1

Functional roles of four conserved charged residues in the membrane domain subunit NuoA of

the proton-translocating NADH-quinone oxidoreductase from Escherichia coli*

Mou-Chieh Kaoa,c, Salvatore Di Bernardoa,c, Marta Peregob, Eiko Nakamaru-Ogisoa,

Akemi Matsuno-Yagia,d, and Takao Yagia,d

Divisions of Biochemistrya and Cellular Biologyb, Department of Molecular and Experimental

Medicine, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037

*This work was supported by U.S. Public Health Service Grants R01GM33712 (to A.M.-Y. and T.Y.)

and R01GM55594 (to M.P.). Synthesis of oligonucleotides and DNA sequencing were, in part,

supported by the Sam & Rose Stein Endowment Fund. This is publication 16127-MEM from The

Scripps Research Institute, La Jolla, CA.

cThese authors contributed equally to this work.

dTo whom correspondence should be addressed: e-mail yagi@scripps.edu or yagi2@scripps.edu

Running title: Roles of Glu81 and Asp79 of NuoA subunit in E. coli NDH-1

JBC Papers in Press. Published on June 2, 2004 as Manuscript M403885200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

2

SUMMARY

The H+ (Na+)-translocating NADH-quinone (Q) oxidoreductase (NDH-1) of Escherichia coli is

composed of 13 different subunits (NuoA – N). Subunit NuoA (ND3, Nqo7) is one of the 7 membrane

domain subunits that are considered to be involved in H+(Na+) translocation. We demonstrated that, in

the Paracoccus denitrificans NDH-1 subunit, Nqo7 (ND3) directly interacts with peripheral subunits

Nqo6 (PSST) and Nqo4 (49k) by using cross-linkers [Di Bernardo, S., and Yagi, T. (2001) FEBS Lett.

508, 385-388; Kao, M.-C., Matsuno-Yagi, A., and Yagi, T. (2004) Biochemistry 43, 3750-3755]. In

order to investigate structural and functional roles of conserved charged amino acid residues, a nuoA

knock-out mutant and site-specific mutants K46A, E51A, D79N, D79A, E81Q, E81A, and D79N/E81Q

were constructed by utilizing chromosomal DNA manipulation. In terms of immunochemical and

NADH dehydrogenase activity-staining analyses, all site-specific mutants are similar to the wild-type,

suggesting that those NuoA site-specific mutations do not significantly affect assembly of peripheral

subunits in situ. In addition, site-specific mutants showed similar deamino-NADH-K3Fe(CN)6

reductase activity to the wild type. The K46A mutation scarcely inhibited deamino-NADH-Q reductase

activity. In contrast, E51A, D79A, D79N, E81A, and E81Q mutation partially suppressed deamino-

NADH-Q reductase activity to 30, 90, 40, 40, and 50%, respectively. The double mutant D79N/E81Q

almost completely lost the energy-transducing NDH-1 activities, but did not display any loss of

deamino-NADH-K3Fe(CN)6 reductase activity. The possible functional roles of residues D79 and E81

were discussed.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

INTRODUCTION

The bacterial H+(Na+)-translocating NADH-quinone (Q)1 oxidoreductase (NDH-1), also known

as complex I in mitochondria, is a multiple subunit enzyme complex embedded in the cytoplasmic

membrane (1). This enzyme represents the first step of the respiratory chain and links the electron

transfer from NADH to Q with the translocation of protons from the cytoplasmic phase to the

periplasmic phase (1). The stoichiometry of H+/2e- is considered to be 4 (2). The resulting membrane

potential is utilized to drive energy required for processes like ATP synthesis or solute transport (3).

While mammalian mitochondrial complex I is composed of 46 unlike subunits (4), bacterial

counterparts contain 14 different subunits (designated Nqo1-14 for Paracoccus denitrificans and

Thermus thermophilus and NuoA-N for E. coli)2 (5,6). The bacterial NDH-1 contains cofactors (one

FMN and 8-9 iron-sulfur clusters) akin to complex I (7,8). Topological studies suggest that the NDH-1

can be divided into two sectors, the peripheral segment and the membrane segment (9). The peripheral

segment is composed of 7 subunits (NuoB, C, D, E, F, G, and I). In the case of the E. coli NDH-1,

subunits NuoC (30k) and D (49k) are fused and form NuoCD. Among these peripheral subunits, the

NuoB (PSST) and NuoI (TYKY) subunits are recognized to act as connector subunits between the

peripheral and membrane segments (9,10). The membrane segment also consists of 7 subunits (NuoA,

H, J - N) (11-13) which are homologues of mtDNA-encoded subunits (ND1-6 and 4L) (14,15). The

peripheral segment protrudes into the cytoplasmic phase and is believed to house all the known

cofactors (1). In contrast, the membrane domain is most likely involved in H+ (or Na+) translocation

and inhibitor- and quinone-binding (16-19). In recent years, complex I, in particular the

mitochondrially encoded subunits, received much attention because of their involvement in many

mitochondrial diseases (including sporadic Parkinson’s disease) (20,21). It is known that point

mutations of the ND1/nuoH, ND4/nuoM and ND6/nuoJ genes are associated with LHON and suppress

the respiratory chain activity of complex I (22,23). Furthermore, it has been reported that the defects of

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

the ND5/NuoL subunit are involved in MELAS syndrome and other encephalomyopathies (24). A

single point mutation (T10191C; this mutation substitutes P for S45, human numbering) of the

ND3/NuoA subunit has been reported to substantially reduce the activity of complex I and to be

associated with a progressive clinical picture of epilepsy, strokes, optic atrophy, and cognitive decline

(25). Recently, another point mutation (T10158C; this mutation replaces S34 with P) of the ND3

subunit has been reported for infantile mitochondrial encephalopathy (26). Although these studies

provided evidence for the important role of these hydrophobic subunits, it is clear that a more

systematic investigation is required to identify the key residues in the mechanism of action of complex

I/NDH-1.

In a previous paper (11), we determined the topology of the Paracoccus NuoA subunit. The

Paracoccus NuoA subunit is composed of three transmembrane segments (designated TM1-3 from the

N-terminus to the C-terminus) and its N- and C-terminal regions are directed toward the cytoplasmic

and periplasmic phases of the membrane, respectively (11). The predicted topology places two highly

conserved carboxyl residues (D79 and E81, E. coli numbering) in the middle of the TM2 (11). More

recently, our cross-linking study revealed direct interactions between subunits NuoA and NuoB and

between subunits NuoA and NuoD (9,27). The NuoB subunit is considered to bear center N2 which

shows the highest Em values of all known cofactors in the NDH-1 (1,6). Therefore, it was of interest to

clarify structural and functional roles of these conserved and protonated residues in the NuoA subunit.

For this purpose, we have constructed mutants of the residues of interest by using gene manipulation

technique of the E. coli chromosomal NDH-1 operon and characterized these mutants. Mutants E51A,

D79A, D79N, E81A, and E81Q showed partial decrease in activities of deamino-NADH oxidase and

deamino-NADH-DB reductase but retained the deamino-NADH-K3Fe(CN)6 reductase activity

comparable to the wild-type. In addition, while the D79N/E81Q mutant is similar to the wild-type in

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

terms of both NADH dehydrogenase activity staining and immunochemical analyses of native gels, the

energy-transducing NDH-1 activities of this double mutant were almost completely inactivated.

EXPERIMENTAL PROCEDURES

Materials.

The pCRScript Cloning kit was from Stratagene (La Jolla, CA). The gene replacement vector, pKO3

was a generous gift from Dr. George M. Church (Harvard Medical School, Boston). Materials for PCR

product purification, gel extraction, and plasmid preparation were obtained from QIAGEN (Valencia,

CA). Site-specific mutants were constructed using the GeneEditor Mutagenesis Kit from Promega

(Madison, WI). The BCA protein assay kit and SuperSignal West Pico chemiluminescent substrate

were from Pierce (Rockford, IL). NADH, deamino-NADH, 2,3-dimethoxy-5-methyl-6-decyl-1,4-

benzoquinone (DB), chloramphenicol (Cat) and spectinomycin (Spc) were from Sigma (St. Louis, MO).

p-Nitroblue tetrazolium (NBT) was from CalBiochem (La Jolla, CA). Capsaicin 40 (Cap-40) and

pET(EcoNuoE) bearing the E. coli nuoE gene were kind gifts from Dr. Hideto Miyoshi (Kyoto

University, Kyoto, Japan) and Dr. Judy Hirst (MRC, Cambridge, UK), respectively.

Cloning and mutagenesis of the E. coli nuoA gene.

The gene encoding the NuoA subunit together with a 1 kb DNA segment upstream and a 1 kb DNA

segment downstream were cloned by PCR technology from E. coli DH5α. In order to generate the

restriction sites SmaI/NotI and NotI/SalI the sense/anti-sense primers

5’-GGTACGCCCGGGAAATCCTGCGTTTTAATGATGAGG-3’ with

5’-ACCTCGCGCGGCCGCGACCGCCTAAAAACCGCC-3’ and

5’-TATCTGGCGGCCGCGTTCTTCGTTATCTTCGACGTTG-3’ with

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

5’-GTGTGCGTCGACGTTCGTCCATGCCGTGTAAGTC-3’, respectively, were used, where the

underlined bases were altered from E. coli DNA and the italicized bases represented the restriction site

sequence. The spectinomycin-encoding gene from transposon Tn554 of Staphylococcus aureus (28)

was cloned by the PCR technology using the sense primer 5’-

CGGGGGCGGCCGCTCAGTGGAACGAAAACTCACG-3’ and the anti-sense primer 5’-

AAGGAGCGGCCGCTTTCTATTTTCAATAGTTAC-3’ both containing a NotI restriction site

represented by italicized bases. The DNA fragments and the Spc cassette were cloned in pCRScript and

finally assembled in pKO3. In the same way the sense primer 5’-

GCATTCAAGATCTTGGTTACGCCAGGAAAATCC-3’, which contains a BglII restriction site

(italicized), was used together with the NotI generating anti-sense primer to produce a DNA fragment

that was cloned in pCRScript. Then the sense primer 5’-CCATGAATCGATGTGGCGTCC-3’, which

contains a ClaI restriction site (italicized) was used together with the SalI generating anti-sense primer

to produce a DNA fragment used for the generation of nuoA point-mutants. The DNA inserted in the

pCRscript cloning plasmid was mutagenized with the mutagenesis primers shown in Table 1. These

fragments were also assembled in pCRScript and then cloned into pKO3.

The first step of site-specific mutation of the nuoA gene of the E. coli NDH-1 operon was to

construct a nuoA gene knock out mutant. For this purpose, we employed the pKO3 system developed

by Church’s group (29). In brief, the pKO3 vector contains a repA(Ts) (temperature sensitive

replication origin), a chloramphenicol-resistant gene (cat) and Bacillus subtilis sacB gene encoding

levansucrase. The pKO3 carrying nuoA-knock out DNA was prepared as follows (Figure 1, a and b).

DNA fragments, SmaI/NotI (1467 bp) and NotI/SalI (1269 bp), were amplified from E. coli

chromosomal DNA by PCR and individually inserted in cloning vector pCRScript at the SrfI site as a

blunt end fragment. A PCR-amplified spc casette carrying NotI sites (1200 bp) was also inserted at the

SrfI site of pCRScript. The two DNA fragments and the spc casette were assembled in pKO3. The

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

resulting plasmid, pKO3(nuoA::spc), lacks 90 bp of the nuoA gene which have been replaced by the spc

cassette.

The pKO3 vectors carrying mutated nuoA genes were prepared as shown in Figure 1, c – e. The

R and L fragments were cloned as blunt end fragments at SrfI site in pCRScript. First, the R fragments

of 1544 bp in which a SalI site was introduced at the 3’ end by the PCR amplification reaction were

cloned in pCRScript (designated pCRScript-R) (Figure 1, c). The pCRScript-R was used to generate

the nuoA mutants. Then the L fragment of 1015 bp containing BglII and NotI sites at the 5’ and 3’

ends, respectively, was also cloned in pCRScript generating plasmid PCRScript-L (Figure 1, d). This

plasmid was digested with HindIII/XhoI, blunted, and religated to remove a ClaI site in the multiple

cloning site (MCS). The R fragments containing the mutations were isolated by ClaI and NotI (the

latter is present in the MCS) and purified. The ClaI/NotI fragments were inserted into ClaI/NotI-

cleaved pCRScript-L. The resulting plasmids were designated pCRScript-nuoA(mutants). Each DNA

fragment containing nuoA mutations were then isolated by BglII/SalI digestion from the pCRScript

constructs and transferred to integration plasmid pKO3 at the BamHI/SalI sites. The resulting plasmids

are referred to as pKO3-nuoA(mutants) (Figure 1, e).

Preparation of knock-out and mutant cells.

E. coli strain MC4100 (F-, araD139, ∆(arg F-lac)U169, ptsF25, relA1, flb5301, rpsL 150.λ-) was

transformed with pKO3(nuoA::Spc) plasmid and recombination was carried out as described in Link et

al. (29). In brief, several well isolated colonies from LB agar plates containing 20 µg/ml

chloramphenicol (Cat) and 100 µg/ml spectinomycin (Spc), grown overnight at 30 °C, were picked into

100 µL LB and serially diluted. The dilutions corresponding to 104-106 were then plated on LB agar

plates containing 20 µg/ml Cat and 100 µg/ml Spc, pre-warmed at 43 °C and grown overnight. The

next day again several colonies (typically 5) were picked from the 43 °C plates into 100 µL LB, serially

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

diluted and plated on LB agar plates containing 5% sucrose at 30 °C overnight. The surviving colonies

were then replica-plated on LB agar plates containing 20 µg/ml Cat and on LB plates containing 100

µg/ml Spc and grown at 30 °C overnight. Colonies sensitive to Cat but resistant to Spc were used for

PCR amplification of the nuoA region using the 5’ oligonucleotide CTGAACATGGCATTCAAC

(chro5’) and the 3’ oligonucleotide AAGGAGCGGCGGCTTTCTATTTTCAATAGTTAC (spc3’).

The chro5’ oligonucleotide was designed so to amplify DNA from within the E. coli chromosome and

the spc3’ oligonucleotide from within the Spc cassette. In this way the presence of the Spc cassette and

its location in the genomic DNA was confirmed. The knocked-out MC4100 cells where then stored as

glycerol stocks at - 80 °C. Knocked-out MC4100 competent cells were then employed to introduce

nuoA mutated DNA in the E. coli genome using a similar procedure except that the identification of

recombinants was carried out by screening for spectinomycin sensitivity in addition to chloramphenicol

sensitivity.

In order to confirm the presence of the mutations, the sense oligonucleotide chro5’ and the antisense

oligonucleotide CATACGCTCGCGGCGTG (nuoA3’) which is located inside the nuoA gene, were

used as primers for PCR amplification of the nuoA DNA fragments. The produced nuoA DNA

fragments were subjected to direct sequencing.

Antibody Production.

Antibodies directed against a 12 amino acid oligopeptide corresponding to the C-terminal region of the

E. coli NuoA subunit was produced as follows: An oligopeptide H-CNPETNSIANRQR-OH was

synthesized (designated NuoAc) and conjugated to maleimide-activated bovine serum albumin (Pierce,

Rockford, IL) according to the manufacturer’s protocol. It should be noted that, for the purpose of

conjugation with bovine serum albumin, a cysteine residue was added to the N-terminus. For raising

antibodies specific toward subunits NuoB, NuoE, NuoF, NuoG, and NuoI inclusion bodies of the

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

overexpressed subunits were used as described previously (7). The antibodies were affinity-purified

according to the ref (30).

Cell growth and membrane preparation.

For the preparation of membranes suitable for enzymatic assays, wild type, knock-out and point mutants

were grown in 250 mL of TB medium until O.D. (600 nm) ~ 2. The cells were then harvested in a GSA

rotor at 6000 rpm for 10 min. The cell pellet was resuspended at 10% (W/V) in a buffer containing 10

mM Tris-HCl (pH 7.0), 1 mM EDTA, 1 mM DTT, 1 mM PMSF, and 15% (w/v) glycerol. The cell

suspension was then passed once in a French press at 25000 psi and centrifuged again in the GSA rotor

at 12000 rpm for 10 min. Cell debris was discarded and the supernatant was then ultracentrifuged in a

70Ti rotor at 50000 rpm for 30 min. The pellet was resuspended in the same buffer and was used

immediately for enzymatic activity measurements.

Gel electrophoresis and Western-blotting analysis.

In order to confirm the expression of the NDH-1 subunits western-blotting experiments were carried

out. Antibodies against the NuoAc and the peripheral subunits NuoE, NuoF, NuoG, and NuoI reacted

with a 16 kDa, a 20 kDa, a 50 kDa, a 91 kDa, and a 21kDa band of the E. coli membranes, respectively.

Membranes were subjected to blue-native PAGE according to the ref (31). Briefly, the cholate-treated

E. coli membranes (800 µg of protein) were prepared as described previously (7) and resuspended in 40

µL of 750 mM aminocaproic acid, 50 mM Bistris-HCl (pH 7.0). Then, 8 µL of 10% dodecylmaltoside

and 50 µg/mL DNase were added and the preparation was left on ice for 1 hour. After the incubation on

ice the samples were centrifuged at 149,000 g in a Beckman airfuge for 5 min. The supernatant was

recovered (~ 40 µL) and 16 µL of 5% Coomassie blue in 500 mM aminocaproic acid was added to the

samples. The samples were then loaded on a 7% gel and run in the cold room at 75 V, until the dye

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

entered the separating gel. Subsequently the voltage was raised to 200 V and the gel was run for

another 3 hours. After completion of the electrophoresis the gel was incubated in 2 mM Tris-HCl (pH

7.5) containing 150 µM NADH and 2.5 mg/mL NBT at 37 °C for 2 hours in a shaking incubator. The

reaction was stopped with 7% acetic acid.

Enzymatic assay.

It is recognized that deamino-NADH can be catalyzed by NDH-1/complex I but not NDH-2 (32).

Therefore, in this study, deamino-NADH was used as a substrate. Deamino-NADH oxidase activity

was spectrophotometrically assayed at 340 nm in 10 mM KPi (pH 7.0) containing 1 mM EDTA and

0.15 mM deamino-NADH at 37 °C as described in (33), using the E. coli membranes (80 µg of

protein/ml). 10 µM Cap-40 (34) was used to inhibit the reaction. For the deamino-NADH – DB

activity measurements, 10 mM KCN, 0.15 mM deamino-NADH, and 100 µM DB were routinely added

to the assay mixture. Deamino-NADH – K3Fe(CN)6 reductase activity was assayed at 420 nm in the

same buffer containing 10 mM KCN, 0.15 mM deamino-NADH, and 1 mM K3Fe(CN)6. The non-

enzymatic activity of deamino-NADH - K3Fe(CN)6 reductase was subtracted from all measurements.

The extinction coefficients used for activity calculations were ε340 = 6.22 mM-1cm-1 for deamino-

NADH and ε420 = 1.00 mM-1cm-1 for K3Fe(CN)6.

Other analytical procedures.

Protein concentrations were estimated by the BCA protein assay kit with bovine serum albumin as the

standard according to the manufacture’s instruction. Any variations from the procedures and details are

described in the figure legends.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

RESULTS

Strategy for constructions of NuoA mutants

The E. coli NDH-1 operon is predicted to be approximately 15 kb long (35,36). Because this

length does not allow incorporation of the whole operon into expression vectors, site-specific mutation

is traditionally carried out by complementation of a cassette-inserted gene with a mutated gene in the

expression plasmid (designated in trans complementation) (37-43). However, the in trans

complementation procedure presents some problems when applied to a gene cluster. For example, the

cassette inserted in chromosomal DNA might interrupt the expression of the downstream genes (44).

The only case that does not suffer this polar effect is when the mutated gene is at the last position in the

operon (38). Another problem is that the mutated gene is under the control of a promoter in the

expression plasmid, which often leads to overexpression of the mutated subunit. In mutation studies of

the NDH-1 using the in trans complementation, it has been reported that the enzyme activities were

significantly low (approximately 20% of the wild type cells) even when the unmutated gene was used

(42,43,45). An alternative method of site-directed mutation is to introduce mutations directly in

chromosomal DNA as detailed in this paper (designated chromosomal DNA mutation) (29,42). In this

procedure, expression of all genes of the operon are regulated by the authentic promoter. Although

chromosomal DNA mutation is laborious and time-consuming, we adopted this technique to produce

NuoA mutants to minimize any complications derived from disruption of the operon. As anticipated,

the NDH1 was apparently expressed at the same level in all mutants as in the wild type (see below).

Sequence analysis of the NuoA subunit

Figure 2A is an amino acid sequence comparison between the E. coli NuoA subunit and its

counterparts of various organisms. In terms of hydropathy plots, the E. coli NuoA subunit is akin to its

counterpart of P. denitrificans. Figure 2B is a hypothetical topology of the E. coli NuoA subunit

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

deduced from topological studies of the P. denitrificans NuoA subunit (11). The E. coli NuoA subunit

is predicted to contain the 3 transmembrane segments (designated TM1-3 from N-terminus to C-

terminus). The N- and C-terminal regions are also predicted to be directed toward the cytoplasmic and

periplasmic phases of the membrane, respectively. In addition, a long loop (L1) between TM1 and TM2

is exposed to the periplasmic side. As far as our data base search is concerned (more than 250

organisms), D79 (E. coli numbering) is conserved except for its homologues of Cyanidium caldarium

mitochondria (D79 → C; CAA88774) and Pseudomonas aeruginosa (D79 → G; D83410). On the other

hand, E81 is perfectly conserved. D79 and E81 (E. coli numbering) seem to be located in the middle of

the TM2. Carboxyl residues are rarely located in the middle of TM of the hydrophobic polypeptides.

Therefore, it has been generally recognized that carboxyl residues present in the TM may play important

roles in cation translocation of the membrane-associated enzyme complexes (46,47). One well-known

example is a perfectly conserved carboxyl residue in the center of a transmembrane helix of the DCCD-

binding protein (also called subunit c or proteolipid subunit) of the ATP synthase (48). This carboxyl

residue is clearly involved in the mechanism of proton translocation catalyzed by the membrane sector

of the ATP synthase (49). It has been demonstrated that DCCD also inhibits energy-transducing

electron transfer of the NDH-1/complex I (50,51). It is therefore possible that the D79 and/or E81 may

be involved in the proton translocation of the energy coupling site 1. In order to clarify the structural

and functional roles of these carboxyl residues, we have constructed site-directed mutants of these two

residues (D79A, D79N, E81A, E81Q, D79N/E81Q) by using chromosomal DNA mutation procedures

instead of the in trans complementation method. In addition, it has been reported that a heteroplasmic

mutation of S34P and S45P (human numbering) in the human ND3 subunit (a homologue of the NuoA)

drastically reduced the complex I activity and caused encephalopathy (25,26). These Ser residues

appear to be located in the Loop 1 directed against the cytoplasmic phase and periplasmic phase in

eukaryotes and bacteria, respectively (see Figure 2A). Unfortunately, neither S34 nor S45 is conserved

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

in the bacterial NDH-1. Therefore, we constructed mutations in charged residues that are well

conserved (K46A, E51A) to assess whether this loop is involved in function of the NDH-1/complex I.

Seven site specific mutants (nuoA-K46A; -E51A; -D79A; -D79N; -E81A; -E81Q; -D79N/E81Q) were

generated. The mutations were confirmed by direct DNA sequencing analyses.

Subunit assembly of NDH-1 in NuoA mutants

Figure 3 illustrates Western blotting analyses of the membranes isolated from wild-type and the

NuoA null mutant with affinity-purified antibodies to the NuoAc and peripheral subunits NuoE, NuoF,

NuoG and NuoI of the E. coli NDH-1. The antibody to the NuoAc reacted with the wild-type but did

not react with nuoA::spc mutant (KO mutant). In addition, mutants K46A, E51A, D79A, D79N, E81A,

E81Q, and D79N/E81Q were recognized by the NuoAc antibody. In contrast, membranes isolated from

the wild-type and all available site-specific NuoA mutants seem to bear similar amounts of peripheral

subunits NuoE, NuoF, NuoG and NuoI. Subunits NuoE and NuoF (the NADH-binding subunit) are

known to be essential for deamino-NADH-K3Fe(CN)6 reductase activity (52). These results suggest

that site-specific NuoA mutants apparently remain intact subunit assembly in all NuoA mutants

examined. To further confirm this point, isolated membranes were treated with dodecylmaltoside and

subjected to blue native polyacrylamide gel electrophoresis. Then, the gels were stained for NADH

dehydrogenase activity using NADH and NBT (Figure 4). Two bands appeared in the wild-type

membranes. The upper band, but not the lower band, was recognized by the antibody to the peripheral

subunit NuoE. In addition, the antibody specific to NuoAc reacted with the upper band (data not

shown). Furthermore, the membranes isolated from the KO mutant lacked the NADH dehydrogenase

activity and reactivity with the NuoE antibody in the upper band position. The data indicate that the

NADH dehydrogenase activity of upper band is due to NDH-1. As shown in Figure 4, all the site-

specific nuoA mutants showed comparable NADH dehydrogenase activity band owing to the NDH-1.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

In addition, the site-specific NuoA mutants are similar to the wild-type in terms of relative molecular

size of the NDH-1 bands. It seems likely that constructed site specific mutants are similar to wild type

in terms of subunit assembly.

Effects of NuoA mutation on the NDH-1 activity

We measured activities of NDH-1 using membranes prepared from wild type and NuoA mutants

(Table 2). E. coli membranes contain a second type of NADH dehydrogenases (NDH-2). To eliminate

contribution from the NDH-2, deamino-NADH was used as the substrate in all assays because NDH-2

cannot utilize this compound (32). First, it should be noted that deamino-NADH - K3Fe(CN)6 reductase

activity of all site-specific mutants was comparable to that of the wild type, while the activity of the KO

mutant was almost null. These results are consistent with the data from the NADH dehydrogenase

activity staining of the native gels, suggesting that none of the mutations affected assembly of the NDH-

1 subunits. Second, deamino-NADH oxidase activity and deamino-NADH - DB reductase activity

behaved in a similar fashion among the mutants tested, indicating that the inhibitory effect observed was

solely due to NDH-1 mutation.

Single-residue mutations introduced into the Loop1 (K46 and E51) or the middle of the TM2

(D79 and E81) resulted in either no inhibition or partial (up to 70%) inactivation. However, when the

two carboxyl residues in the TM2 were mutated simultaneously (D79N/E81Q), NDH-1 activities were

almost completely abolished (see also Figure 5). It was, therefore, of particular interest to examine

sensitivity to DCCD of the NDH-1 activity of these mutants. As anticipated, mutations in the Loop1

region (K46 and E51) showed the same degree of DCCD inhibition as the wild type. Of the two

mutants in the TM2, D79 had the same DCCD sensitivity as the wild type. In contrast, the E81 mutants

were less sensitive to DCCD treatment than other mutants and the wild-type. It remains to be seen

whether E81 is one of the target sites of DCCD binding.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15

Miyoshi’s group (34) reported that Cap-40 acts as a competitive inhibitor for Q in the NDH-

1/complex I and suppresses only the energy-coupled activity. We found that all NuoA mutants

described above were almost completely inhibited by Cap-40 (data not shown). Furthermore, the I50

values of Cap-40 for the mutants were about the same as that of the wild type (Table 2), suggesting that

the Q-binding site is not modified by these mutations.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

16

DISCUSSION

The membrane domain of the NDH-1 is composed of 7 subunits which are homologues of

mitochondrially encoded ND subunits. This domain is involved in H+ (or Na+) translocation in the

coupling site 1 (18), but lacks any cofactors. In addition, DCCD, known to specifically modify

carboxyl residues located in the hydrophobic environment, inhibits energy-coupled activities of the

NDH-1/complex I . It is therefore speculated that conserved carboxyl residues located in the middle of

membranes might participate in cation translocation in the coupling site 1. On the basis of the deduced

primary sequence analysis, we predicted that there are eight highly conserved carboxyl residues in the

transmembrane regions of the NDH-1/complex I, namely, two each in subunits NuoA/ND3,

NuoH/ND1, NuoK/ND4L, and NuoL/ND5. It has been reported that the two carboxyl residues in

subunit NuoH are not essential for the energy-coupled activities of the NDH-1 (37). Recently,

Kervinen et al. (43) demonstrated that one of the two conserved carboxyl residues of subunit NuoK

(E36, E. coli numbering) is indispensable for the energy-transducing NDH-1 activities. In this paper,

we have investigated the two conserved carboxyl residues, D79 and E81, of the E. coli NuoA subunit.

As it turned out, mutating only one of them caused either little or partial inhibition of energy-coupled

activities (deamino-NADH – O2 and deamino-NADH – DB). However, these activities were almost

completely lost when both carboxyl groups were removed. There are at least two explanations for the

results obtained with the NuoA mutants. One is that the residues D79 and E81 synergistically

contribute to maintenance of an intact architecture of the NDH-1, and thus disruption of both, but not

either one of them, results in drastic change in the structure. However, this seems unlikely because, in

all mutants examined, the assembly of the whole enzyme seems to be normal and the deamino-NADH-

Fe(CN)6 activity remained unchanged. Another possibility is that D79 and E81 are both involved in

the mechanism of ion translocation, but they may work in a compensatory manner. In other words,

subunit NuoA needs to have at least one carboxyl group in the area where the two residues are located

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17

for the NDH-1 to function as a pump. It can be further postulated that E81 may be in a more favorable

position than D79 because omission of the latter has much less impact on the coupled activities. In fact,

E81 is perfectly conserved in all sequences available in databases, whereas D79 is replaced with C in

Cyanidium caldarium mitochondria (CAA88774) and with G in Pseudomonas aeruginosa (D83410).

The significance of the presence of two carboxyl groups in NuoA is somewhat similar to that in NuoK.

As described above, the NuoK subunit has two highly conserved glutamic acids presumably in the

middle of transmembrane segments. Both residues seem to be required for the optimal activity and

removal of one of them leads to a partial or substantial loss of coupled activity. Although we do not

know relative positioning of the two subunits, NuoA and NuoK, it might be possible that they together

provide negatively-charged groups that constitute H+ or Na+ binding site as reported for certain cation

tranporters (47,53,54).

Recently, it has been reported that two mutations of the ND3 gene (S34P, T10158C; S45P,

T10191C) induced infantile mitochondrial encephalopathy (26) and a progressive mitochondrial disease

(25). The two Ser residues are not conserved and located in Loop 1 segment of the NuoA/ND3 subunit

(see Figure 2). The mutants had moderately reduced amounts (44-65%) of complex I, but drastically

reduced amounts of complex I activity (1-11% remaining) (26). According to the predicted topology of

the NuoA subunit, the Loop 1 segment is localized in the periplasmic phase and, therefore, may not

interact with the peripheral segment of NDH-1/complex I. We have constructed and characterized

mutants of highly conserved charged residues K46 and E51 which are present in the Loop 1 segment.

Although K46A mutation did not affect any NDH-1 activities, E51A mutation showed significant

inhibition (approximately 70% inhibition) of the energy-transducing NDH-1 activities. On the other

hand, neither mutation induced any drastic modification of subunit assembly or capsaicin sensitivity.

The data suggest that the Loop 1 segment may be involved in the NDH-1/complex I activity even

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18

though this loop faces the periplasmic phase (the cytoplasmic phase in mitochondria). In eukaryotes, it

is not easy to manipulate mitochondrial DNA. In contrast, gene manipulation procedures of bacterial

DNA are well advanced. Although there are some limitations, the bacterial NDH-1 is a useful model to

clarify functional roles of amino acid residues of interest, especially residues involved in human

mitochondrial diseases, in the membrane domain ND subunits of complex I.

ACKNOWLEDGMENT We thank Dr. Hideto Miyoshi (Kyoto University, Japan) for kindly

providing capsaicin-40, Dr. George M. Church (Harvard Medical School, Boston) for allowing us to use

the PKO3 plasmid, Dr. Judy Hirst (MRC, U.K.) for providing a pET(EcoNuoE) plasmid, Drs. Byoung

Boo Seo and Isabel Velázquez Lopez for discussion.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

19

REFERENCES

1. Yagi, T. and Matsuno-Yagi, A. (2003) Biochemistry 42, 2266-2274

2. Galkin, A. S., Grivennikova, V. G., and Vinogradov, A. D. (1999) FEBS Lett. 451, 157-161

3. Anraku, Y. and Gennis, R. B. (1987) TIBS 12, 262-266

4. Carroll, J., Fearnley, I. M., Shannon, R. J., Hirst, J., and Walker, J. E. (2003) Mol.Cell Proteomics. 2, 117-126

5. Friedrich, T., Abelmann, A., Brors, B., Guénebaut, V., Kintscher, L., Leonard, K., Rasmussen, T., Scheide, D., Schlitt, A., Schulte, U., and Weiss, H. (1998) Biochim.Biophys.Acta 1365, 215-219

6. Yagi, T., Yano, T., Di Bernardo, S., and Matsuno-Yagi, A. (1998) Biochim.Biophys.Acta 1364, 125-133

7. Takano, S., Yano, T., and Yagi, T. (1996) Biochemistry 35, 9120-9127

8. Yano, T. and Yagi, T. (1999) J.Biol.Chem. 274, 28606-28611

9. Di Bernardo, S. and Yagi, T. (2001) FEBS Lett. 508, 385-388

10. Yano, T., Magnitsky, S., Sled', V. D., Ohnishi, T., and Yagi, T. (1999) J.Biol.Chem. 274, 28598-28605

11. Di Bernardo, S., Yano, T., and Yagi, T. (2000) Biochemistry 39, 9411-9418

12. Kao, M.-C., Di Bernardo, S., Matsuno-Yagi, A., and Yagi, T. (2002) Biochemistry 41, 4377-4384

13. Kao, M.-C., Di Bernardo, S., Matsuno-Yagi, A., and Yagi, T. (2003) Biochemistry 42, 4534-4543

14. Chomyn, A., Mariottini, P., Cleeter, M. W. J., Ragan, C. I., Matsuno-Yagi, A., Hatefi, Y., Doolittle, R. F., and Attardi, G. (1985) Nature 314, 591-597

15. Chomyn, A., Cleeter, M. W. J., Ragan, C. I., Riley, M., Doolittle, R. F., and Attardi, G. (1986) Science 234, 614-618

16. Nakamaru-Ogiso, E., Sakamoto, K., Matsuno-Yagi, A., Miyoshi, H., and Yagi, T. (2003) Biochemistry 42, 746-754

17. Gong, X., Xie, T., Yu, L., Hesterberg, M., Scheide, D., Friedrich, T., and Yu, C. A. (2003) J.Biol.Chem. 278, 25731-25737

18. Steuber, J. (2003) J.Biol.Chem. 278, 26817-26822

19. Nakamaru-Ogiso, E., Seo, B. B., Yagi, T., and Matsuno-Yagi, A. (2003) FEBS Lett. 549, 43-46

20. Robinson, B. H. (1998) Biochim.Biophys.Acta 1364, 271-286

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

20

21. Greenamyre, J. T., Sherer, T. B., Betarbet, R., and Panov, A. V. (2001) IUBMB.Life 52, 135-141

22. Majander, A., Finel, M., Savontaus, M. L., Nikoskelainen, E., and Wikström, M. (1996) Eur.J.Biochem. 239, 201-207

23. Carelli, V., Ghelli, A., Bucchi, L., Montagna, P., De Negri, A., Leuzzi, V., Carducci, C., Lenaz, G., Lugaresi, E., and Degli Esposti, M. (1999) Ann.Neurol. 45, 320-328

24. Crimi, M., Galbiati, S., Moroni, I., Bordoni, A., Perini, M. P., Lamantea, E., Sciacco, M., Zeviani, M., Biunno, I., Moggio, M., Scarlato, G., and Comi, G. P. (2003) Neurology 60, 1857-1861

25. Taylor, R. W., Singh-Kler, R., Hayes, C. M., Smith, P. E., and Turnbull, D. M. (2001) Ann.Neurol. 50, 104-107

26. McFarland, R., Kirby, D. M., Fowler, K. J., Ohtake, A., Ryan, M. T., Amor, D. J., Fletcher, J. M., Dixon, J. W., Collins, F. A., Turnbull, D. M., Taylor, R. W., and Thorburn, D. R. (2004) Ann.Neurol. 55, 58-64

27. Kao, M.-C., Matsuno-Yagi, A., and Yagi, T. (2004) Biochemistry 43, 3750-3755

28. Murphy, E., Huwyler, L., and Freire Bastos, M. C. (1985) EMBO J. 4, 3357-3365

29. Link, A. J., Phillips, D., and Church, G. M. (1997) J.Bacteriol. 179, 6228-6237

30. Han, A.-L., Yagi, T., and Hatefi, Y. (1989) Arch.Biochem.Biophys. 275, 166-173

31. Schagger, H. (1995) Methods Enzymol. 260, 190-202

32. Matsushita, K., Ohnishi, T., and Kaback, H. R. (1987) Biochemistry 26, 7732-7737

33. Yagi, T. (1986) Arch.Biochem.Biophys. 250, 302-311

34. Satoh, T., Miyoshi, H., Sakamoto, K., and Iwamura, H. (1996) Biochim.Biophys.Acta 1273, 21-30

35. Yagi, T., Di Bernardo, S., Nakamaru-Ogiso, E., Kao, M.-C., Seo, B. B., and Matsuno-Yagi, A. (2004) NADH Dehydrogenase (NADH-Quinone Oxidoreductase). In Zannoni, D., editor. Respiration in Archaea and Bacteria, pp. 15 - 40 Kluwer Publishings, Dordrecht

36. Wackwitz, B., Bongaerts, J., Goodman, S. D., and Unden, G. (1999) Mol.Gen.Genet. 262, 876-883

37. Kurki, S., Zickermann, V., Kervinen, M., Hassinen, I., and Finel, M. (2000) Biochemistry 39, 13496-13502

38. Amarneh, B. and Vik, S. B. (2003) Biochemistry 42, 4800-4808

39. Flemming, D., Hellwig, P., and Friedrich, T. (2002) J.Biol.Chem. 278, 3055-3062

40. Chevallet, M., Dupuis, A., Lunardi, J., Van Belzen, R., Albracht, S. P. J., and Issartel, J. P. (1997) Eur.J.Biochem. 250, 451-458

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

21

41. Lunardi, J., Darrouzet, E., Dupuis, A., and Issartel, J. P. (1998) Biochim.Biophys.Acta 1407, 114-124

42. Flemming, D., Schlitt, A., Spehr, V., Bischof, T., and Friedrich, T. (2003) J.Biol.Chem. 278, 47602-47609

43. Kervinen, M., Patsi, J., Finel, M., and Hassinen, I. E. (2004) Biochemistry 43, 773-781

44. Falk-Krzesinski, H. and Wolfe, A. J. (1998) J.Bacteriol. 180, 1174-1184

45. Garofano, A., Zwicker, K., Kerscher, S., Okun, P., and Brandt, U. (2003) J.Biol.Chem. 278, 42435-42440

46. Sorgen, P. L., Hu, Y., Guan, L., Kaback, H. R., and Girvin, M. E. (2002) Proc.Natl.Acad.Sci.U.S.A 99, 14037-14040

47. Kaback, H. R., Sahin-Toth, M., and Weinglass, A. B. (2001) Nat.Rev.Mol.Cell Biol. 2, 610-620

48. Zhang, Y. and Fillingame, R. H. (1994) J.Biol.Chem. 269, 5473-5479

49. Fillingame, R. H. (1999) Science 286, 1687-1688

50. Yagi, T. (1987) Biochemistry 26, 2822-2828

51. Hassinen, I. E. and Vuokila, P. T. (1993) Biochim.Biophys.Acta 1144, 107-124

52. Yano, T., Sled, V. D., Ohnishi, T., and Yagi, T. (1996) J.Biol.Chem. 271, 5907-5913

53. Clapham, D. E. (1998) Nat.Struct.Biol. 5, 342-344

54. Sather, W. A., Yang, J., and Tsien, R. W. (1994) Curr.Opin.Neurobiol. 4, 313-323

55. Devereux, J., Haeberli, P., and Smithies, O. (1984) Nucleic Acids Res. 12, 387-395

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

22

FOOTNOTES 1ABBREVIATIONS: NDH-1, bacterial H+ (Na+)-translocating NADH-quinone oxidoreductase;

complex I, mitochondrial H+-translocating NADH-quinone oxidoreductase; NDH-2, bacterial NADH-

quinone oxidoreductase lacking the energy coupling site; DB, dimethoxy-5-methyl-6-decyl-1,4-

benzoquinone; deamino-NADH, reduced nicotinamide hypoxanthine dinucleotide; Cat,

chloramphenicol; Spc, spectinomycin: NBT, p-nitroblue tetrazolium; PCR, polymerase chain reaction,

EDTA, ehtylenediaminetetraacetic acid; PMSF, phenylmethanesulfonyl fluoride; DCCD, N,N’-

dicyclohexylcarbodiimide; DTT, dithiothreitol; Q, quinone(s); LHON, Leber’s hereditary optic

neuropathy; MELAS, mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes; Cap-

40, capsaicin-40.

2For simplicity, the E. coli terminology was mainly used throughout this paper. Bovine naming was

also used as needed for clarity.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

23

FIGURE LEGENDS

FIGURE 1: Schematic representation of the strategy of nuoA cloning, deletion from the E. coli DNA

and construction of site-specific nuoA mutants. The restriction enzymes in the parentheses are newly

introduced into the E. coli DNA.

FIGURE 2: (A) Comparison of the deduced amino acid sequence of the E. coli NuoA subunit with its

counterparts from various organisms. The comparison was conducted with the PILEUP programs of

GCG software (55). Pd, Paracoccus denitrificans Nqo7 subunit (M93015); Rc, Rhodobacter

capsulatus NuoA subunit (AF029365); Tt, Thermus thermophilus HB-8 Nqo7 subunit (U52917); Hs,

human mitochondrial ND3 subunit (NP_776058); Ec, E. coli K-12 NuoA subunit (U00096/b2288-

b2276). Amino acid residues mutated in this study are marked by asterisks. Three predicted

transmembrane segments (TM1-3) are surrounded by blocks according to the ref (11). Underlined

segment marked NuoAc indicates the oligopeptide region used to raise the antibody specific to the C-

terminal region of the E. coli NuoA. It should be noted that the E. coli NuoA subunit has a significantly

longer C-terminal stretch than other organisms. The positions of the Ser whose mutations to Pro are

involved in human mitochondrial diseases are illustrated by arrow heads.

(B) Proposed topology of the E. coli NuoA subunit. The prediction has been performed on the basis of

the reported topology of its Paracoccus counterpart (11). As described in the text, the three

transmembrane segments of the E. coli NuoA subunit from the N-terminus to the C-terminus are

tentatively designated TM1, TM2, and TM3, respectively. The loops between the TM1 and TM2 and

between TM2 and TM3 are designated L1 and L2, respectively. The N-terminus and C-terminus of the

subunit are exposed to the cytoplasmic side and the periplasmic side of the membrane, respectively.

The mutated amino acid residues are displayed by squares.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

24

FIGURE 3: Immunoblotting of membrane preparations from the wild-type, nuoA-KO, and site specific

nuoA mutants by using antibodies specific to the NuoAc, NuoE, NuoF, NuoG, and NuoI. The

membranes (10 µg of protein per lane) were loaded on a 13% Laemmli SDS polyacrylamide gel. For

immunoblotting for subunit NuoA, the membranes were suspended in the Laemmli’s sample buffer with

additional 4M urea and the samples were incubated on the boiling water for 10 min before loading on

the SDS gels. If these harsh conditions were not used, the NuoA(D79A) and NuoA(E81A) subunit

bands became remarkably thinner than the band of the wild-type and the mobility of the NuoA(D79A)

subunit band on the SDS gels decreased. After electrophoresis the proteins were transferred to

nitrocellulose membranes and western blotting was carried out with SuperSignal West Pico system

(Pierce) according to the ref (30). The secondary antibody used for detection was goat anti-rabbit IgG

horseradish peroxidase conjugate (Pierce).

FIGURE 4: NADH dehydrogenase activity staining and immunostaining of the blue-native

polyacrylamide gels of the E. coli wild type, KO, and NuoA mutant membranes. (A) NADH

dehydrogenase activity staining of the blue-native polyacrylamide gel. The arrow indicates the NADH

dehydrogenase activity band owing to the NDH-1. The electrophoresis and NADH diaphorase staining

were performed as described in “Experimental Procedures”. (B) Immunoblotting of the E. coli

membrane proteins, by using the affinity-purified antibody specific toward the E. coli NuoE subunit.

After blue-native polyacrylamide gel electrophoresis, the E. coli membrane proteins were transferred to

nitrocellulose membranes. Subsequently, the nitrocellulose membranes were immunostained with the

affinity-purified NuoE antibody as described in Figure 3. The arrow shows the location of the

immunoblotting bands recognized by the anti-NuoE antibody.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

25

FIGURE 5: Comparison of deamino-NADH-K3Fe(CN)6 reductase, deamino-NADH oxidase, and

deamino-NADH-DB reductase activities between the wild type and D79N/E81Q mutant membranes.

d-NADH indicates deamino-NADH. (Left) wild-type membranes (80 µg/ml). (Right) D79N/E81Q

mutant membranes (80 µg/ml). Where indicated, 0.15 mM d-NADH and 10 µM Cap-40 were added.

The reaction medium was composed of 10 mM K-Pi (pH 7.0) containing 1 mM EDTA. When required,

10 mM KCN, 100 µM DB and 1mM K3Fe(CN)6 were added. The d-NADH oxidase and d-NADH-DB

reductase activities were observed at 340 nm. The d-NADH-K3Fe(CN)6 reductase activity was

measured at 420 nm.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

26

Table 1. Primers for introduction of a site-specific mutation into E. coli NuoA subunit

mutation mutagenic primer sequencea

NuoA(K46A) 5’-CACGCGCGAGGTCGGCAAACGTGCCGTTTG-3’ NuoA(E51A) 5’-GTGCCGTTTGCATCCGGTATC-3’ NuoA(D79A) 5’-GTTATCTTCGCCGTTGAAGCG-3’ NuoA(D79N) 5’-CGTTATCTTCAACGTTGAAGC-3’ NuoA(E81A) 5’-GTTATCTTCGACGTTGCCGCGCTGTATCTGTTCG-3’ NuoA(E81Q) 5’-CTTCGACGTTCAAGCGCTGTA-3’ NuoA(D79N + E81Q) 5’-CGTTATCTTCAACGTTCAAGC-3’

aUnderline indicates mutation.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

27

Table 2. Enzyme activities of the membrane-bound NDH-1

of E. coli wild type and various NuoA mutants.

NDH-1 Activitiesa

NuoA mutant

dNADH – O2

nmol dNADH/mg of protein/min

dNADH – DB

nmol dNADH/mg of protein/min

dNADH – K3Fe(CN)6

nmol K3Fe(CN)6/mg of protein/min

I50 (Cap-40)b

DCCD inhibitionc

Wild 461 (100%)d 0.13 568 (100%)d 79% 1264 (100%)

KOe 5 (1%) - 47 (8%) - 96 (8%)

K46A 460 (100%) 0.10 534 (94%) 74% 1248 (100%)

E51A 143 (31%) 0.10 171 (30%) 77% 1210 (97%)

D79A 438 (95%) 0.10 487 (86%) 71% 1275 (102%)

D79N 205 (44%) 0.11 208 (37%) 76% 1235 (99%)

E81A 194 (42%) 0.11 207 (36%) 50% 1200 (96%)

E81Q 357 (77%) 0.12 285 (50%) 30% 1170 (94%)

D79N/E81Q 9 (2%) - 57 (10%) - 1222 (98%)

aActivities were average values of at least three measurements. The assays were conducted at 37°C. deamino NADH and decyl ubiquinone are referred to as dNADH and DB, respectively. bThe concentration of capsaicin-40 (µM) that causes 50% inhibition. cThe E. coli membranes (10µg/µL) were treated with 2 mM DCCD for 4 h at room temperature. dCapsaisin-40 at 10 µM in the reaction medium inhibited 96% of dNADH – O2 reductase activity and 88% of dNADH – DB reductase activity. e nuoA knock-out mutant.

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

28

Figure 1

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

29

Figure 2

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

30

Figure 3

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

31

Figure 4

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

32

Figure 5

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Matsuno-Yagi and Takao YagiMou-Chieh Kao, Salvatore Di Bernardo, Marta Perego, Eiko Nakamaru-Ogiso, Akemi

coliNuoA of the proton-translocating NADH-quinone oxidoreductase from escherichia

Functional roles of four conserved charged residues in the membrane domain subunit

published online June 2, 2004J. Biol. Chem. 

  10.1074/jbc.M403885200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on April 6, 2018

http://ww

w.jbc.org/

Dow

nloaded from