2019 1-s2.0-S1055790304000326-main
7/18
before the insertion site, respectively. Clearly, future
discoveries will present situations for which amendment
to this nomenclature will be necessary.
2.3. Phylogenetic analyses
Because bryophytes often grow as a mixture of several
species, the chance of cross-contamination could still exist
even though we made an effort to check tissue purity
under a dissecting scope. To confirm that the sequences
obtained wereindeedfrom the specieswe targeted andnot
from biological contaminants, we performed phyloge-
netic analyses on the exon sequences ofnad1, using both
the parsimony and maximum likelihood methods as im-
plemented in PAUP* 4.0b10 (Swofford, 2003). In the
parsimony analysis, we weighted all characters and mu-
tations equally. For the maximum likelihood analysis, we
used the HYK85 model with the following settings: two
Table 2
Primers used for mitochondrial nad1 gene amplification and sequencing
Forward primers Reverse primers
Location Sequence Location Sequence
Mp nad1-1 50-ATGAGAATTTATCTAATTGG-30
Ol nad1i258-1327 50-TAGGCCACTCTGAATTCC-30
Mp nad1-82 CTAGCWGAACGWAAAGTCATGGC Ol nad1i258-2118 CTTTCAGTCGAGTGTCTGGAA
Mp nad1-153 GTTACAACCTTTDGCWGAYGG Mp nad1-292 GACAATACCATACCATAATCMp nad1-191 AAGARCCTATTTTAYYRAGTAGTGCT Hl nad1i394-1007 GTCGGTTATTCCATCTCC
Ol nad1i258-763 CARGTGCGCAAGGACCTKWMAC Hl nad1i394-1476 AGCRARGTGCAGARAACRCG
Ol nad1i258-1213 TTCGGAGAGGTCCTATCG Hl nad1i394-1486 CGATAGAGGAAAGCGAGGTGC
Mp nad1-264 TTTGGTTGCTTGGGCGGTTATC Mp nad1-395 TCCTGAAAAAGCATATTTGGRAT
Aa nad1i287-334 ACTATGCGGACATCTTAC Mp nad1-407 ATCGTAATGCTCCYARAAADG
Mp nad1-292 GATTATGGTATGGTATTGTC At-nad1i477-12 ACCTTCGCGGATCCAAACGCGCTC
Hl nad1i394-369 TGTAYGCTGTCTTGCTTCCT At-nad1i477-21 TGCTGCGGTTCCCTTCGGTCCGTTA
Hl nad1i394-705 CTCRAATCYCACGAATCC At nad1i477-479 CTTCCAACGTCAACCTGCG
Hl nad1i394-1060 MGRTGGAAACAAGCAGCG At nad1i477-720 GTRTTGAGTAGGCAGCGCC
Hl nad1i394-1341 CTGGGTACTGAGCCCTTTGC Mp nad1-623
GCGACTRATTCMGCTTCTGCTTCTGGTA Hl nad1i394-1350 GGAACCWTTGTAMCYTAGAKAC
Mp nad1-625 TTCTGCYTCDGCYTCTGG Mp nad1-404 ATGCTTTTYTRGGAGCATTACGAT
Hl nad1i669-1185 ATCTAGGTATATGTTGGTAA Mp nad1-408 TTTTTYRGGAGSWTTACGDTCTG
Hl nad1i669-2391 GTGTGAAGGCAGGACCMS At nad1i477-379 CCTGATCTGGATAACGATAG
Hl nad1i669-2628 CAGCCGCAATAACAGCAC At nad1i477-481 CMAATGGACTCTACRAGGACCMp nad1-671 AGAGCAAAYCCCATDGAVG At nad1i477-586 GGGCTGTAGGTGATAAYGC
Mp nad1-703 CTCATTAAGATCATATTAGCATACTC Mp nad1-623
TACCAGAAGCAGAAGCKGAATYAGTCGC At nad1i728-168 CTTAGATARGTCGTCCGATGGGT
Mp nad1-636 AGCTGAATTMGTHGCDGG At nad1i728-126 GARGGGTAGCCTGGTGTGTARGC
Hl nad1i669-538 RAGTATRATGACCTGGTCG At nad1i728-450 TCTCCCAGRACCARAATGATTATC
Hl nad1i669-984 CACRATCMATATACACACC0 At nad1i728-1712 GGTTTAGACTKGATTYGCTCATA
Hl nad1i669-1435 TACGCCGTTACAATACGCAGA At nad1i728-2070 TCTTTACTAAGTGTCCCTGGCGGT
Hl nad1i669-1818 GGAGCTGGTCTCAGATGATG At nad1i728-2087
GCTATGCRAGATYTCTCTTGATCTTTGC Hl nad1i669-2290 CATTMTTGMTTGGCGAAG
At nad1i728-2229 TCGTCTGCGTCCTCTTCGTTC Mp nad1-670 TCYTCWATGGGRTTTGCTYTKTT
At nad1i728-2490 GTRAATATAGCRGACCAGCGRAT Mp nad1-709 GCYAATATGATCTTAATGAG
At nad1i728-2517 GARGATTTGTGCTTGTKGGC Mp nad1-714 TATGATCTTAATGAGGTGCGGAG
Mp nad1-762 TAGGAATATCTAGGATGGGCAGC Mp nad1-725
TGAGGTGCGGAGCYTTGCATCYGACATT Mp nad1-789 CGAGCCCGGAATCACCTGG
At nad1i728-432 GTAAACTCATTRRACAGG Mp nad1-832 CCCATATATATACMAACAAAAGGGAAt nad1i728-745 CGGTACYCGAATCYATTTACGA Mp nad1-858 MGATATCGWGGAAATGCTGCRC
At nad1i728-766 AKCCCGAGTTTCYAGACACAT Mp nad1-966 TTAAGRAAGCCATTCAAAGGCT
At nad1i728-1028 CAGTGTACTACTATCACCCCTAC
At nad1i728-1249 GCYTACACACCAGGCTACCCYTC
At nad1i728-1852 TAGAGAAGCGTCGGAGAGTA
At nad1i728-1852 TRGARAAGCGTCGGAGAGTAAAGCACC
At nad1i728-1859 GCGTCGGAGAGTAAAGCACCGTATC
At nad1i728-1870 TAAAGCACCGTATCCATCTCACAG
At nad1i728-2890 RGCCTCATAGTGCCTCCTGT
At nad1i728-3128 CAAAAGACTGCTAGTGGCGTCC
* Numbers correspond to the 50 and 30 positions of the forward and reverse primers in Marchantia polymorpha (Mp) mitochondrial nad1 gene
(NC_001660, Oda et al., 1992), Arabidopsis thaliana (At) introns nad1i477** and nad1i728 (NC_001284, Unseld et al., 1997), and Anthoceros agrestis
(Aa) nad1i287, Huperzia lucidula (Hl) nad1i394 and nad1i669, and Ophioglossum lucitanicum (Ol) nad1i258 (all from this study). Amplification
primers are underlined. Two 50-end nucleotides (TT) from Arabidopsis thaliana nad1i477 (NC_001284) actually belong to the upstream exon. Here we follow the
corrected exonintron boundary, starting nucleotide counting in the intron from GTGCG. . .
252 O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263
-
7/28/2019 1-s2.0-S1055790304000326-main
8/18
substitution types (HYK85 variant), a transition/trans-
version ratio of 2 (j 4.2901951), empirical base fre-
quencies (A 0:23129; C 0:17128; G 0:21140; T
0:38603), no invariable sites, equal rates for all sites,
number of distinct data patterns under this model 932,
molecular clock not enforced, starting branch lengths
obtained using RogersSwofford approximation method,branch-length optimizationone-dimensional Newton
Raphson with pass limit 20, delta 1e ) 06, and )ln L
(unconstrained)unavailable due to missing data and/or
ambiguities. A heuristic search was conducted to find the
trees of the shortest length or the highest likelihood using
simple (for the parsimony analysis) or as is (for the
maximum likelihood analysis) taxon-addition replicates,
one tree held at each step during stepwise addition, TBR
branch swapping, steepest descent option in effect, Mul-
Trees option in effect and no upper limit of MaxTrees.
A bootstrap analysis was conducted using the parsimony
method to test robustness of the topology, using 100 re-
sampling replicates and the same tree search procedure as
described above except with SPR branch swapping.
We also carried out phylogenetic analyses on intron
sequences, to evaluate how intron phylogenies reflect the
plant phylogeny and to determine whether an intron
originated via a single acquisition event followed by
vertical inheritance or through multiple independent
gains caused by horizontal transfers. Because the par-
simony and maximum likelihood analyses produced
virtually identical results on the exon data (see Fig. 1
legend), we conducted only parsimony analyses for the
intron sequences. For two introns (nad1i287 and
nad1i728) with data from a relatively large number ofspecies, the same heuristic tree search method and
bootstrap analysis procedure as the exon sequence
analyses were used, except with the TBR branch swap-
ping option. For other five introns that had data from
only a small number of species, we were able to use the
branch-and-bound or exhaustive tree search methods to
find the most parsimonious tree(s). The bootstrap
analysis procedure was the same as in the exon analysis.
3. Results
Among the 46 species of diverse land plants we exam-
ined (Table 1), amplification of almost entire nad1 coding
region encompassing all known intron positions was
possible for a majority of the species. However, only
partial coding regions of varyinglengths covering some of
the intron positions were obtained from Isoetes, Psilotum
Sw., Angiopteris Hoffm., Marattia Sw., Ophioglossum,
Osmunda, and Cycas L.. Our analyses of the exon se-
quences produced a phylogeny (Fig. 1) that is in general
agreement with the relationships of these plants as re-
ported in published studies (Hedderson et al., 1998; Lewis
et al., 1997; Newton et al., 2000; Pryer et al., 2001) and in
our own unpublished analysis of six genes from over 180
land plants. However, there were several anomalies in the
exon phylogeny, e.g., Haplomitrium falling into the clade
of leafy and simple thalloid liverworts, paraphyly of
mosses, and Takakia being sister to hornworts. Several
factors may have contributed to these results: short se-
quences used for such a broad range of taxa, uneven RNAediting patterns (see below), and insufficient taxon sam-
pling. Nonetheless, we think that theexon phylogeny does
suggest that nad1 is a useful phylogenetic marker and that
all of the sequences obtained are indeed from the species
we targeted, i.e., not from biological contaminants.
A total of seven introns were found, and all of them
belong to group II (Table 1, Fig. 2). Five of them have
been reported before (Chapdelaine and Bonen, 1991;
Conklin et al., 1991; Kubo et al., 2000; Malek and
Knoop, 1998; Notsu et al., 2002; Wissinger et al., 1991),
and two are newly discovered in this study. They all
have characteristic group II intron primary and sec-
ondary structural features: the consensus sequence of
GBGYG at the 50-end (the second nucleotide consensus
needs to be expanded; the consensus sequence of AY at
the 30-end is not being followed by many group II in-
trons, including three of the seven introns reported here:
nad1i348, nad1i669, and nad1i728); six double helical
domains radiating from a central wheel; the bulging A
residue at the 7th8th position from the 30-end in do-
main VI, which is required for lariat formation and in-
tron excision; and the conserved domain V with a
GNRA terminal tetraloop (for six out of seven introns)
(Lambowitz and Belfort, 1993; Qin and Pyle, 1998).
For 12 liverworts, we obtained the full length codingregion ofnad1 using primers that covered start and stop
codons (Metzgeria conjugata and M. temperata missed
two codons at the 30-end), and found no introns at all
(Table 1, Fig. 2). This is the same condition as reported in
Marchantia (Oda et al., 1992). In other land plants, the
introns showed lineage-specific distribution patterns as
described below.
3.1. nad1i258
This is a novel intron we discovered in the present
study; its secondary structure is shown in Fig. 3A. It is
present in all the moniliformopses for which we could get
a sequence of this region of the gene: Equisetum, Ophio-
glossum, Angiopteris, Marattia, Adiantum, and Asple-
nium, but is absent from green algae, bryophytes and
other vascular plants (Table 1, Fig. 2). Its typical length is
approximately 900 bp, with an exception in Ophioglos-
sum, where the intron contains a remnant ORF, resulting
in a length of 2598 bp. Our phylogenetic analyses show
that the evolutionary historyof the intron parallels that of
the plants (Fig. 4A; Pryer et al., 2001), suggesting that the
intron was acquired in the common ancestor of monili-
formopses and has been inherited vertically.
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 253
-
7/28/2019 1-s2.0-S1055790304000326-main
9/18
Fig. 3. Inferred secondary structure of two newly discovered group II introns in the mitochondrialnad1. (A) nad1i258 from Marattia attenuata and
(B) nad1i348 from Phaeoceros carolinianus.
254 O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263
-
7/28/2019 1-s2.0-S1055790304000326-main
10/18
3.2. nad1i287
This intron, being orthologous to the one discovered
in Ceratodon purpureus by Malek and Knoop (1998),
was found in all 19 mosses and three hornworts we in-
vestigated (no PCR product was obtained from
Megaceros D.H. Campbell), and has an average length
of 900 bp. It is absent in green algae and other lineages
of land plants (Table 1, Fig. 2). The intron phylogeny
(Fig. 4B) is in agreement with that of the plants (Newton
et al., 2000), indicating vertical transmission of the
intron in the mosses and hornworts.
Fig. 4. Phylogenies of the seven introns found in the mitochondrial nad1 of land plants. The numbers above the branches are bootstrap values.
The taxa with sequences from the GenBank are underlined: Ceratodon (Y17810), Isoetes lac. (Y17812), Pinus (AF160261), Osmunda 1 (Y17815),
Equisetum tel. (Y17811), and Notothylas (AF068932). (A) nad1i258, the single shortest tree found in an exhaustive tree search (length: 1033 steps,
CI: 0.9555, and RI: 0.8357). (B) nad1i287, the strict consensus tree of 10 shortest trees found in a heuristic search (length: 694 steps, CI: 0.7277, and
RI: 0.7970). (C) nad1i348, the single shortest tree found in an exhaustive tree search (length: 73 steps, CI: 0.9863, and RI: 0.8000). (D) nad1i394, thesingle shortest tree found in an exhaustive tree search (length: 1057 steps, CI: 0.9574, and RI: 0.9240). (E) nad1i477, the single shortest tree found
in an exhaustive tree search (length: 2223 steps, CI: 0.9353, and RI: 0.6949). (F) nad1i669, the single shortest tree found in an exhaustive tree search
(length: 1708 steps, CI: 0.9895, and RI: 0.9669). (G) nad1i728, the strict consensus tree of 12 shortest trees found in a heuristic search (length: 7556
steps, CI: 0.6546, and RI: 0.5223).
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 255
-
7/28/2019 1-s2.0-S1055790304000326-main
11/18
3.3. nad1i348
This is another new intron we discovered, and its
secondary structure is shown in Fig. 3B. It is present
in all four hornworts we examined: Anthoceros [Mic-
heli] L., Megaceros, Phaeoceros Proskauer and Not-
othylas Sull., but absent in green algae and all otherland plants (Table 1, Fig. 2). The intron has a typical
length of 600 bp. Our phylogenetic analyses indicate
that it has been transmitted vertically following its
acquisition in the common ancestor of hornworts
(Fig. 4C).
3.4. nad1i394
This intron is orthologous to the cis-spliced nad1Ti1
in Isoetes lacustris reported by Malek and Knoop
(1998) and the trans-spliced first intron of nad1 in
angiosperms (Chapdelaine and Bonen, 1991; Conklin
et al., 1991; Wissinger et al., 1991). According to our
survey, it is also present, in a cis-spliced form as in
Isoetes lacustris, in Huperzia Bernh., Isoetes sp., Eq-
uisetum arvense, Angiopteris, Marattia, Adiantum, and
Asplenium, but absent entirely in bryophytes and green
algae (Table 1, Fig. 2). Among the species investi-
gated, the intron size ranges from 1400 to 2000 bp in
most species, but in Isoetes it drops dramatically to
520 bp. This sharp decrease of intron size in Isoetes
has been observed earlier by Malek and Knoop (1998)
for this intron as well as for two other introns in nad2
and nad5. It appears now that the decrease of intron
size is restricted to only Isoetes; the other lycopod weexamined, Huperzia, has a normal-sized intron. The
absence of this intron in Ophioglossum (Fig. 2) and
Equisetum telmateia (Malek and Knoop, 1998) can be
explained by secondary losses. The intron phylogeny
(Fig. 4D) essentially agrees with the plant phylogeny
(Pryer et al., 2001), with the exception of Equisetum
embedded in Marattiaceae. This topological anomaly
may be caused by insufficient taxon sampling, rather
than serving as evidence of intron horizontal transfer.
Distribution of the intron in land plants (Fig. 2) is
mostly consistent with the hypothesis of a single origin
of the intron in the beginning of vascular plant evo-
lution followed by independent losses. Our failure to
amplify the portion of the gene covering the intron
insertion site in Psilotum, Osmunda, and Cycas, if not
due to technical reasons, could be an indication that
this intron is present in a trans-spliced state in these
plants, as multiple independent evolutions of trans-
splicing have been detected in another nad1 intron,
nad1i728 (Conklin et al., 1991; Kubo et al., 2000;
Notsu et al., 2002; Qiu and Palmer, in press; Wis-
singer et al., 1991). Further investigation in these
plants would be desirable to find out the exact status
of the intron.
3.5. nad1i477
This intron is orthologous to the second intron in
nad1 of angiosperms (Chapdelaine and Bonen, 1991;
Conklin et al., 1991; Wissinger et al., 1991). It has been
reported to be present in Huperzia lucidula and a large
number of seed plants by Gugerli et al. (2001) and Wonand Renner (2003) using either sequencing or Southern
hybridization. In this survey, we found that this intron is
present in Huperzia lucidula (the same DNA was used
for both Gugerli et al., 2001, and this study), Angiop-
teris, Marattia, Ophioglossum, Osmunda, and Cycas, but
absent in green algae, bryophytes, and four vascular
plants that were sequenced through the intron insertion
site, Isoetes, Equisetum, Adiantum, and Asplenium (Table
1, Fig. 2). Clearly, absence of the intron in the four
vascular plants represents secondary losses, as has been
observed earlier in some seed plants (Gugerli et al.,
2001). The size of this intron shows a full range of
variation from 896 bp in Arabidopsis to 2844 bp in
Ophioglossum, unlike nad1i394 which has a bimodal size
distribution. The intron phylogeny (Fig. 4E) agrees well
with the plant phylogeny. Judging from the data shown
here and in Gugerli et al. (2001), the intron was most
likely acquired in the common ancestor of vascular
plants and has been vertically inherited ever since, with
secondary losses in a small number of plant lineages.
3.6. nad1i669
This is another trans-spliced intron in angiosperms
(Chapdelaine and Bonen, 1991; Conklin et al., 1991;Wissinger et al., 1991), and its cis-spliced ortholog has
been isolated from Equisetum telmateia and Osmunda
regalis (Malek and Knoop, 1998). In this study, we ob-
tained sequences ofcis-spliced introns from Huperzia and
Psilotum as well as from a different species of Equisetum
(E. arvense) and a different accession ofOsmunda regalis
than those used by Malek and Knoop (1998) (Table 1,
Fig. 2). The size of the intron varies from 1561 bp in E.
arvense to 3090 bp in Huperzia, with size in Psilotum and
Osmunda being intermediate. The intron phylogeny
(Fig. 4F) shows no sign of horizontal transfer. Besides its
entire absence in green algae and bryophytes, the intron is
also absent in Isoetes, Adiantum, and Asplenium, which
can be attributed to secondary losses (Fig. 2). Its distri-
bution pattern is consistent with the idea that the intron
was gained in the ancestor of vascular plants. Failure of
obtaining PCR product in Angiopteris, Marattia, Ophio-
glossum,and Cycas again could indicate presence oftrans-
spliced introns in these plants.
3.7. nad1i728
This intron is orthologous to the nad1.i4 that has
previously been isolated from Sphagnum L. and
256 O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263
-
7/28/2019 1-s2.0-S1055790304000326-main
12/18
Notothylas (Qiu et al., 1998) as well as several angio-
sperms (Chapdelaine and Bonen, 1991; Conklin et al.,
1991; Kubo et al., 2000; Notsu et al., 2002; Thomson
et al., 1994; Unseld et al., 1997; Wahleithner et al., 1990;
Wissinger et al., 1991). It has also been shown to be
present in a large number of land plants except liver-
worts according to the Southern hybridizations (Qiuet al., 1998; Qiu and Palmer, in press) and matR (an
ORF encoded within the intron) sequencing (Anderberg
et al., 2002; Qiu et al., 1999). Here, we report sequences
of this intron from 19 mosses, 3 hornworts (the Not-
othylas intron sequence was taken from Qiu et al. (1998)
and hence was not included in this count), and 9 pteri-
dophytes (Table 1, Fig. 2). The intron in hornworts and
pteridophytes shows a range of size variation from
2221 bp in Osmunda to 4037 bp in Marattia. However, in
mosses, while two Takakia species still have a full-sized
intron (slightly over 2800 bp), Sphagnum and other
mosses have lost most or all of their matR (with the
intron size being 1452bp in Sphagnum and around
850 bp in all other mosses). The portion of matR still
present in Sphagnum is the X domain, which is impli-
cated in intron splicing and is usually retained in any
group II intron that contains an ORF (Mohr et al.,
1993). The phylogeny of the intron (Fig. 4G) mirrors
that of the plants rather well, indicating that the intron
has been inherited vertically since its acquisition in the
common ancestor of non-liverwort land plants as sug-
gested by Qiu et al. (1998). For both Psilotum and
Ophioglossum, we obtained only partial sequences of the
intron using primers in the adjacent exons and in 5 0- or
30
-end of the intron, and thus cannot confirm splicingstatus of the intron. Isoetes was reported to lack the
intron in a Southern hybridization survey (Qiu et al.,
1998), and our attempt to use PCR to check for the
presence of the intron failed this time.
4. Discussion
4.1. Phylogenetic implications of intron distribution in
nad1 of land plants
A total of seven introns, all belonging to group II,
have been discovered in the mitochondrial gene nad1
through surveys of a large number of land plants by this
study and many others (Chapdelaine and Bonen, 1991;
Conklin et al., 1991; Gugerli et al., 2001; Kubo et al.,
2000; Malek and Knoop, 1998; Notsu et al., 2002; Qiu
et al., 1998; Qiu and Palmer, in press; Thomson et al.,
1994; Unseld et al., 1997; Wahleithner et al., 1990;
Wissinger et al., 1991). Yet, no intron has been found in
the 12 liverworts sequenced in this study nor in
Marchantia by Oda et al. (1992), which span most of the
liverwort diversity: Calobryales, Marchantiales, Metz-
geriales, and Jungermanniales (Schuster, 1966, 2000).
This complete absence of introns in liverworts is the
same condition as in the green algal outgroups (Kroy-
mann and Zetsche, 1998; K uck et al., 2000; Nedelcu
et al., 2000; Turmel et al., 1999, 2002a,b, 2003; Wolff
et al., 1994; M.W. Gray, unpublished data). The sole
group I intron in nad1 of Chlamydomonas eugametos
(Denovan-Wright et al., 1998), but not in C. reinhardtii(M.W. Gray, unpublished data (GenBank Accession
No. U03843)), is irrelevant to the discussion here, as its
distribution clearly suggests that it was gained via hor-
izontal transfer.
Earlier, Qiu et al. (1998) used the hypothesized gains
of nad1i728 (nad1.i4 in their nomenclature) and two
other introns in the mitochondrial gene cox2, cox2i373
and cox2i691, to argue for the basal-most position of
liverworts among land plants. Nickrent et al. (2000)
suggested that absence of these introns in the liverworts
could be caused by secondary losses, as seen in some
plants reported in Qiu et al. (1998). Further, Nishiyama
and Kato (1999), Nickrent et al. (2000), and Renzaglia
et al. (2000) conducted phylogenetic analyses of multi-
gene data sets (with limited taxon sampling) and sper-
matogenesis characters and concluded that hornworts
occupy the basal-most position in land plants. In light of
the data presented here, we believe that the most par-
simonious explanation for intron distribution in nad1 is
still that liverworts, not hornworts, represent the oldest
land plants, and that both nad1i287 and nad1i728 were
gained in the common ancestor of mosseshornworts
vascular plants after liverworts had diverged. While the
former was lost in the ancestor of vascular plants, the
latter had been retained. The idea of a single gain ofnad1i287 in a common ancestor of mosses and horn-
worts can only be entertained if the two groups form a
clade, but both published studies (Kenrick and Crane,
1997b; Mishler et al., 1994; Nickrent et al., 2000; Ni-
shiyama and Kato, 1999; Renzaglia et al., 2000; see also
Qiu and Lee, 2000) and our unpublished multigene
analysis of land plant phylogeny have failed to recover
this topology. If we follow the hornwort basal hypoth-
esis, both introns would have to be gained in the com-
mon ancestor of land plants and lost in liverworts, with
an additional loss ofnad1i287in vascular plants since no
study so far has suggested a sister relationship of liver-
worts and vascular plants (Qiu and Lee, 2000). This
scenario is significantly less parsimonious than the ex-
planation offered by the liverwort basal hypothesis. The
hornwort basal hypothesis is also contradicted by the
distribution of two other mitochondrial group II in-
trons, one in nad2 (nad2i1282, Pruchner et al., 2002) and
the other in nad5 (nad5i477, Malek and Knoop, 1998),
both of which are present in vascular plants and horn-
worts but not in liverworts and mosses. Meanwhile, two
introns in nad7, nad7i40, and nad7i209, have now been
found in mosses, hornworts, and vascular plants but not
in liverworts, thus adding more evidence to the liverwort
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 257
-
7/28/2019 1-s2.0-S1055790304000326-main
13/18
basal hypothesis (Hashimoto and Sato, 2001; Pruchner
et al., 2001; N. Sato, personal communication). There-
fore, the overall intron distribution in the mitochondrial
genes (cox2, nad1, nad2, nad5, and nad7) is more con-
sistent with the liverwort basal hypothesis than with the
hornwort basal hypothesis.
The liverwort basal hypothesis received an indirectsupport from recently completed studies of chloroplast
genome sequencing of Physcomitrella patens (a moss,
Sugiura et al., 2003), Anthoceros formosae (Kugita et al.,
2003a), Psilotum nudum (Wakasugi et al., unpublished
data, GenBank Accession No. AP004638), and Adian-
tum capillus-veneris (Wolf et al., 2003). In Marchantia
(Ohyama et al., 1986), Physcomitrella, and Chaetosph-
aeridium (Turmel et al., 2002b), the inverted repeat in
the chloroplast genome does not include the genes ndhB,
rps7, and rps12 (partial). However, Anthoceros cpDNA
has these three genes as part of its inverted repeat, a
condition otherwise only seen in Psilotum, Adiantum,
and other vascular plants such as rice (Hiratsuka et al.,
1989) and tobacco (Wakasugi et al., 1998). This ex-
pansion of the inverted repeat to encompass these three
genes can almost certainly be regarded as a synapo-
morphy to unite hornworts and vascular plants, a rela-
tionship alluded to by the aforementioned phylogenetic
distribution of nad2i1282 and nad5i477 as well as some
sequence analyses (Lewis et al., 1997; Samigullin et al.,
2002; see also Qiu and Lee, 2000) (admittedly, taxon
sampling, in particular of vascular plants, in these se-
quence analyses is rather thin). Lastly, the most recent
report of fossil evidence from the Ordovician rocks of
Oman on sporangium structure that contain sporetetrads characteristic of early land plants also support
the liverwort basal hypothesis (Wellman et al., 2003).
A recent study found that certain genomic structural
changes, such as ribosomal protein gene loss and
transfer from the mitochondrial to nuclear genomes,
occur at rather high frequencies (Adams et al., 2002).
Another study also showed that a group II intron had
likely experienced horizontal transfer from angiosperms
to Gnetum (Won and Renner, 2003). Moreover, deep
losses of introns have clearly happened, as can be seen
from this study and others that investigated mitochon-
drial introns in basal land plants (Beckert et al., 1999,
2001; Pruchner et al., 2002). These studies raise the issue
of utility of genomic structural characters in inferring
plant phylogenetic relationships. However, our phylo-
genetic analyses of intron sequences showed little sign of
independent gains and horizontal transfer of the group
II introns investigated here (Fig. 4). Hence, we contend
that while one certainly cannot use genomic structural
characters, nor any other kind of characters, blindly for
phylogenetic inference, it is appropriate to use intron
distribution patterns, particularly intron gains, if they
are demonstrated to occur at very low frequencies, to
evaluate competing phylogenetic hypotheses. Intron
distribution patterns as well as other genomic structural
characters such as gene order and content in the cpDNA
inverted repeat will add a new source of information for
plant phylogenetic reconstruction.
Another issue that these intron distribution data may
help to resolve is the phylogenetic position of the enig-
matic bryophyte genus Takakia. Though first thought tobe related to liverworts (Hattori and Inoue, 1958;
Schuster, 1966) or as an independent lineage at the same
rank as liverworts, mosses, and hornworts (Crandall-
Stotler, 1986), discovery of antheridia and sporophytes
has revived an earlier idea that the genus shows affinity
to mosses (Mizutani, 1967; Smith and Davison, 1993).
Recent phylogenetic analyses of morphological and
molecular data seem to support this conclusion, but the
exact placement of Takakia within mosses is far from
being certain (Hedderson et al., 1998; Kenrick and
Crane, 1997b; Mishler et al., 1994; Newton et al., 2000;
Renzaglia et al., 2000). In this study, we found that the
intron content in nad1 of both Takakia species is the
same as 17 diverse mosses we investigated, but different
from that of liverworts and hornworts (Table 1, Fig. 2).
Hence, a moss affinity for the genus seems most prob-
able. Furthermore, our examination of the ORF (matR)
in nad1i728 indicates that the two Takakia species still
have an intact matR, whereas Sphagnum has only the X
domain of the ORF and the other 16 mosses lack the
ORF entirely. Two lines of evidence support the fol-
lowing ordering of the three states in these taxa: Takakia
(ancestral), Sphagnum (intermediate), and all other
mosses (derived). One is that the X domain has been
suggested to be the least dispensable element in group IIintron ORFs since it is involved in intron splicing (Mohr
et al., 1993). The other is that no matR loss has been
observed in any of the large number of other land plants
that have been investigated (Anderberg et al., 2002; Qiu
et al., 1999; Qiu and Palmer, in press). Consequently, the
matR distribution data would support a topology in
which Takakia is sister to the clade of Sphagnum plus
other mosses, as has been recovered in some recent
sequence analyses (Renzaglia et al., 2000; Qiu et al.,
unpublished data).
The data of the present study may also address the
monophyly of moniliformopses, a group that comprises
traditionally circumscribed ferns, Equisetum, and Psi-
lotaceae. The clade was first identified by Kenrick and
Crane (1997b) after they analyzed both extant and ex-
tinct pteridophytes, and was subsequently supported by
both multigene sequence analysis and a shared unique
insertion in the chloroplast gene rps4 (Pryer et al., 2001).
In this study, we found that the ferns (both eusporan-
giate and leptosporangiate) and Equisetum share the
intron nad1i258. Unfortunately, no sequence was ob-
tained from Psilotaceae. Our phylogenetic analyses of
the intron sequences indicate that the intron was most
likely acquired in a single event in the common ancestor
258 O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263
-
7/28/2019 1-s2.0-S1055790304000326-main
14/18
of moniliformopses and has been inherited vertically
since the acquisition (Fig. 4A). This intron gain would
then be a synapomorphy to support the monophyly of
moniliformopses.
Finally, three introns that were first characterized in
angiosperms, nad1i394, nad1i477, and nad1i669, are now
found to be present throughout vascular plants (Fig. 2).Thus, they were most likely gained in the common an-
cestor of the group. These characters would add to the
large body of information already in existence that
supports the monophyly of vascular plants (Kenrick and
Crane, 1997b).
4.2. Molecular evolutionary implications of intron distri-
bution in nad1 of land plants
One conspicuous aspect of distribution of the seven
nad1 introns in land plants is that they are all of broad
phylogenetic occurrence. The intron that shows the
narrowest phylogenetic range is nad1i258, which is still
found in Equisetum, and eusporangiate and leptospo-
rangiate ferns (Table 1; Fig. 2). The common ancestor of
these plants likely existed between the Silurian and
Devonian (435345 million years ago) (Kenrick and
Crane, 1997a,b). The other intron that is restricted to
only one lineage is nad1i348, which occurs in all four
genera (belonging to the only two families) of hornworts
that were examined (Table 1; Fig. 2). The hornworts as a
lineage must have existed between the mid-Ordovician
(about 450 million years ago) and Silurian, as fossils of
liverwort affinity have been reported from the mid-
Ordovician (Edwards et al., 1995; Taylor, 1995; Well-man et al., 2003) and those of vascular plants from the
lower Silurian (Kenrick and Crane, 1997a,b). All other
five introns are found to be shared by at least two major
lineages of land plants (Table 1; Fig. 2). Hence, these
data suggest that these introns arrived at their current
positions at least during the Silurian to Devonian pe-
riod. There is also evidence suggesting that these and
other group II introns in the non-liverwort land plant
mitochondrial genome originated via transposition from
pre-existing introns in other genes of liverworts [cur-
rently based on data mostly from Marchantia (Oda
et al., 1992)] and other organisms (Dombrovska and
Qiu, in preparation). If these observations hold, it seems
that group II intron transposition was quite active in the
mitochondrial genome during the early stage of land
plant evolution. Meanwhile, among studies that have
surveyed introns in a broad range of land plants (Ha-
shimoto and Sato, 2001; Malek and Knoop, 1998;
Pruchner et al., 2001; Qiu et al., 1998), only one intron
has been shown to be restricted to a single species, the
nad5i392 in Huperzia selago (Vangerow et al., 1999).
This general lack of group II introns with extremely
narrow phylogenetic distribution leads us to conclude
that they have not been actively undergoing transposi-
tion in the recent history of land plant evolution. Fur-
ther, our phylogenetic analyses of all seven nad1 introns
uncovered no evidence of horizontal transfer, specifi-
cally intron homing (Fig. 4). This situation is in stark
contrast to what was reported by Cho et al. (1998) of
rampant horizontal transfer (homing) by a group I in-
tron in the mitochondrial gene cox1 of angiosperms.The only explanation we can offer is that the cox1 intron
carries an endonuclease ORF whereas most of the group
II introns in vascular plant mitochondrial genomes have
lost their ORFs, which contain domains involved in
intron mobility (Mohr et al., 1993; Zimmerly et al.,
2001).
Despite stable inheritance after ancient gains, some of
the introns did experience losses, possibly very deep
losses. The distribution pattern of nad1i287 potentially
suggests a deep loss in the common ancestor of vascular
plants. The likelihood that this intron was gained once
in a common ancestor of mosses and hornworts or twice
in ancestors of each lineage is much less than that of a
single gain in the ancestor of non-liverwort land plants
and a subsequent loss in vascular plants, given the in-
tron phylogeny (Fig. 4B) and current results on land
plant phylogeny reconstruction (Kenrick and Crane,
1997b; Mishler et al., 1994; Renzaglia et al., 2000; Qiu
et al., unpublished data). Three other introns, nad1i394,
nad1i477, and nad1i669, also showed a few sporadic
losses (Fig. 2; Gugerli et al., 2001), but they are all
phylogenetically restricted. Both deep and shallow losses
have also been observed for two cox2 introns in angio-
sperms (Joly et al., 2001; Kudla et al., 2002; Rabbi and
Wilson, 1993; Qiu and Palmer, unpublished data). Theprecise mechanisms for how both deep and shallow in-
tron losses have occurred remain largely unknown at
this stage. Among all plants studied, Isoetes is distinct in
that it has lost two, if not three (the third one possibly
being nad1i728, the exact status of which still cannot be
confirmed by sequencing because of our failure to ob-
tain a PCR product), of the four introns that are usually
present in nad1 in vascular plants (Fig. 2). Even when
introns are present in this and other mitochondrial genes
(nad2 and nad5) in Isoetes, they are unusually small
(384520bp, this study; Malek and Knoop, 1998;
Pruchner et al., 2002). These two lines of evidence sug-
gest that the mitochondrial genome in Isoetes is proba-
bly under strong selection pressure for genome size
reduction, as has been seen in some abnormal genomes
(Douglas et al., 2001).
4.3. RNA editing in nad1 of land plants
RNA editing, post-transcriptional modification of
cytidine to uridine and vice versa in RNAs, has been
reported to occur commonly in organellar genes and
genomes of certain land plants (Giege and Brennicke,
1999; Kugita et al., 2003b; Steinhauser et al., 1999).
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 259
-
7/28/2019 1-s2.0-S1055790304000326-main
15/18
In this study, we noticed that after aligning the exon
sequences from all the plants, some lineages seem to
have numerous aberrant C!T(U) and T(U)!C mu-
tations in the first or second codon positions. Hence, we
checked for the possibility of RNA editing by looking
for whether the mutation has altered a conserved amino
acid or generated an internal stop codon in some cases.Obviously, this approach is not as conclusive and
accurate as cDNA analysis, but has been employed and
proven to be valid by others (Steinhauser et al., 1999).
With this approach, we found that the nad1 gene in the
liverwort Haplomitrium, two Takakia species, all four
hornworts, and several pteridophytes (Isoetes, Ophio-
glossum, Adiantum, and Asplenium) potentially experi-
ence heavy editing, with up to 5.11% of all thenucleotide positions in Anthoceros being edited (Fig. 5).
Fig. 5. Selected codons of the mitochondrialnad1 in land plants showing the extent of RNA editing. Inferred edited nucleotides are underlined, body-
faced ones having been confirmed by cDNA analysis in the studies that reported editing. Editing frequency (%) equals the number of edited nu-
cleotides divided by the exon length examined. Boxes mark stop codons that require editing for conversion. Dots indicate nucleotides identical to
those in Marchantia polymorpha and dashes denote missing data. Marchantia position refers to the position of the first nucleotide in a codon.
260 O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263
-
7/28/2019 1-s2.0-S1055790304000326-main
16/18
Previously, high frequencies of RNA editing have been
noticed in many of these plants in other mitochondrial
genes, cox3, nad2, nad4, and nad5 (Malek and Knoop,
1998; Malek et al., 1996; Pruchner et al., 2001, 2002).
However, questions remain as to why there is RNA
editing in the first place and why it occurs in certain
lineages but not in others.
Acknowledgments
We thank J.D. Palmer for providing initial ideas on
starting this project, and V. Knoop for stimulating dis-
cussion on plant mitochondrial intron evolution, and
both of them for their advice on developing the intron
nomenclature. We also thank B. Crandall-Stotler and E.
Urmi for help with obtaining plant material. This work
was supported by a Swiss NSF research grant (3100-
053602) and a NSF CAREER Award (DEB 0093012) to
Y.Q.
References
Adams, K.L., Qiu, Y.-L., Stoutemyer, M., Palmer, J.D., 2002.
Punctuated evolution of mitochondrial gene content: high and
variable rates of mitochondrial gene loss and transfer during
angiosperm evolution. Proc. Natl. Acad. Sci. USA 99, 99059912.
Anderberg, A.A., Rydin, C., Kallersjo, M., 2002. Phylogenetic
relationships in the order Ericales s.l.: analyses of molecular data
from five genes from the plastid and mitochondrial genomes. Am.
J. Bot. 89, 677687.
Beckert, S., Muhle, H., Pruchner, D., Knoop, V., 2001. Themitochondrial nad2 gene as a novel marker locus for phylogenetic
analysis of early land plants: a comparative analysis in mosses.
Mol. Phylogenet. Evol. 18, 117126.
Beckert, S., Steinhauser, S., Muhle, H., Knoop, V., 1999. A molecular
phylogeny of bryophytes based on nucleotide sequences of the
mitochondrial nad5 gene. Plant Syst. Evol. 218, 179192.
Chapdelaine, Y., Bonen, L., 1991. The wheat mitochondrial gene for
subunit I of the NADH dehydrogenase complex: a trans-splicing
model for this gene-in-pieces. Cell 65, 465472.
Cho, Y., Qiu, Y.-L., Kuhlman, P., Palmer, J.D., 1998. Explosive
invasion of plant mitochondria by a group I intron. Proc. Natl.
Acad. Sci. USA 95, 1424414249.
Conklin, P.L., Wilson, R.K., Hanson, M.R., 1991. Multiple trans-
splicing events are required to produce a mature nad1 transcript in
a plant mitochondrion. Genes Dev. 5, 14071415.Crandall-Stotler, B., 1986. Morphogenesis, developmental anatomy
and bryophyte phylogenetics: contradictions of monophyly. J.
Bryol. 14, 123.
Denovan-Wright, E.M., Nedelcu, A.M., Lee, R.W., 1998. Complete
sequence of the mitochondrial DNA ofChlamydomonas eugametos.
Plant Mol. Biol. 36, 285295.
Douglas, S., Zauner, S., Fraunholz, M., Beaton, M., Penny, S., Deng,
L.-T., Wu, X., Reith, M., Cavalier-Smith, T., Maier, U.-G., 2001.
The highly reduced genome of an enslaved algal nucleus. Nature
410, 10911096.
Doyle, J.J., Doyle, J.S., 1987. A rapid DNA isolation procedure for
small quantities of fresh leaf tissue. Phytochem. Bull. 19, 1115.
Edwards, D., Duckett, J.G., Richardson, J.B., 1995. Hepatic charac-
ters in the earliest land plants. Nature 374, 635636.
Gensel, P.G., Edwards, D., 2001. Plants Invade the Land: Evolution-
ary and Environmental Perspectives. Columbia University Press,
New York, NY.
Giege, P., Brennicke, A., 1999. RNA editing in Arabidopsis mitochon-
dria effects 441 C to U changes in ORFs. Proc. Natl. Acad. Sci.
USA 96, 1532415329.
Graham, L.E., 1993. Origin of Land Plants. Wiley, New York, NY.
Gugerli, F., Sperisen, C., Buchler, U., Brunner, I., Brodbeck, S.,
Palmer, J.D., Qiu, Y.-L., 2001. The evolutionary split of Pinaceae
from other conifers: evidence from an intron loss and a multigene
phylogeny. Mol. Phylogenet. Evol. 21, 167175.
Hallick, R.B., Hong, L., Drager, R.G., Favreau, M.R., Monfort, A.,
Orsat, B., Spielmann, A., Stutz, E., 1993. Complete sequence of
Euglena gracilis chloroplast DNA. Nucleic Acids Res. 21, 3537
3544.
Hashimoto, K., Sato, N., 2001. Characterization of the mitochondrial
nad7 gene in Physcomitrella patens: similarity with angiosperm
nad7 genes. Plant Sci. 160, 807815.
Hattori, S., Inoue, H., 1958. Preliminary report on Takakia lepido-
zioides. J. Hattori Bot. Lab. 19, 133137.
Hedderson, T.A., Chapman, R., Cox, C.J., 1998. Bryophytes and the
origins and diversification of land plants: new evidence from
molecules. In: Bates, J.W., Ashton, N.W., Duckett, J.G. (Eds.),
Bryology for the Twenty-first Century. W.S. Maney & Son Ltd.,
Leeds, UK, pp. 6577.
Hiratsuka, J., Shimada, H., Whittier, R., Ishibashi, T., Sakamoto, M.,
Mori, M., Kondo, C., Honji, Y., Sun, C.-R., Meng, B.-Y., Li, Y.
-Q., Kanno, A., Nishizawa, Y., Hirai, A., Shinozaki, K., Sugiura,
M., 1989. The complete sequence of the rice (Oryza sativa)
chloroplast genome: intermolecular recombination between distinct
tRNA genes accounts for a major plastid DNA inversion during
the evolution of the cereals. Mol. Gen. Genet. 217, 185194.
Johansen, S., Haugen, P., 2001. A new nomenclature of group I
introns in ribosomal DNA. RNA 7, 935936.
Joly, S., Brouillet, L., Bruneau, A., 2001. Phylogenetic implications of
the multiple losses of the mitochondrial coxII.i3 intron in the
angiosperms. Int. J. Plant Sci. 162, 359373.
Kenrick, P., Crane, P.R., 1997a. The origin and early evolution ofplants on land. Nature 389, 3339.
Kenrick, P., Crane, P.R., 1997b. The Origin and Early Diversification
of Land Plants: A Cladistic Study. Smithsonian Institution Press,
Washington, DC.
Kroymann, J., Zetsche, K., 1998. The mitochondrial genome of
Chlorogonium elongatum inferred from the complete sequence. J.
Mol. Evol. 47, 431440.
Kubo, T., Nishizawa, S., Sugawara, A., Itchoda, N., Estiati, A.,
Mikami, T., 2000. The complete nucleotide sequence of the
mitochondrial genome of sugar beet (Beta vulgaris L.) reveals a
novel gene for tRNACys (GCA). Nucleic Acids Res. 28, 25712576.
Kuck, U., Jekosch, K., Holzamer, P., 2000. DNA sequence analysis of
the complete mitochondrial genome of the green alga Scenedesmus
obliquus: evidence for UAG being a leucine and UCA being a non-
sense codon. Gene 253, 1318.Kudla, J., Albertazzi, F.J., Blazevic, D., Hermann, M., Bock, R., 2002.
Loss of the mitochondrial cox2 intron 1 in a family of monocoty-
ledonous plants and utilization of mitochondrial intron sequences
for the construction of a nuclear intron. Mol. Genet. Genomics
267, 223230.
Kugita, M., Kaneko, A., Yamamoto, Y., Takeya, Y., Matsumoto, T.,
Yoshinaga, K., 2003a. The complete nucleotide sequence of the
hornwort (Anthoceros formosae) chloroplast genome: insight into
the earliest land plants. Nucleic Acids Res. 31, 716721.
Kugita, M., Yamamoto, Y., Fujikawa, T., Matsumoto, T., Yoshinaga,
K., 2003b. RNA editing in hornwort chloroplasts makes more than
half the genes functional. Nucleic Acids Res. 31, 24172423.
Lambowitz, A.M., Belfort, M., 1993. Introns as mobile genetic
elements. Annu. Rev. Biochem. 62, 587622.
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 261
-
7/28/2019 1-s2.0-S1055790304000326-main
17/18
Lewis, L.A., Mishler, B.D., Vilgalys, R., 1997. Phylogenetic relation-
ships of the liverworts (Hepaticae), a basal embryophyte lineage,
inferred from nucleotide sequence data of the chloroplast gene
rbcL. Mol. Phylogenet. Evol. 7, 377393.
Malek, O., Knoop, V., 1998. Trans-splicing group II introns in plant
mitochondria: the complete set ofcis-arranged homologs in ferns,
fern allies, and a hornwort. RNA 4, 15991609.
Malek, O., Brennicke, A., Knoop, V., 1997. Evolution oftrans-splicing
plant mitochondrial introns in pre-Permian times. Proc. Natl.
Acad. Sci. USA 94, 553558.
Malek, O., Lattig, K., Hiesel, R., Brennicke, A., Knoop, V., 1996.
RNA editing in bryophytes and a molecular phylogeny of land
plants. EMBO J. 15, 14031411.
Manhart, J.R., Palmer, J.D., 1990. The gain of two chloroplast tRNA
introns marks the green algal ancestors of land plants. Nature 345,
268270.
Mathews, D.H., Sabina, J., Zuker, M., Turner, D.H., 1999. Expanded
sequence dependence of thermodynamic parameters improves
prediction of RNA secondary structure. J. Mol. Biol. 288, 911940.
Michel, F., Umesono, K., Ozeki, H., 1989. Comparative and functional
anatomy of group II catalytic intronsa review. Gene 82, 530.
Mishler, B.D., Lewis, L.A., Buchheim, M.A., Renzaglia, K.S.,
Garbary, D.J., Delwiche, C.F., Zechman, F.W., Kantz, T.S.,
Chapman, R.L., 1994. Phylogenetic relationships of the green
algae and bryophytes. Ann. Missouri Bot. Gard. 81, 451483.
Mizutani, M., 1967. A new knowledge of archegonia of Takakia
lepidozioides. J. Jpn. Bot. 42, 379381.
Mohr, G., Perlman, P.S., Lambowitz, A.M., 1993. Evolutionary
relationships among group II intron-encoded proteins and identi-
fication of a conserved domain that may be related to maturase
function. Nucleic Acids Res. 21, 49914997.
Nakayama, H., Morinaga, Y., Nomura, N., Nunoura, T., Sako, Y.,
Uchida, A., 2003. An archaeal homing endonuclease I-Pog I
cleaves at the insertion site of the neighboring intron, which has no
nested open reading frame. FEBS 544, 165170.
Nedelcu, A.M., Lee, R.W., Lemieux, C., Gray, M.W., Burger, G.,
2000. The complete mitochondrial DNA sequence ofScenedesmus
obliquus reflects an intermediate stage in the evolution of the greenalgal mitochondrial genome. Genome Res. 10, 819831.
Newton, A.E., Cox, C.J., Duckett, J.G., Wheeler, J.A., Goffinet, B.,
Hedderson, T.A.J., Mishler, B.D., 2000. Evolution of major moss
lineages: phylogenetic analyses based on multiple gene sequences
and morphology. Bryologist 103, 187211.
Nickrent, D.L., Parkinson, C.L., Palmer, J.D., Duff, R.J., 2000.
Multigene phylogeny of land plants with special reference to
bryophytes and the earliest land plants. Mol. Biol. Evol. 17, 1885
1895.
Nishiyama, T., Kato, M., 1999. Molecular phylogenetic analysis
among bryophytes and tracheophytes based on combined data of
plastid coded genes and the 18S rRNA gene. Mol. Biol. Evol. 16,
10271036.
Notsu, Y., Masood, S., Nishikawa, T., Kubo, N., Akiduki, G.,
Nakazono, M., Hirai, A., Kadowaki, K., 2002. The completesequence of the rice (Oryza sativa L.) mitochondrial genome:
frequent DNA sequence acquisition and loss during the evolution
of flowering plants. Mol. Genet. Genomics 268, 434445.
Oda, K., Yamato, K., Ohta, E., Nakamura, Y., Takemura, M.,
Nozato, N., Akashi, K., Kanegae, T., Ogura, Y., Kohchi, T.,
Ohyama, K., 1992. Gene organization deduced from the complete
sequence of liverwort Marchantia polymorpha mitochondrial DNA:
a primitive form of plant mitochondrial genome. J. Mol. Biol. 223,
17.
Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T., Sano, S.,
Umesono, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S.,
Inokuchi, H., Ozeki, H., 1986. Chloroplast gene organization
deduced from complete sequence of liverwort Marchantia poly-
morpha chloroplast DNA. Nature 322, 572574.
Pruchner, D., Beckert, S., Muhle, H., Knoop, V., 2002. Divergent
intron conservation in the mitochondrial nad2 gene: signatures for
the three bryophyte classes (mosses, liverworts, and hornworts) and
the lycophytes. J. Mol. Evol. 55, 265271.
Pruchner, D., Nassal, B., Schindler, M., Knoop, V., 2001. Mosses
share mitochondrial group II introns with flowering plants, not
with liverworts. Mol. Genet. Genomics 266, 608613.
Pryer, K.M., Schneider, H., Smith, A.R., Cranfill, R., Wolf, P.G.,
Hunt, J.S., Sipes, S.D., 2001. Horsetails and ferns are a mono-
phyletic group and the closest relatives to seed plants. Nature 409,
618622.
Qin, P.Z., Pyle, A.M., 1998. The architectural organization and
mechanistic function of group II intron structural elements. Curr.
Opin. Struct. Biol. 8, 301308.
Qiu, Y.-L., Cho, Y., Cox, J.C., Palmer, J.D., 1998. The gain of three
mitochondrial introns identifies liverworts as the earliest land
plants. Nature 394, 671674.
Qiu, Y.-L., Lee, J., Bernasconi-Quadroni, F., Soltis, D.E., Soltis, P.S.,
Zanis, M., Zimmer, E.A., Chen, Z., Savolainen, V., Chase, M.W.,
1999. The earliest angiosperms: evidence from mitochondrial,
plastid and nuclear genomes. Nature 402, 404407.
Qiu, Y.-L., Lee, J., 2000. Transition to a land flora: a molecular
phylogenetic perspective. J. Phycol. 36, 799802.
Qiu, Y.-L., Palmer, J.D., in press. Many independent origins oftrans-
splicing of a plant mitochondrial group II intron. J. Mol. Evol.
Rabbi, M.F., Wilson, K.G., 1993. The mitochondrial coxII intron has
been lost in two different lineages of dicots and altered in others.
Am. J. Bot. 80, 12161223.
Raubeson, L.A., Jansen, R.K., 1992. Chloroplast DNA evidence on
the ancient evolutionary split in vascular land plants. Science 255,
16971699.
Renzaglia, K.S., Duff, R.J., Nickrent, D.L., Garbary, D.J., 2000.
Vegetative and reproductive innovations of early land plants:
implications for a unified phylogeny. Philos. Trans. R. Soc. B 355,
769793.
Samigullin, T.K., Yacentyuk, S.P., Degtyaryeva, G.V., Valiehoroman,
K.M., Bobrova, V.K., Capesius, I., Martin, W.M., Troitsky, A.V.,
Filin, V.R., Antonov, A.S., 2002. Paraphyly of bryophytes and closerelationship of hornworts and vascular plants inferredfrom analysis
of chloroplast rDNA ITS (cpITS) sequences. Arctoa 11, 3143.
Schuster, R.M., 1966. The Hepaticae and Anthocerotae of North
America, vol. 1. Columbia University Press, New York, NY.
Schuster, R.M., 2000. Austral Hepaticae, Part I. J. Cramer in der
Gebrueder Borntraeger Verlagsbuchhandlung, Stuttgart.
Sharp, P.A., 1981. Speculations on RNA splicing. Cell 23, 643646.
Smith, D.K., Davison, P.G., 1993. Antheridia and sporophytes in
Takakia ceratophylla (Mitt.) Grolle: evidence for reclassification
among the mosses. J. Hattori Bot. Lab. 73, 263271.
Steinhauser, S., Beckert, S., Capesius, I., Malek, O., Knoop, V., 1999.
Plant mitochondrial RNA editing. J. Mol. Evol. 48, 303312.
Sugiura, C., Kobayashi, Y., Aoki, S., Sugita, C., Sugita, M., 2003.
Complete chloroplast DNA sequence of the moss Physcomitrella
patens: evidence for the loss and relocation of rpoA from thechloroplast to the nucleus. Nucleic Acids Res. 31, 53245331.
Swofford, D.L., 2003. PAUP*4.0b10: Phylogenetic analysis using
parsimony. Sinauer, Sunderland, MA.
Taylor, W.A., 1995. Spores in earliest land plants. Nature 373, 391
392.
Thomson, M.C., MacFarlane, J.L., Beagley, C.T., Wolstenholme,
D.R., 1994. RNA editing ofmat-r transcripts in maize and soybean
increases similarity of the encoded protein to fungal and bryophyte
group II intron maturases: evidence that mat-r encodes a functional
protein. Nucleic Acids Res. 22, 57455752.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins,
D.G., 1997. The ClustalX windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 24, 48764882.
262 O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263
-
7/28/2019 1-s2.0-S1055790304000326-main
18/18
Turmel, M., Lemieux, C., Burger, G., Lang, B.F., Otis, C., Plante, I.,
Gray, M.W., 1999. The complete mitochondrial DNA sequences of
Nephroselmis olivacea and Pedinomonas minor: two radically differ-
ent evolutionary patterns within green algae. Plant Cell 11, 1717
1729.
Turmel, M., Otis, C., Lemieux, C., 2002a. The complete mitochondrial
DNA sequence ofMesostigma viride identifies this green alga as the
earliest green plant divergence and a highly compact mitochondrial
genomein theancestor of allgreen plants.Mol. Biol. Evol. 19,2438.
Turmel, M., Otis, C., Lemieux, C., 2002b. The chloroplast and
mitochondrial genome sequences of the charophyte Chaetosphae-
ridium globosum: insights into the timing of the events that
restructured organelle DNAs within the green algal linegae that
led to land plants. Proc. Natl. Acad. Sci. USA 99, 1127511280.
Turmel, M., Otis, C., Lemieux, C., 2003. The mitochondrial genome of
Chara vulgaris: insights into the mitochondrial DNA architecture
of the last common ancestor of green algae and land plants. Plant
Cell 15, 18881903.
Unseld, M., Marienfeld, J.R., Brand, P., Brennicke, A., 1997. The
mitochondrial genome ofArabidopsis thaliana contains 57 genes in
366,924 nucleotides. Nat. Genet. 15, 5761.
Vangerow, S., Teekorn, T., Knoop, V., 1999. Phylogenetic information
in the mitochondrial nad5 gene of pteridophytes: RNA editing and
intron sequences. Plant Biol. 1, 235243.
Wakasugi, T., Sugita, M., Tsudzuki, T., Sugiura, M., 1998. Updated
gene map of tobacco chloroplast DNA. Plant Mol. Biol. Rep. 16,
231241.
Wahleithner, J.A., MacFarlane, J.L., Wolstenholme, D.R., 1990. A
sequence encoding a maturase-related protein in a group II intron
of a plant mitochondrial nad1 gene. Proc. Natl. Acad. Sci. USA 87,
548552.
Wellman, C.H., Osterloff, P.L., Mohiuddin, U., 2003. Fragments of
the earliest land plants. Nature 425, 282285.
Wissinger, B., Schuster, W., Brennicke, A., 1991. Trans-splicing in
Oenothera mitochondria: nad1 mRNA are edited in exon and
trans-splicing group II intron sequences. Cell 65, 473482.
Wolf, P.G., Rowe, C.A., Sinclair, R.B., Hasebe, M., 2003. Complete
nucleotide sequence of the chloroplast genome from a leptospo-
rangiate fern, Adiantum capillus-veneris L. DNA Res. 10, 5965.
Wolff, G., Plante, I., Lang, B.F., Kuck, U., Burger, G., 1994. Complete
sequence of the mitochondrial DNA of the chlorophyte alga
Prototheca wickerhamii: gene content and genome organization. J.
Mol. Biol. 237, 7586.
Won, H., Renner, S.S., 2003. Horizontal gene transfer from
flowering plants to Gnetum. Proc. Natl. Acad. Sci. USA 100,
1082410829.
Zimmerly, S., Hausner, G., Wu, X.-C., 2001. Phylogenetic relation-
ships among group II intron ORFs. Nucleic Acids Res. 29, 1238
1250.
Zuker, M., Mathews, D.H., Turner, D.H., 1999. Algorithms and
thermodynamics for RNA secondary structure prediction: a
practical guide. In: Barciszewski, J., Clark, B.F.C. (Eds.), RNA
Biochemistry and Biotechnology. NATO ASI Series. Kluwer
Academic Publishers, Dordrecht, pp. 1143.
O. Dombrovska, Y.-L. Qiu / Molecular Phylogenetics and Evolution 32 (2004) 246263 263