1.-Biosynthesis of Polylactic Acid and Its Copolymers

ARTICLE

Biosynthesis of Polylactic Acid and Its CopolymersUsing Evolved Propionate CoA Transferase andPHA Synthase

Taek Ho Yang,1 Tae Wan Kim,1 Hye Ok Kang,1 Sang-Hyun Lee,1 Eun Jeong Lee,1

Sung-Chul Lim,1 Sun Ok Oh,1 Ae-Jin Song,2 Si Jae Park,1 Sang Yup Lee2,3

1Corporate R&D, LG Chem Research Park, 104-1 Moonji-dong, Yuseong-gu, Daejeon

305-380, Republic of Korea; telephone: þ82-42-870-6442; fax: +82-42-861-2057;

e-mail: [email protected] and Biomolecular Engineering National Research Laboratory, Department of

Chemical and Biomolecular Engineering (BK21 Program), Center for Systems and Synthetic

Biotechnology, and Institute for the BioCentury, KAIST, 335 Gwahangno, Yuseong-gu,

Daejeon 305-701, Republic of Korea; telephone: þ82-42-350-3930; fax: þ82-42-350-3910;

e-mail: [email protected] of Bio and Brain Engineering, Department of Biological Sciences, BioProcess

Engineering Research Center, and Bioinformatics Research Center, KAIST, 335 Gwahangno,

Yuseong-gu, Daejeon 305-701, Republic of Korea

Received 26 July 2009; revision received 5 September 2009; accepted 14 September 2009

Published online in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/bi
t.22547
ABSTRACT: For the synthesis of polylactic acid (PLA) andits copolymers by one-step fermentation process, hetero-logous pathways involving Clostridium propionicum propio-nate CoA transferase (PctCp) and Pseudomonas sp. MBEL 6-19 polyhydroxyalkanoate (PHA) synthase 1 (PhaC1Ps6-19)were introduced into Escherichia coli for the generation oflactyl-CoA endogenously and incorporation of lactyl-CoAinto the polymer, respectively. Since the wild-type PhaC1Ps6-19 did not efficiently accept lactyl-CoA as a substrate, sitedirected mutagenesis as well as saturation mutagenesis wereperformed to improve the enzyme. The wild-type PctCp wasnot able to efficiently convert lactate to lactyl-CoA and wasfound to exert inhibitory effect on cell growth, randommuta-genesis by error-prone PCR was carried out. By employingengineered PhaC1Ps6-19 and PctCp, poly(3-hydroxybutyrate-co-lactate), P(3HB-co-LA), containing 20–49mol% lactatecould be produced up to 62wt% from glucose and 3HB.By controlling the 3HB concentration in the medium, PLAhomopolymer and P(3HB-co-LA) containing lactate as amajor monomer unit could be synthesized. Also, P(3HB-co-LA) copolymers containing various lactate fractions couldbe produced from glucose alone by introducing the Cupria-vidus necator b-ketothiolase and acetoacetyl-CoA reductase

Correspondence to: S.Y. Lee and S.J. Park

Contract grant sponsor: LG Chem

Contract grant sponsor: Korean Systems Biology Research Project of the Ministry of

Education, Science and Technology through Korea Science and Engineering Founda-

tion

Contract grant sponsor: World Class University Program of the Ministry of Education,

Science and Technology

Contract grant number: 20090065571

150 Biotechnology and Bioengineering, Vol. 105, No. 1, January 1, 2010

genes. Fed-batch cultures were performed to produce P(3HB-co-LA) copolymers having 9–64mol% of lactate, and theirmolecular weights, thermal properties, and melt flow proper-ties were determined.

Biotechnol. Bioeng. 2010;105: 150–160.

� 2009 Wiley Periodicals, Inc.

KEYWORDS: polylactic acid; PLA; PHA synthase; propio-nate CoA transferase; enzyme evolution

Introduction

Production of polymers from renewable biomass has beenattracting much attention due to the increasing concerns onthe environmental problems and the limited nature of fossilresources. Polylactic acid (PLA) has been considered as agood alternative to petroleum-based plastic as it possessesseveral desirable properties such as biodegradability, bio-compatibility, compostability, and low toxicity to humans(Drumright et al., 2000; Mehta et al., 2005; Sodergard andStolt, 2002; Vink et al., 2003). At present, PLA is synthesizedby a two-step process consisting of fermentation for lacticacid production and chemical process for polymerizationsuch as ring opening polymerization of lactide, a cyclic dimerresulting from the dehydration of lactic acid, or solvent-basedazeotropic dehydrative condensation (Drumright et al., 2000;Mehta et al., 2005; Sodergard and Stolt, 2002; Vink et al.,

� 2009 Wiley Periodicals, Inc.

2003). Improvement of the material properties of PLA, whichare quite stiff and brittle, has been attempted by copoly-merization or blending with other polymers includingpolyhydroxyalkanoates (PHAs) (Chen andWu, 2005; Hayneset al., 2007; Noda et al., 2004; Schreck and Hillmyer, 2007).Despite these efforts, existing chemical methods are noteffective considering the availability of lactonized monomersused in copolymerization and their cost.

Differently from PLA which requires chemical polymer-ization of lactic acid or lactide, PHAs are synthesized in vivoby PHA synthase (PhaC) which polymerizes various (D)-hydroxyacyl-CoAs (HA-CoAs) generated through diversemetabolic pathways in the cell (Lee, 1996). Lactate has alsobeen suggested to be a possible monomer unit of naturalPHAs because it contains both hydroxyl and carboxylgroups required to form an ester bond (Steinbuchel andValentin, 1995). However, until recently, there has been noreport on the production of PHAs containing lactate as amajor monomer, which is most likely due to the limitationof substrate specificity of the existing PHA synthases; severalstudies have shown that the in vitro activity of PHA synthasetowards (D)-lactyl-CoA is very low or negligible comparedwith other HA-CoAs, especially (D)-3-hydroxybutyryl-CoA(3HB-CoA) (Valentin and Steinbuchel, 1994; Yuan et al.,2001; Zhang et al., 2001).

Several years ago, we were able to show that poly(3-hydroxybutyrate-co-lactate), P(3HB-co-LA), could besynthesized in recombinant Cupriavidus necator H16(formerly, Ralstonia eutropha H16) expressing the Clos-tridium propionicum propionate CoA transferase (PctCp)gene, which allows generation of (D)-lactyl-CoA in the cell,even though the lactate fraction was very low (Cho et al.,2006). Four representative PHA synthases belonging todifferent types including C. necator H16 PhaC from type I,Pseudomonas sp. MBEL 6-19 PhaC1 (PhaC1Ps6-19) (Song,2004) from type II, Allochromatium vinosum DSM 180PhaEC from type III, and Bacillus cereus ATCC 14579PhaRC from type IV were examined in recombinantEscherichia coli expressing PctCp as a supplier of (D)-lactyl-CoA. Among them, the type I, type III and type IVPHA synthases allowed production of only minute amountsof P(3HB-co-LA) from glucose and 3HB (Cho et al., 2006).In order to make PHA synthase to more efficiently accept(D)-lactyl-CoA as a substrate, in vitro mutagenesis ofPhaC1Ps6-19 was performed (Park et al., 2008). This allowedslightly better synthesis of P(3HB-co-LA). Recently, a similarstrategy was employed for the production of P(94mol%3HB-co-6mol% LA) and P(53mol% 3HB-co-47mol% LA)in recombinant E. coli (Taguchi et al., 2008; Yamada et al.,2009). However, the latter polymer could only be producedto 2% of dry cell weight (Yamada et al., 2009). So far, it wasnot possible to produce PLA homopolymer or thecopolymer having the lactate fraction greater than50mol%. It was thus reasoned that the in vivo generationof (D)-lactyl-CoA as well as the substrate specificity of PHAsynthase are limiting the possibility of producing the PLAand copolymer having high mole fraction of lactate.

Here, we report the development of recombinant E. colicapable of producing PLA and its copolymers having lactateas a major monomer by employing evolved PctCp andPhaC1Ps6-19 for the efficient generation and polymerizationof (D)-lactyl-CoA, respectively. Using the recombinantE. coli expressing evolved PctCp and PhaC1Ps6-19, PLA andP(3HB-co-LA) copolymers containing various lactate frac-tion could be synthesized. Furthermore, the thermal andmelt flow properties of synthesized P(3HB-co-LA) copoly-mers were determined.

Materials and Methods

Bacterial Strains and Plasmids

All strains, plasmids, and primers used in this study are listedin Table I. E. coli XL1-Blue was used in all standard cloningprocedures and was used as the host strain for screeningmutants of PhaC1Ps6-19 and PctCp, and for synthesis of PLAand its copolymer unless otherwise stated. PlasmidpPs619C1-CpPCT was constructed for engineering ofPhaC1Ps6-19 and PctCp, as illustrated in Figure 1. First,plasmid pSYL105 (Lee et al., 1994) was digested withBamHI and EcoRI to obtain C. necator PHA biosynthesisoperon (phaCABCn), which was inserted into pBluescript IIKS(þ) resulting in pCnCAB. Next, the C. necator phaC genein the pCnCAB was replaced by the phaC1Ps6-19 gene at theBstBI and SbfI sites. The phaC1Ps6-19 gene was amplified byPCR using the primers 619C1F1 and 619C1R2 and thegenomic DNA of Pseudomonas sp. MBEL 6–19 as a template.The internal BstBI site within the wild-type phaC1Ps6-19 genewas removed without amino acid change by sequenceoverlap extension PCR using the primers 619C1F1,619C1R2, 619C1BstBIDF, and 619C1BstBIDR. Then, theupstream region of a start codon containing the ribosomebinding site and the BstBI site, and the downstream region ofa stop codon containing the SbfI site were amplified by PCRusing the primers REABF, 619C1R1, 619C1F1, 619C1R2,619C1F2, and REABR. The resulting plasmid was designatedas pPs619C1-CnAB. Finally, the C. necator phaAB(phaABCn) genes in the pPs619C1-CnAB were replaced bythe pctCp gene at the SbfI and NdeI sites. The pctCp gene wasamplified by PCR using plasmid pTac99Pct (Cho et al.,2006) as a template and the primers CPPCTFSbfI andCPPCTRNdeI flanked with the SbfI and NdeI restrictionsites, respectively. For the elimination of the internalNdeI site within the wild-type pctCp gene without amino acidchange, overlap extension PCR was performed using theprimers CPPCTFSbfI, CPPCTRNdeI, CPPCTNdeIDF, andCPPCTNdeIDR. The resulting plasmid, designated aspPs619C1-CpPCT, contains the phaC1Ps6-19 gene and thepctCp gene, in which the expression of the correspondinggenes was driven by the promoter of the phaCABCn operon.In order to express the phaABCn genes encoding b-ketothiolase (PhaA) and acetoacetyl-CoA reductase (PhaB),an expression plasmid was constructed by using pBBR1MCS

Yang et al.: Biosynthesis of PLA and Its Copolymers 151

Biotechnology and Bioengineering

Table I. Bacterial strains, plasmids, and primers used in this study.

Strains, plasmids, or primers Relevant characteristicsa Source or remarks

Strains

Pseudomonas sp. MBEL 6-19 PHA synthase (PhaC1Ps6-19) producer Song (2004)

E. coli JM109 e14�(McrA�) recA1 endA1 gyrA96 thi-1 hsdR17(r�K mþK ) supE44 relA1 D(lac-proAB)

[F’ traD36 proAB lacIqZDM15]

Stratagenea

E. coli XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F’ proAB lacIqZDM15 Tn10 (TetR)] Stratagenea

Plasmids

pSYL105 ApR, C. necator PHA biosynthesis operon (phaCABCn), parB locus of plasmid R1,

derivative of pBluescript SK(�)

Lee et al. (1994)

pBluescriptII KS(þ) ApR, cloning and expression vector Stratagenea

pTac99Pct Tac promoter, Clostridium propionicum DSM 1682 propionate CoA transferase gene

(PctCp), derivative of pTrc99A

Cho et al. (2006)

pCnCAB Promoter of phaCABCn, phaCABCn, transcriptional terminator of phaCABCn, derivative

of pBluescriptII KS(þ)

This study

pPs619C1-CnAB Promoter of phaCABCn, phaC1Ps6-19 (GenBank accession number FJ626663), C. necator

phaAB genes (phaABCn), transcriptional terminator of phaCABCn, derivative of pCnCAB

This study

pPs619C1-CpPCT Promoter of phaCABCn, phaC1Ps6-19, pctCp, transcriptional terminator of phaCABCn,

derivative of pPs619C1-CnAB

This study

pPs619C1300-CpPCT phaC1Ps6-19 variant (phaC1300Ps6-19; E130D, S325T, Q481M), pctCp, derivative of

pPs619C1-CpPCT

This study

pPs619C1300-CpPCT532 pctCp variant (pct532Cp; A243T, Silent mutation: A1200G), derivative of

pPs619C1300-CpPCT

This study

pPs619C1300-CpPCT540 pctCp variant (pct540Cp; V193A, Silent mutations: T78C, T669C, A1125G, T1158C),

derivative of pPs619C1300-CpPCT

This study

pTrcHisB ApR, vector for expression of recombinant proteins from trc promotor Invitrogenb

pTHCPPCT pctCp, derivative of pTrcHisB This study

pTHCPPCT532 pctCp variant (pct532Cp: A243T; Silent mutation: A1200G), derivative of pTrcHisB This study

pTHCPPCT540 pctCp variant (pct540Cp: V193A, Silent mutations: T78C, T669C, A1125G, T1158C),

derivative of pTrcHisB

This study

pBBR1MCS CmR, cloning vehicle Kovach et al. (1995)

p10499A gntT104 promoter, derivative of pTrc99A Park et al. (2002)

p10499PhaAB gntT104 promoter, phaABCn, derivative of p10499A This study

pMCS104CnAB gntT104 promoter, phaABCn, derivative of pBBR1MCS This study

Primers

Primers for gene cloning

REABF atgcccggagccggttcgaa

REABR aacgggagggaacctgcagg

REABR2 gaaattgttatccgcctgcagg

619C1F1 gagagacaatcaaatcatgagtaacaagagtaacg

619C1R1 cgttactcttgttactcatgatttgattgtctctc

619C1F2 gtacgtgcacgaacggtgacgcttgcatgagtg

619C1R2 cactcatgcaagcgtcaccgttcgtgcacgtac

CPPCTFSbfI aggcctgcaggcggataacaatttcacacagg

CPPCTRNdeI gcccatatgtctagattaggacttcatttcc

Primers for the deletion of internal restriction sites

619C1BstBIDF gcagtcaaacgcttttttgaaaccggtggcaaaag

619C1BstBIDR cttttgccaccggtttcaaaaaagcgtttgactgc

CPPCTNdeIDF gaacccaaaaacattacctatgtttattgtggttc

CPPCTNdeIDR gaaccacaataaacataggtaatgtttttgggttc

Primers for the random mutagenesis of pctCp gene

CPPCTEF cgccggcaggcctgcagg

CpPCTER ggcaggtcagcccatatgtc

Ap, ampicillin; Tet, tetracycline; Cm, chloramphenicol; R, resistance.aStratagene Cloning System (La Jolla, CA).bInvitrogen, Corp. (Carlsbad, CA).

(Kovach et al., 1995). The PstI-digested phaABCn genesfragment from pSYL105 (Lee et al., 1994) was inserted intothe PstI-digested p10499A (Park et al., 2002) to constructp10499PhaAB. Plasmid p10499PhaAB was digested withSspI to obtain a fragment containing the gntT104 promoterand the phaABCn genes. This fragment was inserted into theEcoRV-digested pBBR1MCS to result in pMCS104CnAB. All


oligonucleotides were synthesized at Bioneer (Daejeon,Korea). The enzymes and related reagents for DNAmanipulation were purchased from New England Biolabs(Berverly, MA), TaKaRa Shuzo (Shiga, Japan), Solgent(Daejeon, Korea), and Sigma–Aldrich (St. Louis, MO).Preparation of plasmids and DNA fragments were per-formed with Qiagen kits (Qiagen, Chatsworth, CA). All

Figure 1. Construction of pPs619C1-CpPCT used for engineering of PhaC1Ps6-19 and PctCp. The phaCCn, phaACn, and phaBCn genes derived from C. necator encode PHA

synthase, b-ketothiolase and acetoacetyl-CoA reductase, respectively. The phaC1Ps6-19 and pctCp genes encode PHA synthase I from Pseudomonas sp. MBEL 6-19 and propionate

CoA transferase from C. propionicum, respectively. PCn and TCn denote the promoter and terminator regions in the phaCABCn operon from C. necator.

other chemicals used were of analytical grade and purchasedfrom Sigma–Aldrich. DNA sequencing was carried out usingAmpliTaq DNA polymerase (Perkin Elmer, Foster City, CA)on an ABI Prism 377 DNA sequencer (Perkin Elmer).

Culture Conditions for the Production of Polymer

For the production of polymer using recombinant E. coli, achemically defined MR medium was used. The MR medium(pH 7.0) contains (per liter) 6.67 g KH2PO4, 4 g(NH4)2HPO4, 0.8 g MgSO4�7H2O, 0.8 g citric acid, and

5mL trace metal solution. The trace metal solution contains(per liter of 0.5M HCl) 10 g FeSO4�7H2O, 2 g CaCl2, 2.2 gZnSO4�7H2O, 0.5 g MnSO4�4H2O, 1 g CuSO4�5H2O, 0.1 g(NH4)6Mo7O24�4H2O, and 0.02 g Na2B4O7�10H2O. Glucoseand 3HB (Acros organics, Geel, Belgium) were sterilizedseparately. Seed cultures were prepared in 15mL test tubescontaining 3mL Luria-Bertani (LB) medium at 308Covernight in a rotary shaker at 250 rpm. One milliliter ofovernight culture was used to inoculate 250mL flaskcontaining 100mL MR medium supplemented with 20 g/Lof glucose for accumulation of PLA homopolymer. In thecase of P(3HB-co-LA) production, 3HB was also used as



supplement at final concentration of 2 g/L. Flask cultureswere carried out at 308C in a rotary shaker at 200 rpm for 4days. When necessary, 100mg/mL ampicillin, 10mg/mLtetracycline, 34mg/mL chloramphenicol, and 10mg/mLthiamine were added to the medium.

Saturation and Site-Directed Mutagenesis

A triple mutant of the phaC1Ps6-19 gene, phaC1300Ps6-19(E130D, S325T, and Q481M), was generated first to increasethe substrate specificity towards short-chain-length (SCL)3HA-CoAs by site-directed mutagenesis using the muta-genic primers and the upstream/downstream primers,REABF and REABR2, respectively. To prepare Glu130,Ser325, Ser477, and Gln481 substituted mutants ofPhaC1300Ps6-19, saturation mutagenesis and site-directedmutagenesis were performed. For example, the saturationmutagenesis library at position 130 was generated by overlapextension PCR using a pair of mutagenic primers and theupstream/downstream primers, REABF and REABR2,respectively. The PCR using pfuDNA polymersase (Solgent)was performed with an automatic thermal cycler (Bioneer)for 20 cycles consisting of 958C for 20 s, 608C for 40 s, and728C for 1.5min. Other saturation mutagenesis libraries atposition 325, 477, and 481 were prepared by the samemethod using the corresponding pairs of mutagenicprimers. Also, for the site-directed mutagenesis at position130, 325, 477, and 481, the same overlap extension PCRmethod was employed using the corresponding pairs ofmutagenic primers and the upstream/downstream primers.The mutagenic PCR products were gel-purified and wereligated with BstBI- and SbfI-digested pPs619C1300-CpPCT.This process generated various plasmids harboring themutated genes of phaC1300Ps6-19.

Random Mutagenesis by Error-Prone PCR

Random mutagenesis of the pctCp gene was carried out byperforming mutagenic PCR with pPs619C1300-CpPct as atemplate. Two primers flanked with the SbfI andNdeI restriction sites, CPPCTEF and CPPCTER, were usedas forward and reverse primers, respectively. In order toobtain both the desired level of mutation, that is, one or twoamino acid substitutions, and the base substitutions withoutmutational bias, the condition for PCR randommutagenesiswas optimized; a 50mL reaction mixture contained 10mMTris–HCl (pH 8.3), 50mM KCl, 2mM MgCl2, 20mMMnSO4, 0.04mM dATP, 0.25mM dTTP, 0.08mM dGTP0.25mM dCTP, 0.2mM each of two primers, 5 ng templateDNA, and 5U ExTaq polymerase (TaKaRa Shuzo). The PCRwas performed with an automatic thermal cycler (Bioneer)for 25 cycles consisting of 958C for 20 s, 608C for 40 s, and728C for 1.5min. The mutagenic PCR products were gel-purified and then ligated with the SbfI- and NdeI-digestedpPs619C1300-CpPCT. This process generated the plasmidscontaining the mutated pctCp genes.


Screening Mutants Accumulating Higher Levelsof P(3HB-co-LA)

Screening of P(3HB-co-LA) accumulating variants ofPhaC1Ps6-19 and PctCp was carried out based on a previouslyreported in vivo PHA screening system (Spiekermann et al.,1999). The recombinants harboring the phaC1Ps6-19 andpctCp mutant genes were grown on LB agar mediumsupplemented with 20 g/L glucose, 2 g/L 3HB, 0.5mg/mLNile red, and 100mg/mL ampicillin. The change in P(3HB-co-LA) accumulation resulting from the introduction ofmutations into the phaC1Ps6-19 and pctCp genes wasdetermined on the basis of the intensity of the pinkishcolor due to the Nile red staining of cells.

Western Blot Analysis

The expression of wild-type PctCp and its variants wereanalyzed by western blotting of the whole-cell lysate of E. coliusing antiserum against PctCp. A rabbit antiserum againstPctCp was prepared by injection of synthetic oligopeptide,QEGKQKKFLKAVEQ. The antiserum was purified byantigen specific affinity chromatography. The whole-celllysates of recombinant E. coli cells corresponding 10mL of asuspension (OD600 of 3.0) were separated by sodiumdodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). Subsequently, the samples were electroblotted ontopolyvinylidene-difluoride membranes and probed with thepurified antiserum diluted to 1:2,000 in Tris-buffered saline(TBS; 150mM NaCl, 50mM Tris–HCl; pH 7.4) containing1% gelatin and 0.05% Tween-20. Immunoblots were rinsedthree times with TBS containing 0.05% Tween-20. Antigen-antibody complexes were visualized by reaction with thealkaline phosphatase-linked goat anti-rabbit IgG secondaryantibody (Bio-Rad, Hercules, CA) diluted to 1:5,000 in TBS.Colorimetric reaction of alkaline phosphatase was performedaccording to the manufacturer’s instructions (Bio-Rad).

PctCp Assay

For the assay of PctCp, the plasmids, pTHCPPCT,pTHCPPCT532, and pTHCPPCT540 (Table I), expressingthe wild-type PctCp and its variant (pct532Cp and pct540Cp)genes fused to the His-tag under the trc promoter wereconstructed. Wild-type PctCp and its variants were purifiedusing the Ni-NTA Spin Kit (Qiagen) under native condition.The PctCp activity was determined by measuring thesynthesized lactyl-CoA from acetyl-CoA and lactate usinghigh performance liquid chromatography system equippedwith an ultraviolet detector (SCL-10A, Shimadzu, Kyoto,Japan). For measuring the activity, reaction was carried outfor 4min at 308C in 50mM phosphate buffer (pH 7.0)containing 1mM acetyl-CoA and 10mM lactate by adding15mg of purified protein. Product, lactyl-CoA, was separatedby using Capcell Pak C18 UG120 column (Shiseido, Tokyo,Japan) with a mixture of water and acetonitrile as a mobile

Table II. Summary of P(3HB-co-LA) copolymer production using PhaC1Ps6-19 mutants in recombinant E. coli XL1-Blue.�

PHA synthase Amino acid substitutions

Polymer

content (wt%)

Lactate

fraction (mol%)

Molecular weighta

Mn (�103Da) Mw (�103Da)

PhaC1202Ps6-19 E130D/Q481K 36.6 35.3 71 195

PhaC1204Ps6-19 E130D/Q481M 28.2 19.7 80 267

PhaC1301Ps6-19 E130D/S325T/Q481K 56.0 39.1 38 74

PhaC1300Ps6-19 E130D/S325T/Q481M 43.8 31.9 36 88

PhaC1304Ps6-19 E130D/S477R/Q481K 20.2 21.9 67 203

PhaC1305Ps6-19 E130D/S477R/Q481M 40.5 29.6 56 158

PhaC1307Ps6-19 E130D/S477H/Q481K 36.9 31.0 28 121

PhaC1308Ps6-19 E130D/S477H/Q481M 46.9 27.6 75 237

PhaC1310Ps6-19 E130D/S477F/Q481K 44.2 36.2 56 199

PhaC1311Ps6-19 E130D/S477F/Q481M 49.2 32.2 55 192

PhaC1316Ps6-19 E130D/S477G/Q481K 47.7 39.9 37 94

PhaC1317Ps6-19 E130D/S477G/Q481M 27.9 23.7 66 159

PhaC1401Ps6-19 E130D/S325T/S477R/Q481K 51.0 30.3 38 74

PhaC1400Ps6-19 E130D/S325T/S477R/Q481M 55.0 41.2 34 58

PhaC1440Ps6-19 E130D/S325T/S477H/Q481K 48.0 36.8 28 63

PhaC1441Ps6-19 E130D/S325T/S477H/Q481M 44.7 33.2 32 85

PhaC1439Ps6-19 E130D/S325T/S477F/Q481K 61.5 46.0 30 53

PhaC1434Ps6-19 E130D/S325T/S477F/Q481M 56.0 37.3 33 66

PhaC1437Ps6-19 E130D/S325T/S477G/Q481K 53.5 49.0 22 39

PhaC1436Ps6-19 E130D/S325T/S477G/Q481M 51.7 41.1 29 52

�Plasmid pPs619C1300-CpPct540 was used for the generation of the PhaC1Ps6-19 mutants. The polymer content, the lactate fraction, and the molecularweights of P(3HB-co-LA) produced in recombinant E. coli XL1-Blue shown above are the average of five independent experiments.

aMn and Mw represent number-average molecular weight and weight-average molecular weight, respectively.

phase at a flow rate of 1mL/min. A ratio of acetonitrile towater was maintained as 3:97 (v/v) for 5min, and thengradually increased to 15:85 (v/v) for 25min. One unit ofenzyme activity is defined as the amount of enzyme thatconverts 1mmol of the substrate to the product per min.

Fed-Batch Culture Condition

Fed-batch cultures were performed at 308C in a 6.6-L jarfermentor (Bioflo 3000; New Brunswick Scientific Co.,Edison, NJ) initially containing 1.6 L of MR medium. Theculture pH was kept at 7.0 by the addition of 28% (v/v)ammonia water. The dissolved oxygen concentration(DOC) was controlled at above 30% or 10% of airsaturation by automatically changing the agitation speedup to 1,000 rpm and additionally supplying pure oxygen.The feeding solution contains (per liter) 700 g glucose, 15 gMgSO4�7H2O, and 250mg thiamine. The pH-stat feedingstrategy was used. When the pH rose to a value greater thanits set point (pH 7.0) by 0.1, an appropriate volume offeeding solution was automatically added to increase theglucose concentration in the culture medium to 15 g/L(feeding strategy A) or 5 g/L (feeding strategy B).

Analysis of Polymers

The content and monomer composition of polymersaccumulated in the cells were determined by gas chromato-graphy (GC) using Agilent 6890N GC system (AgilentTechnologies, Palo Alto, CA) equipped with Agilent 7683

automatic injector, flame ionization detector, and a fusedsilica capillary column (ATTM-Wax, 30m, ID 0.53mm, filmthickness 1.20mm, Alltech, Deerfield, IL). About 30mg ofdried cell pellet was subjected to methanolysis with benzoicacid as an internal standard in the presence of 15% sulfuricacid. The resulting methyl esters of constituent lactate andcarboxylic acids were assayed by GC according to themethod of previous report (Braunegg et al., 1978). The GC-mass spectrometry was performed on Hewlett-Packard 5890GC system (Hewlett-Packard, Wilmington, DE) equippedwith capillary column (HP-5, Agilent Technologies). Thetemperature program was initially maintained at 508C for5min, ramped to 3208C at 108C/min and then held at 3208Cfor 10min. Methyl-3HB and methyl-lactate were analyzedwith an HP 5971A mass selective detector (Hewlett-Packard). The enantiomeric excess (%ee) of methyl-3HBand methyl-lactate was determined by GC using Agilent6890N GC system equipped with a capillary column(Chiraldex G-TA, Astec, Whippany, NJ). The temperatureprogram was maintained at 708C for 15min.

To determine the molecular weights, thermal and meltflow properties of the synthesized polymers, the polymersaccumulated in the cells were extracted with hot chloroformrefluxed in a Soxhlet apparatus (Corning, Lowell, MA) for14 h and purified by precipitation with ice-cold methanol.Molecular weights of polymers were determined by gelpermeation chromatography (GPC) at 408C using a WatersAlliance 2695 Separation Module (Waters, Milford, MA)equipped with Waters 2414 RI detector and two PL Gelcolumns (Mixed C, 5mm particles, 30 cm, ID 7.5mm,Polymer Laboratories, Amherst, MA). Polystyrene mole-



cular weight standards (Polymer Standard Service-USA,Silver Spring, MD) with a narrow range of polydispersity(1.03–1.05) were employed for calibration. For the analysisof thermal properties of P(3HB-co-LA), differential scan-ning calorimetry (DSC) was performed on a Q10 DSC (TAInstruments, New Castle, DE). DSC measurements wereconducted with ca. 5mg of fractionated polymer samples inthe temperatures ranging from �50 to 1808C under anitrogen atmosphere at heating and cooling rates of 10 and28C/min, respectively. The melt viscosities of P(3HB-co-LA)s were measured by using an Rh2000 capillary rheometer(Malvern Instrument Ltd., Malvern, UK) at 1808C. Theshear rates were set within the range of 20–4,000/s.

All of the 1D (1H, 13C) and 2D COSY NMR spectra of thepolymers, PLA and P(3HB-co-LA), were recorded on BrukerAVANCE DMX 600MHz spectrometer (Bruker, Rheinstet-ten, Germany) using a BBO probe in CDCl3 withtetramethylsilane (TMS) as an internal chemical shiftstandard at 298K. The optimized 908 pulse width was7.6ms at the delay time of 5 s in 1H NMR experiment. Inquantitative 13C NMR experiment, the 308 pulse width was3.3ms at the delay time of 2 s for PLA and 10 s for P(3HB-co-LA). In 2D NMR experiments, 1.3 s delay time, 128msacquisition time, processing data size of 2k� 1k for PLA and1k� 1k for P(3HB-co-LA) and sinebell processing functionwere used. In 2D COSY experiment (Lim et al., 2008), thetotal number of 256 and 128 increments, and 16 and 8 scansper increment were used for PLA and P(3HB-co-LA),respectively.

Results and Discussion

Directed Evolution of PHA Synthase and PropionateCoA Transferase

PHA synthases, which play a key role in PHA biosynthesis,can be classified into four types based on their primarystructures and substrate specificities (Rehm, 2003). Type I,III, and IV PHA synthases preferentially catalyze CoAthioesters of hydroxyalkanoates of SCL (C3-C5), while mostof the type II synthases prefer CoA thioesters of hydro-xyalkanoates of medium-chain-length (C6-C14). Interest-ingly, type II PHA synthase from Pseudomonas sp. MBEL 6-19, PhaC1Ps6-19, possesses exceptionally broad substratespecificities towards 3HA-CoAs of 4–12 carbons andsynthesize PHAs containing both short and medium chainlength monomer units (Song, 2004). This is similar to thetype II PHA synthase from Pseudomonas sp. 61-3 (Takaseet al., 2004). For this reason, PhaC1Ps6-19 was chosen as atarget PHA synthase for engineering as it will allow synthesisof a wide range of PHA copolymers containing lactate.

Since the recombinant E. coli expressing wild-typePhaC1Ps6-19 along with PctCp was able to accumulatenegligible levels of P(3HB-co-LA) under 1 wt% of dry cellweight, site-directed mutagenesis of PhaC1Ps6-19 was firstperformed to make PHA synthase to more efficiently accept


three carbon (D)-lactyl-CoA as a substrate. The nucleotidesites for mutagenesis were chosen based on the previousstudies on altering the substrate specificity of Pseudomonassp. 61-3 PHA synthase 1 (PhaC1Ps61-3) having amino acidhomology of 84% with PhaC1Ps6-19 (Matsumoto et al., 2005,2006; Matsusaki et al., 1998; Takase et al., 2003, 2004).According to these reports, the amino acids E130, S325,S477, and Q481 in PhaC1Ps61-3 are important in altering thesubstrate specificity toward 3HB-CoA, enhancing PHAaccumulation in the cells, or increasing the molecular weightof polymer.

After mutagenesis, several variants that were capable ofmore efficiently accepting (D)-lactyl-CoA as a substratewere identified. Recombinant E. coli JM109 expressing oneof these mutant synthases PhaC1300Ps6-19 (E130D, S325T,and Q481M) together with PctCp was able to synthesizeP(81mol% 3HB-co-19mol% LA) with a content of 8 wt% inLB medium containing 20 g/L glucose and 2 g/L 3HB(Fig. 2). Lactate was endogenously generated within theE. coli cells from glucose during cultivation, converted tolactyl-CoA by PctCp, and then was incorporated into thepolymer by evolved PhaC1300Ps6-19. The composition andthe monomer sequence distribution of P(3HB-co-LA) wereinvestigated by 1D (1H and 13C) NMR and 2D (1H-1H)COSY NMR spectroscopy (Fig. 2A–C). The mole fractionsof 3HB and lactate units obtained from 1H NMR were ingood agreement with those obtained from GC analysis. Thestereospecificity analysis of P(3HB-co-LA) showed that themethyl-3HB and methyl-lactate were all in (D)-configura-tion with enantiopurities above 96% (Fig. 2D). From thisresult, although P(3HB-co-LA) content in the cells and thelactate mole fraction in the polymer were not high, theamino acid substitutions within PhaC1300Ps6-19, that is,E130D, S325T, and Q481M, resulted in the production ofpolymer containing lactate monomer unit. Thus,PhaC1300Ps6-19 was subjected to saturation mutagenesis atthe above mentioned positions, E130, S325, S477, and Q481,to find a variant PhaC1Ps6-19 having enhanced activitytoward (D)-lactyl-CoA. Various mutant enzymes wereselected from each library and examined for their activitiesto produce P(3HB-co-LA) in vivo with respect to the lactatefraction and the polymer content in recombinant E. coliexpressing PctCp. Several mutants obtained from saturationmutagenesis and site-directed mutagenesis were examinedagain with the evolved PctCp mutants described in thefollowing section (Table II).

PctCp had low activity in generating lactyl-CoA fromlactate in E. coli. Also, it has been known that the expressionof PctCp exerts inhibitory effect on cell growth (Selmer et al.,2002). Thus, random mutagenesis of the pctCp gene wasconducted to create a PctCp mutant possessing enhancedability to supply (D)-lactyl-CoA in E. coli without severegrowth inhibition. Among several positive PctCp mutantsfrom two rounds of mutagenesis and screening, twobeneficial PctCp mutants, Pct532Cp (A243T, and one silentnucleotide mutation of A1200G) and Pct540Cp (V193A, andfour silent nucleotide mutations of T78C, T669C, A1125G,

Figure 2. NMR analysis (1D 1H, 2D COSY, and 1D 13C) and determination of the stereospecificity of P(3HB-co-LA) copolymer synthesized in recombinant E. coli JM109

expressing PhaC1300Ps6-19 and PctCp. A: 600MHz 1H NMR spectrum. The methylene protons of 3HB are assigned at 2.4–2.7 ppm (#2), while the oxymethine protons of 3HB-co-LA

(#1,#10) are at 4.8–5.5 ppm. The methyl protons (#3,#30) of 3HB-co-LA and HOD are assigned at 1.2–1.6 ppm. B: 1H-1H COSY spectrum, which reveals the configurational structure of

P(3HB-co-LA) by highlighting its intra-three bond coupling of protons. The coupling between the oxymethine proton (#1) and the methylene protons (#2) next to the oxymethine

proton (#1) can be seen as a cross peak at 5.2 ppm/2.5 ppm (open arrowheads) while the coupling between protons (#1,#10) and the remaining protons (#3,#30) can be seen at

5.2 ppm/1.3 ppm (closed arrowheads), as expected. C: 150MHz 13C NMR spectrum with the chemical shift assignments and an expanded spectrum of carbonyl carbons region. This

region (168.8–170.1 ppm) is clearly resolved into three groups of peaks showing different diad sequences of 3HB and LA bonds. The peak at 169.1 ppm is assigned to carbonyl

carbons in the 3HB�–3HB sequence. The peak at 169.4 ppm is assigned to the carbonyl resonance in 3HB�–LA and 3HB–LA� sequences. The peak at 169.7 ppm is assigned to LA�–

LA sequences. D: Determination of the stereospecificity of the monomers in P(3HB-co-LA) copolymer by chiral GC analysis. Methyl-3HB and methyl-LA were all in (D)-configuration

with enantiopurity above 96%. [Color figure can be seen in the online version of this article, available at www.interscience.wiley.com.]

and T1158C), which led to the increase of both polymercontent and lactate mole fraction in the copolymer, wereselected for further characterization. The expression levels,and in vivo and in vitro activities of PctCp mutants wereexamined and compared with those of the wild-type PctCp(Fig. 3). As shown in Figure 3A, the expression level ofPct532Cp was almost the same as the wild-type PctCp, whilePct540Cp showed slightly higher expression level than thewild-type PctCp. Notably, in vitro specific activities of

Table III. The molecular weights, thermal properties, and melt viscosity of P

PhaC1310Ps6-19, Pct540Cp, and PhaABCn.

Polymera

Molecular weightb

Mn (�103Da) Mw (�103Da) PDI T

P(3HB-co-8.7mol% LA) 138.0 355.0 2.6

P(3HB-co-27.0mol% LA) 68.4 222.0 3.3

P(3HB-co-64.4mol% LA) 36.0 118.0 3.3

aP(3HB-co-LA) copolymers having various lactate fractions were produceconcentration in the feeding solution. The DOC and the glucose concentration8.7mol% LA), 10% and 15 g/L for P(3HB-co-27.0mol% LA), and 10% and 5

bMn, number-average molecular weight; Mw, weight-average molecular weicTg, glass transition temperature; Tm, melting temperature; Tc, crystallizatiodMelt viscosity was measured at a shear rate of 1,000/s.

Pct532Cp and Pct540Cp were reduced by 2.05- and 1.65-fold,respectively, compared with that of the wild-type. Theseresults indicated that the inhibitory effect of the PctCp on cellgrowth could be alleviated by employing the PctCp mutantshaving lower specific activities, which consequently allowedenhanced synthesis of P(3HB-co-LA) in recombinant E. colialso expressing PhaC1300Ps6-19; the polymer content and thelactate fraction were considerably improved by employingthe PctCp mutants (Fig. 3B).

(3HB-co-LA) synthesized in recombinant E. coli XL1-Blue expressing

Thermal propertiesc

Melt viscosityd (Pa s)g (8C) Tm (8C) Tc (8C) DHm (J/g)

9.3 165.7 104.9 50.5 102.2

12.6 159.5 78.0 10.5 29.0

33.1 160.5 83.9 5.0 7.1

d by the pH-stat fed-batch cultures changing the DO level and glucose(upon pH-stat feeding) in the medium were 30% and 15 g/L for P(3HB-co-g/L for P(3HB-co-64.4mol% LA), respectively.ght; PDI, polydispersity index.n temperature; DHm, enthalpy of fusion.



Figure 3. Expression levels and activities of the wild-type PctCp and its mutants. A: Western blot analysis of whole-cell lysates of recombinant E. coli XL1-Blue expressing the

wild-type PctCp and its mutants. For the expression of the wild-type PctCp (WT), Pct532Cp (532), and Pct540Cp (540) in E. coli XL1-Blue, plasmids pTHCPPCT, pTHCPPCT532, and

pTHCPPCT540, respectively, were employed. Equal amounts of whole-cell lysates of recombinant E. coli XL1-Blue cells corresponding to 10mL of a suspension with an OD600 of 3.0

were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and subsequently Western blot analysis with anti-PctCp antiserum was performed. The arrow head

indicates the band corresponding to the His-tagged PctCp. B: In vivo and in vitro activities of wild-type PctCp and its variants. For the synthesis of P(3HB-co-LA) in recombinant E. coli

XL1-Blue, plasmids pPs619C1300-CpPCT, pPs619C1300-CpPCT532, and pPs619C1300-CpPCT540, which were containing the wild-type pctCp, pct532Cp, and pct540Cp, respectively,

were employed. Recombinant E. coli XL1-Blue strains were cultivated in LB medium supplemented with 20 g/L glucose and 2 g/L 3HB at 378C during 4 days. The polymer content andlactate fraction in P(3HB-co-LA) are the averages of three independent experiments. Error bars indicate standard deviation. For the measurement of in vitro activities of the wild-

type PctCp, Pct532Cp and Pct540Cp, each enzyme was purified using the Ni-NTA affinity purification procedure under native condition as described in Materials and Methods

Section. One unit is defined as an amount of enzyme that converts 1mmol of the substrate (acetyl-CoA) to the product (lactyl-CoA) per min at 308C. [Color figure can be seen in theonline version of this article, available at www.interscience.wiley.com.]

Biosynthesis of P(3HB-co-LA) and PLA Homopolymer

Various PhaC1Ps6-19 mutants were examined for their abilityto produce P(3HB-co-LA) with respect to the lactate fractionin polymer and polymer content in recombinant E. coli XL1-Blue expressing Pct540Cp (Table II). A chemically definedMR medium supplemented with 20 g/L glucose and 2 g/L3HB was used in all P(3HB-co-LA) production studiesunless otherwise stated. Recombinant E. coli strainsexpressing Pct540Cp and evolved mutants of PhaC1Ps6-19were able to produce P(3HB-co-LA) random copolymerscontaining different lactate fractions ranging from 20mol%to 49mol% to varying polymer contents. Among these,quadruple mutant PhaC1437Ps6-19 (E130D, S325T, S477G,and Q481K) resulted in the highest lactate fraction of49.0mol% in P(3HB-co-LA), while PhaC1439Ps6-19 (E130D,S325T, S477F, and Q481K) mutant showed the highestpolymer content of 61.5 wt%. Although, there was noapparent correlation between the polymer content andlactate fraction, E130D and S325T mutations resulted in thehigh polymer content exceeding 44wt% with high lactatemole fraction over 30mol% in P(3HB-co-LA).

The molecular weight (Mw) of synthesized polymer washighly affected by the lactate mole fraction in copolymer andthe PHA synthase mutants employed.When the lactate molefraction was greater than 30mol%, the Mw’s of polymerswere lower than 200,000Da (Table II). When the lactatefraction in P(3HB-co-LA) was gradually increased bydecreasing the concentration of 3HB in the culture medium,the Mw’s of synthesized P(3HB-co-LA) decreased regardless


of the PHA synthase mutants employed, that is, themolecular weight of P(3HB-co-LA) was inversely propor-tional to the mole fraction of lactate monomer (seeaccompanying paper Jung et al., 2010). Even thoughE130D/S325T double mutation in PhaC1Ps6-19 mutantswas effective to achieve high polymer content and highlactate fraction, it severely decreased the Mw of polymers.For the synthesis of P(3HB-co-LA) having the lactatefraction higher than 50mol% and even PLA homopolymer,recombinant E. coli XL1-blue expressing PhaC1310Ps6-19 andPct540Cp was cultured in MR medium containing 20 g/Lglucose and varying concentrations (0–4 g/L) of 3HB. Sincelactate is generated endogenously and activated by PctCp,PLA homopolymer can theoretically be synthesized inrecombinant E. coli from glucose if 3HB is not fed. As the3HB concentration decreased, the lactate fraction increased(Fig. 4). When no 3HB was fed, PLA homopolymer couldindeed be produced, albeit to a relatively low polymercontent of 0.5 wt% of dry cell weight. Thus, recombinantE. coli strain expressing evolved PhaC1Ps6-19 and PctCpmutant allowed production of PLA homopolymer andP(3HB-co-LA) copolymers with controlled lactate fractions.

Characterization of P(3HB-co-LA) Produced inRecombinant E. coli

To characterize the polymer properties, various P(3HB-co-LA) copolymers having different lactate mole fractions wereproduced by fed-batch cultures of recombinant E. coli.

Figure 4. Production of PLA homopolymer and P(3HB-co-LA) copolymers hav-

ing different lactate fractions. Recombinant E. coli XL1-Blue expressing PhaC1310Ps6-19and Pct540Cp was cultured in MR medium containing 20 g/L glucose and varying

concentrations (0–4 g/L) of 3HB at 30 C. The polymer content (black bar) and the

lactate fraction (gray bar) in P(3HB-co-LA) produced in recombinant E. coli shown

above are the average of five independent experiments. Error bar indicates standard

deviation.

Among various PhaC1Ps6-19 mutants obtained, a triplemutant PHA synthase, PhaC1310Ps6-19 (E130D, S477F, andQ481K), which resulted in both relatively high polymercontent and Mw, was employed. Also, in order to generate3HB-CoA from glucose and thus produce P(3HB-co-LA)without 3HB feeding, the C. necator phaA and phaB genesencoding b-ketothiolase and acetoacetyl-CoA reductase,respectively, were introduced. Fed-batch cultures ofrecombinant E. coli XL1-Blue expressing PhaC1310Ps6-19,Pct540Cp, PhaABCn allowed production of various P(3HB-co-LA) copolymers (Table III). The lactate fraction in thepolymer could be controlled from 8.7 to 64.4mol% byvarying the fermentation conditions including DOC andglucose feeding strategy (see Materials and MethodsSection). It was reasoned that by decreasing the DOC, cellswould prefer the production of lactate. Indeed, by decreasingthe DOC from 30% of air saturation to 10% of air saturationusing the glucose feeding strategy A (15 g/L upon pH-statfeeding), the lactate fraction could be increased from 8.7 to27.0mol%. As the glucose feeding strategy can also altermetabolic fluxes during fed-batch culture, a different glucosefeeding strategy was employed. By using glucose feedingstrategy B (5 g/L upon pH-stat feeding) at the DOC of 10% ofair saturation, the lactate fraction could be further increasedfrom 27.0 to 64.4mol%. Thus, by altering the fermentation(fed-batch) culture condition, copolymers of varying lactatefractions can be produced.

The properties of the synthesized P(3HB-co-LA) copo-lymers including the molecular weight, thermal properties,and melt viscosity are summarized in Table III. As observedabove, the molecular weight of P(3HB-co-LA) was inverselyproportional to the mole fraction of lactate monomer. Theglass transition temperature of the polymer increased withan increase of the lactate fraction, whereas the crystallinityestimated from the enthalpy of fusion, decreased with an

increase of the lactate fraction. This tendency is in goodagreement with that observed for the chemically synthesizedP[(D)-3HB-co-(L,L)-LA] (Abe et al., 1997). The meltingtemperature (Tm) of the polymer was only slightly affectedby the lactate fraction and maintained around 1608C, whichwas in accordance with the results of previous reports(Taguchi et al., 2008; Yamada et al., 2009). However,according to Abe et al. (1997), the Tm of chemicallysynthesized P[(D)-3HB-co-(L,L)-LA] was highly dependenton monomer composition; the Tm decreased from 176 to598C as the lactate fraction was increased from 0 to47mol%, and then increased from 115 to 1768C with anincrease in the lactate from 70 to 100mol%. Furthermore,the melting temperatures of P(3HB-co-LA) copolymerssynthesized in this study are higher than those of thechemically synthesized ones consisting of similar monomercomposition. Discrepancies in the Tm of biologicallysynthesized copolymer and chemically synthesized onemight be due to the differences in lactate monomers havingdifferent sterospecificity; the chemically synthesized P[(D)-3HB-co-(L,L)-LA] copolymer has the (L) configured lactateas amonomer unit and is composed of a dimeric sequence ofthe lactate, whereas P(3HB-co-LA) copolymer synthesized inthis study has the lactate unit in the (D) configuration andhas a random sequence. To investigate the melt flowproperties of the synthesized polymers, the melt viscositieswere measured by using capillary rheometer at slightly abovemelting temperature. The melt viscosity decreased with anincrease of the lactate fraction, which properly reflects theproportional relationship between the melt viscosity and thenumber-average molecular weight of the synthesizedpolymer. Thus, the molecular weights, thermal properties,and melt flow properties of the copolymers could be tunednot only by employing the evolved enzymes, but also byvarying the fermentation conditions.

Conclusions

In this study, we reported for the first time that PLA and itscopolymers containing various lactate fractions can beproduced in recombinant E. coli by establishing hetero-logous pathways employing evolved Pct and PHA synthase.This allowed one-step fermentative production of PLA andits copolymers from renewable resources. As E. coli cannotsupply (D)-lactyl-CoA, which is a monomer required for thesynthesis of PLA, evolved PctCp was introduced to generate(D)-lactyl-CoA more efficiently. PHA synthase was alsoevolved to accept (D)-lactyl-CoA more preferentially as asubstrate by rational design and saturation mutagenesis. Theevolved variants of these two enzymes were introduced intoE. coli for establishing new metabolic pathways leading tothe biosynthesis of PLA and its copolymers containingvarious lactate fractions. Also, fed-batch cultures werecarried out under three different conditions to tune thelactate fraction of the polymer from 8.7 to 64.4mol%. Theproperties of these polymers, including the molecular



weights, thermal properties, and melt flow property, werealso examined. This strategy of introducing new metabolicpathways together with evolved enzymes described hereshould be useful for the efficient production of PLA andvarious P(HA-co-LA) copolymers. Considering that variousHA monomers can be incorporated into the polymer (Lee,1996), P(HA-co-LA) copolymers composed of lactate andone or more carboxylic acids including 3-hydroxypropio-nate, 4-hydroxybutyrate, 3-hydroxyvalerate, 3-hydroxyhex-anoate, 3-hydroxyoctanoate, 3-hydroxydecanoate, 3-hydroxydodecanoate, and many more (Steinbuchel andValentin, 1995) can be produced by one-step fermentationof engineered microorganisms.

We thank Yu Kyung Jung (KAIST) for her helpful discussion. Further

supports by LGChemChair Professorship andMicrosoft are appreciated.

References

Abe H, Doi Y, Hori Y, Hagiwara T. 1997. Physical properties and enzymatic

degradability of copolymers of (R)-3-hydroxybutyric acid and (S,S)-

lactide. Polymer 39:59–67.

Braunegg G, Sonnleitner B, Lafferty RM. 1978. A rapid gas chromatographic

method for the determination of poly-b-hydroxybutyric acid in micro-

bial biomass. Eur J Appl Microbiol Biotechnol 6:29–37.

Chen GQ, Wu Q. 2005. The application of polyhydroxyalkanoates as tissue

engineering materials. Biomaterials 26:6565–6578.

Cho JH, Park SJ, Lee SY, Jung YK. 2006. Cells or plants that can produce

polylactate or its copolymers and to a method for preparing polylactate

or its copolymers using the same. WO/2006/126796.

Drumright RE, Gruber PR, Henton DE. 2000. Polylactic acid technology.

Adv Mater 12:1841–1846.

Haynes D, Abayasinghe NK, Harrison GM, Burg KJ, Smith DW, Jr. 2007.

In situ copolyesters containing poly (L-lactide) and poly (hydroxyalk-

anoate) units. Biomacromolecules 8:1131–1137.

Jung YK, Kim TY, Park SJ, Lee SY. 2010. Metabolic engineering of

Escherichia coli for the production of polylactic acid and its copolymers.

Biotechnol Bioeng 105:161–171.

Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RMn,

Peterson KM. 1995. Four new derivatives of the broad-host-range

cloning vector pBBR1MCS, carrying different antibiotic-resistance

cassettes. Gene 166:175–176.

Lee SY. . Bacterial polyhydroxyalkanoates. Biotechnol Bioeng 49:1–14.

Lee SY, Lee KM, Chan HN, Steinbuchel A. 1994. Comparison of recombi-

nant Escherichia coli strains for synthesis and accumulation of poly-(3-

hydroxybutyric acid) and morphological changes. Biotechnol Bioeng

44:1337–1347.

Lim SC, Kim SW, Jung MH, Cho M, Kim JH, Cho HS, Ok JH. 2008.

Complete NMR spectral assignments of siloxanol based copolycarbo-

nate including the configurational copolymer structure and the deter-

mination of each monomer conversion. J Mol Struct 886:166–174.

Matsumoto K, Takase K, Aoki E, Doi Y, Taguchi S. 2005. Synergistic effects

of Glu130Asp substitution in the type II polyhydroxyalkanoate (PHA)

synthase: Enhancement of PHA production and alteration of polymer

molecular weight. Biomacromolecules 6:99–104.

Matsumoto K, Aoki E, Takase K, Doi Y, Taguchi S. 2006. In vivo and in vitro

characterization of Ser477Xmutations in polyhydroxyalkanoate (PHA)

synthase 1 from Pseudomonas sp. 61-3: Effects of beneficial mutations

on enzymatic activity, substrate specificity, and molecular weight of

PHA. Biomacromolecules 7:2436–2442.

Matsusaki H, Manji S, Taguchi K, Kato M, Fukui T, Doi Y. 1998. Cloning

and molecular analysis of the Poly(3-hydroxybutyrate) and Poly(3-


hydroxybutyrate-co-3-hydroxyalkanoate) biosynthesis genes in Pseu-

domonas sp. strain 61-3. J Bacteriol 180:6459–6467.

Mehta R, Kumar V, Bhunia H, Upadhyay SN. 2005. Synthesis of poly (lactic

acid): A review. J Macromol Sci Polym Rev 45:325–349.

Noda I, Satkowski MM, Dowrey AE, Marcott C. 2004. Polymer alloys of

Nodax copolymers and poly(lactic acid). Macromol Biosci 4:269–

275.

Park SJ, Park JP, Lee SY. 2002. Metabolic engineering of Escherichia coli for

the production of medium-chain-length polyhydroxyalkanoates rich in

specific monomers. FEMS Microbiol Lett 214:217–222.

Park SJ, Yang TH, Kang HO, Lee S-H, Lee EJ, Kim TW, Lee SY. 2008.

Mutants of PHA synthase from Pseudomonas sp. 6-19 and method for

preparing lactate homopolymer or copolymer using the same. WO/

2008/062999.

Rehm BH. 2003. Polyester synthases: Natural catalysts for plastics.

Biochem J 376:15–33.

Schreck KM, Hillmyer MA. 2007. Block copolymers and melt blends of

polylactide with NodaxTM microbial polyesters: Preparation and

mechanical properties. J Biotechnol 132:287–295.

Selmer T, Willanzheimer A, Hetzel M. 2002. Propionate CoA-transferase

from Clostridium propionicum. Cloning of gene and identification of

glutamate 324 at the active site. Eur J Biochem 269:372–380.

Sodergard A, Stolt M. 2002. Properties of lactic acid based polymers and

their correlation with composition. Progr Polym Sci 27:1123–

1163.

Song AJ. 2004. Cloning of new Pseudomonas sp. MBEL 6-19 polyhydrox-

yalkanoate synthase genes and their use in the development of recom-

binant microorganisms. M.S. Thesis, KAIST: Korea.

Spiekermann P, Rehm BH, Kalscheuer R, Baumeister D, Steinbuchel A.

1999. A sensitive, viable-colony staining method using Nile red for

direct screening of bacteria that accumulate polyhydroxyalkanoic acids

and other lipid storage compounds. Arch Microbiol 171:73–80.

Steinbuchel A, Valentin HE. 1995. Diversity of bacterial polyhydroxyalk-

anoic acids. FEMS Microbiol Lett 128:219–228.

Taguchi S, Yamada M, Matsumoto K, Tajima K, Satoh Y, Munekata M,

Ohno K, Kohda K, Shimamura T, KambeH, Obata S. 2008. Amicrobial

factory for lactate-based polyesters using a lactate-polymerizing

enzyme. Proc Natl Acad Sci USA 105:17323–17327.

Takase K, Taguchi S, Doi Y. 2003. Enhanced synthesis of poly(3-hydro-

xybutyrate) in recombinant Escherichia coli by means of error-prone

PCR mutagenesis, saturation mutagenesis, and in vitro recombination

of the type II polyhydroxyalkanoate synthase gene. J Biochem 133:139–

145.

Takase K, Matsumoto K, Taguchi S, Doi Y. 2004. Alteration of substrate

chain-length specificity of type II synthase for polyhydroxyalkanoate

biosynthesis by in vitro evolution: In vivo and in vitro enzyme assays.

Biomacromolecules 5:480–485.

Valentin HE, Steinbuchel A. 1994. Application of enzymatically synthesized

short-chain-length hydroxy fatty acid coenzyme A thioesters for assay

of polyhydroxyalkanoic acid synthases. Appl Microbiol Biotechnol

40:699–709.

Vink ETH, Rabago KR, Glassner D, Gruber PR. 2003. Applications of life

cycle assessment to NatureWorksTM polylactide(PLA) production.

Polym Degrad Stab 80:403–419.

Yamada M, Matsumoto K, Nakai T, Taguchi S. 2009. Microbial production

of lactate-enriched poly[(R)-lactate-co-(R)-3-hydroxybutyrate] with

novel thermal properties. Biomacromolecules 10:677–681.

Yuan W, Jia Y, Tian J, Snell KD, Muh U, Sinskey AJ, Lambalot RH, Walsh

CT, Stubbe J. 2001. Class I and III polyhydroxyalkanoate synthases

from Ralstonia eutropha and Allochromatium vinosum: Characteriza-

tion and substrate specificity studies. Arch Biochem Biophys 394:87–

98.

Zhang S, Kamachi M, Takagi Y, Lenz RW, Goodwin S. 2001. Comparative

study of the relationship between monomer structure and reactivity for

two polyhydroxyalkanoate synthases. Appl Microbiol Biotechnol 56:

131–136.

1.-Biosynthesis of Polylactic Acid and Its Copolymers

Documents

Transcript of 1.-Biosynthesis of Polylactic Acid and Its Copolymers