1-s2.0-S096517480700238X-main

7/27/2019 1-s2.0-S096517480700238X-main

1/9

InsectBiochemistry

andMolecularBiology

Insect Biochemistry and Molecular Biology 38 (2008) 146154

Alterations of the acetylcholinesterase enzyme in the oriental fruit fly

Bactrocera dorsalis are correlated with resistance to the

organophosphate insecticide fenitrothion

Ju-Chun Hsua,b,, Wen-Jer Wub, David S. Haymerc, Hsiu-Ying Liaoa, Hai-Tung Fenga

aTaiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, 11, Guang ming Road,

Wufong, 413 Taichung Hsien, TaiwanbDepartment of Entomology, National Taiwan University, 27, Lane 113, Roosevelt Road, Sec. 4, Taipei 106, Taiwan

cDepartment of Cell and Molecular Biology, University of Hawaii at Manoa, 1960 EastWest Road, Honolulu, HI 96822, USA

Received 1 June 2007; received in revised form 6 October 2007; accepted 8 October 2007

Abstract

Alterations of the structure and activity of the enzyme acetylcholinesterase (AChE) leading to resistance to organophosphate

insecticides have been examined in the oriental fruit fly, Bactrocera dorsalis (Hendel), an economic pest of great economic importance in

the Asia-Pacific region. We used affinity chromatography to purify AChE isoenzymes from heads of insects from lines showing the

phenotypes of resistance and sensitivity to insecticide treatments. The AChE enzyme from a strain selected for resistance to the

insecticide fenitrothion shows substantially lower catalytic efficiency for various substrates and 124-, 373- and 5810-fold less sensitivity to

inhibition by paraoxon, eserine and fenitroxon, respectively, compared to that of the fenitrothion susceptible line. Using peptide mass

fingerprinting, we also show how specific changes in the structure of the AChE enzymes in these lines relate to the resistant and sensitive

alleles of the AChE (ace) gene characterized previously in this species (described in Hsu, J.-C., Haymer, D.S., Wu, W.-J., Feng, H.-T.,

2006. Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides.Insect Biochem. Mol. Biol. 36, 396402). Polyclonal antibodies specific to the purified isoenzymes and real-time PCR were also used to

show that both the amount of the isoenzyme present and the expression levels of the ace genes were not significantly different between the

R and S lines, indicating that quantitative changes in gene expression were not significantly contributing to the resistance phenotype.

Overall, our results support a direct causal relationship between the mutations previously identified in the ace gene of this species and

qualitative alterations of the structure and function of the AChE enzyme as the basis for the resistance phenotype. Our results also

provide a basis for further comparisons of insecticide resistance phenomena seen in closely related species, such as Bactrocera oleae, as

well as in a wide range of more distantly related insect species.

r 2007 Elsevier Ltd. All rights reserved.

Keywords: Fenitrothion; ace gene; Insecticide resistance; Enzyme kinetics; Bactrocera dorsalis

1. Introduction

The oriental fruit fly (Bactrocera dorsalis (Hendel))

causes serious financial losses to orchards globally and is

the most serious fruit pest of fruit trees in Taiwan.

Organophosphate based insecticides have been used tocontrol this pest for many years. However, the develop-

ment of even subtle resistance has been shown to be

capable of causing a loss of effectiveness of such control

agents (Hsu and Feng, 2000). For example the organopho-

sphorous insecticide fenitrothion has been used for pest

control since 1960 (Nishizawa et al., 1961), but in areas

such as Taiwan it has become increasingly limited in

effectiveness for control of B. dorsalis (Hsu and Feng,

2002). Similar cases of the development of resistance and

subsequent reductions in effectiveness to this and other

ARTICLE IN PRESS

www.elsevier.com/locate/ibmb

0965-1748/$ - see front matterr 2007 Elsevier Ltd. All rights reserved.

doi:10.1016/j.ibmb.2007.10.002

Corresponding author. Taiwan Agricultural Chemicals and Toxic

Substances Research Institute, Council of Agriculture, 11, Guang ming

Road, Wufong, 413 Taichung Hsien, Taiwan. Tel.: +886 4 23302101;

fax: +886 4 23314106.

E-mail address: [email protected] (J.-C. Hsu).
http://www.elsevier.com/locate/ibmbhttp://localhost/var/www/apps/conversion/tmp/scratch_6/dx.doi.org/10.1016/j.ibmb.2007.10.002mailto:[email protected]:[email protected]://localhost/var/www/apps/conversion/tmp/scratch_6/dx.doi.org/10.1016/j.ibmb.2007.10.002http://www.elsevier.com/locate/ibmb

7/27/2019 1-s2.0-S096517480700238X-main

2/9

organophosphate based insecticides have been observed

in a wide range of other insect species in different localities

(Hama, 1983, 1984; Konno and Shishido, 1989; Kotze

and Walkbank, 1996; Kozaki et al., 2001). Because of

this, improved understanding of the actual or potential

mechanisms of resistance can be very important for

preventing even greater loss of the tools available for pestcontrol.

The enzyme acetylcholinesterase (AChE, EC 3.1.1.7) is

known to be the target of many organophosphate and

carbamate based insecticides. These insecticides work by

promoting phosphorylation or carbamylation type mod-

ifications of the active site of the AChE enzyme. These

modifications inhibit AChE activity and block the hydro-

lysis of acetylcholine (Oppenoorth and Welling, 1979), a

step that is normally necessary for the proper regulation of

nerve cell activity. In Drosophila melanogaster as well as

several other insect species, the development of resistance

to these insecticides has been associated with point

mutations in the gene (ace) encoding the AChE enzyme

(Fournier et al., 1992; Mutero et al., 1994; Vaughan et al.,

1997). In a number of species (Zhu and Clark, 1995a, b;

Kozaki et al., 2001; Weill et al., 2004), at least some of

these point mutations appear to correspond to regions

encoding the active site of the enzyme. Included in this

latter category is a previous study ofB. dorsalis (Hsu et al.,

2006) where two of the sites producing missense mutations

were shown to be identical to sites that had been altered in

a strain of a congeneric species, B. oleae, which also

exhibited insecticide resistance (Vontas et al., 2002;

Hawkes et al., 2005).

In addition to the clear evidence associating DNAchanges with the acquisition of resistance, it is also

important to develop a better understanding of how these

mutations may exert either quantitative or qualitative

effects on specific genes and their products. In some

species, for example the aphid Myzus persicae, insecticide

resistance has been associated with various mechanisms

such as the overproduction of detoxifying esterases,

qualitative alterations of the AChE enzyme itself and

mutations in other genes conferring knockdown resistance

(reviewed in Margaritopoulos et al., 2007). It is of interest

to know which if any of these phenomena occur in

B. dorsalis, especially in light of the work in the congeneric

species B. oleae that shows a decreased sensitivity to the

inhibitors and a qualitative reduction of the catalytic

activity of the AChE enzyme as the basis for resistance in

this species (Vontas et al., 2002).

To this end we examine here the effects on ace gene

expression and AChE enzyme activity due to the previously

described mutations in the ace gene of B. dorsalis (Hsu

et al., 2006). Overall, our results confirm that the resistance

phenotype is associated with qualitative effects on the

structure and activity of this enzyme. At least for the cases

examined here, quantitative changes in the levels of gene

expression can also be ruled out as significant contributors

to this phenotype.

2. Materials and methods

2.1. Fly strains

An insecticide-susceptible (S) line of the oriental fruit fly,

B. dorsalis, was established in our laboratory from flies

collected from central Taiwan in 1994. This laboratorycolony was reared on an artificial diet maintained without

any exposure to insecticides. An insecticide resistant (R)

line was selected from this line, and susceptibilities (LD50)

of the flies to varied doses of fenitrothion and methomyl

were assayed using topical application as described in Hsu

et al. (2004).

2.2. Chemicals

Insecticides and their respective oxons used in this study

were analytical grade. Fenitrothion, and paraoxon-ethyl

were obtained from Fluka Chemie GmbH (Switzerland).

Fenitroxon was obtained from Tokyo Kasei Kogyo Co.

(Japan).

AChE assay reagents and inhibitors, including acet-

ylthiocholine iodide (ATC), propionylthiocholine iodide

(PTC), 5,5-dithiobis-2-nitrobenzoic acid (DTNB), S-butyr-

ylthiocholine iodide (BTC), 1,5-bis(4-allyldimethylammo-

nium phenyl)pentan-3-one dibromide (BW284C51), eserine

hemisulfate (eserine), ethopropazine hydrochloride (etho-

propazine) were purchased from Sigma Chemical Co.

(USA).

The ECH Sepharose 4B was purchased from Amersham

Pharmacia Biotech (Piscataway, NJ). The chemicals tetra-

ethylammonium iodide (Net4I), procainamide, andN-ethoxycarbonyl-2-ethoxy-1, 2-dihydroquinoline (EEDQ)

were purchased from ACROS Organics (USA). The bovine

serum albumin (BSA) protein assay standard was pur-

chased from Bio-Rad Laboratories (USA).

2.3. Enzyme purification

AChE was purified from the heads of adults by affinity

chromatography using procainamide as described in

Hsiao et al. (2004). Approximately, 12 g of frozen heads

were homogenized in 120 mL of ice-cold phosphate buffer

(pH 7.4) containing 0.5% (v/v) triton-X100 (extracted

buffer). After centrifugation at 13 000g for 15min, the

supernatant was filtered through two layers of cheesecloth

to remove the lipids. The recovered material was then

applied to a procainamide-based Sepharose 4B affinity

column as described by the manufacturer. A buffer

containing 50mM NaCl (PTS) was used to wash the

column until the absorbance at 280 nm fell below 0.01 and

the AChE was then eluted with 30mM Net4I in PTS

buffer.

The purity of enzyme was analyzed by SDS-PAGE.

Fractions containing purified AChE were pooled, dialyzed

against PTS buffer to remove the Net4I and concentrated

using an Amicon concentrator (model 8050) at 4 1C.

ARTICLE IN PRESS

J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154 147

7/27/2019 1-s2.0-S096517480700238X-main

3/9

2.4. AChE enzyme quantitation

Immunoassays were conducted to quantify the amount

of AChE present in flies from both lines. The indirect-

ELISA sandwich method and anti-AChE polyclonal

antibodies were used based on a modification of the

method from Yeh and Gonsalves (1984). Two purifiedextracts (about 1 mg, titer of anti-AChEs (1:10000)) of

polyclonal antibodies against AChE from both feni-

trothion-susceptible and -resistant B. dorsalis, respectively,

were produced in rabbits (Taiwan Protein Co., Ltd).

Purification was done from pooled antisera using the

Melon Gel IgG spin purification kit (Pierce Biotech., USA)

following instructions provided by the manufacturer.

The concentration of IgG protein was estimated using

readings from a spectrophotometer at optical density at

280 nm (OD280).

For both lines, ten heads cut from fresh flies were

homogenized in phosphate-buffered saline (PBS) and

diluted to 1.2mg total protein per well to coat 96-well

microtiter plates for 1 h at 37 1C. Each sample was assayed

using four replicates to minimize intra-experiment varia-

tion. The 96-well microtiter plates were used for either

direct measurement of AChE activity or for an ELISA

assay.

After blocking, wells were sequentially incubated

with anti-AChE rabbit serum (at concentrations of

0.22 mg for anti-susceptible AChE or 0.28mg anti-feni-

trothion AChE/well), and the alkaline phosphatase-

conjugated goat anti-rabbit IgG (Jackson Immuno

Research; 0.04 mg/well). All incubations were carried out

fo r 1 h a t 3 7 1C with washes between successive steps.The absorbance value was determined in an ELISA reader

at 405 nm using a Benchmark microplate reader (Bio-Rad,

USA).

2.5. AChE activity assays and enzyme kinetics

AChE activity was determined by the method of Ellman

et al. (1961). AChE extracts (before and after purification)

buffered in sodium phosphate (pH 7.0) were assayed for

activity with ATC (0.50 mM) as a substrate. The change in

light absorbance at 410 nm was recorded for 5 min in a

Benchmark microplate reader (Bio-Rad) and used to

calculate AChE activity as in units of mmol ATC

hydrolysed/min/mg.

The substrate specificity of purified AChE was assessed

using ATC, PTC, and BTC. A total of 11 different

substrate concentrations ranging from 40 to 4000 mM for

ATC and 161600 mM for PTC and BTC were used (as well

as no substrate) to determine the enzyme kinetic para-

meters of purified enzyme from both the fenitrothion-

susceptible (S) and -resistant (R) lines. For each substrate

the maximum velocities (Vmax) and the Michaelis con-

stants (Km) were calculated using Hanes/Woolf plots

(Java-EMBOSS Software). The ratio Vmax/Km is referred

to as efficiency of catalysis and the turnover number (Kcat)

was calculated from the molecular mass of purified AChE

(116 kDa, the predicted mass) and Vmax. The substrate

specificity constant (Kcat/Km) was determined from the Kcatand Km values according to the method of Zhu and

Brindley (1992).

2.6. Sensitivity of AChE to inhibition

Purified AChE was incubated with eight different

concentrations of each of five inhibitors (ethopropaxine,

BW284C51, eserine, paraoxon and fenitroxon) at 37 1C for

5 min before adding substrate to assay the AChE activity

(the substrate is ATC (0.50 mM)). Ethopropazine was used

in a concentration range of 0.886 to 114 mM, BW284C51

from 4.55pM to 45.5 mM, eserine from 2.73pM to

2.27 mM, paraoxon from 145 pM to 11.4 mM and fenitrox-

on from 40.6 pM to 11.4mM. In each case, AChE activity

was assayed as described.

The inhibition concentration (I50) for each inhibitor

was determined based on log-concentration vs. log-% inhibi-

tion regression analysis. In this study, the concentrations

of five inhibitors were 3.55455mM for ethopropazine,

4.55 pM45.5mM for BW284C51, 37.2 pM22.7 nM for eser-

ine, 74.5 nM45.5mM for paraoxon and 18.6 nM11.4mM for

fenitroxon, respectively. Results are reported as means7stan-

dard deviation and the sample size is five for every inhibitor

analysis.

The plot of the log of residual activity (AChE) against

time was linear for a given inhibitor concentration. The

bimolecular rate constant (Ki) was calculated by linear

regression as described by Main and Iverson (1966). The

concentrations in BW284C51, paraoxon and fenitroxon were20.8 nM45.5mM, 0.145 nM11.4mM and 88.8 nM11.4mM,

respectively, and the other inhibitors were in the same

concentration ranges as the inhibition concentration

described.

2.7. Peptide mass fingerprinting analysis

Using material from both fenitrothion-susceptible and

-resistant lines, AChE was obtained for peptide mass

analysis using either gel slices isolated from SDS-PAGE

gels, processed by in-gel digestion, or from PBS solutions

dialyzed against deioned water where direct digestion

with trypsin was carried out. These were analyzed by

laser desorption/ionization with matrix assisted, time-of-

flight spectroscopy (MALDI-TOF) (Applied Biosystems/

Voyager DE Pro) (Proteomic MS Core Laboratory,

National Chung Hsing University). Peptide mass values

obtained were used to search the NCBInr database

(2006.02.16) using Ms-Fit software (http://prospector.ucsf.

edu/prospector/4.0.8/html/msfit.htm). The mass tolerance

was set at 100 ppm, and other parameters were typically set

as follows: trypsin up to two miss cleavages; cysteine

modification, acrylamide; and considered modifications

including oxidation of Met and carbamidmethylation of

cystein.

ARTICLE IN PRESS

J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 38 (2008) 146154148
http://prospector.ucsf.edu/prospector/4.0.8/html/msfit.htmhttp://prospector.ucsf.edu/prospector/4.0.8/html/msfit.htmhttp://prospector.ucsf.edu/prospector/4.0.8/html/msfit.htmhttp://prospector.ucsf.edu/prospector/4.0.8/html/msfit.htm

7/27/2019 1-s2.0-S096517480700238X-main

4/9

2.8. Quantitative real-time PCR method

Total RNA was extracted from the heads of 15 flies of

each line using a microscale total RNA extraction kit

(RNeasyR Mini kit, Qiagen Gmbh). After treatment with

DNase, one microgram of total RNA was used for the first

strand synthesis of cDNA in 20ml of total volume using theThermoScriptTM reverse transcription cDNA synthesis

system (Invitrogen) with poly T as the primer, according

to the manufacturers instructions.

Real-time PCR was used to examine the expression of

the ace gene in specimens from both the R and S lines.

Primers designed to specifically amplify ace gene sequences

from cDNA were used (described below). In both lines

similar amplifications were also carried out with primers

designed from conserved ribosomal 18S sequences (18S) as

a control, and ratios of ace/18S levels of gene expression

were calculated.

Real-time PCR amplifications were done using an IQ5

machine (Bio-Rad, USA). One microliter of template was

used in each reaction of 25ml total volume (including

the SYBR Green I). Primers specific to the ace gene

(AY155500) were sense: CGGCAAGTTGAACGAGAG;

and antisense: AGAGGAAGCGGATGATGG. Primers

specific to the 18S ribosomal gene (AF033944) were sense:

ATTTGTGCTTCATACGGGTAG; and antisense: AA-

CAGAGGTCTTATTTCATTATTCC.

Quantification references were designed to have similar

properties in terms of length and %GC content. An

optimized thermal program consisting of one cycle of 95 1C

for 3 min, 40 cycles of 95 1C for 10s, 52 1C for 15s, and

followed by a final one cycle of 72 1C for 2.5 min was used.Following the qRTPCR, the homogeneity of PCR product

was confirmed by the melting curve analysis. The relative

amount of target gene against reference gene was

calculated according to the 2DCt method (Pfaffl, 2001).

The assay was repeated six times with total RNA extracted

separately for flies from both lines, and three replicates

were carried out for each reaction to minimize intra-

experiment variation.

2.9. Statistical analysis

Using EXCEL software statistical analysis of the AChEkinetics was carried out using two factor ANOVA. For

other experiments the two-tailed Students t-test was used.

Differences were considered significant at Po0.05 level.

3. Results

3.1. AChE purification and activity

The purity of the AChE isoenzyme was confirmed by

SDS-PAGE using the coomassie blue staining method

using material obtained from both the fenitrothion-

susceptible (S) and -resistant (R) lines. In both cases a

monomer of 59.7 kDa (estimated molecular weight, MW)

was obtained (Fig. 1).

The overall purification factors and yields were similar

for both lines (about 1500-fold and 20%, respectively)

(Table 1). Resistance ratios and cross-resistance ratios were

calculated as the ratio of the resistant LD50 to the

susceptible LD50 values for fenitrothion (RR) or methomyl

(CR) insecticide treatments.

3.2. AChE kinetics

Three substrates (ATC, PTC, and BTC) were used to

assess the kinetic parameters of the AChE enzyme purified

from both the S and R lines (Table 2):

(a) The hydrolyzing efficiencies (Vmax) for these substrates

differed significantly between two lines (Fsubstrates

(2,20) 139.2, Po0.05). The AChE from the R line

exhibited hydrolyzing efficiency about two times lower

(two factor ANOVA, Fline (1,20) 35.6, Po0.05)

compared with the AChE purified from the S line for

all substrates investigated.

(b) The substrate affinities (Km) also differed significantly

between two lines using two factor ANOVA (Fsubstrate

(2,20) 75.3, Po0.05 for Km) with the AChE from the R

line exhibiting significantly lower affinities (two factor

ANOVA, Fline (1,20) 20.8, Po0.05) for all three of the

substrates compared to the AChE purified from the Sline.

3.3. Sensitivity of AChE to inhibition

AChEs purified from both S and R lines showed similar

curves for inhibition by BW284C51, eserine, paraoxon and

ARTICLE IN PRESS

Fig. 1. SDS-PAGE analysis of AChEs purified from flies of the

susceptible and fenitrothion-resistant lines. Purified AChEs were mixed

with loading dye and DTT reducing agent and heated at 95 1C for 5 min in

a dry bath. Treated samples were loaded onto a 10% SDS-PAGE and

electrophoresed for 1.5 h at 100 V at room temperature. The protein bands

were visualized by coomassie blue staining (kit from AmershamPharmacia Biotech). Susppurified AChE from susceptible oriental fruit

flies; Resistpurified AChE from fenitrothion-resistant flies; marker

lanemid-range protein marker (GeneMark, Taiwan).


7/27/2019 1-s2.0-S096517480700238X-main

5/9

fenitroxon although inhibition by ethopropazine required

approximately a 100-fold higher concentration (Fig. 2). In

all cases the purified AChE from the R line displayed lessoverall activity compared to that of the AChE purified

from the S line.

The I50 values in Table 3 show that in the S line, eserine

was the most potent inhibitor of purified AChE, followed

by fenitroxon, paraoxon, BW284C51, and finally ethopro-

pazine. In the R line eserine was also the most potent

inhibitor (followed by fenitroxon), but in this case

BW284C51 was a more potent inhibitor than paraoxon.

However, ethopropazine was the least effective here also.

This table also shows that overall for eserine, fenitroxon

and paraoxon, the purified AChE enzyme from the R line

was much less sensitive to inhibition compared to the

AChE from the S line.

Table 3 also shows that the values for inhibition

constants (Ki) of AChE in each of the lines ranged from

4.93 103 to 5.09 107 M1 min1. Here again eserine was

the most potent inhibitor while ethopropazine was the

least. Except for eserine, these inhibitors also showed

higher Ki values for the S line compared to the R line.

3.4. Peptide mass fingerprinting

Peptide mass fingerprinting was used first to confirm that

the enzymes purified from these B. dorsalis lines were

AChEs (Table 4). AChE from the S line is identified as the

normal AChE of this species (AAO06900), and the

peptide products from this line are also compared to the

AChE from the R line (AAO06932). Next, the residuesobtained for the R and S lines were directly compared.

Only the amino acid change corresponding to position

G488 (peptide corresponding to residues #486506) was

found in these experiments despite the fact this experiment

was performed several times using both AChE enzyme in

solution and from slices of polyacrylamide gels for both

lines.

3.5. Quantitation of gene expression

As assessed using the t-test, no significant differences

were detected in terms of the quantities of AChE recovered

as indicated by the indirect-ELISA assay using antibodies

directed against both the susceptible AChE and resistant

AChE (Table 5).

The real-time PCR analysis also shows that the levels of

expression of the ace gene (relative to 18Sexpression levels)

were roughly equivalent in individuals from both the

susceptible and resistant lines (Table 6).

4. Discussion

The development of resistance to organophosphate

based insecticides is a current and growing problem for

the management of many insect pest species of agricultural

ARTICLE IN PRESS

Table 1

Purification ratios of acetylcholinesterase for homogenized extracts (crude) and purified by affinity chromatography from fenitrothion-susceptible ( S) and

-resistant (R) oriental fruit fly linesa

Lines Step Total activity

(mmol/min)

Specific activity

(mmol/min/mg)

Yield (%) Purification factor

(fold)

Resistance ratios

RR CR

S Crude 78.375.17 0.2870.01 100 1 1 1

Purified 16.470.15 4217120 20.9 1504

R Crude 50.471.22 0.1870.01 100 1 416 6.1

Purified 10.271.13 2667111 20.2 1478

The resistance ratio was calculated as the value of the resistant LD50/the susceptible LD50 value for fenitrothion (RR) or methomyl (CR) treatment,

respectively. The susceptible LD50 values for fenitrothion and methomyl are 22.8 and 43.7 ng/fly, respectively.aThe results are presented as the means7SD (n 2).

Table 2

Comparison of the kinetic parameters of AChE purified from S and R lines by hydrolysis of three substratesa

Substrates Lines Vmax (mmol/min/mg) Km (mM) Vmax/Km (ratio) Kcat (min1) Kcat/Km (mM

1 min1)

ATC S 158.575.69 16.574.00 9.62 18 400 1116

R 69.770.95 35.578.43 1.96 8080 228

PTC S 131.274.15 53.4725.2 2.46 15 200 285

R 70.972.43 65.576.21 1.08 8220 126

BTC S 79.671.55 85.777.27 0.93 9230 108

R 45.870.49 129.272.76 0.35 5310 41

aThe results are presented as the means7SD (n 4). The Vmax and Km for these substrates differ significantly between two lines by two factor ANOVA

test (Po0.05) as described in the text (Section 3.2).


7/27/2019 1-s2.0-S096517480700238X-main

6/9

and medical importance, and because of this a wide range

of studies have focused on the elucidation of the molecular

basis of this resistance. For example, our previous study of

insecticide resistance in B. dorsalis (Hsu et al., 2006)

showed that flies exhibiting high levels of resistance to the

organophosphate insecticide fenitrothion carried three

specific mutations in the ace gene of this species (designated

bdace2). Indeed mutations of ace genes have been reported

to be associated with insecticide resistance for a wide range

of dipteran species (Fournier et al., 1992; Mutero et al.,

1994; Vaughan et al., 1997; Vontas et al., 2002). For our

study in particular it was of interest to note that two of the

changes we identified (Hsu et al., 2006) occurred at

positions identical to mutations of the ace gene reported

in a strain of a congeneric species, B. oleae, which also

exhibited insecticide resistance (Vontas et al., 2002).

In addition to the association of mutations with the

acquisition of insecticide resistance it is important to

examine whether such mutations are associated primarily

with either quantitative or qualitative effects on the

production and/or activity of specific enzymes. In B. oleae,

for example, it is clear that the mutations were associated

with reductions of the catalytic efficiency of the AChE

enzyme on the order of 3540% (Vontas et al., 2002).

However, in non-dipteran species such as those in the

Hemiptera (Aphididae) at least three distinct mechanisms

have been associated with the acquisition of resistance.

These include alterations exhibiting both quantitative and

qualitative effects on the structure and function of the

AChE enzyme and on distinct genes involved in sodium

channeling (Margaritopoulos et al., 2007). To investigate

this phenomenon in B. dorsalis, here we purified and

analyzed the biochemical properties of AChE isoenzymes

obtained from both the resistant (R) and susceptible (S)

insects analyzed in our previous study (Hsu et al., 2006).

We also compared the changes we observed with those

reported for B. oleae (Vontas et al., 2002) as well as various

other insect species.

We first used peptide mass fingerprinting to link specific

alterations in the AChE proteins from the two lines to

predictions made from the DNA sequence of the alleles of

the ace gene associated with the R and S phenotypes

described in Hsu et al. (2006). The alteration at position

G488 (found in the R line) was, however, the only one out

ARTICLE IN PRESS

Fig. 2. Effects of five inhibitors (ethopropaxine, BW284C51, eserine, paraoxon and fenitroxon) on activity of AChE from both fenitrothion-susceptible

and -resistant lines at eight concentrations.

Table 3

I50 values and bimolecular rate constants (Ki) for five inhibitors of enzyme activity for AChE from both S and R lines of B. dorsalis

Inhibitor I50 (nM) R/S Ki ( 103 M1 min1) S/R

Susceptible Resistant Susceptible Resistant

Eserine 0.01270.0095 4.4870.38 373 46 00077050 50 90071880 0.90

Fenitroxon 0.04370.037 2507121 5810 314783.8 18378.37 1.72

Paraoxon 49.379.08 61207374 124 26678.33 12276.93 2.09

BW284C51 10407315 9757405 0.94 54.071.31 50.271.49 1.08

Ethopropazine 195 000721 900 215 000797 200 1.10 6.0370.136 4.9770.353 1.21

The R/S ratio was calculated as the value of the resistant I50/the susceptible I50. The S/R ratio was calculated as the value of the susceptible Ki/the

resistant Ki.Significant differences from the susceptible colony by Student t-test (Po0.05).


7/27/2019 1-s2.0-S096517480700238X-main

7/9

of three predicted missense changes in the peptides we

could actually identify. The I214 mutation position may

not be easily identified by the peptide mass fingerprinting

because the MW of trypsin digested peptide fragment

including this mutation is on the order of 6340 Da in the S

line (6326 Da in the R line). Normally, the abundance of

monoisotopic ions above 3000 Da becomes vanishingly low

and difficult to resolve (Yergey et al., 1983). The inability

to detect alterations of peptides corresponding to the third

mutation may be explained by proximity to the end of the

primary translation product. This was also seen in the case

in the AChE purified from Drosophila, and here it was

speculated that mutations occurring near the end of a gene

might place them beyond the C-terminal amino-acid of the

mature protein (Mutero and Fournier, 1991) remaining

after posttranslational processing. Further investigations

may show that similar phenomena may apply to the AChE

protein from the oriental fruit fly.

ARTICLE IN PRESS

Table 4

Peptide mass fingerprint results

Residues nos. Measured mass (Da) Calculated mass (Da) Error (ppm) Sequence

AChE from the susceptible line match details:

400407 966.454 966.438 16 MMETADLR

408417 1137.59 1137.57 15 GYDILMGNVR

443455 1584.88 1584.81 44 KYLEIMNNIFGK

462467 748.433 748.435 3.6 EAIIFR

468485 2021.02 2020.99 15 HTSWVGNPGLENQQQIGR

486506 2397.17 2397.09 30 AVGDHFFTCPTNEYAQALAER

507518 1500.73 1500.70 18 GASVHYYYFTHR

561570 1135.63 1135.62 7.2 MLNAVIEFAK

571586 1763.83 1763.79 22 TGNPATDGEEWPNFTK

588602 1834.86 1834.84 14 DPVYYVFSTDDKEEK

612620 1258.59 1258.57 14 CAFWNEYLR

625642 2021.03 2020.98 24 WGSQCELKPSSASSLQQK

AChE from the fenitrothion-resistant line match details:

5059 1142.66 1142.55 97 MSSVYGVIDR

6070 1142.66 1142.65 7.9 LVVQTSSGPVR

101116 1772.97 1772.94 12 KPVPAEPWHGVLDATR

400407 966.507 966.438 71 MMETADLR408417 1137.60 1137.57 23 GYDILMGNVR

418442 3033.36 3033.40 13 DEGTYFLLYDFIDYFDKDEATSLPR

462467 748.480 748.435 60 EAIIFR

468485 2021.02 2021.00 11 HTSWVGNPGLENQQQIGR

486506 2427.12 2427.10 7 AVSDHFFTCPTNEYAQALAER

507518 1500.73 1500.70 16 GASVHYYYFTHR

560570 1307.70 1307.71 7.9 RMLNAVIEFAK

571586 1763.82 1763.79 17 TGNPATDGEEWPNFTK

587602 1962.96 1962.93 13 KDPVYYVFSTDDKEEK

588502 1834.98 1834.84 79 DPVYYVFSTDDKEEK

606611 628.380 628.341 61 GPLEGR

612620 1258.59 1258.57 15 CAFWNEYLR

625642 2021.02 2020.98 20 WGSQCELKPSSASSLQQK

Indicates residue changes noted between the peptides from the two different lines.

Table 6

Real-time PCR results showing levels of expression of the ace and

ribosomal 18S genes in the fenitrothion-susceptible (S) and -resistant (R)

lines

Lines Ace (Ct) 18S (Ct) Ratioa of ace/18S

S 24.4970.84 15.1071.20 0.0017570.00101

R 25.4170.76 16.1371.52 0.0017770.000847

Ct refers to the threshold cycle. The ratio is used to show the relative

quantification of expression of the target gene (ace) in comparison to the

reference gene (18S) (Pfaffl, 2001).aRatio 2[Ctace-Ct18S].

Table 5

Quantifying the AChE from the S and R lines by the indirect-ELISA

methoda

Lines AChE activity

(mmol/min/mg)

The absorbance value in OD405(mean7SD, n 6)

Anti-susceptible

AChE

Anti-resistant

AChE

S 0.26970.071 0.9770.12 0.8570.23

R 0.12170.022 0.8870.12 0.7970.22

Significant differences from the susceptible colony by Student t-test

(Po0.05).aThe alkaline phosphatase activities were detected spectrophotometri-

cally at 405 nm, and the absorbance values for this wavelength (OD405)

were used to calculate the quantity of AChE.


7/27/2019 1-s2.0-S096517480700238X-main

8/9

In terms of activity, we found that the purified AChE

enzyme from the R line of B. dorsalis exhibited approxi-

mately one half the level of activity compared to the Sline.

This lower level of activity agreed with our previous

findings obtained from crude preparations of AChE in

these same flies (Hsu et al., 2006). This reduction in activity

of purified AChE from resistant individuals is also similarto results seen in studies of resistance in the Colorado

potato beetle (Zhu and Clark, 1995b). However, in studies

of organophosphate-resistance for insects such as the green

rice leafhopper (Hama, 1983, 1984) and lesser grain borer

(Guedes et al., 1998) no similar reductions were seen.

In terms of hydrolyzing efficiencies (Vmax), the overall

range of values obtained for the purified AChE from both

lines were similar to those observed from studies of

Drosophila (Gnagey et al., 1987) and other insect species

such as the Colorado potato beetle, lesser grain borer,

Western corn rootworm and greenbug (Zhu and Clark,

1994; Guedes et al., 1998; Gao et al., 1998; Gao and Zhu,

2001). However, between the S and R lines of B. dorsalis

examined here, the purified AChEs had different kinetic

characteristics. For the R line the enzyme activity, Vmax/Kmratio, turnover number (Kcat) and substrate specificity

constant (Kcat/Km) of AChE for the substrates, ATC, PTC,

and BTC were nearly two-fold lower compared to that

from the S line (Table 2). This is consistent with the

hypothesis that a modification of the enzyme catalytic site

is present in the enzyme from the resistant flies.

Purified AChE from the two lines examined here also

differed in terms of inhibition by various compounds

(as measured using I50 values). The R line was insensitive to

inhibition even under high concentrations of paraoxon orfenitroxon (105107 M), and was also 1245810-fold

more insensitive to inhibition by eserine, paraoxon and

fenitroxon, respectively, compared to the Sline. This range

of effects using different inhibitors is to some extent also

consistent with cross resistance to other organophosphate

insecticides seen previously in B. dorsalis (Hsu et al., 2004).

However, AChE from the R line showed only slight

differences in inhibition by BW284C51 or ethopropazine

compared to AChE from the S line. The BW284C51

compound is considered to be a very specific inhibitor of

AChE (Felder et al., 2002), and it is curious why our results

do not show a greater difference in inhibitory effects

between the two lines. One possible explanation for this is

the fact that although one of the sites affected here (I214V)

interacts with the key anionic site residue W121

(in Torpedo californica; position 138 in B. dorsalis) (Harel

et al., 2000; Hsu et al., 2006), Felder et al. (2002) showed

that in T. californica, BW284C51 binds only weakly to this

particular site. Because of the weak binding, any altering of

the interactions between the I214V and W121 sites may

simply be limited in effect.

Finally, using anti-AChE polyclonal antibodies we also

showed that there were no quantitative differences in the

amount of enzyme present in extracts from the R and S

lines. Real-time PCR was also used to measure the levels of

RNA expression of the different alleles of the ace gene

(relative to the 18S gene), and here again no significant

differences were detected between the two lines.

Overall, these findings strongly indicate that the qualitative

alteration of the structure and function of the AChE

enzyme appears to be the major cause for the observed

resistance of B. dorsalis to fenitrothion. No evidence ofquantitative effects on expression of the ace gene or

the amount of enzyme produced between the R and S lines

that would explain the phenotypes observed was obtained

here.

The conclusion that the resistance phenomenon observed

in B. dorsalis results from qualitative effects on the AChE

enzyme is entirely consistent with the results seen for

B. oleae (Vontas et al., 2002). For both of these species,

point mutations at two identical positions in the ace gene

producing predicted amino acid substitutions in the AChE

enzyme were detected, and in both cases significant

reductions in the catalytic efficiency of the enzyme and

decreased sensitivity to inhibition were observed in

association with resistance. As described in the paper by

Vontas et al. (2002) one of these alterations, specifically the

I214V mutation, appears to be located within the active site

of enzyme, and this certainly would be expected to have a

dramatic impact on enzyme activity for both species.

Alteration of this site may also result in decreased

deacetylation activity, and this could affect the sensitivity

of the enzyme to various carbamate based insecticides

(Harel et al., 2000; Villatte et al., 2000; Shi et al., 2004).

In addition to these qualitative effects, we also showed

that at least for the B. dorsalis lines analyzed here, these

mutations did not appear to be associated with anyquantitative alterations in the level of gene expression. It

remains to be seen whether these kinds of effects on gene

expression or alterations of distinct genes, such as that seen

in the Aphididae (Margaritopoulos et al., 2007), apply to

the case of resistance phenomena in these or other fruit fly

species.

Acknowledgments

The authors wish to acknowledge the helpful comments

and corrections on an earlier version of this manuscript

made by Dr. J.G. Vontas and the suggestions for signi-ficant improvements made by two anonymous reviewers.

We also wish to thank Y.-C. Chen for assistance with the

bioassays and G.-S. Lin for his assistance with the real-time

PCR assay. We also appreciate Dr. C.-C. Lo for access to

the real-time PCR equipment. This research was supported

by the Council of Agriculture, Executive Yuan, and

National Science Council (NSC 95-2313-B-001), Taiwan.

References

Ellman, G.L., Courtney, K.D., Andres Jr., V., Featherstone, R.M., 1961.

A new and rapid colorimetric determination of acetylcholinesterase

activity. Biochem. Pharmacol. 7, 8896.

ARTICLE IN PRESS


7/27/2019 1-s2.0-S096517480700238X-main

9/9

Felder, C.E., Harel, M., Silman, I., Sussman, J.L., 2002. Structure of a

complex of the potent and specific inhibitor BW284C51 with Torpedo

californica acetylcholinesterase. Acta Cryst. D 58, 17651771.

Fournier, D., Bride, J.M., Hoffman, F., Karch, F., 1992. Acetylcholines-

terase: two types of modifications confer resistance to insecticides.

J. Biol. Chem. 267, 1427014274.

Gao, J.R., Zhu, K.Y., 2001. An acetylcholinesterase purified from the

greenbug (Schizaphis graminum) with some unique enzymological andpharmacological characteristics. Insect Biochem. Mol. Biol. 31,

10951104.

Gao, J.R., Rao, J.V., Wilde, G.E., Zhu, K.Y., 1998. Purification and

kinetic analysis of acetylcholinesterase from Western corn rootworm,

Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae). Arch.

Insect Biochem. Physiol. 39, 118125.

Gnagey, A.L., Forte, M., Rosenberry, T.L., 1987. Isolation and

characterization of acetylcholinesterase from Drosophila. J. Biol.

Chem. 262, 1329013298.

Guedes, R.N., Zhu, K.Y., Kambhampati, S., Dover, B.A., 1998.

Characterization of acetylcholinesterase purified from the lesser grain

borer, Rhyzopertha dominica (Coleoptera: Bostrichidae). Comp.

Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 119, 205210.

Hama, H., 1983. Resistance to insecticides due to reduced sensitivity of

acetylcholinesterase. In: Georghiou, P.G., Saito, T. (Eds.), PestResistance to Pesticides. Plenum Press, New York, pp. 146.

Hama, H., 1984. Mechanism of fenitrothion-resistance and diazinon-

resistance in the green rice leafhopper, Nephotettix cincticeps Uhler

(Hemiptera, Deltocephalidae)the role of aliesterase. Jpn. J. Appl.

Entomol. Zool. 28, 143149.

Harel, M., Kryger, G., Rosenberry, T.L., Mallender, W.D., Lewis, T.,

Fletcher, R.J., Guss, J.M., Silman, I., Sussman, J.L., 2000. Three-

dimensional structures ofDrosophila melanogaster acetylcholinesterase

and of its complexes with two potent inhibitors. Prot. Sci. 9,

10631072.

Hawkes, N.J., Janes, R.W., Hemingway, J., Vontas, J., 2005. Detection of

resistance-associated point mutations of organophosphate-insensitive

acetylcholinesterase in the olive fruit fly, Bactrocera oleae (Gmelin).

Pestic. Biochem. Physiol. 81, 154163.

Hsiao, Y.-M., Lai, J.-Y., Liao, H.-Y., Feng, H.-T., 2004. Purification andcharacterization of acetylcholinesterase from oriental fruit fly

(Bactrocera dorsalis (Hendel)) (Diptera: Tephritidae). J. Agric. Food

Chem. 52, 53405346.

Hsu, J.-C., Feng, H.-T., 2000. Insecticide susceptibility of the oriental fruit

fly (Bactrocera dorsalis (Hendel)) (Diptera: Tephritidae) in Taiwan.

Chinese J. Entomol. 20, 109118.

Hsu, J.-C., Feng, H.-T., 2002. Susceptibility of melon fly (Bactrocera

cucurbitae) and oriental fruit fly (B. dorsalis) to insecticides in Taiwan.

Plant Prot. Bull. 44, 303314 (in Chinese, with English abstract).

Hsu, J.-C., Feng, H.-T., Wu, W.-J., 2004. Resistance and synergistic

effects of insecticides in Bactrocera dorsalis (Diptera: Tephritidae) in

Taiwan. J. Econ. Entomol. 97, 16821688.

Hsu, J.-C., Haymer, D.S., Wu, W.-J., Feng, H.-T., 2006. Mutations in the

acetylcholinesterase gene of Bactrocera dorsalis associated with

resistance to organophosphorus insecticides. Insect Biochem. Mol.Biol. 36, 396402.

Konno, Y., Shishido, T., 1989. Binding-protein, a factor of fenitrooxon

detoxication in OP-resistant rice stem borers. J. Pestic. Sci. 14,

359362.

Kotze, A.C., Walkbank, B.E., 1996. Esterase and monooxygenase

activities in organophosphate-resistant strains of Oryzaephilus surina-

mensts (Coleoptera, Cucujidae). J. Econ. Entomol. 89, 571576.

Kozaki, T., Shono, T., Tomita, T., Kono, Y., 2001. Fenitroxon insensitive

acetylcholinesterases of the housefly, Musca domestica associated with

point mutations. Insect Biochem. Mol. Biol. 31, 991997.

Main, A.R., Iverson, F., 1966. Measurement of the affinity and

phosphorylation constants governing irreversible inhibition of choli-

nesterases by di-isopropyl phosphorofluoridate. Biochem. J. 100,

525531.

Margaritopoulos, J.T., Skouras, P.J., Nikolaidou, P., Manolikaki, J.,

Maritsa, K., Tsamandani, K., Kanavaki, O.M., Bacandritsos, N.,

Zarpas, K.D., Tsitsipis, J.A., 2007. Insecticide resistance status of

Myzus persicae (Hemiptera: Aphididae) populations from peach and

tobacco in mainland Greece. Pest Manage. Sci. 63, 821829.

Mutero, A., Fournier, D., 1991. Drosophila acetylcholinesterase structure.In: Massouile, J., Bacou, F., Bacou, E., Chatonnet, A., Doctor, B.P.,

Quinn, D.M. (Eds.), Cholinesterases: Structure, Function, Mechanism,

Genetics, and Cell Biology. American Chemical Society Publishers,

Washington, pp. 141145.

Mutero, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistance-

associated point mutations in insecticide-insensitive acetylcholinester-

ase. Proc. Natl. Acad. Sci. USA 91, 59225926.

Nishizawa, Y., Fujii, K., Kadota, T., Miyamoto, J., Sakamoto, H., 1961.

Studies on organophosphorus insecticides part VII. Chemical and

biological properties of new low toxic organophosphorus insecticide,

O, O-dimiethyl-O-(3-methyl-4-nitrophenyl) phosphorothioate. Agric.

Biol. Chem. 25, 605610.

Oppenoorth, F.J., Welling, W., 1979. Biochemistry and physiology of

resistance. In: Wilkinson, C.F. (Ed.), Insecticide Biochemistry and

Physiology, second ed. Plenum Press, New York, pp. 507551.Pfaffl, M.W., 2001. A new mathematical model for relative quantification

in real-time RT-PCR. Nucleic Acids Res. 29, e45.

Shi, M.A., Lougarre, A., Alies, C., Fremaux, I., Tang, Z.H., Stojan, J.,

Fournier, D., 2004. Acetylcholinesterase alterations reveal the fitness

cost of mutations conferring insecticide resistance. BMC Evol. Biol. 4,

5.

Vaughan, A., Rocheleau, T., Ffrench-Constant, R., 1997. Site-directed

mutagenesis of an acetylcholinesterase gene from the yellow fever

mosquito Aedes aegypticonfers insecticide insensitivity. Exp. Parasitol.

87, 237244.

Villatte, F., Ziliani, P., Marcel, V., Menozzi, P., Fournier, D.,

2000. A high number of mutations in insect acetylcholinesterase

may provide insecticide resistance. Pestic. Biochem. Physiol. 67,

95102.

Vontas, J.G., Hejazi, M.J., Hawkes, N.J., Cosmidis, N., Loukas, M.,Hemingway, J., 2002. Resistance-associated point mutations of

organophosphate insensitive acetylcholinesterase, in the olive fruit fly

Bactrocera oleae. Insect Mol. Biol. 11, 329336.

Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A.,

Marguine, M., Raymond, M., 2004. The unique mutation in ace-1

giving high insecticide resistance is easily detectable in mosquito

vectors. Insect Mol. Biol. 13, 17.

Yeh, S.D., Gonsalves, D., 1984. Purification and immunological analyses

of cylindrical-inclusion protein induced by papaya ringspot virus and

watermelon mosaic virus 1. Phytopathology 74, 12731278.

Yergey, J., Heller, D., Hansen, G., Cotter, R.J., Fenselau, C., 1983.

Isotopic distributions in mass spectra of large molecules. Anal. Chem.

55, 353356.

Zhu, K.Y., Brindley, W.A., 1992. Catalytic and inhibitory properties of a

major molecular form of acetylcholinesterase isolated from Lygushesperus Knight (Hemiptera: Miridae). Comp. Biochem. Physiol. 103B,

147151.

Zhu, K.Y., Clark, J.M., 1994. Purification and characterization of

acetylcholinesterase from the Colorado potato beetle, Leptinotarsa

decemlineata (Say). Insect Biochem. Mol. Biol. 24, 453461.

Zhu, K.Y., Clark, J.M., 1995a. Cloning and sequencing of a cDNA

encoding acetylcholinesterase in Colorado potato beetle, Leptinotarsa

decemlineata (Say). Insect Biochem. Mol. Biol. 25, 11291138.

Zhu, K.Y., Clark, J.M., 1995b. Comparisons of kinetic properties of

acetylcholinesterase purified from azinphosmethyl-susceptible and

resistant strains of Colorado potato beetle. Pestic. Biochem. Physiol.

51, 5767.

ARTICLE IN PRESS


1-s2.0-S096517480700238X-main

Documents

Transcript of 1-s2.0-S096517480700238X-main