1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC...
Transcript of 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC...
![Page 1: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/1.jpg)
Development and validation of Thinopyrum elongatum expressed molecular 1
markers specific for the long arm of chromosome 7E 2
3
Lulu Gou, Jiro Hattori, George Fedak, Margaret Balcerzak, Andrew Sharpe, Paul 4
Visendi, David Edwards, Nicholas Tinker, Yu-Ming Wei, Guo-Yue Chen and Thérèse 5
Ouellet* 6
Jiro Hattori, George Fedak, Margaret Balcerzak, Nicholas Tinker, Thérèse Ouellet 7
Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada, 960 8
Carling Ave, Ottawa, ON K1A 0C6, Canada; 9
Lulu Gou, Yuming Wei, Guoyue Chen 10
Triticeae Research Institute, Sichuan Agricultural University, 211 Huimin Road, 11
Wenjiang, Chengdu, Sichuan 611130, P.R.China; 12
Andrew Sharpe 13
Wheat Improvement Flagship, National Research Council of Canada, 110 Gymnasium 14
Place, Saskatoon, SK S7N 0W9; 15
Paul Visendi 16
School of Agriculture and Food Sciences, University of Queensland, Brisbane, QLD 17
4072 Australia. 18
David Edwards 19
School of Plant Biology, University of Western Australia, WA 6009, Australia 20
Received ---------------. *Corresponding author ([email protected]). 21
1
![Page 2: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/2.jpg)
22
Abbreviations: BC1F2, backcross-one second filial; CS, wheat variety Chinese Spring; 23
CS-7EL, Chinese Spring ditelocentric addition line containing the chromosome 7EL; 24
FHB, fusarium head blight. 25
2
![Page 3: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/3.jpg)
ABSTRACT 26
27
The ditelocentric addition line CS-7EL of the spring wheat (Triticum aestivum) cultivar 28
Chinese Spring (CS) contains the long arm of the chromosome 7E from Thinopyrum 29
elongatum (CS-7EL), which confers high resistance to fusarium head blight. It is of 30
great interest to breeders to integrate the resistance locus (loci) from Th. elongatum 31
into commercial wheat varieties. The objectives of this study were to identify 32
candidate genes expressed from the 7EL chromosome of CS-7EL, to develop 33
7EL-specific molecular markers, and to validate their usefulness to characterize 34
recombination between one of the group 7 chromosomes of wheat and Th. 35
elongatum. High-throughput sequencing of Fusarium graminearum-infected and 36
control CS and CS-7EL cDNA libraries was performed using RNA-Seq. A stepwise 37
bioinformatics strategy was applied to assemble the sequences obtained from 38
RNA-Seq and to create a conservative list of candidate genes expressed from the 39
foreign chromosome 7EL. PCR primer pairs were designed and tested for 135 40
candidate genes. A total of 48 expressed molecular markers specific for the 41
chromosome 7EL were successfully developed. Screening of progenies from two 42
BC1F2 families from the cross CS-7E(7D)×2*CSph1b showed that these markers are 43
useful to characterize recombination events between the chromosomes 7D from 44
wheat and 7E from Th. elongatum. 45
46
3
![Page 4: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/4.jpg)
INTRODUCTION 47
Many accessions of tall wheatgrass Thinopyrum elongatum (Host) D.R. Dewey (also 48
called Lophopyrum elongatum, Agropyron elongatum and Elytrigia elongatum) 49
(2n=14, EE genome) tolerate many abiotic and biotic stresses (Sharma et al., 1989; 50
Taeb et al., 1993; Friebe et al., 1996; Bai and Shaner, 2004; Lammer et al., 2004; 51
Shen et al., 2004; Colmer et al., 2006; Garg et al., 2009; Hussein et al., 2014). Since 52
the last century, successful crosses of E-genome containing species with wheat have 53
facilitated the transfer of desired traits and genes to wheat for genetic improvement 54
(Dvořák and Knott, 1974; Mujeeb-Kazi et al., 2008; Wang et al., 2011). Up to now, Th. 55
elongatum has been used as a donor to transfer genes to bread wheat for 56
improvement of seed quality (Lammer et al., 2004; Garg et al., 2009), as well as 57
resistance to different stresses, including salinity (Colmer, et al., 2006; Hussein et al., 58
2014), waterlogging (Taeb et al., 1993), and diseases such as barley yellow dwarf, 59
leaf rust, and Fusarium head blight (FHB) (Sharma et al., 1989; Friebe et al., 1996; 60
Shen et al., 2004; Zhang et al., 2005) . 61
Fusarium head blight is a devastating disease, caused mainly by the fungus 62
Fusarium graminearum Schwabe (Gibberella zeae (Schwein.) Petch). Fusarium head 63
blight leads to a reduction in grain production in wheat and other small grain cereals, 64
lower grain quality and accumulation of mycotoxins, including deoxynivalenol, 65
potentially making the grain toxic as food and feed (McMullen et al., 1997; Bai and 66
Shaner, 2004). The long arm of chromosome 7E of Th. elongatum has been shown 67
4
![Page 5: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/5.jpg)
to carry the major determinant(s) of resistance to FHB (Shen et al., 2004; Shen and 68
Ohm, 2006; Shen and Ohm, 2007; Wang et al., 2010; Miller et al., 2011; Fu et al., 69
2012). 70
Genetic markers developed for wheat, including genomic- and expressed 71
sequence tags (EST)-derived single sequence repeats (SSRs) and cleaved amplified 72
polymorphic sequences (CAPS), have been useful for mapping traits on Th. 73
elongatum chromosome 7E (You et al., 2003; Shen et al., 2004; Shen and Ohm, 2006; 74
Hu et al., 2012). More recently, 7E specific markers were designed based on specific 75
length amplified fragment sequencing (SLAF) of Th. elongatum genomic DNA 76
fragments (Chen et al., 2013). However, more efforts are needed to develop a 77
sufficient number of Th. elongatum-specific markers to allow genetic mapping and 78
introgression of loci for the desired traits present in Th. elongatum, including 79
resistance to FHB. 80
RNA-Seq is a technology based on high-throughput sequencing which can allow 81
an entire transcriptome to be surveyed in a deep and quantitative manner. However, 82
RNA-Seq data analysis is challenging and costly, requiring specialised bioinformatics 83
software and large computational resources. This is especially true when no 84
reference genomic sequence is available for use as an assembly template (Garg and 85
Jain, 2013). For T. aestivum, which is composed of three large subgenomes and 86
contains more than 80% repetitive sequence, a stepwise assembly process was 87
recently proposed (Duan et al., 2012). However, such analysis is still a large 88
5
![Page 6: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/6.jpg)
undertaking for laboratories with limited computational resources. The 89
bioinformatics strategy presented here for sequence assembly relied on modest 90
computer capacity and on software available in most molecular biology laboratories. 91
Our objectives were to identify differentially expressed candidate gene 92
sequences associated to the Th. elongatum chromosome 7EL through RNA-Seq 93
analysis of heads from spring wheat variety Chinese Spring (CS) compared to those 94
from the ditelocentric addition line CS-7EL when treated with either F. graminearum 95
or water, and to develop, from these sequences, molecular markers diagnostic of the 96
presence of the 7EL fragment. We propose that such markers would improve the 97
accuracy of gene discovery and introgression. 98
99
6
![Page 7: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/7.jpg)
MATERIALS AND METHODS 100
Plant materials 101
Genetic stocks used in this work (Table 1) included Chinese Spring (CS), a CSph1b 102
mutant (Sears, 1977), CS-Th. elongatum ditelocentric addition lines, CS-Th. 103
elongatum disomic addition lines, and CS-Th. elongatum disomic substitution lines 104
(Dvořák and Knott, 1974; Dvořák, 1979; Dvořák, 1980). A cross was made between 105
the CSph1b mutant (confirmed homozygous for ph1b) and the substitution line 106
CS-7E(7D) using pollen from a single plant of each genotype. F1 plants were 107
backcrossed with the CSph1b mutant and 556 BC1F1 (backcross-one first filial) plants 108
were obtained; those were screened with the marker PSR574 (specific for ph1b; 109
Roberts et al., 1999) and 286 plants were identified as homozygous recessive for 110
ph1b. The homozygous recessive plants were point-inoculated with F. graminearum 111
(Somers et al., 2003) and 124 had a FHB-resistance phenotype. Meiosis was 112
examined in the pollen mother cells of the BC1F1 plants with an FHB-resistance 113
phenotype for normal chromosome pairing, which was indicative of an induction of 114
chromosome pairing between the homoeologous chromosomes 7E and 7D. Ten 115
plants were selected on the basis of normal chromosome pairing and best scores for 116
FHB resistance. BC1F2 progenies (47 individuals) from two of those plants, 58-5 and 117
64-8, were used in this work. 118
119
Inoculation of plants with F. graminearum 120
7
![Page 8: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/8.jpg)
A highly virulent isolate of F. graminearum, DAOM 180378 (Canadian Collection of 121
Fungal Cultures, Agriculture and Agri-Food Canada, Ottawa, Canada) was used for 122
plant inoculations. For spore production, a 3 mm plug of F. graminearum was 123
extracted from a fresh SNA (Spezieller-Nährstoffar Agar) plate culture and 124
transferred to 50 mL of CMC (carboxymethylcellulose) medium (Cappellini and 125
Peterson, 1965); cultures were shaken at 28 °C in the dark for 3 d and conidia were 126
harvested by passing the culture through sterile Miracloth (Calbiochem) to separate 127
mycelium from spores. Macroconidia were washed with sterile water three times by 128
centrifugation at 4,000 rpm for 10 min. 129
Plants from CS, a moderately FHB-susceptible variety, and CS-7EL, a 130
FHB-resistant ditelocentric addition line which contains the long arm of chromosome 131
7E from Th. elongatum (Wang et al., 2010), were grown in a controlled-environment 132
cabinet under a 16 h light (20 °C, about 750 μmol photons/m2 x s) and 8 h dark (16 °C) 133
cycle until mid-anthesis. 3 plants were grown per pot, in 5 in fiber pots, and the soil 134
used was a mix of 1 part top soil, 1 part sand and 1 part Pro-Mix. Fertilizer 135
(20-20-20, 2 g/L) was applied once a week from the 2-leaf stage until the plants were 136
3 to 4 in tall, then fed twice a week until plants were in boot stage; between the 137
start of boot stage and mid-anthesis, the plants were fed with a 20-5-35 fertilizer (2 138
g/L) once a week, then the 20-20-20 fertilization was resumed once a week. The 139
plants at mid-anthesis were transferred to a growth room at 25 °C, and 10 µL of 140
either water (mock inoculation treatment as a control) or a F. graminearum 141
8
![Page 9: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/9.jpg)
macroconidial spore suspension at 1x105 spores/mL was point-inoculated with a 142
micropipette between the lemma and palea of two basal florets of each fully 143
developed spikelet of each head. Ten to twelve heads were inoculated per biological 144
replicate and three replicates were done per treatment. Following inoculation, 145
plants were transferred into a growth room where they were misted overhead for 30 146
s every 1 h during the light period for 2 d. Following this, they were moved to a 147
non-misted bench in the same growth room maintained at 75% humidity. Day-length 148
in the growth room was maintained at 16 h, and temperature was maintained at a 149
constant 25 °C. At 4 d after inoculation, rachis segments from the inoculated 150
portion of each head (spikelets removed) were harvested, immediately frozen in 151
liquid nitrogen and stored at -80 °C. 152
153
RNA isolation, cDNA library preparation and sequencing 154
Plant total RNA from rachis tissues was extracted using the TRIzol (Invitrogen Canada 155
Inc., Burlinton, Ontario) method. Isolated RNAs were treated with an RNase-free 156
DNase (Qiagen, Mississauga, Canada) and cleaned using RNeasy Mini Kits (Qiagen) 157
according to manufacturer’s instructions. RNA quality and quantity was 158
determined using a 2100 BioAnalyzer (Agilent Technologies Canada Inc, Mississauga, 159
ON, Canada). 160
Multiplexed cDNA libraries for sequencing were prepared from total RNA using 161
the TruSeq RNA Sample Preparation v2 kit (Illumina, Inc, San Diego, CA) and MID tags 162
9
![Page 10: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/10.jpg)
as described by the Manufacturer. The twelve libraries were sequenced using the 163
short-read paired-end protocol (2 x 100 b/read) in one lane on an Illumina (San 164
Diego, USA) HiSeq 2500 System using the Illumina HiSeq Cluster kit and following the 165
manufacturer’s instructions. 166
167
Bioinformatics analyses of RNA-Seq sequences 168
Illumina reads from the six CS and six CS-7EL cDNA libraries were assembled 169
following a two-step strategy to identify candidate expressed genes originating from 170
the Th. elongatum 7EL chromosome arm in the CS ditelocentric addition line CS-7EL. 171
At the time of the analysis, only a draft genome sequence was available for T. 172
aestivum and very limited genomic sequences were available for Th. elongatum. 173
The focus of the bioinformatics analysis was to identify enriched CS-7EL expressed 174
genes that were absent in the CS samples (Part A below), and which did not show 175
homology or homoeology with other available T. aestivum genomic and cDNA 176
sequences, but did show putative orthology with T. aestivum group 7 chromosomes 177
sequences (Part B). 178
Part A: assembly to identify CS-7EL-enriched sequences. 179
This step is illustrated in Fig. 1, with detailed parameters presented in 180
Supplementary Table 1. All assemblies were performed using SeqMan NGen 4.0.0 181
(DNASTAR, Madison, WI) with the option ‘de novo’ for the first two steps and 182
SeqMan NGen 3.1.2 (DNASTAR) with the option “small-templated” for the 3rd step. 183
10
![Page 11: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/11.jpg)
In a first step, each of the twelve samples was assembled separately. Unassembled 184
reads (referred to as singletons) were then assembled across treated and 185
non-treated samples within each germplasm; remaining singletons were discarded. 186
In a second step, for CS-7EL, the de novo assembly was based on all contigs from the 187
sub-assemblies in the first step. For CS, all contigs from step 1 were co-assembled 188
with publicly available EST sequences from CS (NCBI; http://www.ncbi.nlm.nih.gov/ ), 189
to provide a broader reference base of expressed T. aestivum sequences. The 190
resulting contigs in both assemblies were scanned for F. graminearum contaminating 191
sequences using the F. graminearum genome database (FGDB) v3.2 open reading 192
frames (ORFs; Wong et al., 2011) obtained from the Munich Information Center for 193
Protein Sequences (http://mips.helmholtz-muenchen.de/genre/proj/FGDB/), and 194
matching contigs were removed. In a third step, the CS contigs and singletons from 195
the second step, together with F. graminearum ORFs, were used as a reference 196
template onto which second-step contigs from CS-7EL were assembled. The CS-7EL 197
sequences that assembled with CS or F. graminearum sequences were discarded. 198
The CS-7EL sequences that did not assemble onto the reference template are 199
referred to as ‘CS-7EL-enriched singletons’; in addition to Th. elongatum 7EL 200
candidate genes, these singletons could also include T. aestivum sequences that 201
were not present in the public database at the time of analysis. Further enrichment 202
and characterization of these “singletons” was performed in Part B of the analysis. 203
Part B: Identification of 7EL orthologs. 204
11
![Page 12: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/12.jpg)
RNA-Seq reads from all 12 cDNA libraries were independently mapped to a 205
combined reference template including T. aestivum genomic sequence for 206
chromosomes 7A, 7B, 7D and 4AL (Berkman et al., 2011; Hernandez et al., 2012; 207
Lorenc et al., 2012; Berkman et al., 2013) and F. graminearum genomic sequence 208
using Tophat (version 2.0.4) (Kim et al., 2013), to identify among the T. aestivum 209
genomic contigs originating from the group 7 chromosomes of wheat those that 210
contains sequences expressed in our samples. We then proceeded in two steps to 211
identify CS-7EL-enriched singletons that matched T. aestivum genomic sequences 212
from the group 7 chromosomes at a predicted range of orthology (see below). First, 213
the CS-7EL-enriched singletons from step 3 of Part A were BLAST-aligned against the 214
genomic sequences from the group 7 chromosomes of T. aestivum that contained 215
expressed sequences, and singletons within the estimated range of orthology were 216
kept. Those singletons were then blasted against a full draft genome sequence 217
assembly (5x coverage) of Chinese Spring ( Brenchley et al., 2012) and those showing 218
similarity in a range estimated for homoeology between wheat subgenomes were 219
discarded. Finally, the longest (>500bp) of the remaining singletons were further 220
blasted to a local T. aestivum EST database containing ESTs from all T. aestivum 221
varieties (Hattori et al., 2005) and to the raw Wheat Survey Sequence database 222
(International Wheat Genome Sequencing Consortium repository hosted at Unité de 223
Recherche Génomique, http://wheat-urgi.versailles.inra.fr/Seq-Repository/BLAST; 224
12
![Page 13: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/13.jpg)
accessed between February 2013 and March 2014), to further eliminate probable T. 225
aestivum sequences. 226
Appropriate thresholds to distinguish homology and orthology were estimated 227
as follows. Firstly, the level of sequence similarity between Th. elongatum and T. 228
aestivum sequences was estimated from BLAST alignments between 369 Th. 229
elongatum sequences (obtained from NCBI) and their closest sequence match 230
among the contigs from our CS assembly. Secondly, the average level of similarity 231
between hexaploid T. aestivum homoeologous gene sequences was estimated from 232
CS ESTs that assembled into distinct triplet sets. This step allowed calibration of the 233
similarity on a cDNA basis, and avoided uncertainty related to genome assembly and 234
gene prediction, both of which were unavailable for T. aestivum at the time of 235
analysis. The CS-7EL-enriched singletons retained, referred to as candidate 7EL 236
expressed genes, were mapped onto the complete Brachipodium distachyon 237
genome (http://www.plantgdb.org/BdGDB/ cgi-bin/blastGDB.pl) using sequence 238
similarity detected by BLAST. 239
240
DNA extraction and PCR analysis 241
Total genomic DNA was extracted from young leaves of CS, CS-7EL and CS-7ES using 242
a modified cetyl trimethylammonium bromide (CTAB) extraction protocol (Doyle, 243
1990). DNA quality was checked on 1.0% agarose gels, and concentration was 244
13
![Page 14: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/14.jpg)
determined using a NanoDrop-1000 spectrometer (NanoDrop Technologies, DE, 245
USA). 246
Up to three PCR primer pairs were designed for each of 135 candidate 7EL 247
expressed genes using the PrimerSelect application from the software Lasergene 248
(DNASTAR) and synthesized by Sigma Biology (Oakville, Canada). Regions of 249
maximum difference between the 7EL candidate genes and the most similar T. 250
aestivum sequences were favored for primer design. PCR amplifications were 251
performed in a 20 µL reaction mix consisting of 1×PCR buffer II (Roche, Branchburg, 252
New Jersey, USA), 2.0 mM MgCl2, 0.6 mM dNTPs, 1.0 mM oligonucleotide primers, 253
20 ng DNA solution from CS, CS-7EL or CS-7ES genomic DNA, and 1 U AmpliTaq Gold 254
polymerase (Roche). Reactions were performed in an MJ Research Thermal Cycler, 255
with conditions set to 94 ℃ for 5 min, followed by 35 cycles consisting of 94 ℃ for 30 256
s, 50-60 ℃ for 30 s, 72 ℃ for 40 s, with a final extension at 72 ℃ for 10 min.. PCR 257
products were resolved on 2% agarose gels containing ethidium bromide and 258
visualized with a UV transilluminator. 259
Using the best pair of primers for each 7EL-specific molecular markers, 260
specificity of amplification was further tested on genomic DNA from a series of 261
disomic addition lines, with each line containing one of the seven chromosomes 262
from Th. elongatum in CS background: CS-1E to CS-7E, as well as on DNAs from the 263
CS-Th. elongatum disomic substitution lines CS-7E(7A), CS-7E(7B), CS-7E(7D), where 264
one of the chromosome 7 of T. aestivum (the one mentioned in bracket in the name) 265
14
![Page 15: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/15.jpg)
is substituted by the chromosome 7E from Th. elongatum (Table 1; Dvořák and Knott, 266
1974; Dvořák, 1980). 267
To assess the utility of the 7EL-specific molecular markers, they were also used 268
to characterize 47 progeny from two BC1F2 families selected from the cross 269
CS-7E(7D)x 2*CSph1b (Table 1). The data obtained was analysed with the maximum 270
likelihood algorithm in JoinMap 4.0 (Kyazma, Wageningen, Netherlands) to produce 271
a preliminary order for our 7EL-specific molecular markers. 272
15
![Page 16: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/16.jpg)
RESULTS 273
Candidate 7EL expressed genes identified from RNA-Seq analysis 274
Twelve rachis samples from the moderately FHB-susceptible CS and the 275
FHB-resistant ditelocentric addition line CS-7EL, which contains the long arm of 276
chromosome 7E from Th. elongatum, were sequenced using RNA-Seq; 8.8 to 11.6 M 277
reads were obtained per sample. The stepwise bioinformatics strategy used to 278
identify candidate 7EL expressed genes from the RNA-Seq analysis is described in 279
details in Material and Methods and the assembly part of it (Part A) is illustrated in 280
Fig. 1. Our assembly strategy identified a set of about 1,229,000 CS-7EL-enriched 281
“singletons” (sequences not assembled in the last assembly step); those needed to 282
be further characterized for additional enrichment. 283
To estimate the degree of orthology between Th. elongatum and T. aestivum, 284
we compared 369 Th. elongatum sequences with their closest match among the 285
contigs from our CS assembly. Seventy percent of the Th. elongatum sequences 286
showed greater than 84% similarity to CS contigs (Supplementary Fig. 1). To estimate 287
the degree of homoeology between T. aestivum subgenomes, triplet sequences from 288
low copy genes in the CS EST collections were aligned; this showed that most 289
homoeologs within T. aestivum differed by less than 4% (data not shown). Based 290
on this information, we selected thresholds of 85% to 95% (for orthology) and 291
greater than 95% (for homoeology) as conservative choices for further enrichment of 292
the collection of CS-7EL enriched “singletons” to a more conservative group of 9,494 293
16
![Page 17: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/17.jpg)
candidate 7EL expressed genes. Most (78%) of the candidate 7EL expressed genes 294
mapping to B. distachyon genomic sequence showed a best ortholog on Bd 1 or Bd 3. 295
296
7EL-specific molecular markers 297
After additional BLAST-alignment of candidate 7EL expressed genes with any 298
available T. aestivum sequences and removal of those with similarity within the 299
range estimated for homoeology, a conservative set of 135 candidate 7EL expressed 300
genes with length greater than 500 b were selected for validation as candidate genes 301
from the chromosome 7EL of Th. elongatum. Primer pairs for 87 candidate 7EL 302
expressed genes produced non-polymorphic bands between CS, CS-7EL and/or 303
CS-7ES in our assay conditions. Fully diagnostic Th. elongatum 7EL 304
chromosome-specific molecular markers were identified for 48 candidate 7EL 305
expressed genes. The primer sequences for all of the 7EL-specific molecular markers 306
are presented in Table 2. Of the 48 candidate expressed genes from which 307
7EL-specific molecular markers were designed, the majority (28) had a best homolog 308
on chromosome 1 of B. distachyon, nine matched to either chromosome 2, 3 or 4, 309
and 11 had no significant similarity with B. distachyon genes (Table 2). Full sequences 310
and additional information on the 48 candidate 7EL expressed genes are provided in 311
Supplementary Table 2. Examples of PCR amplification results with some of the 312
7EL-specific molecular markers are presented in Fig. 2, showing specific amplification 313
with CS-7EL only. Further amplification tests showed that all of the markers were 314
17
![Page 18: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/18.jpg)
specific to the 7E chromosome and did not amplify any band from the 6 other E 315
chromosomes nor unexpected bands from the CS-Th. elongatum disomic 316
substitution lines CS-7E(7A), CS-7E(7B), CS-7E(7D),( see example with molecular 317
marker M7EL-1 in Fig. 3). 318
319
Recombination in F2 families from the cross CS-7E(7D)× 2*CSph1b 320
The 7EL-specific molecular markers were used to characterize 47 progeny from two 321
BC1F2 families selected from the cross CS-7E(7D)x 2*CSph1b (Table 1), which allowed 322
recombination between the chromosomes 7D (of T. aestivum) and 7E (of Th. 323
elongatum) . Figure 4 shows an example of the results obtained with the molecular 324
marker M7EL-1. Results of all 7EL-specific molecular markers on all lines from the 325
two families are summarized in Supplementary Table 3 (in tab “Marker results 326
unordered”). Our results showed that only the CS genotype was observed in eight 327
out of 19 individuals from the 64-8 family and in 14 out of 28 individuals from the 328
58-5 family, while four individuals of the 58-5 family (none in 64-8) carried all 329
markers tested for 7EL. In all other individuals of both families, a variable subset of 330
the 7EL-specific markers was absent. Using the above results, we estimated that 331
recombination between the long arms of 7E and 7D occurred in 32% of the progeny 332
in family 58-5 and in 58% of the progeny from family 64-8. However, since all T. 333
aestivum scores are marked by the null PCR allele, we cannot exclude that some null 334
scores represent misamplifications of the dominant Th. elongatum allele. This is 335
18
![Page 19: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/19.jpg)
most likely to be the case for progeny in which only a single null allele was observed. 336
A more conservative estimation of the recombination frequency between 7EL and 337
7DL would be of 25% and 53% for the families 58-5 and 64-8, respectively. 338
339
19
![Page 20: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/20.jpg)
DISCUSSION 340
A RNA-Seq dataset comparing expression in two wheat lines, CS and CS-7EL, was 341
used to identify candidate expressed genes specific to the Th. elongatum 7EL 342
chromosome arm. The bioinformatics strategy that we have tested, using modest 343
computer capacity and software available in most molecular biology laboratories, 344
has allowed the identification of over 9,000 candidate 7EL expressed genes. Some 345
of the stepwise assembly methods (e.g. assembly of individual samples) could be 346
simplified by single assembly steps if resources (e.g. computer memory) allowed. 347
However, the stepwise methods also have the advantage of providing intermediate 348
sub-assemblies that may be useful in other investigations. 349
The assignment of candidate genes to the 7EL-specific group was based on 350
current understanding of the relationship between T. aestivum and Th. elongatum 351
genomes and comprehensive use of publicly-available databases. Recently published 352
studies corroborate our choices of orthology and homoeology thresholds. 353
Bioinformatics analysis of transcriptome from Th. elongatum under water deficit 354
stress has shown that 47% of the unique transcripts profiled had a significant 355
similarity to T. aestivum genes, with most of them showing 80% or more similarity 356
and the largest number of transcripts being 95 to 98% similar to T. aestivum (Shu et 357
al., 2015). Our selected threshold for exclusion of homoeologous sequences (96 to 358
100% similarity) is supported by a recent study that reported an average of 97% 359
gene sequence similarity between subgenomes A, B and D of T. aestivum (The 360
20
![Page 21: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/21.jpg)
International Wheat Genome sequencing Consortium, 2014). Our selected 361
thresholds will exclude highly conserved Th. elongatum genes (e.g., ubiquitin, 362
histones) and also genes with no T. aestivum counterparts. Discovery of those 363
genes would require the sequence of the Th. elongatum genome, or a concerted 364
effort to test and map more PCR amplicons by trial and error. Consequently, the set 365
of 7EL-specific candidate genes obtained is considered to be a conservative but 366
useful set of reference genes, and it is expected that additional genes specific to 7EL 367
will be identified when extensive genomic sequence data becomes available for Th. 368
elongatum. 369
Mapping of the candidate 7EL expressed genes to B. distachyon genomic 370
sequence showed a best ortholog on Bd 1 or Bd 3, the two B. distachyon 371
chromosomes known to be syntenic to T. aestivum chromosomes from the group 7 372
(International Brachypodium Initiative, 2010; Kumar et al., 2012). This is consistent 373
with the close relationship observed between the E genome of Th. elongatum and 374
the A, B and D subgenomes of T. aestivum (Dvořák and Knott, 1974; Liu et al., 2007; 375
Hu et al., 2012). 376
We were able to develop 7EL-specific molecular markers for 48 of the 135 377
candidate 7EL expressed genes used for validation. Our result represents a success 378
rate of 36% for the development of specific markers from characterized sequences. 379
This is higher than the success obtained when using sequences from SLAF-Seq 380
technology (Chen et al., 2013), where 26% of the genomic sequences led to the 381
21
![Page 22: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/22.jpg)
development of specific markers for the same chromosome arm. The method 382
presented here also shows a considerable improvement in the rate of discovery of 383
specific markers when compared to other methods used to develop 7E-specific 384
markers, such as RAPD, SSR, SSH, ESTs and PLUG (You et al., 2003; Shen et al., 2004; 385
Shen and Ohm, 2006; Fu et al., 2012; Hu et al., 2012). Our greater success rate can 386
be explained at least in part by the increasing availability of Th. elongatum and T. 387
aestivum genomic sequences, allowing for a more precise design of species-specific 388
molecular markers. 389
Spontaneous translocations and substitutions between Thinopyrum E and T. 390
aestivum D genomes have been observed in other studies, and Southern 391
hybridizations with genomic DNAs has shown that the E genome of Thinopyrum 392
species was more closely related to the D genome than the A and B subgenomes of T. 393
aestivum (Liu et al., 2007). It has also been shown that homoeologous pairing and 394
recombination between the D and E genomes can be facilitated by the use of the 395
wheat mutant line CSph1b (Qi et al., 2007; Niu et al., 2011; Niu et al., 2014). In our 396
crossing experiment, the ph1b mutation in CSph1b (Sears 1977) allowed 397
homoeologous pairing between the Th. elongatum chromosome 7E in the 398
substitution line CS-7E(7D), which is missing 7D, and the 7D chromosome present in 399
CSph1b. The molecular markers developed in this study allowed us to estimate the 400
recombination frequency between 7D (T. aestivum) and 7E (Th. elongatum) in two 401
BC1F2 families from the cross CS-7E(7D)x 2*CSph1b. No 7EL-specific markers were 402
22
![Page 23: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/23.jpg)
observed in 22 of the progeny analysed, suggesting that no recombination occurred 403
between the long arms of the 7E and 7D chromosomes in those individuals and that 404
only the long arm of 7D remained in these lines. Four individuals carried all markers 405
tested for 7EL and may contain a full version of the long arm of 7E. In all other 406
individuals of both families, a variable subset of the 7EL-specific markers was absent, 407
suggesting that recombination between the long arms of 7E and 7D had occurred. 408
The recombination frequency of 25% to 53% that we have observed in the two BC1F2 409
families is intermediate to other reports. Niu et al. (2014) results suggested about 410
80% recombination between chromosome 7D (T. aestivum) and a large segment of 411
7E (whole 7EL+7ES half proximal to the centromere) from Th. ponticum. Qi et al. 412
(2007) obtained 2% recombination between the short arms of chromosomes 4D (T. 413
aestivum) and 4Ai of Th. intermedium. 414
A genetic order and graphical genotypes produced using the 7EL-specific 415
molecular marker data for the BC1F2 families revealed putative sites of 416
recombination (Tab “Markers ordered” of Supplementary Table 3). However, 417
because this result is based on a very small number of progeny, it is very 418
approximate; data will need to be collected on a larger number of progenies and 419
families before meaningful mapping could be performed. 420
There has been substantial interest in transferring traits from Thinopyrum 421
species to wheat, particularly those conferring resistance to disease. However, it has 422
been difficult to develop reliable molecular markers specific to Thinopyrum 423
23
![Page 24: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/24.jpg)
chromosomes. This is in part due to the high level of sequence similarity between T. 424
aestivum and Thinopyrum species (Liu et al., 2007; Hu et al., 2012), and to the 425
paucity of sequence information, especially from Thinopyrum species. In the 426
present study, we have tested with success a bioinformatics strategy to analyse 427
RNA-Seq data and publically available sequences in the identification of candidate 428
expressed genes from the Th. elongatum 7EL chromosome arm introgressed into the 429
ditelocentric addition line CS-7EL. Furthermore, we have used these candidate 7EL 430
expressed genes to develop reliable PCR-based markers, and have demonstrated the 431
utility of those markers in identifying recombination events between a native and an 432
introgressed chromosome fragments. These markers will provide identification of 433
specific fragments that may allow refinement and isolation of genes for desired 434
traits. 435
436
437
24
![Page 25: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/25.jpg)
Acknowledgements 438
We would like to thank Darrin Klassen, Danielle Wolfe–Deshaies and Dawn Chi for 439
providing the plant material used in this study. The financial support of Agriculture 440
and Agri-Food Canada’s Canadian Crops Genomics Initiative and A-base are 441
gratefully acknowledged. L.G. was supported by the China Scholarship Council under 442
the MOE-AAFC PhD Research Program. D.E. would like to acknowledge funding 443
support from Australian Research Council (Projects LP0882095 and LP0883462). 444
Support is also acknowledged from the Australian Genome Research Facility (AGRF). 445
P.V. would also like to thank the Australian Department of Foreign Affairs and Trade 446
(DFAT) for funding support. 447
448
25
![Page 26: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/26.jpg)
References 449
Bai, G. and G. Shaner. 2004. Management and resistance in wheat and barley to 450
Fusarium head blight. Annu. Rev. Phytopathol. 42: 135-161. 451
452
Berkman, P.J., A. Skarshewski, M.T. Lorenc, K. Lai, C. Duran, E.Y. Ling, J. Stiller, L. 453
Smits, M. Imelfort, S. Manoli, M. McKenzie, M. Kubaláková, H. Šimková, J. Batley, D. 454
Fleury, J. Doležel and D. Edwards. 2011. Sequencing and assembly of low copy and 455
genic regions of isolated Triticum aestivum chromosome arm 7DS. Plant Biotechnol. J. 456
9: 768-775. 457
458
Berkman, P.J., P. Visendi, H.C. Lee, J. Stiller, S. Manoli, M.T. Lorenc, K. Lai, J. Batley, D. 459
Fleury, H. Simková, M. Kubaláková, S. Weining, J. Doležel and D. Edwards. 2013. 460
Dispersion and domestication shaped the genome of bread wheat. Plant Biotechnol. 461
J. 11: 564-571. 462
463
Brenchley, R., M. Spannagl, M. Pfeifer, G.L. Barker, R. D’Amore, A.M. Allen, N. 464
McKenzie, M. Kramer, A. Kerhornou, D. Bolser, S. Kay, D. Waite, M. Trick, I. Bancroft, 465
Y. Gu, N. Huo, M.C. Luo, S. Sehgal, B. Gill, S. Kianian, O. Anderson, P. Kersey, J. 466
Dvorak, W.R. McCombie, A. Hall, K.F. Mayer, K.J. Edwards, M.W.Bevan and N. Hall. 467
2012. Analysis of the bread wheat genome using whole-genome shotgun sequencing. 468
Nature 491: 705-710. 469
26
![Page 27: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/27.jpg)
470
Cappellini, R. and J. Peterson. 1965. Macroconidium formation in submerged 471
cultures by a non-sporulating strain of Gibberella zeae. Mycologia: 962-966. 472
473
Chen, S., Z. Huang, Y. Dai, S. Qin, Y. Gao, L. Zhang, Y. Gao and J. Chen. 2013. The 474
development of 7E chromosome-specific molecular markers for Thinopyrum 475
elongatum based on SLAF-seq technology. PloS One 8: e65122. 476
477
Colmer, T.D., T.J. Flowers and R. Munns. 2006. Use of wild relatives to improve salt 478
tolerance in wheat. J. Exper. Bot.57: 1059-1078. 479
480
Doyle, J.J. 1990. Isolation of plant DNA from fresh tissue. Focus 12: 13-15. 481
482
Duan, J., C. Xia, G. Zhao, J. Jia and X. Kong. 2012. Optimizing de novo common wheat 483
transcriptome assembly using short-read RNA-Seq data. BMC Genomics 13: 392. 484
485
Dvořák, J. 1979. Metaphase I pairing frequencies of individual Agropyron elongatum 486
chromosome arms with Triticum chromosomes. Can. J. Genet. Cytol. 21: 243-254. 487
488
Dvořák, J. 1980. Homoeology between Agropyron elongatum chromosomes and 489
Triticum aestivum chromosomes. Can. J. Genet. Cytol.22: 237-259. 490
27
![Page 28: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/28.jpg)
491
Dvořák, J. and D. Knott. 1974. Disomic and ditelosomic additions of diploid 492
Agropyron elongatum chromosomes to Triticum aestivum. Can. J. Genet. Cytol. 16: 493
399-417. 494
495
Friebe, B., J. Jiang, W. Raupp, R. McIntosh and B. Gill. 1996. Characterization of 496
wheat-alien translocations conferring resistance to diseases and pests: current status. 497
Euphytica 91: 59-87. 498
499
Fu, S., Z. Lv, B. Qi, X. Guo, J. Li, B. Liu and F. Han. 2012. Molecular Cytogenetic 500
Characterization of wheat–Thinopyrum elongatum addition, substitution and 501
translocation lines with a novel source of resistance to wheat Fusarium Head Blight. J. 502
Genet. Genom. 39: 103-110. 503
504
Garg, M., H. Tanaka, N. Ishikawa, K. Takata, M. Yanaka and H. Tsujimoto. 2009. 505
Agropyron elongatum HMW-glutenins have a potential to improve wheat 506
end-product quality through targeted chromosome introgression. J. Cereal Sci. 50: 507
358-363. 508
509
Garg, R. and M. Jain. 2013. RNA-Seq for transcriptome analysis in non-model plants. 510
Methods Mol. Biol. 1069: 43-58. 511
28
![Page 29: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/29.jpg)
512
Hattori, J., T. Ouellet and N.A. Tinker. 2005. Wheat EST sequence assembly facilitates 513
comparison of gene contents among plant species and discovery of novel genes. 514
Genome 48: 197-206. 515
516
Hernandez, P., M. Martis, G. Dorado, M. Pfeifer, S. Gálvez, S. Schaaf, N. Jouve, H. 517
Šimková, M. Valárik, J. Doležel and K.F. Mayer. 2012. Next-generation sequencing 518
and syntenic integration of flow-sorted arms of wheat chromosome 4A exposes the 519
chromosome structure and gene content. Plant J. 69: 377-386. 520
521
Hu, L.-J., C. Liu, Z.-X. Zeng, G.-R. Li, X.-J. Song and Z.-J. Yang. 2012. Genomic 522
rearrangement between wheat and Thinopyrum elongatum revealed by mapped 523
functional molecular markers. Genes Genom. 34: 67-75. 524
525
Hussein, Z., A. Dryanova, D. Maret and P.J. Gulick. 2014. Gene expression analysis in 526
the roots of salt-stressed wheat and the cytogenetic derivatives of wheat combined 527
with the salt-tolerant wheatgrass, Lophopyrum elongatum. Plant Cell Reports 33: 528
189-201. 529
530
International Brachypodium Initiative. 2010. Genome sequencing and analysis of the 531
model grass Brachypodium distachyon. Nature 463: 763-768. 532
29
![Page 30: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/30.jpg)
533
Kim, D., G. Pertea, C. Trapnell, H. Pimentel, R. Kelley and S.L. Salzberg. 2013. TopHat2: 534
accurate alignment of transcriptomes in the presence of insertions, deletions and 535
gene fusions. Genome Biol. 14: R36. 536
537
Kumar, S., H.S. Balyan and P.K. Gupta. 2012. Comparative DNA Sequence Analysis 538
Involving Wheat, Brachypodium and Rice Genomes Using Mapped Wheat ESTs. J. 539
Triticeae Genom. Genet. 3: 25-37. 540
541
Lammer, D., X. Cai, M. Arterburn, J. Chatelain, T. Murray and S. Jones. 2004. A single 542
chromosome addition from Thinopyrum elongatum confers a polycarpic, perennial 543
habit to annual wheat. J. Exper. Bot. 55: 1715-1720. 544
545
Liu, Z., D. Li and X. Zhang. 2007. Genetic relationships among five basic genomes St, E, 546
A, B and D in Triticeae revealed by genomic Southern and in situ hybridization. J. 547
Integr. Plant Biol. 49: 1080-1086. 548
549
Lorenc, M.T., S. Hayashi, J. Stiller, H. Lee, S. Manoli, P. Ruperao, P. Visendi, P.J. 550
Berkman, K. Lai, J. Batley and D. Edwards. 2012. Discovery of single nucleotide 551
polymorphisms in complex genomes using SGSautoSNP. Biology 1: 370-382. 552
553
30
![Page 31: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/31.jpg)
McMullen, M., R. Jones and D. Gallenberg. 1997. Scab of wheat and barley: a 554
re-emerging disease of devastating impact. Plant Disease 81: 1340-1348. 555
556
Miller, S., E. Watson, J. Lazebnik, S. Gulden, M. Balcerzak, G. Fedak and T. Ouellet. 557
2011. Characterization of an alien source of resistance to Fusarium head blight 558
transferred to Chinese Spring wheat. Botany 89: 301-311. 559
560
Mujeeb-Kazi, A., A. Cortes, A. Gul, M. Farooq, F. Majeed, I. Ahmad, H. Bux, M. 561
William, V. Rosas and R. Delgado. 2008. Production and cytogenetics of a new 562
Thinopyrum elongatum/Triticum aestivum hybrid, its amphiploid and backcross 563
derivatives. Pakistan J. Bot. 40: 565-579. 564
565
Niu, Z., D.L. Klindworth, T.L. Friesen, S. Chao, Y. Jin, X. Cai and S.S. Xu. 2011. Targeted 566
introgression of a wheat stem rust resistance gene by DNA marker-assisted 567
chromosome engineering. Genetics 187: 1011-1021. 568
569
Niu, Z., D. Klindworth, G. Yu, T. Friesen, S. Chao, Y. Jin, X. Cai, J.‑B. Ohm, J. B. 570
Rasmussen and S.S. Xu. 2014. 2014. Development and characterization of wheat 571
lines carrying stem rust resistance gene Sr43 derived from Thinopyrum ponticum. 572
Theor. Appl. Genet. 127: 969-980. 573
574
31
![Page 32: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/32.jpg)
Roberts, M.A., S.M. Reader, C. Dalgliesh, T.E. Miller, T.N. Foote, L.J. Fish, J.W. Snape 575
and G. Moore. 1999. Induction and characterization of Ph1 wheat mutants. Genetics 576
153: 1909–1918. 577
578
Qi, L., B. Friebe, P. Zhang and B.S. Gill. 2007. Homoeologous recombination, 579
chromosome engineering and crop improvement. Chromosome Res. 15: 3-19. 580
581
Sears, E.R. 1977. A induced mutant with homoeologous paring in common wheat. 582
Can. J. Genet. Cytol. 19: 585-593. 583
584
Sharma, H., H. Ohm, R. Lister, J. Foster and R. Shukle. 1989. Response of 585
wheatgrasses and wheat× wheatgrass hybrids to barley yellow dwarf virus. Theor. 586
Appl. Genet. 77: 369-374. 587
588
Shen, X., L. Kong and H. Ohm. 2004. Fusarium head blight resistance in hexaploid 589
wheat (Triticum aestivum)-Lophopyrum genetic lines and tagging of the alien 590
chromatin by PCR markers. Theor. Appl. Genet. 108: 808-813. 591
592
Shen, X. and H. Ohm. 2006. Fusarium head blight resistance derived from 593
Lophopyrum elongatum chromosome 7E and its augmentation with Fhb1 in wheat. 594
Plant Breeding 125: 424-429. 595
32
![Page 33: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/33.jpg)
596
Shen, X. and H. Ohm. 2007. Molecular mapping of Thinopyrum-derived Fusarium 597
head blight resistance in common wheat. Molec. Breeding 20: 131-140. 598
599
Shu, Y., J. Zhang, Y. Ao, L. Song and C. Guo. 2015. Analysis of Thinopyrum elongatum 600
transcriptome under water deficit stress. Internat. J. Genomics 2015: ID 265791 601
(dx.doi.org/10.1155/2015/265791). 602
603
Somers, D.J., G. Fedak and M. Savard. 2003. Molecular mapping of novel genes 604
controlling Fusarium head blight resistance and deoxynivalenol accumulation in 605
spring wheat. Genome 46: 555-564. 606
607
Taeb, M., R. Koebner and B. Forster. 1993. Genetic variation for waterlogging 608
tolerance in the Triticeae and the chromosomal location of genes conferring 609
waterlogging tolerance in Thinopyrum elongatum. Genome 36: 825-830. 610
611
The International Wheat Genome Sequencing Consortium. 2014. A 612
chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) 613
genome. Science 345: 1251788-1 to 11. 614
615
33
![Page 34: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/34.jpg)
Wang, J.-R., L. Wang, S. Gulden, H. Rocheleau, M. Balcerzak, J. Hattori, W. Cao, F. 616
Han, Y.-L. Zheng, G. Fedak and T. Ouellet. 2010. RNA profiling of fusarium head 617
blight-resistant wheat addition lines containing the Thinopyrum elongatum 618
chromosome 7E. Can. J. Plant Pathol. 32: 188-214. 619
620
Wang, R. R.-C. 2011. Chapter 2. Agropyron and Psathyrostachys. In: Chittaranjan Kole 621
(ed.), Wild Crop Relatives: Genomic and Breeding Resources, Cereals. 622
Springer-Verlag, Berlin and Heidelberg. Pp. 77-108 623
624
Wong, P., M. Walter, W. Lee, G. Mannhaupt, M. Münsterkötter, H.-W. Mewes, G. 625
Adam and U. Güldener. 2011. FGDB: revisiting the genome annotation of the plant 626
pathogen Fusarium graminearum. Nucl. Acids Res. 39: D637-D639. 627
628
You M.S., B.Y. Li, Z.H. Tian, Z.H. Tang, S.B. Liu and G.T. Liu. 2003 Development of 629
specific SSR marker for Ee-genome of Thinopyrum sp. by using wheat microsatellites. 630
J. Agric. Biotechnol. 11(6): 577–581. 631
632
Zhang, W., A.J. Lukaszewski, J. Kolmer, M.A. Soria, S. Goyal and J. Dubcovsky. 2005. 633
Molecular characterization of durum and common wheat recombinant lines carrying 634
leaf rust resistance (Lr19) and yellow pigment (Y) genes from Lophopyrum ponticum. 635
Theor. Appl. Genet. 111: 573-582. 636
637 34
![Page 35: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/35.jpg)
Figure captions 638
Figure 1. Strategy used to assemble the Illumina reads from the six CS and six CS-7EL 639
cDNA libraries and create a pool of sequences enriched in 7EL candidate genes. CS, 640
Chinese Spring; CS-7EL, Chinese Spring ditelocentric addition line containing the 641
chromosome arm 7EL; Fg, F. graminearum treatment; W, water treatment; Fg ORFs, 642
open reading frames from F. graminearum; R1 to R3: biological replicate samples 1 643
to 3 of a given treatment; contigs, groups each containing two or more assembled 644
sequences with 97 to 100% similarity, either from sequencing reads or from the 645
previous assembly step; singletons: unassembled sequences from a given assembly 646
step. 647
648
Figure 2. Example of PCR amplification with 7EL-specific markers using genomic 649
DNAs from CS and the CS addition lines CS-7EL (7EL) and CS-7ES (7ES). M: DNA 650
ladder. 651
652
Figure 3. PCR amplification using marker M7EL-1 and genomic DNAs from the CS-Th. 653
elongatum disomic addition lines CS-1E to CS-7E, and the CS-Th. elongatum disomic 654
substitution lines CS-7E(7A), CS-7E(7B) and CS-7E(7D). M: DNA ladder. 655
656
35
![Page 36: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/36.jpg)
Figure 4. PCR amplification using marker M7EL-1 and DNA from progeny of BC1F2 657
families 64-8 (A) and 58-5 (B), from the cross CS-7E(7D) x 2*CSph1b. M: DNA ladder; 658
1-17: BC1F2 progeny; 18: CS-7E(7D); 19: CSph1b 659
660
Supplementary Figure 1. Sequence similarity between Th. elongatum and wheat 661
contigs. The values on the X-axis indicate the maximum value for each interval of 2%. 662
Th. elongatum mRNA sequences were obtained from NCBI; contigs obtained after 663
step three of our assembly (in Part A) of CS reads were used as wheat sequences. 664
665
Supplementary Table 1. Parameters and statistics for the different steps of the 666
assembly strategy. 667
668
Supplementary Table 2. Sequences and additional information on the 48 candidate 669
7EL expressed genes used to design the molecular markers. 670
671
Supplementary Table 3. Tab “Marker results unordered”: summary of the results 672
obtained with all 7EL-specific molecular markers for the characterization of 47 673
progeny from two BC1F2 families selected from the cross CS-7E(7D) x 2*CSph1b. 674
Tab “Markers ordered”: naïve ordering of 7EL-specific markers performed using 675
JoinMap on all progeny that showed heterogeneous marker scores. Presence or 676
absence of a 7EL-specific band was scored as 1 or 0, respectively. 677
36
![Page 37: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/37.jpg)
Table 1. Experimental material used in this publication. 678
679 Description of materials Abbreviated names Chinese Spring and Chinese Spring with ph1b mutation
CS and CSph1b
Chinese Spring-Th. elongatum ditelocentric addition lines (long and short arm)
CS-7EL, CS-7ES
Chinese Spring-Th. elongatum disomic addition lines (chromosomes 1E to 7E)
CS-1E, CS-2E, CS-3E, CS-4E, CS-5E, CS-6E, CS-7E
Chinese Spring-Th. elongatum disomic substitution lines (with 7E replacing 7A, 7B or 7D)
CS-7E(7A), CS-7E(7B), CS-7E(7D)
CS-7E(7D) x 2*CSph1b, progeny from two BC1F2 families
64-8-N and 58-5-N series
680 681
682
37
![Page 38: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/38.jpg)
Table 2. 7EL–specific molecular markers developed from candidate 7EL expressed 683 genes. 684 685
Marker name
Sequence of the PCR primer pairs (5’-3’) Original
contigs
Chromosome location of homolog in
B. distachyon
Forward Reverse
M7EL-1 AGTGCTGGCTAGGTACATTTTTCT CGAGCGCGAGGTTGAGG Contig98334 Chr 1
M7EL-2 GGTGGTACAGATTCAGTCAAAA GCAGAGGTAGCAGCAGTAGTAGTC Contig2061459 Chr 1
M7EL-3 TGTCGCGTGGTATCCCAT TCCCTGTATAGCCAAATGAAGAGT 1274 Chr 1
M7EL-4 CGCCGCGACATTTTGAG CTGTAAGATTTGCTGGCGGGTTTT Contig917019 Chr 1
M7EL-5 TTACCTATGGGCCTATGCTTCCTT TGTCTATTCTTGCCACGATTGT Contig319660 Chr 1
M7EL-6 ACCGGGTAGCAGTTGTA GGTTCCCCCATTTTCTAT Contig311687 Chr 1
M7EL-7 TGTTGGGTCCTATCCTTTCACTTT ACGCCGATCTCCCCATACATT Contig1096359 Chr 1
M7EL-8 TGGTGGTGGGCGACAGTG TCCCCAGCCTTAGAAATCAAAAT Contig184838 Chr 1
M7EL-9 GGTTTTCTATATTTGATTACAG AACAAATCTTAGGTCCTCATACTG Contig861043 Chr 1
M7EL-10 GTAATTCTGCTGCTGCTGTTCTTG GCCACGTTTCGGGTCATTTG Contig412195 Chr 1
M7EL-11 GCTTGCACACGGCGATTTATTG CTGGCGGCGATGAGGGAGAAGA Contig269170 Chr 1
M7EL-12 TATATCTAAGAACAAGTAAAA GTCGCCCCACAGCAGGAA Contig610325 Chr 1
M7EL-13 CCGCGAGGAGTTCAAGCAGA TGAAAAGCAATCCAGCAAACACAT Contig413980 Chr 1
M7EL-14 GCGGCGGCAGCATCAATCA ACGCATCGAGTGGTGTTCTAT Contig313982 Chr 1
M7EL-15 ATGGATGGATCGTCAAGGTG CTAAGAACAAGTAAAAGAAAAA Contig892764 Chr 1
M7EL-16 GCCGTGGTGCTCGTCGTC GCACCACGGCTAACCTCTCAG Contig274134 Chr 1
M7EL-17 ATACGCCATTACATTACAG TGACCTCGATACAGCATAC Contig174400 Chr 1
M7EL-18 CGGCTCGATCGACAGACACC GGCAAGACCGTTTCCTACAGC Contig373357 Chr 1
M7EL-19 ACAAACCATCATCATCATCCTCTG ATTTGGCAACTGCTGACATTTTCT Contig384336 Chr 1
M7EL-20 AGGATCTCGCCAAAAAG CGCGAGCGACGGTGTTC Contig430201 Chr 1
38
![Page 39: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/39.jpg)
M7EL-21 GAGGGAAGACGGGAGGAGGAAGAT GTGATCGACAATGAACCAAC Contig588646 Chr 1
M7EL-22 CACTAGAATAAAGACAAAAATGGT TAAATGGAACTGTGGGTAAGATA Contig583775 Chr 1
M7EL-23 TCACATCGATCGAAACCTAATA GAACCGCTCGCACTCCTCGTC Contig169654 Chr 1
M7EL-24 TCGCCAGCCCCCTACAGCAGAC AGCCATCATCGTCCCTCCTTCCTT Contig736571 Chr 1
M7EL-25 AGTGCTGGCTAGGTACATTTTTCT CGAGCGCGAGGTTGAGG Contig923004 Chr 1
M7EL-26 GCACACCCCAGGCTAAAGTTC TAAGTCATGGCAGTATCC Contig139646 Chr 1
M7EL-27 TCACCACAGATGTTCAGAGATA AAGCCGAGGCCACTAAGGAATA Contig1117864 Chr 1
M7EL-28 AGGGCATGCACTGTCTGG ATGCCCTAAATGATACCCTGAG Contig196989 Chr 1
M7EL-29 CTCCAGCAGGTCGTCGTTTTC GGGCCTCTTCCGCTTACCTC Contig661732 Chr 3
M7EL-30 GCCCAACAAAATCATCACTA TCGCTTATTTTGGGACAGA Contig357536 Chr 3
M7EL-31 GTCTCGGGCTCCACTCC TGGCTCCGATGCACTCTCACTTTC Contig414085 Chr 3
M7EL-32 TCGTTTTGCTCCGTATGTAGTCTG CTGCTGCAACCCAAGTCTGAA Contig519891 Chr 2
M7EL-33 GTTCTCCTCGACGACCCTCTG CCCCGCCGGCGACCACAA Contig306667 Chr 2
M7EL-34 CGTCAAGTCGAGCGTGTGC ATGGGAAGGATGGGAGGAGAC Contig32077 Chr 2
M7EL-35 CATCGTCGGGCCTGTTAGC TAGTGCAATGGGATGATGATGAGA Contig977836 Chr 2
M7EL-36 TATAAATTTAGGGTTCGTTCT CTCTCGGGATGCTCTGT Contig71253 Chr 4
M7EL-37 TGGTCGACAGGGGAAAATG AACTGGCTGGATAACAAAAGGAAG Contig196962 Chr 4
M7EL-38 TGGATTATCGCATGGTGTGACTA AACTTGGCAGATCGGAGAGGAA Contig1225302 -
M7EL-39 GCACCGAGCGAGCCACCTG GCGCGACCTTTCCCTTCCTCT Contig202087 -
M7EL-40 GAGATCAGTGGCTTGGGGTTGG GTTTGGACTTTTGGTTGC Contig322987 -
M7EL-41 CAAGGAAATTAATCAAGAACTACT CTGCTCAGCTGGGTGTGG Contig263095 -
M7EL-42 GAGTTTCCGTGCTTCTGG AAAAACACAACTAAACCCTAACGA Contig1455493 -
M7EL-43 GATGGTTATTTTGCGTTTCAC CTCCCTCCGATCCATATTACTTGT Contig1052811 -
M7EL-44 ATGAGTTTTCCAGTTATTACG ATCATCCATCTCTTGTCCT Contig1305214 -
M7EL-45 GAAATTTTTAGGTATACTGTCAAC GATAATTCTCCCTCGTCCTCTA Contig1930629 -
39
![Page 40: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/40.jpg)
M7EL-46 CTGGCCAGATGAAAGTAGTT AAGCCAGTGACCCGGACAATAA Contig1809051 -
M7EL-47 CTTGCATCAGAATACCCTTTTACT CATCACGATCTACTATTCTACTTG Contig1901674 -
M7EL-48 TGATGAAGATGGCGACACAAA TTCGGCTTAATCAACTCCAT Contig1375954 -
686 687 688 689
40
![Page 41: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/41.jpg)
CS-7EL+Fg R1 R2 R3
CS-7EL+W R1 R2 R3
CS+Fg R1 R2 R3
CS+W R1 R2 R3
reference templates
Fg ORFs
CS ESTs
contigs singletons contigs singletons contigs singletons contigs singletons
contigs contigs contigs contigs
contigs singletons contigs
12 separate assemblies
Assembly of singletons
Assembly with Fg scan Removed Fg sequences and wheat sequences highly similar to Fg
Templated assembly of CS-7EL on CS+FG Singletons contain: 7EL candidates genes (and wheat sequences not in the templates, contaminants, bad or misassembled sequences)
singletons
![Page 42: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/42.jpg)
For Review O
nly
254x190mm (96 x 96 DPI)
Page 42 of 73
5585 Guilford Rd., Madison WI 53711
Crop Science
![Page 43: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/43.jpg)
For Review O
nly
254x190mm (96 x 96 DPI)
Page 43 of 73
5585 Guilford Rd., Madison WI 53711
Crop Science
![Page 44: 1 Development and validation of Thinopyrum elongatum · 125 transferred to 50 m L of CMC (carboxymethylcellulose) medium (Cappellini and 126 Peterson, 1965); cultures were shaken](https://reader031.fdocuments.us/reader031/viewer/2022022113/5c66423d09d3f2e4308bf0dd/html5/thumbnails/44.jpg)
For Review O
nly
254x190mm (96 x 96 DPI)
Page 44 of 73
5585 Guilford Rd., Madison WI 53711
Crop Science