1

Nonsense Mutations in Close Proximity to the Initiation Codon

Fail to Trigger Full Nonsense-Mediated mRNA Decay

Ângela Inácio1, Ana Luísa Silva1, Joana Pinto1, Xinjun Ji2, Ana Morgado1, Fátima

Almeida1, Paula Faustino1, João Lavinha1, Stephen A. Liebhaber2 and Luísa Romão1,*

1Centro de Genética Humana, Instituto Nacional de Saúde Dr. Ricardo Jorge (INSA),

Av. Padre Cruz, 1649-016 Lisboa, PORTUGAL, and 2Departments of Genetics and

Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA

* Corresponding author

Mailing address: Centro de Genética Humana, Instituto Nacional de Saúde Dr. Ricardo Jorge,

Av. Padre Cruz, 1649-016 LISBOA, PORTUGAL

Phone number: (+351) 21 751 9234

FAX number: (+351) 21 752 6410

E-mail: luisa.romao@insa.min-saude.pt

JBC Papers in Press. Published on May 25, 2004 as Manuscript M405024200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

2

Running title:

Proximity of nonsense codon to AUG inhibits NMD

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

SUMMARY

Nonsense-mediated mRNA decay (NMD) is a surveillance mechanism that degrades

mRNAs containing premature translation termination codons. In mammalian cells, a

termination codon is ordinarily recognized as ‘premature’ if it is located greater than 50-54

nucleotides 5’ to the final exon-exon junction. We have described a set of naturally occurring

human β-globin gene mutations that apparently contradict this rule. The corresponding β-

thalassemia genes contain nonsense mutations within exon 1 and yet their encoded mRNAs

accumulate to levels approaching wild-type β-globin (βWT) mRNA. In the present report we

demonstrate that the stabilities of these mRNAs with nonsense mutations in exon 1 are

intermediate between βWT mRNA and β-globin mRNA carrying a prototype NMD-sensitive

mutation in exon 2 (codon 39 nonsense; β39). Functional analyses of these mRNAs with 5’-

proximal nonsense mutations demonstrate that their relative resistance to NMD does not

reflect abnormal RNA splicing or translation re-initiation and is independent of promoter

identity and erythroid specificity. Instead, the proximity of the nonsense codon to the

translation initiation AUG constitutes a major determinant of NMD; positioning a

termination mutation at the 5’-terminus of the coding region blunts mRNA destabilization and

this effect is dominant to the “50-54 nt boundary rule”. These observations impact on current

models of NMD.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

INTRODUCTION

Nonsense-mediated mRNA decay (NMD) is an mRNA surveillance mechanism that

rapidly degrades mRNAs carrying premature translation termination codons (1). Nonsense-

containing mRNAs targeted by NMD can be generated by naturally-occurring frameshift and

nonsense mutations, splicing errors, leaky 40S scanning, and by utilization of minor AUG

initiation sites (2, 3). A major function of the NMD pathway is to block the synthesis of

truncated proteins that could have dominant negative effects on cell function (2, 4).

Recent studies have shown that the NMD pathway in mammalian cells is linked to

splicing-dependent deposition of a protein complex 20-24 nucleotides (nt) 5’ of each exon-

exon junction (exon-junction complex; EJC). The EJC contains the general splicing activator

RNPS1, the RNA export factor Aly/REF, the shuttling protein Y14, the nuclear matrix-

localized serine-arginine-containing protein SRm160, the oncoprotein DEK, and the Y14

binding protein magoh. The interaction of magoh with Y14 may have a role in cytoplasmic

localization of mRNAs and in anchoring the NMD-specific factors Upf3 and Upf2 to the

mRNA (5-18). Previous published data have shown that Upf3 and Upf2 join the EJC in

different subcellular compartments: Upf3 (Upf3a and Upf3b) is loaded onto mRNAs in the

nucleus during splicing via interactions with components of the EJC. In contrast, Upf2 joins

the complex soon after cytoplasmic export is initiated (14, 19, 20). According to present

models, translating ribosomes displace EJCs from the open reading frame (ORF) during the

‘pioneer’ round of cytoplasmic translation (21). If, however, the mRNA contains a premature

termination codon located more than 50-54 nt 5’ of at least one EJC, complex components 3’

to the termination mutation will remain on the mRNA. The retention of one or more EJCs on

the mRNA trigger the NMD response by an as yet undefined mechanism. According to

current models, recognition of the nonsense codon as ‘premature’ involves a direct interaction

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

of the phosphorylated Upf1 RNA helicase with EJC-bound Upf2 (20, 22, 23). Interactions

between Upf1 and other Upf factors may also be involved in this process (14, 19, 20, 23-26).

The interactions of the translation termination factors eRF1 and eRF3 with Upf1 and of eRF3

with Upf2 and Upf3 appear to provide a mechanistic link between NMD and translation

termination at the premature stop codon (reviewed in reference 1, 27).

Studies supporting the ”50-54 nt boundary rule” suggest that an exon-exon junction

serves as the major cis-acting NMD-regulatory element (28-30). While EJC regulated NMD

is supported by multiple lines of evidence, exceptions to the “50-54 nt boundary rule” have

been reported. These exceptions suggest that additional determinants may be involved in

determining the net stability of nonsense-containing mRNAs. For example, nonsense codons

positioned close to the initiation AUG of the TPI, immunoglobulin µ heavy chain, and

BRCA1 mRNAs, fail to specify NMD (31-33). For the TPI and immunoglobulin µ heavy

chain mRNAs, NMD appears to be circumvented by re-initiation of translation 3’ to the

nonsense codon. This mechanism of NMD-avoidance has also been speculated for nonsense

codons located early in the BRCA-1 transcript (33). Such re-initiation would allow the

ribosome to disrupt EJCs located 3’ to the nonsense mutation (31, 32). Nonsense codons in

the T-cell receptor (TCR)-β transcript also fail to elicit canonical NMD; nonsense codons

located more 5’ in the mRNA trigger robust NMD while nonsense codons closer to the

terminal exon-exon junction induce a much weaker NMD response (34). Finally, premature

termination codons located in different exons of the fibrinogen Aα-chain gene or at exon 2 of

the human ALG3 gene can avoid NMD (35, 36). The basis for NMD-avoidance by the

fibrinogen Aα-chain and ALG3 mRNAs remain undefined. Thus present evidence indicates

that determinants of NMD, at least in some systems, are more complex than would be

predicted on the basis of the single ”50-54 nt boundary rule”.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

We have previously reported that human β-globin mRNAs containing naturally-

occuring nonsense mutations in the 5’-part of exon 1 accumulate to levels similar to those of

normal β-globin transcripts (37). The aim of the present study is to investigate the mechanism

by which these mutant β-globin transcripts circumvent the full impact of NMD. Our results

reveal that this unusual NMD-behaviour reflects the proximity of the nonsense mutations to

the AUG initiation codon. Remarkably, the impact of this 5’ localization is dominant to the

“50-54 nt boundary rule”.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

EXPERIMENTAL PROCEDURES

Plasmid constructs. The plasmids containing the normal (βWT), β15 [CD 15

(TGG→TGA)] or β39 [CD 39 (C→T)] human β-globin genes were previously described

(37). All variants were created within the 428 bp Nco I-Bam HI fragment of the β-globin gene

template by overlap-extension PCR (37). PCR reactions were performed by using Life

Technologies primers (Barcelona, Spain; see Table I). To create variants carrying DelA

(deletion of 69 bp between codons 3 to 27, exclusively), the PCR reaction # 1 was performed

by using L5’β-S and DelA-AS primers, and DNA template from the previously cloned βWT

gene. PCR reaction # 2 was performed by using DelA-S and R5’β-AS primers and the βWT or

�39 genes as template. To clone variant βWTseqhet and β39seqhet constructs, which contain a

different sequence between codons 3 and 27, from the second exon of the human α2 globin

gene (from codon 34 through codon 56), PCR reaction # 1 was performed by using Seqhet-S

and Seqhet-AS primers, and the hα2-globin gene as DNA template (pTet-Wt detailed in

reference 38). PCR reaction # 2 was performed by using 3’exon1-S and 3’exon2-AS primers

and the βWT or β39 gene DNAs. To obtain β62 and β62DelA variants carrying the nonsense

mutation (GCT→TAG) at codon position 62, PCR reaction # 1 was performed with ATG-S

and 62-AS primers and the previously cloned βWT or DelA gene DNAs. PCR reaction # 2 was

performed with 62-S and 3’exon2-AS primers and the βWT gene as DNA template. To clone

the double nonsense mutated gene β15nonβ39, carrying both nonsense mutations at codons

15 and 39, PCR reaction # 1 was performed by using L5’β-S and 15non39-AS primers and

the β39 gene DNA. PCR reaction # 2 was performed by using 15non39-S and R5’β-AS

primers and the same DNA template. To obtain the constructs βWT-CD55-63/64-73/74, β15-

CD55-63/64-73/74, β39-CD55-63/64-73/74, and β39DelA-CD55-63/64-73/74, the three

different mutations were introduced sequentially and the βWT-CD55, β15-CD55, β39-CD55

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

and β39DelA-CD55 genes [βWT, β15, β39, or β39DelA genes carrying a missense mutation

that converts Met to Ile (AUG�AUA) at codon 55] were created first. Thus, PCR reaction #

1 was performed by using the L5’β-S and 55-AS primers, and the βWT, β15, β39, or β39DelA

gene DNAs. PCR reaction # 2 was performed by using the 55-S and the R5’β-AS primers and

the βWT DNA template. To create the βWT-CD55-73/74, β15-CD55-73/74, β39-CD55-73/74

and β39DelA-CD55-73/74 constructs [correspond to the βWT-CD55, β15-CD55, β39-CD55 or

β39DelA-CD55 human β-globin genes carrying an additional missense mutation that converts

the out-of-frame Met to Thr (AUG�ACG) at position 73/74] PCR reaction # 1 was

performed by using the L5’β-S and 73/74-AS primers, and the βWT-CD55, β15-CD55, β39-

CD55, or β39DelA-CD55 genes as DNA template. PCR reaction # 2 was performed by using

the 73/74-S and the R5’β-AS primers and the βWT DNA template. In all cases, PCR reaction #

3 was performed using a mix of PCR reactions # 1 and # 2 and primers sense from PCR

reaction # 1 and antissense from PCR reaction # 2. The obtained PCR products were digested

with Nco I-Bam HI and replaced into the plasmid containing the cloned normal human β-

globin gene previously digested with the same enzymes. The mutation at position 63/64

(ATG�ACG) was introduced into the genes βWT-CD55-73/74, β15-CD55-73/74, β39-CD55-

73/74, and β39DelA-CD55-73/74 by using the QuickChangeTM site-directed mutagenesis kit

as indicated by the manufacturers (Stratagene, Amesterdam, The Netherlands). Reactions

were performed with the 63/64-S and 63/64-AS mutagenic primers and the DNA template

from βWT-CD55-73/74, β15-CD55-73/74 β39-CD55-73/74 and β39DelA-CD55-73/74

plasmids. The correct Nco I-Bam HI globin gene fragment containing all mutations was

employed to substitute the original non-mutated Nco I-Bam HI fragment present in the native

gene of the p158.2 expression vector (37). To obtain plasmids used to transiently transfect

HeLa cells, a human �-globin gene fragment extending from the transcription initiation site to

200 bp 3’ to the polyadenylation site was amplified by PCR from the p158.2 plasmid, using

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

LinkClaI-S and LinkNotI-AS primers (Table I). The 1806 bp Cla I - Not I human β-globin

fragment was sub-cloned into pTet2 plasmid, creating the pTet2-βWT plasmid [pTet2 plasmid

is derived from pTet-Splice vector (Life Technologies) by deleting a 126 bp fragment

upstream the Cla I site; the deletion was introduced by substituting the native 500 bp Xho

I/Cla I fragment by the 374 bp DNA fragment that was amplified using pTetXhoI1/15-S and

pTetClaI351/370-AS primers (Table I)]. The human β-globin variants β15, β17, β39, β62,

DelA, β39DelA, β62DelA, βWTseqhet, β39seqhet, or β15nonβ39 were cloned into the pTet2-

βWT vector previously obtained, by substituting normal Nco I-Bam HI fragment for the

corresponding mutated fragment, which had been previously cloned into the p158.2 vector

(see above). To obtain genes βWT(15:39) and β15(15:39) which present the original codon 15

at position 39, initially the restriction sites Hind III-Apa I were introduced between codons 14

and 15 into the Nco I-Bam HI fragment of the βWT and β15 genes, using the QuickChangeTM

site-directed mutagenesis kit as before. Reactions were performed with the following

mutagenic primers: WT15:39-S and WT15:39-AS (for βWT) or 15:39-S and 15:39-AS (for

β15) (Table I). After to obtain the correct mutagenized βWT and β15 clones, a 60 bp DNA

sequence of the ampicillin resistance gene (Ampr; 5’-

TACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAG

AACGT-3’) was introduced in both clones (βWT and β15) between Hind III/Apa I sites. The

sequence was previously obtained by PCR using HindIIIAmpr-S and ApaIAmpr-AS primers

(Table I), using the pGEM-3 plasmid (Promega) as DNA template. The cloned Nco I-Bam HI

quimeric fragments were transferred to the pTet2-βWT vector by substituting the normal Nco

I-Bam HI fragment. As the introduced DNA Ampr spacer revealed to contain one splicing

donor site with high consensus value (sequence CGGTAAGA), an additional mutagenesis

(T�A) was performed in order to inhibit the alternative splicing. The mutagenesis was

carried out in both constructs βWT(15:39) and β15(15:39), with the QuickChangeTM site-

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

directed mutagenesis kit using the GA-S and GA-AS oligonucleotides (Table I). The pTet

plasmid containing the human α-globin gene (pTet-�wt) used as a control for transient

transfection efficiency was previously described (39).

Cell culture and transfections. Mouse erythroleukemia (MEL) cells were cultured in

RPMI medium with glutamax-1 (Invitrogen), supplemented with 10% fetal bovine serum.

Stable transfections were carried out with 40 µg of linearized plasmid DNA mixed with 2 µg

of linearized pGKpuro (plasmid containing the puromicin resistance gene). Electroporations

were performed using 3x107 cells per transfection, as previously described (37). Each

electroporated cell pool was expanded in selective medium during approximately 10-12 days,

by adding puromicin (Invitrogen) to 2.5 µg/mL. Erythroid cell differentiation was induced by

adding 2% (v/v) DMSO to the media of each transfection cell pool. Following five days, cell

pools were harvested for RNA extraction. MEL cells stably expressing the tet transactivator

(MEL/tTA; described in reference 39) were used for conditional expression of hβ-globin

genes (previously cloned into the pTet vector). For transient transfections, MEL/tTA cells

were split 1 day before transfection and cultured in minimal essential medium (MEM)

supplemented with 10% fetal bovine serum, and 100ng/ml tetracycline. Cells were washed

three times in cold Dulbecco phosphate-buffered saline (PBS) and ressuspended in cold

serum-free minimal essential medium at a concentration of 3 x 10 7 cells per ml. Two

micrograms of pTet2-βWT or each pTet2-β variant were added to the cell suspension and

mixed thoroughly. Electroporation was performed at 250 V, 1.180�F, and low resistance in a

BRL Cell-Porator system. For steady state mRNA quantification, cells were harvest after 12

hours transcription pulse. For mRNA stability analysis, cells were split into four 60 mm

diameter dishes. Cells were pulsed with β-globin mRNA for 12 hours by growth in Tet-

media. Following this period, transcription from the plasmid was then blocked by the addition

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

of Tet to the media. Cells from each culture dish were harvest in different time points for

further analysis.

The adherent HeLa cells, stably expressing the tet transactivator (HeLa/tTA; described

in reference 39), were grown in Dulbecco’s modified Eagle’s medium (DMEM)

supplemented with 10% fetal bovine serum. Transient co-transfections were performed with

the pTet-�wt (to control for transfection efficiency) and the appropriate pTet2-β plasmid,

using Lipofectin - Plus Reagent (Invitrogen), following the manufacturer’s instructions, using

1x105 cells per transfection and one microgram of each plasmid. Cells were harvest after one

day transcription pulse.

RNA isolation. Total RNA from transfected cells was prepared using the RNeasy total

kit (Qiagen) following the manufacturer’s instructions. Before analysis, RNA samples were

treated with RNase-free DNAse I (Ambion) and purified by phenol:chloroform extraction.

Primer extension analysis. Primer extension assays were performed using 5’end-

labeled primers: Hβexon3-AS or Hβ3’UTR-AS and Mα-AS (Table I). Both primers were

mixed, hybridized with 10 µg of MEL RNA at 50ºC during 5 hours, and extended with

reverse transcriptase Superscript II (Invitrogen), as described previously (37). Primer

extension products were analyzed by PhosphorImaging, using a Typhoon® Imager 8600

(Molecular Dynamics) with a 6 hours exposure period. One, ten, and fifteen micrograms of

RNA extracted from cells transfected with the normal β-globin gene were also transcribed to

show that the experiment was carried out in the presence of primer in excess. The intensity of

each band was quantified using the Image Master Phoretix® Software (Amersham Pharmacia

Biotech).

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

Ribonuclease protection assays. Probes used were generated by in vitro transcription

of plasmids containing DNA fragments from hβ-globin, hα-globin (40), mα-globin (40), or

mGAPDH (Ambion). The hβ-globin probe is a 170 bp fragment encompassing last 20 bp of

intron 2, the entire exon 3 coding region, and first 21 bp of 3’UTR, which was generated by

PCR and inserted into the polylinker region of pGEM3. Amplification primers contained

restriction sites which facilitated insertion into the vector polylinker. To generate RNA

probes, each transcription vector was linearized and transcribed in the presence of α[32P]CTP

(400 ci/mmol, 10 mCi/ml; Amersham Pharmacia Biotech) using a Maxiscript SP6 kit, under

conditions recommended by the manufacturer (Ambion). Final concentration of ATP, GTP

and UTP were 0.5 mM, and that of CTP was 0.06 mM. One microgram of RNA was added to

20 µl of hybridization buffer (40 mM piperazine-N,N´-bis(2-ethanesulfonic acid) (pH 6.4), 1

mM EDTA (pH 8.0), 0.4 M NaCl, 80% formamide) supplemented with probes. Samples were

heated at 80ºC for 10 min, incubated overnight at 50ºC, and digested for 15 min at room

temperature in 200 µl of RNase assay buffer (300 mM NaCl, 10 mM Tris-HCl pH 7.5, 5 mM

EDTA pH 8.0) containing 1 µl of RNase cocktail (500 mg of RNAse A/ml, 20.000 U of

RNase T1/ml; Ambion). Digestions were terminated by addition of 18 µl of an SDS-protease

K (10%:2mg/ml) mixture to each sample followed by incubation 20 min at 37ºC. RNA was

extracted, precipitated, dissolved in loading buffer, and resolved onto a 6 or 8 % acrylamide 8

M urea gel. Radioactivity in bands of interest was quantified by PhosphorImaging, using a

Typhoon® Imager 8600 (Molecular Dynamics).

RT-PCR analysis. Two micrograms of each total RNA sample were mixed with 2

pmoles of Hβ3’RNA-AS primer (Table I). The mixture was heated to 70ºC for 10 min and

quick chilled on ice. Four micriliters of 5X first strand Buffer (Invitrogen), 2 µl of 0.1 M DTT

(Invitrogen), 1 µl of 25 mM dNTP mix (25 mM each dATP, dGTP, dCTP and dTTP) and 0.1

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

µl of Ribonuclease Inhibitor (Invitrogen) were added per sample. The contents were mixed

and reverse transcribed with 200 U of SuperscriptII (Invitrogen) at 42ºC for 2 min. Five µl

aliquots of cDNA product were PCR amplified in a 50 µl reaction volume, using 0.3 µl (1.5

U) of Amplitaq DNA polymerase (Applied Biosystems) for 30 cycles at 95 º C for 1 min, 54 º

C for 1 min, and 72º C for 2 min, with a final extension at 72ºC for 10 min. Reaction mixture

contents were: 37.3 µl of water, 5 µl of 10X buffer (15 mM MgCl2) (Applied Biossystems),

0.4 µl dNTP Mix (25 mM each dATP, dGTP, dCTP and dTTP), 15 picomoles of each primer

(Hβ5’RNA-S plus Hβ3’RNA-AS, Hβ5’RNA-S plus Hβ3’exon2-AS, or Hβexon2-S plus

Hβ3’RNA-AS; see Table I) and 0.3 µl of enzyme. 10 µl aliquots from each RT-PCR sample

were analysed by electrophoresis on 1% agarose gels.

Sucrose gradient polysome fractionation. Polysome gradients were carried out as

described (38). In brief, transiently transfected MEL cells were centrifuged at 1,000 x g for 5

min at 4°C. The cell pellet was washed with ice-cold PBS, lysed in TMK100 buffer (10 mM

Tris-HCl at pH7.4), 5 mM MgCl2, 100 mM KCl, 2 mM DTT, 1% Triton X-100, and RNase

inhibitor 100U/ml - Promega), the nuclei were cleared at 10,000 x g for 10 min at 4°C, and

the supernatants (S10) were removed and layered onto the prepared 10%-to-50% linear

sucrose gradients and centrifuged at 40000 rpm for 85 min at 4°C. The gradients were

collected in 15 fractions from the top to the bottom by displacing them upwards with 60%

sucrose, and the gradient profile was monitored via UV absorbance at 254 nm with an ISCO

UA-5 detector (Lincoln, Nebr., USA). RNA was extracted from sucrose fractions and ethanol

precipitated. mRNA content was determined by RPA, using probes generated by in vitro

transcription of plasmids containing genomic DNA inserts for hβ-globin (38), and mGAPDH

(Ambion). The final protected fragments were resolved on a 6% acrylamide-8 M urea gel.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

Radioactivity in bands of interest was quantified by PhosphorImager analysis (Storm 840;

Molecular Dynamics).

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15

RESULTS

ββββ15 and ββββ17 mRNAs are more stable than the NMD-targeted ββββ39 mRNA. We

have previously reported that a set of thalassemic hβ-globin mRNAs bearing nonsense

mutations in exon 1 (β5, β15, and β17, respectively) accumulate to steady-state levels in vivo

that are significantly higher than the β-globin mRNA with a prototype NMD-sensitive

nonsense mutation (β39) (37, 41). This observation suggested that these nonsense-containing

β-globin mRNAs avoid the full impact of NMD. To firmly establish that this is the case, the

half-lives of two of the β-globin mRNAs with nonsense mutations in exon 1, β15 and β17,

were determined and compared to βWT and β39 mRNAs. Each β-globin gene (normal or

mutant) was cloned behind a tet-controlled promoter and transfected into a MEL cell line that

stably expresses the tet-transcriptional transactivator (MEL/tTA cells) (39). The cells were

transcriptionally pulsed for 12 hours with each β-globin mRNA, and the corresponding

mRNA decay rate was subsequently established. An example of this study is shown in figure

1A and a compilation of four independent experiments is shown in figure 1B. The half-life

(t1/2) of normal β-globin mRNA (βWT) in this system is 10 hours and that of the NMD-

sensitive β39 mRNA is 3.5 hours. These half-lives are in agreement with a recent study by

Couttet and Grange (42). The half-lives of the β15 and β17 mRNA were similar to each other

and were intermediate to the βWT and β39 mRNAs; t1/2 of β15 mRNA is ~6.3 hours, and t1/2 of

β17 is ~5.8 hours (Fig. 1B). These half-lives are consistent with the steady state levels of β15

and β17 mRNAs in erythroid cells (37) and suggest that hβ-globin mRNAs with nonsense-

mutations located in close proximity to the initiation AUG can escape the full impact of

NMD.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

16

Close proximity of nonsense mutations to the initiation AUG minimizes NMD of

hββββ-globin mRNA. The above data confirm that the β15 and β17 mRNAs are relatively

resistant to NMD. We hypothesized that resistance might reflect the positioning of the

nonsense codon relative to the initiation AUG. To test this hypothesis, a deletion was

introduced into the β39 mRNA that removed 69 bp between codons 3 – 27 (β39DelA). This

deletion relocates the β39 nonsense mutation to a position 16 codons from the AUG while

leaving the mutation within exon 2 and preserving the distance between the β39 nonsense

codon and the terminal (exon 2-3) splice junction (195 nt) (Fig. 2A). MEL cells were stably

co-transfected with equimolar amounts of β39DelA plus β39 or βWTDelA plus βWT and the

levels of the corresponding mRNAs were determined after the MEL cells were stimulated to

terminally differentiate (37) (Fig. 2B). The results from three independent experiments

revealed that the DelA deletion increased the level of β39 mRNA by 7.3-fold. This increase

was significantly greater than the 1.8-fold increase in the level of βWT mRNA. Thus,

shortening the distance between the β39 mutation and the AUG resulted in a significant and

preferential mRNA stabilization.

The stabilizing effect of DelA on the β39 mRNA was confirmed by a second

approach. MEL cells were stably transfected with each individual construct, the cells were

induced to erythroid differentiation, and the steady state level of each mRNA was assessed

relative to an internal control [mouse (m) α-globin mRNA] (Fig. 2C). Results from four

independent experiments indicate that β39DelA transcripts accumulate at about 84% of

βWTDelA transcript levels, while β39 transcripts show levels of accumulation at about 9% of

βWT (Fig. 2C). The studies support the conclusion that NMD is significantly abrogated when

β-globin nonsense mutations are in close proximity to the initiation AUG.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17

The half-life of ββββ39DelA mRNA is similar to that of ββββ15 or ββββ17 mRNAs. Based on

steady state mRNA levels (Fig. 2), we hypothesized that DelA stabilizes the NMD-sensitive

β39 mRNA. To directly test this prediction, β39 and β39DelA genes were placed under

control of the tetracycline-regulated promoter. MEL/tTA cells transfected with the β39 and

β39DelA genes were transcriptionally pulsed for 12 hours and the decay rates of the β-globin

mRNAs were monitored over time (Fig. 3A). Results from three independent experiments

revealed a t1/2 of 5.2 hours for β39DelA mRNA (Fig. 3B). This half-life is equivalent to that

determined for the β15 or β17 mRNAs and significantly longer than that determined for the

β39 mRNA. These data confirm that DelA stabilizes the β39 mRNA.

The relative stability of ββββ-globin mRNAs with 5’-proximal nonsense mutations is

independent of promoter- and tissue-specificity. Work from others suggests that the decay

rate of nonsense-containing β-globin mRNAs can be impacted by an erythroid environment

(43). For this reason, we next compared the NMD profiles established in MEL cells (Figs. 2

and 3) with those in HeLa cells. HeLa cells were transiently co-transfected with equimolar

amounts of hα- and β39DelA-globin genes under control of the CMV promoter. Twenty-four

hours post-transfection, RNA was quantified by RPA using probes specific for the human α-

and β-globin mRNAs. The mRNA levels of βWT, β15, β39, and βWTDelA genes were assessed

in parallel (Fig. 4). Results from three independent experiments revealed accelerated decay of

β39 mRNA in non-erythroid cells; levels of β39 mRNA were 37% of βWT mRNA. In contrast,

mRNA with a 5’ proximal nonsense mutation (β15) accumulated to the same level as βWT.

Furthermore, deletion of sequences between codons 3-27 (Del A) of β39 mRNA increased its

accumulation in HeLa cells from 37% to 86% of βWT. Thus β15 mRNA evades NMD in the

non-erythroid (HeLa) as well as erythroid (MEL) cells, while β39 is NMD-sensitive in both

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18

settings and is stabilized by DelA. Since the stabilizing impact of DelA on β39 mRNA is

equivalent in MEL and HeLa cells, using either the homologous β-globin promoter or the

heterologous CMV promoter in erythroid and non-erythroid cells, the relative impact of NMD

on the various mutant mRNAs appears to be independent of promoter as well as tissue

specificity. Taken together, these data substantiate the stability of the 5’ nonsense mutations

and the stabilizing effect of deleting codons 3-27 from β39 mRNA.

Stabilities of ββββ39DelA and 5’-proximal nonsense mRNAs do not reflect activation

of abnormal splicing pathways. Mechanisms that might contribute to stabilization of the β-

globin mRNAs with 5’-proximal nonsense mutations were explored. We initially tested the

possibility that these mutations activated cryptic splicing pathway(s) with consequent

alteration in mRNA sequence and circumvention of the premature termination codon. This

possibility was of particular interest in light of the numerous cryptic splice-donor sites in exon

1 that can be activated in vivo (44-47). Representative hβ-globin genes were expressed in

transfected MEL cells and the encoded mRNAs were analysed by RT-PCR, using a set of

primers that encompass the full-length β-globin mRNA (Fig. 5A) (see Methods). A single

full-length product of 625 bp was amplified from all non-deletional transcripts and a 556 bp

fragment was amplified from cDNAs carrying DelA. In all cases, the cDNAs that were

amplified correspond to the expected sizes of normally spliced β-globin mRNA. These results

were confirmed by amplifying 5’ and 3’ halves of the hβ-globin cDNA from mRNA

transiently expressed in HeLa cells (Fig. 5B; see Methods). As expected, the 5’ half of the

cDNA generated a product of 351 bp for βWT, β39, and β15 transcripts and a fragment of 282

bp corresponding to the βWTDelA and β39DelA mRNA samples. Analysis of the 3’cDNA

fragment revealed the amplification of a 359 bp product in all samples (Fig. 5B). These

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

19

results demonstrate normal splicing patterns for the transcripts containing the various

nonsense and deletion mutations.

ββββ39DelA and 5’-proximal nonsense mRNAs fail to undergo appreciable levels of

translation re-initiation. NMD can be abrogated if translation re-initiates downstream of the

nonsense codon (31). With this in mind, we investigated whether translational re-initiation

was occurring on the β-globin mRNAs with 5’-proximal nonsense mutations. Polysome

distributions were determined for βWT, β15, β39, βWTDelA, and β39DelA mRNAs expressed

in transiently-transfected MEL cells (Fig. 6A and B). Data revealed a normal polysome

profile for the βWT mRNA (ORF 146 codons) with a mean polysome size of 4 ribosomes.

The mean polysome size for the βWTDelA mRNA was 3 ribosomes, a size consistent with its

slightly shortened ORF (123 codons). In contrast, β15 and β39 mRNAs were both limited to a

mean polysome size of 1-1.5 ribosomes and β39DelA mRNA peaked at a mean polysome size

of 1 ribosome (Fig. 6C). These results support the conclusion that β15, β39, and β39DelA

mRNAs terminate translation at their respective nonsense codons without appreciable levels

of downstream re-initiation.

The question of translational re-initiation was further addressed by a second approach.

If residual re-initiation, even at low levels, did occur and was able to circumvent NMD, this

effect should be inhibited by inactivating putative initiating AUG codons located 3’ to the

nonsense codon. The most proximal hβ-globin AUGs in a favoured Kozak consensus (48) are

at positions 55 (in frame) and 73/74 (out of frame). A third AUG codon at 63/64 is in a less

optimal sequence context (49). All three putative reinitiation AUGs were mutated in cis

within the βWT, β15, β39, and β39DelA genes; Met-55 was converted to isoleucine (Ile)

(AUG�AUA), in cis to AUG�ACG substitutions at positions 63/64 and 73/74. HeLa cells

were transiently transfected with each of these constructs or with the parental βWT, β39DelA,

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

20

β15, and β39 constructs. The expression of each β-globin mRNA was normalized to the

expression of a co-transfected hα-globin gene (Fig. 6D). The results demonstrate that the

combined array of missense mutations introduced at codons 55, 63/64, and 73/74 failed to

destabilize the β15 or the β39DelA mRNAs. These data, along with the polysome profiles,

lead us to conclude that the stability of the β15 mRNA and the stabilization of the β39 mRNA

by the DelA deletion, do not reflect translation re-initiation.

The proximity of nonsense codons to the translation initiation AUG is a major

determinant of NMD. The stabilization of the β39 mRNA by DelA could be explained by

two models. The first model reflects the repositioning the β39 mutation closer to the initiation

codon. The second model reflects deletion of a cis element within the DelA segment that is

important to the NMD pathway. The second model might also account for the relative

stabilities of β5, β15, and β17 mRNAs if each of the corresponding base substitutions altered

the structure of the putative NMD determinant. The merit of the second model was tested by

substituting the entire sequence between codons 3 and 27 in the β39 with a ‘neutral’ sequence

corresponding to exon 2 of the hα2-globin gene. The resulting β39seqhet gene and a control

βWTseqhet gene were separately stably transfected in MEL cells. Following erythroid

induction, hβ-globin mRNA levels were quantified relatively to the endogenous mα-globin

(Fig. 7A). Results from four independent experiments revealed that β39seqhet and β39

mRNAs accumulate to approximately the same levels when compared to the corresponding

βWT (31% and 28%, respectively) (Fig. 7A). These data suggest that sequences between

codons 3-27 in the β-globin mRNA do not contain an NMD-relevant determinant.

The lack of support for a NMD determinant in the first exon led us to consider in

further detail the model which proposes that the strength of NMD is impacted by the

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

21

proximity of the nonsense mutation to the initiation AUG. This proximity effect was tested

by introducing DelA in a second NMD-committed β-globin mRNA, β62 (29). In this case

DelA moves the β62 nonsense codon to a position 39 codons from the AUG; ie the same

distancing as in NMD-sensitive β39 mRNA. The β62 and β62DelA constructs were stably

transfected into MEL cells in parallel with βWT, β15, or β39 genes. Transfected cell pools

were induced to differentiation and RNA levels were quantified in four experiments (Fig.

7A). The β62 transcripts are expressed at about 18% of normal and β62DelA mRNA

accumulates at about 15% of normal, and both of these transcripts have NMD-sensitivity

similar to β39 (Fig. 7A). These data support the conclusion that DelA stabilizes the β39

mRNA by bringing the nonsense codon into critical proximity with the AUG rather than by

removing an NMD determinant.

The relationship between the AUG-proximity of nonsense mutations to the strength of

NMD was confirmed in nonerythroid cells. HeLa cells expressing the tet transactivator

(HeLa/tTA; 39) were transiently co-transfected with each of seven β-globin constructs (βWT,

βWTseqhet, β15, β39, β39seqhet, β62, β62DelA) under control of the tetracycline-regulated

promoter. Cells were cultured in the absence of tetracycline for 24 hours to induce expression

and RNA levels were subsequently quantified. The expression of each β-globin gene was

normalized to a co-transfected hα-globin gene. The results of three studies are summarized in

figure 7B. When compared to the level of βWT mRNA, the β15 mRNA is expressed at 105%;

β39 mRNA at 38%; and β62 and β62DelA mRNAs at 44-49% of normal. The β39seqhet is

expressed at 40% of βWTseqhet. These data parallel those in MEL cells and reinforce the

conclusion that DelA stabilizes a nonsense-containing mRNA by repositioning a nonsense

codon close to the initiation AUG.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

22

As an additional test of the relationship of AUG proximity to NMD we increased the

distance between the β15 nonsense codon and the AUG. A heterologous 24 codon spacer was

inserted between codons 14 and 15 of β15 gene. As a control, the same insertion was made in

the βWT gene. This insertion moves the β15 nonsense mutation to a position 39 codons from

the AUG. HeLa/tTA cells were co-transfected with each of these hybrid constructs and the

hα-globin gene. Cells were grown for 24 hours in the absence of tetracycline and RNA levels

were subsequently quantified (Fig. 7B). These studies reveal that βWT(15:39) mRNA

accumulates at approximately 112% of normal (βWT) and β15(15:39) mRNA accumulates at

approximately 37% of βWT. These results further support the role of AUG-proximity in NMD

by demonstrating that increasing the distance between the β15 mutation and the AUG results

in mRNA destabilization.

Finally, we analysed if the impact of AUG-proximity on NMD is dominant over the

general “50-54 nt boundary” rule. Here, we introduced the β15 mutation in cis to the β39

(construct β15nonβ39). This gene was stably transfected in MEL cells and the level of

accumulation was determined after induction of differentiation. We find that the β15nonβ39

mRNA accumulates to approximately the same level as the β15 mRNA (respectively, 63%

and 60% of βWT; Fig. 7A). Concordant results were also obtained in HeLa cells, where

β15nonβ39 mRNA is at about 97% of βWT (Fig. 7B). These data unequivocally demonstrate

that the effect of the proximity of the nonsense mutation to the AUG is a dominant

determinant in the inhibition of the NMD pathway.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

23

DISCUSSION

Termination codons are recognized by the NMD apparatus as premature if they are

located more than 50-54 nt 5’ to the 3’-most exon-exon junction (28, 29). We have previously

reported that human β-globin mRNAs bearing nonsense mutations in the 5’-region of exon 1

accumulate to levels similar to those of wild type β-globin mRNA (37). This finding is in

apparent contradiction to the “50-54 nt boundary rule” as these mutations are substantially 5’

to the terminal exon 2-3 junction. In the present report we demonstrate that these mRNAs

with AUG-proximal nonsense mutations are in fact significantly more stable than prototype

NMD-sensitive β-globin mRNAs and that the proximity of nonsense mutation to the AUG

initiation codon comprises the basis of their relative NMD resistance. Thus, AUG-proximity

can over-ride the “50-54 nt boundary rule” in establishing the overall efficiency of NMD for a

particular mutant mRNA.

The AUG-proximity effect studied in the current report is based on the hβ-globin

mRNA model. The study stems from observations originally made in patients with specific β-

thalassemic mutations. The cell culture studies currently reported appear to accurately

recapitulate our prior in vivo observations. The effect of AUG-proximity on NMD mechanism

in β-globin mRNA is independent of promoter sequence and is not restricted to erythroid

cells. Thus, it is likely that these findings are not restricted to the globin genes or to the

erythroid cell environment and may in fact constitute general determinants of the NMD

pathway.

To our knowledge, the AUG-proximity effect that we report represents a newly

recognized parameter of the NMD response. However, a number of apparent exceptions to the

“50-54 nt boundary rule” have been previously reported by others. The mechanisms involved

in these individual cases of NMD-resistance include translation re-initiation downstream the

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

24

nonsense codon (TPI and immunoglobulin µ heavy chain mRNAs; 31, 32) and the presence

of a sequence cis-acting element that confers immunity to the “50-54 nt boundary rule” (TCR-

β mRNA; 34). In additional cases the rule is apparently circumvented although the underlying

mechanism responsible for inhibition of the NMD response remains undefined (BRCA1,

fibrinogen Aα-chain and ALG3 mRNAs; 33, 35, 36). We propose, based on the likelihood

that the current findings are not limited to the β-globin mRNA, that the NMD-resistance in

some of these model systems reflects the AUG-proximity effect.

The observed lack of cell-type specificity for NMD phenotypes in the β-globin

mRNAs is consistent with the understanding that NMD constitutes an essential surveillance

process operating in all tissues. Nonetheless, a comparison of results shown in figures 2C and

4 suggests that NMD of human β-globin mRNA may be somewhat more efficient in

terminally-differentiated erythroid cells when compared to HeLa cells. This may be

contributed by the observation of Stevens et al. (43) that the degradation of nonsense-mutated

β-globin mRNAs in erythroid cells is accomplished by a tissue specific endonuclease with

preference for UG dinucleotides (43). Thus, while specialized decay pathways may exist in

the erythroid compartment, the general conservation of the NMD phenotypes that we observe

in MEL and HeLa cells suggests that the AUG-proximity effect reflects a general attribute of

the NMD pathway.

The relevance of the AUG-proximity of a nonsense codon to NMD is consistent with

prior studies on 5’ ORF structure in NMD in other systems (50). For example, thrombopoietin

mRNA is normally insensitive to NMD, but can be rendered NMD-sensitive by extending the

length of its upstream ORF. These data led to the suggestion that mammalian mRNAs with

naturally occurring short upstream ORFs may have a general resistance to NMD (50). These

data, in conjunction with our present study, would support a model in which termination of

translation in close proximity to the initiation codon results in a resistance to NMD. This

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

25

notion combined with the knowledge that the NMD pathway is translation-dependent, may

lead to a further proposal that the observed NMD-insensitivity of mRNAs with a short 5’

ORF, whether natural or resulting from a nonsense mutation, can mechanistically reflect

ineffective and/or brief translation. In this regard, it is interesting to note that the smallest

naturally occurring eukaryotic ORF that produces significant levels of protein product

comprises 24 codons (51). Based on our results and those published by Zhang et al. (28), this

boundary for human β-globin mRNAs appears to map between codons 17 and 21/22 (β17 is

the 3’-most mutation that fails to trigger full NMD and the β21/22 mutation is the 5’-most

mutation able to fully commit mRNA to the NMD pathway; 28, 37). Thus, the reported

minimal size of an ORF for effective translation roughly correlates with the boundary

between NMD-resistant and NMD-sensitive mutations.

The apparent concordance between the minimal length of an ORF for effective protein

synthesis and the minimal length for effective NMD may be relevant to disease

pathophysiology. In the case of thalassemia, the production of truncated proteins via nonsense

mutations can have a dominant-negative effect on red cell structure and function (52, 53). C-

terminal truncated proteins, if produced at significant levels, can block proteolytic pathways

in differentiating erythroblast and/or can interfere with critical aspects of the assembly and

function of hemoglobin tetramers (53). The NMD pathway is generally considered to clear

cellular mRNAs that can encode such ‘toxic’ protein fragments. However, mutant β-globin

mRNAs with AUG-proximal nonsense mutations are relatively stable. This apparent defect in

NMD surveillance would theoretically place the cell in jeopardy. Nevertheless, we note that

the thalassemic phenotype of heterozygotes and homozygotes carrying AUG-proximal

nonsense mutations do not appear to be any more severe than in patients carrying more distal

nonsense mutations that are effectively targeted by NMD. The lack of a detectable dominant-

negative effect in these patients may reflect the inefficiency with which mutant mRNAs with

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

26

short 5’ ORFs are translated. Thus, the inability of the NMD pathway to effectively clear

mRNAs with 5’-proximal nonsense mutations may be mitigated, at least in part, by the

inability of these mRNAs with very short ORFs to be effectively translated.

The relative NMD resistance of mRNAs with AUG-proximal nonsense-mutations can

be related to critical steps in translational biochemistry. The short ORF may result in a

temporal overlap between translational initiation and termination. The ribosome may arrive

at the premature termination (nonsense) codon before it has discharged its initiation factors

and/or stabilized interactions with elongation/termination factors. This effect would result in

interference with elongation/termination reactions that may be central to the NMD pathway.

Present evidence indicates that the translation termination process is intimately linked with

the NMD pathway. Analyses in other systems have shown that during the process of

translation of short upstream ORFs, interactions involving ribosomal or ribosome-associated

factors including but not limited to releasing factors, can inhibit translation elongation as well

as termination (54-57). In the case of NMD, Upf1 must interact with eRF1 and eRF3 to

terminate translation and, in the proper setting, to interact with additional factors to trigger

NMD (reviewed in reference 1, 27). Therefore, it is possible that the dynamics of the mRNP

remodelling necessary for NMD cannot occur or is defective in this compressed environment

of the AUG-proximal nonsense-mutated mRNAs. The present study further supports the

notion that NMD is a multifaceted process that reflects the overall complexity of eukaryotic

translational biochemistry.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

27

REFERENCES

1. Wagner, E., Lykke-Andersen, J. (2002) J. Cell Sci. 115, 3033-3038

2. Maquat, L.E. (1995) RNA 1, 453-465

3. Kozak, M. (2002) Mamm. Genome 13, 401-410

4. Maquat, L.E. (2004) Nature Rev. Mol. Cell Biol. 5, 89-99

5. Blencowe, B.J., Issner, R., Nickerson, J.A., Sharp, P.A. (1998) Genes Dev. 12, 996-

1009

6. Mayeda, A., Badolato, J., Kobayashi, R., Zhang, M.Q., Gardiner, E.M., Krainer, A.R.

(1999) EMBO J. 18, 4560-4570

7. Kataoka, N., Yong, J., Kim, V.N., Velazquez, F., Perkinson, R.A., Wang, F.,

Dreyfuss, G. (2000) Mol. Cell 6, 673-682

8. Le Hir, H., Izaurralde, E., Maquat, L.E., Moore, M.J. (2000) EMBO J. 19, 6860-6869

9. Le Hir, H., Moore, M.J., Maquat, L.E. (2000) Genes & Develop. 14, 1098-1108

10. Zhou, Z., Luo, M.J., Straesser, K., Katahira, J., Hurt, E., Reed, R. (2000)

Nature 407, 401-405

11. Kim, V.N., Kataoka, N., Dreyfuss, G. (2001) Science 293, 1832-1836

12. Kim, V.N., Yong, J., Kataoka, N., Abel, L., Diem, M.D., Dreyfuss, G. (2001) EMBO

J. 20, 2062-2068

13. Lykke-Andersen, J, Shu, M-D, Steitz, JA. (2001) Science 293, 1836-1839

14. Le Hir, H., Gatfield, D., Izaurralde, E., Moore, M.J. (2001) EMBO J. 20, 4987-4997

15. Le Hir, H., Gatfield, D., Braun, I.C., Forler, D., Izaurralde, E. (2001)

EMBO Rep. 2, 1119-1124

16. Kataoka, N., Diem, M.D., Kim, V.N., Yong, J., Dreyfuss, G. (2001) EMBO J. 20,

6424-6433

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

28

17. Gehring, N.H., Neu-Yilik, G., Schell, T., Hentze, M.W., Kulozik, A.E. (2003) Mol.

Cell 11, 939-949

18. Kataoka, N., and Dreyfuss, G. (2004) J. Biol. Chem. 20, 7009-7013

19. Lykke-Andersen, J, Shu, M-D, Steitz, JA. (2000) Cell 103, 1121-1131

20. Serin, G., Gersappe, A., Black, J.D., Aronoff, R., Maquat, L.E. (2001) Mol. Cell. Biol.

21, 209-223

21. Ishigaki, Y., Li, X., Serin, G., Maquat, L.E. (2001) Cell 106, 607-617

22. Pal, M., Ishigaki, Y., Nagy, E. Maquat, L.E. (2001) RNA 7, 5-15

23. Ohnishi, T.,Yamashita, A., Kashima, A., Schell, T., Andres K.R., Grimson, A.,

Hachiya, T., Hentze, M.W., Anderson, P., Ohno, S. (2003) Mol. Cell 12, 1187-1200

24. He, F., Brown, A.H., Jacobson, A. (1997) Mol. Cell. Biol. 17, 1580-1594

25. Mendell, J.T., Medghalchi, S.M., Lake, R.G., Noensie, E.N., Dietz, H.C. (2000) Mol.

Cell. Biol. 20, 8944-8957

26. Schell, T., Kocher, T., Wilm, M., Seraphin, B., Kulozik, A., Hentze, M.W. (2003)

Biochem J. 373, 775-783

27. Czaplinski, K., Ruiz-Echevarria, M.J., Paushkin, S.V. Han, X., Weng, Y., Perlick,

H.A., Dietz, H.C. Ter-Avanesyan, M.D., Peltz, S.W. (1998) Genes & Develop. 12, 1665-1677

28. Zhang, J., Sun, X., Qian, Y., Maquat, L.E. (1998) RNA 4, 801-815

29. Thermann, R., Neu-Yilik, G., Deters, A., Frede, U., Wehr, K., Hagemeier, C., Hentze,

M.W., Kulozik, A.E. (1998) EMBO J. 17, 3484-3494

30. Zhang, J., Sun, X., Qian, Y., Maquat, L.E. (1998) Mol. Cell. Biol. 18, 5272-5283

31. Zhang, J., Maquat, L.E. (1997) EMBO J. 16, 826-833

32. Buzina, A., Shulman, M.J. (1999) Mol. Biol. Cell 10, 515-524

33. Perrin-Vidoz, L., Sinilnikova, O.M., Stoppa-Lyonnet, D., Lenoir, G.M., Mazoyer, S.

(2002) Hum. Mol. Genet. 11, 2805-2814

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

29

34. Wang, J., Gudikote, J.P., Olivas, O.R., Wilkinson, M.F. (2002) EMBO Rep. 3, 274-

279

35. Asselta, R., Duga, S., Spena, S., Santagostino, E., Peyvandi, F., Piseddu, G.,

Targhetta, R., Malcovati, M., Mannucci, P.M., Tenchini, M.L. (2001) Blood 98, 3685-3692

36. Denecke, J., Kranz, C., Kemming, D., Koch, H.-G., Marquardt, T. (2004) Hum. Mutat.

23, 477-486

37. Romão, L., Inácio, A., Santos, S., Ávila, M., Faustino, P., Pacheco, P., Lavinha, J.

(2000) Blood 96, 2895-2901

38. Ji, X., Kong, J., Liebhaber, S.A. (2003) Mol. Cell. Biol. 23, 899-907

39. Kong, J., Ji, X., Liebhaber, S.A. (2003) Mol. Cell. Biol. 23, 1125-1134

40. Liebhaber, S.A., Wang, Z., Cash, F.E., Monks, B., Russel, J.E. (1996) Mol. Cell. Biol.

16, 2637-2646

41. Baserga, S., Benz, E.J.Jr. (1988) Proc. Natl. Acad. Sci. USA. 85, 2056-2060

42. Couttet, P., Grange, T. (2004) Nucl. Acids Res. 32, 488-494

43. Stevens, A., Wang, Y., Bremer, K., Zhang, J., Hoepfner, R., Antoniou, M., Schenberg,

D.R., Maquat, L.E. (2002) Proc. Nat. Acad. Sci. USA. 99, 12741-12746

44. Orkin, S.H., Kazazian, H.H.Jr., Antonarakis, S.E., Oster, H., Goff, Sc., Sexton J.P.

(1982) Nature 300, 768-769

45. Goldsmith, M.E., Humphries, R.K., Ley, T., Cline, A., Kantor, J.A., Nienhuis, A.W.

(1983) Proc. Natl. Acad. Sci. USA. 80, 2318-2322

46. Orkin, S.H., Antonarakis, S.E., Loukopoulos, D. (1984) Blood 64, 311-313

47. Yang, K.G., Kutlar, F., George, E., Wilson, J.B., Kutlar, A., Stoming, T.A., Gonzalez-

Redondo, J.M.. Huisman, T.H.J. (1989) Br. J. Haematol. 72, 73-80

48. Kozak, M. (1997) EMBO J. 16, 2482-2492

49. Hinnebusch, A.G. (1993) Mol. Cell. Biol. 10, 215-223

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

30

50. Stockklausner, C. (Personal communication)

51. Yu, X., Warner, J.R. (2001) J. Biol. Chem. 276, 33821-33825

52. Thein, S.L., Hesketh, C., Taylor, P., Temperley, I. J., Hutchinson, R.M., Old, J.,

Wood, W.G., Clegg, J.B., Weatherall D.J. (1990) Proc. Nat. Acad. Sci. USA. 87, 3924-3928

53. Hall, G.H., Thein, S. (1994) Blood 83, 2031-2037

54. Lovett, P.S., and Rogers, E.J. (1996) Microbiol. Rev. 60, 366-385

55. Morris, D.R., and Geballe, P. (2000) Mol. Cell. Biol. 20, 8635-8642

56. Tenson, T., and Ehrenberg, M. (2002) Cell 108, 591-594

57. Janzen, D.M., Frolova, L., Geballe, A.P. (2002) Mol. Cell. Biol. 22, 8562-8570

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

31

ACKNOWLEDGEMENTS

This work was partially supported by Fundação para a Ciência e a Tecnologia

(PRAXIS/P/SAU/63/96, POCTI/MGI/34105/2000 and Programa Plurianual/CIGMH), and by

NIH grant RO1-HL 65449 (SAL). J. Pinto, A.L. Silva, A. Morgado, F. Almeida and A. Inacio

were supported by Fellowships from Fundação para a Ciência e a Tecnologia.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

32

FIGURE LEGENDS

FIGURE 1. The stabilities of hββββ-globin mRNAs with nonsense mutations at codons 15

and 17 (ββββ15 and ββββ17, respectively) are intermediate between ββββWT and a ββββ-globin mRNA

fully committed to NMD (ββββ39). MEL cells stably expressing the tet transactivator (MEL tTA

cells) were transiently transfected with βWT, β15, β17 or β39 genes under the transcriptional

control of a tTA-regulated promoter. Cells were pulsed with the respective β-globin mRNAs

for 12 hours by transfer to Tet(-) media and then transferred back to Tet(+) media for analysis

of decay rates. Total mRNA was isolated at various time intervals during the transcriptional

chase period and analysed by RPA.

(A) Representative RPA analysis. Expression constructs are indicated above the

respective autoradiographs, and hours of chase are noted below the respective lanes. RNase

protection bands corresponding to hβ-globin mRNA and to the constitutively expressed

mGAPDH mRNA (loading control) are indicated. The intensities of the hβ-globin mRNA

bands were quantified and normalized relative to GAPDH mRNA band.

(B) Decay rates of ββββ-globin mRNAs. The data generated from the RPA studies (A,

above) are recorded in the graph. To calculate the β-globin mRNA half-lives, each data time

point was expressed as a ratio of hβ-globin:mGAPDH mRNA and normalized to the average

value of all time points from a single transfection. The ratios were then re-normalized to the

average initial time point from all transfections (time 0 = 1). Each point represents the mean

+/- Standard Deviation from four independent experiments. Linear regression analysis was

performed by standard techniques. The half-lives (t1/2) of the mRNAs are indicated.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

33

FIGURE 2. Shortening exon 1 stabilizes the ββββ39 mRNA.

(A) Physical maps of the hββββ-globin constructs. The closed rectangles, open

rectangles, and lines depict UTRs, exons and introns, respectively. The vertical line represents

the position of the nonsense mutation. The name of each construct is indicated on the right.

(B) Comparison of ββββWT and ββββ39 mRNA expression with expression of the

corresponding set of DelA mRNAs. MEL cells were co-transfected with equimolar amounts

of the βWT and β39 gene with (DelA) and without (Non-del) the exon 1 deletion. Primer

extension analysis is as in Methods. The identity of each end-labelled cDNA product is

indicated on the right of the gel and the level of each DelA mRNA normalized to the level of

its corresponding intact mRNA is represented at the bottom of the corresponding lane (mean

of three independent experiments). The standard deviations (SD) are indicated.

(C) Representative primer extension analysis of the ββββWT, ββββ39, ββββWTDelA, and

ββββ39DelA mRNA expression in transfected MEL cells normalized to endogenous mαααα-

globin mRNA. hβ-globin exon 3 and mα-globin specific end-labelled oligonucleotides

(described in Materials and Methods and Table I) were hybridized with RNA, and extended

with reverse transcriptase (see Methods). Human reticulocyte RNA (hRet) and untransfected

differentiated MEL mRNA (t-) were also reverse transcribed to mark the positions of hβ- and

mα-globin cDNAs, respectively (indicated on the right). The mean PhosphorImager

quantification of the hβ-globin mRNA (hβ) normalized to the level of endogenous mα-globin

mRNA (mα) and calculated as a percentage of the corresponding nonsense-free transcript

(from four independent experiments) is shown at the bottom of the respective lanes. The

standard deviations (SD) are indicated.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

34

FIGURE 3. Decay rate of ββββ39DelA mRNA in tTA/MEL cells. The tet-regulated promoter-

driven β39DelA construct was transiently transfected into tTA/MEL cells and the decay of the

pulsed mRNA was followed over time (hours, bottom) by RPA analysis.

(A) Representative RPA analysis.

(B) Compilation of data from three studies (means and standard deviations). The

half-life (t1/2) of the β39DelA mRNA was determined by regression analysis.

FIGURE 4. The impact of NMD on the various ββββ-globin mRNAs is cell-type and

promoter independent. HeLa cells were transiently co-transfected with a tet-regulated β-

globin (specified above each respective lane) and normal hα-globin gene. After 24 hours of

transcription the RNA from transfected and untransfected (t-) HeLa cells was isolated and

analysed by RPA using specific probes for hβ- and hα-globin mRNAs (see Methods).

Increasing amounts of RNA from HeLa cells transfected with normal hβ- and hα-globin

genes (indicated above the lanes by a triangle) were also analysed to demonstrate that the

experimental RPA was carried out in probe excess and was in the linear range of detection.

The level of mRNA from each β-globin allele was normalized to the level of hα-globin in

order to control for variations in the cell transfection efficiency and RNA recovery.

Normalized values were then calculated as the percentage of βWT-globin mRNA; the values

below each lane represent three independent experiments. Mean values and standard

deviations (SD) are shown.

FIGURE 5. The structures of ββββ39DelA, ββββ15 and ββββ39 mRNAs indicate that the

corresponding transcripts are normally spliced.

(A) Structural analysis of full-length hββββ-globin mRNAs stably expressed in MEL

cells. The identity of each gene is indicted above the respective lane. RNA from untransfected

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

35

(t-) cells was used as the negative control for RT-PCR reactions. Plasmid DNA carrying the

human βWT gene constitutes the positive PCR control. Molecular weight marker (M) is the

100 bp DNA ladder (Invitrogen). RT-PCR products were resolved on an ethidium bromide

stained agarose gel. Primers (Table I) for RT and PCR reactions are represented in the

diagram below the gel. A single full-length product of 625 bp was amplified from all non-

deletional transcripts and a 556 bp fragment was amplified from cDNAs carrying deletion

between codons 3 and 27. The 1605 bp fragment was amplified from plasmid DNA (pDNA)

containing the human βWT-globin gene.

(B) Structural analysis of mRNA transiently expressed in HeLa cells. The top gel

picture shows the analysis of amplification between exon 1 and exon 2; a single 351 bp

product was amplified from all non-deletional transcripts and a 282 bp fragment was

amplified from cDNAs carrying delA. The 482 bp fragment was amplified from plasmid

DNA containing the human βWT-globin gene. The lower gel shows the analysis between exon

2 and exon 3; a single 359 bp product is observed for each construct. The 1209 bp fragment

was amplified from plasmid DNA containing the human βWT-globin gene. Plasmid DNA

(pDNA) and water comprise the positive and negative RT-PCR controls. M represents the 100

bp DNA ladder marker. Primers localization (Table I) for RT and PCR reactions are

represented on the bottom of each ethidium bromide stained agarose gel.

FIGURE 6. hββββ-globin mRNA and its nonsense derivatives are localized to polysome

peaks consistent with the sizes of their predicted ORFs.

(A) Representative sucrose gradient profile. The absorbance profile (OD254) of the

gradient is shown. The top of the gradient is to the left; the positions of absorbance peaks

corresponding to pre-ribosomal RNPs, 40S, 60S, and 80S, and polysomes (2-, 3-, 4-, 5-, 6-,

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

36

and 7-somes) are indicated. The 15 fractions collected for subsequent analysis are identified

below the gradient profile.

(B) Representative RPA to detect the globin RNAs across the polysome gradient.

MEL cells were transiently transfected with the β-globin genes. Each gradient fraction was

assessed for human β-globin and mouse GAPDH mRNAs by RPA with the corresponding

32P-labeled riboprobes; hβ-globin and mGAPDH protected mRNAs fragments are shown.

(C) Polysome distribution of human ββββWT-globin, ββββ15, ββββ39, ββββWTDelA or ββββ39DelA

mRNAs. The contents of hβ-globin mRNAs in each fraction (see panel B) were quantified by

PhosphorImager analysis (data concerning βWTDelA and β39DelA mRNAs not shown in

panel B). The amount of each mRNA species in each fraction is depicted as a percentage

(ordinate) of the total for the corresponding species across the gradient.

(D) The stability of the ββββ15 or ββββ39DelA mRNAs is unaffected by elimination of

potential re-initiating AUGs. The three potential reinitiating AUGs at codons 55, 63/64, and

73/74, were converted to coding triplets in each of the index mRNAs. Shown is a

representative RPA of RNA isolated from HeLa cells untransfected (t-) or transiently co-

transfected with βWT, β15, β39, β39DelA, βWT-CD55-63/64-73/74, β15-CD55-63/64-73/74,

β39-CD55-63/64-73/74 or β39DelA-CD55-63/64-73/74 human globin genes along with an

equal quantity of the hα-globin gene. The positions of the hβ- and α-globin protected

fragments are indicated to the right of the autoradiograph. Levels of hβ-globin mRNA were

quantified relative to the hα-globin mRNA, and these values are shown beneath each

respective lane [average and standard deviations (SD)] normalized to the expression level of

the βWT gene. All assays were carried out in riboprobe excess. For each case, three

independent experiments were performed.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

37

FIGURE 7. NMD-resistance of human ββββ-globin mRNAs carrying a 5’-proximal

nonsense mutation reflects the proximity of the nonsense codon to the initiating AUG.

(A) Analysis of mRNA expression in terminally differentiated MEL cells. MEL

cells were stably transfected with the hβ-globin construct specified above each lane. After

erythroid induction, the normalized steady-state levels of β-globin mRNA were determined

from either transfected or untransfected (t-) MEL cell pools by RPA using specific probes for

hβ- and mα-globin (see Methods). The protected bands corresponding to the hβ- and mα-

globin mRNA are indicated. The level of mRNA from each β-globin gene was normalized to

the level of endogenous mα-globin in order to control for RNA recovery and erythroid

induction. Normalized values were then calculated as the percentage of βWT (left panel), or of

βWTseqhet (central panel) globin mRNAs. The right panel contains an analysis of 10 and 15

µg of RNA from MEL cells transfected with normal β-globin gene (indicated by a wedge) to

demonstrate that the RPA was in linear range. The values at the bottom of each lane represent

a mean of four independent experiments, and are plotted below the autoradiograph with

standard deviations.

(B) Analysis of mRNA expression in HeLa cells. HeLa cells were co-transfected

with the β-globin constructs specified above each lane and the hα-globin gene to normalize

the expression levels for transfection efficiency. The β-globin and α-globin genes are both

driven by the tetracycline-regulated promoter. Twenty-four hours after transfection, steady-

state total RNA from either transfected or untransfected (t-) HeLa cells was isolated, analysed

by RPA using specific probes for hβ- and α-globin mRNAs, and quantified as indicated

above. The percentage mRNA values (indicated on the bottom) were plotted for each

construct, and standard deviations from three independent experiments are shown.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

38

Table I. DNA oligonucleotides used in the current study

Primer* Sequence (5’�3’) Genomic position Cloning

L5’β-S TAAGCCAGTGCCAGAAGAG β 5’ flanking

DelA-AS CAACCTGCCCAGGGCCAGGTCCACCATGGTG β Exon 1

DelA-S CACCATGGTGCACCTGGCCCTGGGCAGGTTG β Exon 1

R5’β-AS TCCCATTCTAAACTGTACCC β Intron 2

Seqhet-S GACCATGGTGCACCTGCTGTCCTTCCCCACCACC(a) Compound β/α

Seqhet-AS TACCAACCTGCCCAGGGCCTTAACCTGGGCAGAGCC(a) Compound β/α

3’exon1-S GCCCTGGGCAGGTTGGTA β Exon 1/Intron 1

3’exon2-AS TCAGGATCCACGTGCAGC β Exon 2

ATG-S GACACCATGGTGACAATG β 5’ UTR/Exon 1

62-AS TTGCCATGCTACTTCACCTTAGG(b) β Exon 2

62-S CCTAAGGTGAAGTAGTAGCATGGCAA(b) β Exon 2

15non39-AS CTTGCCTCACAGGGCAG(b) β Exon 1

15non39-S CTGCCCTGTGAGGCAAG(b) β Exon 1

55-AS GGTTGCCTATAACAGCATC(b) β Exon 2

55-S GATGCTGTTATAGGCAACC(b) β Exon 2

73/74-AS GCCAGGCCGTCACTAAAG(b) β Exon 2

73/74-S CTTTAGTGACGGCCTGGC(b) β Exon 2

63/64-S GGTGAAGGCTCACGGCAAGAAAGTG(b) β Exon 2

63/64-AS CACTTTCTTGCCGTGAGCCTTCACC(b) β Exon 2

LinkClaI -S CCATCGATACATTTGCTTCTGACACAACTG(c) β 5’UTR

LinkNotI-AS ATAGTTTAGCGGCCGCAGGGATGAATAAGGCATAGGC(c) β 3’ flanking

pTetXhoI1/15-S CCCCCTCGAGTTTACCACT(c) pTet-Splice

pTetClaI351/370-AS CCATCGATACGGTTCACTAAACGAGCTC(c) ptet-Splice

WT15:39-S GCCGTTACTGCCCTGAAGCTTGGGCCCTGGGGCAAGGTGAAC(d) β Exon 1

WT15:39-AS GTTCACCTTGCCCCAGGGCCCAAGCTTCAGGGCAGTAACGGC(d) β Exon 1

15:39-S GCCGTTACTGCCCTGAAGCTTGGGCCCTGAGGCAAGGTGAAC(d) β15 Exon 1

15:39-AS GTTCACCTTGCCTCAGGGCCCAAGCTTCAGGGCAGTAACGGC(d) β15 Exon 1

HindIIIAmpr-S TTTAAGCTTTACATCGAACTGGATCTCAA(c) Ampr

ApaIAmpr-AS AAAGGGCCCACGTTCTTCGGGGCGAAAAC(c) Ampr

GA-S GATCTCAACAGCGGAAAGATCCTTGAGAG(b) Ampr Spacer

GA-AS CTCTCAAGGATCTTTCCGCTGTTGAGATC(b) Ampr Spacer

Primer extension assay

Hβexon3-AS CACTTTCTGATAGGCAGCCTGC β Exon 3

Hβ3’UTR-AS GAAAGCGAGCTTAGTGATAC β 3’UTR

Mα-AS CAGCCTTGATGTTGCT Mouse α Exon 1

RT-PCR assay

Hβ3’RNA-AS GCAATGAAAATAAATGTTTTTTATTA β 3’UTR

Hβ5’RNA-S ACATTTGCTTCTGACACAAC β 5’UTR

Hβexon2-S TGATGGCCTGGCTCACCTG β Exon 2

Hβ3’exon2-AS GATCCACGTGCAGCTTGTCA β Exon 2 *Primer designations reflect the corresponding utilization; S means sense and AS means antissense. (a)The underlined sequences anneal to the hα-globin gene; (b)the underlined sequences correspond to the introduced mutation; (c)the underlined sequences correspond to the restriction site indicated in the primer designation; (d)the underlined sequences correspond to the Hind III-Apa I restriction sites.

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

39

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

40

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

41

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

42

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

43

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

44

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

45

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Paula Faustino, Joao Lavinha, Stephen A. Liebhaber and Luisa RomaoAngela Inacio, Ana Luisa Silva, Joana Pinto, Xinjun Ji, Ana Morgado, Fatima Almeida,

nonsense-mediated mRNA decayNonsense mutations in close proximity to the initiation codon fail to trigger full

published online May 25, 2004J. Biol. Chem. 

  10.1074/jbc.M405024200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from