1 A Novel Three-Component Rieske Non-Heme...
-
Upload
duongtuong -
Category
Documents
-
view
219 -
download
3
Transcript of 1 A Novel Three-Component Rieske Non-Heme...
* Author for correspondence: Jian He. Tel: +86-25-84396685, Fax: +86-25-84395326;
E-mail: [email protected]
1
A Novel Three-Component Rieske Non-Heme Iron Oxygenase 1
(RHO) System Catalyzing the N-Dealkylation of 2
Chloroacetanilide Herbicides in Sphingomonads DC-6 and DC-2 3
4
Qing Chen, Cheng-Hong Wang, Shi-Kai Deng, Ya-Dong Wu, Yi Li, Li Yao, 5
Jian-Dong Jiang, Xin Yan, Jian He*, and Shun-Peng Li 6
Key Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, 7
College of Life Sciences, Nanjing Agricultural University, Nanjing, China 8
9
AEM Accepts, published online ahead of print on 13 June 2014Appl. Environ. Microbiol. doi:10.1128/AEM.00659-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
2
ABSTRACT 10
Sphingomonads DC-6 and DC-2 degrade chloroacetanilide herbicides alachlor, 11
acetochlor and butachlor via N-dealkylation. In this study, we report a three- 12
component Rieske non-heme iron oxygenase (RHO) system catalyzing the 13
N-dealkylation of these herbicides. The oxygenase component gene cndA is located in 14
a transposable element that is highly conserved in the two strains. CndA shares 15
24-42% identities with the oxygenase components of some RHOs that catalyze the N- 16
or O-demethylation. Two putative [2Fe-2S] ferredoxins and one GR (glutathione 17
reductase)-type reductase genes were retrieved from the genome of each strain, these 18
genes were not located in the immediate vicinity of cndA. The four ferredoxins share 19
64-72% identities to the ferredoxin component of dicamba O-demethylase (DMO), 20
and the two reductases share 62-65% identities to the reductase component of DMO. 21
cndA, the four ferredoxins and two reductases genes were expressed in Escherichia 22
coli and the recombinant proteins were purified using Ni-affinity chromatography. 23
The individual components or in pairs displayed no activity; only when CndA-His6 24
plus one of the four ferredoxins and one of the two reductases did the enzyme mixture 25
show N-dealkylase activities toward alachlor, acetochlor and butachlor, suggesting 26
that the enzyme consists of three components: a homo-oligomer oxygenase, a [2Fe-2S] 27
ferredoxin and a GR-type reductase, and CndA has a low specificity for electron 28
transport component (ETC). The N-dealkylase utilizes NADH, but not NADPH, as 29
electron donor. 30
31
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
3
INTRODUCTION 32
Chloroacetanilide herbicides are a class of highly efficient pre-emergence herbicides 33
that are widely used in corn, cotton, soybean and many other crops for the control of 34
annual grass and broadleaf weeds (1). The majority of commonly used 35
chloroacetanilide herbicides, such as alachlor, acetochlor, butachlor and metolachlor, 36
are N-alkoxyalkyl-N-chloroacetyl-substituted aniline derivatives in structure. Due to 37
their widespread use, long persistence and high water solubility, some of these 38
herbicides and their metabolites have been frequently detected in soil and 39
underground water (2). Chloroacetanilide herbicides are suspected to be carcinogenic, 40
e.g., alachlor and acetochlor are characterized as class B2 (probable human 41
carcinogens), whereas butachlor and metolachlor are listed as class L2 (likely to be 42
carcinogenic to humans) and C (possible human carcinogens), respectively, by the US 43
Environmental Protection Agency (3-5). Furthermore, these herbicides have a high 44
chronic toxicity toward some aquatic organisms, and the residues in soil frequently 45
injure subsequent rotation crops, especially in sandy soils with low organic matter 46
contents (3-5). Therefore, the degradation mechanisms for chloroacetanilide 47
herbicides in the environment have received considerable attention. 48
49
Microbial metabolism is the most important factor in the degradation of 50
chloroacetanilide herbicides in the environment (6). A variety of bacterial strains that 51
are able to degrade butachlor, alachlor, acetochlor and metolachlor have been 52
characterized (7-11). The microbial degradation of chloroacetanilide herbicides can be 53
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
4
initiated by two reactions: formation of a glutathione conjugate (12) or N-dealkylation 54
(9-11). In the N-dealkylation pathway, these herbicides are N-dealkylated to 55
2-chloro-N-(2, 6-diethylphenyl) acetamide (CDEPA) (for alachlor and butachlor) or 56
2-chloro-N-(2-methyl-6-ethylphenyl) acetamide (CMEPA) (for acetochlor and 57
metolachlor), which are then converted to 2,6-diethylaniline (DEA) or 58
2-methyl-6-ethylaniline (MEA), respectively (9-11). A gene, cmeH, encoding an 59
amidase that catalyzes the amide bond cleavage of CDEPA or CMEPA was cloned 60
from Sphingobium quisquiliarum DC-2 (11). However, the molecular basis for the 61
N-dealkylation of chloroacetanilide herbicides in microorganisms is still unknown. 62
63
In living organisms, N-Dealkylation by members of cytochrome P450 and Rieske 64
non-heme iron oxygenase (RHO) families are important metabolic or detoxification 65
mechanisms for many N-alkyl-containing natural or xenobiotic compounds (13-15). 66
RHOs are characterized by utilizing Rieske-type non-heme Fe(II) as the catalytic 67
centers, and they are important enzymes for the degradation of xenobiotics and the 68
biosynthesis of bioactive natural compounds (14, 16). To date, more than 130 RHOs 69
have been reported, but only a few RHOs are N-demethylases. Summers et al. 70
described three RHO monooxygenases, NdmA, NdmB and NdmC, which catalyze the 71
N1-, N3- and N7-specific demethylation of caffeine, respectively, in Pseudomonas 72
putida CBB5 (17). Recently, Gu et al. identified an N-demethylase PudmA catalyzing 73
the demethylation of phenylurea herbicides in Sphingobium sp. YLB-2 (18). To the 74
best of our knowledge, there is no description of an RHO that is involved in the 75
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
5
N-dealkylation of chloroacetanilide herbicides. 76
77
Previously, two sphingomonads Sphingomonas wittichii DC-6 and Sphingobium 78
quisquiliarum DC-2 were isolated from activated sludge of a wastewater treatment 79
facility of a herbicide manufacturer (10, 11). Strain DC-6 mineralizes 80
chloroacetanilide herbicides such as alachlor, acetochlor and butachlor, while strain 81
DC-2 can only transform them to final products DEA or MEA. In both strains, the 82
initial metabolic reaction is N-dealkylation. In this study, a three-component RHO 83
responsible for the N-dealkylation of alachlor, acetochlor and butachlor was identified 84
in the two sphingomonads. 85
86
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
6
MATERIALS AND METHODS 87
Chemicals and media. Alachlor, acetochlor, pretilachlor, butachlor, propisochlor, 88
metolachlor, CDEPA, DEA and MEA were purchased from Sigma-Aldrich (Shanghai, 89
China); CMEPA was purchased from Alfa-Aesar (Tianjin, China). All chemicals and 90
reagents were of analytical grade. Luria-Bertani (LB) agar and LB broth were 91
obtained from Difco Laboratories (Detroit, MI). The minimal salts medium (MSM) 92
consisted of the following components (in g liter-1): K2HPO4 1.5, KH2PO4 0.5, 93
NH4NO3 1.0, NaCl 1.0, MgSO4·7H2O 0.2, yeast extract 0.02; pH 7.0. 94
95
Bacterial strains, plasmids and culture conditions. The strains and plasmids used in 96
this study are listed in Table 1. Escherichia coli strains were routinely grown 97
aerobically at 37°C in LB broth or on LB agar. The sphingomonads were grown 98
aerobically at 30°C in LB medium, unless otherwise indicated. 99
100
Sequencing, assembly, annotation and genome comparison. DNA manipulation 101
was performed according to standard protocols as described by Sambrook et al. (19). 102
Draft genome sequencing was performed by Shanghai Majorbio Bio-pharm 103
Technology Co., Ltd. (Shanghai, China) using Illumina HiSeq 2000 system. 300 bp 104
shotgun libraries were constructed for each strain, the raw reads was assembled using 105
SOAPdenovo software (http://soap.genomics.org.cn/soapdenovo.html; version: 1.05). 106
De novo gene prediction was performed through Glimmer software 107
(http://cbcb.umd.edu/software/glimmer; version: 3.0). Functional annotation was 108
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
7
accomplished by BLAST analysis of protein sequences in Kyoto Encyclopedia of 109
Genes and Genomes database (KEGG), Swiss-Prot database, Non-Redundant protein 110
database (NR) and Cluster of Orthologous Groups database (COG) using E-value 111
cutoff of 1E-5. To find the missing DNA fragment in DC-6Mut, an all-versus-all 112
analysis was carried out between the genomes of strains DC-6 and DC-6Mut using 113
MAUVE1.2.3 software package with its default setting (20). The analysis of 114
nucleotide and deduced amino acid sequences were performed through Omiga 115
software (version: 3.0). DNA walking was performed by SEFA-PCR (21). For the 116
phylogenetic analysis, all protein sequences were aligned by Clustal X (version: 2.0) 117
(22); the phylogenetic tree was constructed by Neighbor-Joining method (23) with 118
Kimura two-parameter distance model (24) in MEGA software (version: 5.0) (25). 119
120
Functional complement of the DC-6Mut defect with CndA. A 1,047 bp 121
KpnI-EcoRI-digested PCR fragment containing cndA was ligated into the 122
corresponding site of broad-host-range plasmid pBBR1MCS-5 (26). The resulting 123
plasmid, pBBRcndA, was transformed into E. coli DH5α. The inserted fragment of 124
pBBRcndA was verified by sequencing, and pBBRcndA was then introduced into the 125
DC-6Mut by triparental mating with pRK600 as the helper. The abilities of the strains 126
harboring pBBRcndA to degrade alachlor, acetochlor and butachlor were determined 127
by a whole-cell biotransformation test as described by Liu et al. (27) with some 128
modification. Briefly, the post-log phase cells were harvested by centrifugation, 129
washed with MSM and resuspended in 30 ml MSM to a final OD600 of 1.0. The cell 130
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
8
suspension was added with 0.5 mM of each substrate and incubated aerobically on a 131
rotary shaker at 30°C with 150 rpm. Samples were taken at regular intervals and 132
concentrations of the substrates were determined by high-performance liquid 133
chromatography (HPLC) analysis as described below. 134
135
Expression of the oxygenase, ferredoxin and reductase genes and purification of 136
the recombinant proteins. The genes coding the oxygenase, ferredoxins and 137
reductases were amplified from the genomic DNA of strain DC-6 or DC-2 with the 138
primers listed in Table 2 using PrimeSTAR HS DNA polymerase. The amplified 139
products were digested with NdeI and XhoI (or HindIII) and ligated into the 140
corresponding site of plasmid pET29a(+). All the recombinant plasmids were 141
sequenced to verify that the coding sequence of each gene was in-frame with the 142
vector sequence that encodes an C-terminal His6 tag and then transformed into E. coli 143
BL21(DE3). The expression of the genes and purification of the recombinant proteins 144
were carried out according to the methods described by Fang et al. (28). The 145
molecular weight was determined by SDS-PAGE, and the protein concentrations were 146
quantified by the Bradford method using bovine serum albumin as the standard (29). 147
148
Enzyme activity assays. The activity of the oxidative N-dealkylase toward various 149
chloroacetanilide herbicides was determined in 1 ml mixture containing 20 mM 150
acetate buffer (pH 7.0), 0.19 μg oxygenase, 0.64 μg ferredoxin, 0.18 μg reductase, 1 151
mM NADH, 0.5 mM Fe2+ and 1 mM Mg2+. The assays were initiated by addition of 152
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
9
the substrate at a final concentration of 0.5 mM to the enzyme mixture; the reactions 153
were performed at 30°C for 60 min and then terminated by boiling at 100°C for 3 min. 154
The disappearance of the substrates was monitored by HPLC, and the products were 155
identified by gas chromatography-mass spectrometry (GC-MS) as described below. 156
One unit of N-dealkylase activity was defined as the consumption of 1 nmol substrate 157
per minute. 158
159
Biochemical characterization. The pH range of the enzyme was determined by 160
incubating the enzyme with 0.5 mM acetochlor as the substrate for 60 min at 30°C 161
between pH 3.8 and 10.6. Three different buffering systems were used: 20 mM citric 162
acid buffer (pH 3.8 to 5.8), 20 mM acetate buffer (pH 5.4 to 8.6) and 20 mM 163
glycine-NaOH buffer (pH 7.8 to 10.6). The relative activity was calculated by 164
assuming that the activity observed at pH 7.0 was 100%. The optimal reaction 165
temperature was determined under standard conditions at pH 7.0 and different 166
temperatures (5-70 at 5°C intervals); the relative activity was calculated by assuming 167
that the activity observed at 30°C was 100%. The effects of potential inhibitors on the 168
enzyme were determined by addition of various monovalent and divalent cations 169
(each 1.0 mM) and metal chelating-agent EDTA (10 mM) to the reaction mixture and 170
incubation at 30°C for 60 min. N-dealkylase activity was assayed as described above 171
and expressed as a percentage of the activity obtained in the absence of the added 172
compounds. 173
174
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
10
HPLC and GC-MS analyses. The samples were freeze-dried, dissolved in 500 μL 175
methanol and filtered through a 0.22 µm Millipore membrane to remove particles. A 176
separation column (4.6 mm×250 mm×5 µm, Kromasil 100-5C18) was used for HPLC 177
analysis. The mobile phase was a mixture of methanol and water at 80:15 (vol/vol) 178
and the flow rate was 0.8 mL per min. The detection wavelength was 225 nm, and the 179
injection volume was 20 μL. GC-MS analysis was performed in electron ionization 180
(EI) mode (70 eV) with a Finnigan gas chromatograph equipped with an MS detector. 181
Gas chromatography was conducted using an RTX-5MS column (15 m×0.25 182
mm×0.25 µm, RESTEK CORP, US). The column temperature was programmed from 183
50°C (1.5 min hold) to 220°C at 20°C per min and held for 1 min and then increased 184
to 260°C at 50°C per min and held at 260°C for 10 min. Helium was used as the 185
carrier gas at a constant flow of 1.0 ml per min. The samples were analyzed in split 186
mode (1:20) at an injection temperature of 220°C and an EI source temperature of 187
250°C and scanned in the mass range from 50 m/z to 400 m/z. 188
189
Nucleotide sequence accession numbers. The GenBank accession no. of the 19,932 190
bp DNA fragment containing the oxygenase gene cndA is KJ461679. The GenBank 191
accession nos. of the ferredoxin genes cndB1, cndB2, fdx1 and fdx2 are KJ020542, 192
KJ020543, KJ186091 and KJ186092, respectively. The GenBank accession nos. of the 193
reductase genes cndC1 and red1 are KJ020540 and KJ020538, respectively. The draft 194
genome sequences of strain DC-6 and strain DC-2 have been deposited at 195
DDBJ/EMBL/GenBank under the accession JMUB00000000 and JNAC00000000, 196
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
11
respectively. The versions described in this paper are version JMUB01000000 and 197
version JNAC01000000, respectively. 198
199
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
12
RESULTS 200
Screen of a mutant DC-6Mut defective in herbicide degradation. When grow on 201
LB agar supplemented with 0.5 mM butachlor, sphingomonads DC-6 and DC-2 202
produce a visible transparent halo around the colony due to the lowly water-soluble 203
butachlor being mineralized or transformed to water-soluble product DEA. 204
Occasionally, we found that a few colonies of strain DC-6 lost the ability to produce 205
the transparent halo after successive streaking on LB agar; one of such mutant was 206
designated as DC-6Mut (Fig. S1). Whole-cell transformation experiments showed that 207
DC-6Mut could completely degrade CMEPA, CDEPA, MEA and DEA, which were 208
the metabolites of chloroacetanilide herbicides, but not alachlor, acetochlor or 209
butachlor, indicating that the gene responsible for the inital step (N-dealkylation) of 210
chloroacetanilide herbicide degradation was lost or disrupted in mutant DC-6Mut. 211
212
Genome comparison of strains DC-6, DC-6Mut and DC-2. The draft genomes of 213
strains DC-6, DC-6Mut and DC-2 consist of 6,334,837 bp, 6,325,634 bp and 214
5,004,271 bp in length, respectively. By comparing the genomes of strains DC-6 and 215
DC-6Mut, a 3,496 bp fragment of strain DC-6 was found to be absent in mutant 216
DC-6Mut, which was confirmed by PCR. Subsequently, the genomic regions flanking 217
the 3,496 bp fragment were obtained by DNA walking, and finally, a 19,932 bp 218
fragment was assembled. Sequence comparison and PCR analysis revealed that a 219
portion (18,183 bp) of the 19,932 bp sequence was also present in the genome of 220
strain DC-2, and a 4,265 bp fragment within the 18,183 bp was missing in mutant 221
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
13
DC-6Mut (Fig. 1). 222
223
ORF analysis of the missing fragment. ORF search revealed that an oxygenase gene, 224
designated cndA, was present in the 4,265 bp fragment (Table 3, Fig. 1). cndA consists 225
of 1,047 bp and encods a protein of 348 amino acids. BLAST analysis showed that 226
CndA shares homologies with the oxygenase components of some RHOs catalyzing 227
N- or O-demethylation reactions, e.g., VanA (vanillate O-demethylase, 42% identity) 228
from Pseudomonas sp. ATCC 19151 (30), DdmC (dicamba O-demethylase, 40% 229
identity) from Pseudomonas maltophilia DI-6 (31), PudmA (phenylurea herbicides 230
N-demethylase, 30% identity) from Sphingobium sp. YBL2 (18) and NdmA (27% 231
identity), NdmB (25% identity) and NdmC (24% identity), which are involved in the 232
N1-, N3- and N7-specific demethylation of caffeine in Pseudomonas putida CBB5 233
(17), respectively. Sequence alignment revealed that CndA contains conserved 234
sequences for a Rieske [2Fe-2S] domain (CXHX17CX2H) and a non-heme Fe(II) 235
domain (DX2HX4H) (Fig. S2), suggesting that CndA is a member of the RHO family. 236
Notably, two classes of transposon genes are found in the upstream and downstream 237
of cndA. Upstream of cndA, there were two genes, istA1 and istB1. IstA1 and IstB1 238
share 100% and 99% identities to IstA and IstB from Rhizobium sp. AC100, 239
respectively (32). Downstream of cndA, there are also two genes, tnpA1 and tnpA2. 240
TnpA1 and TnpA2 exhibit 99% identities to the IS6100 transposase-like proteins from 241
E. coli (33). The results indicated that gene cndA is located in a transposable element. 242
The homologies of CndA with some N- or O-demethylation oxygenases, the existence 243
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
14
of cndA in DC-6 and DC-2 and its absence in mutant DC-6Mut, suggested that cndA 244
is most likely the oxygenase component of an RHO that is responsible for the 245
N-dealkylation of chloroacetanilide herbicides. 246
247
CndA could functionally complement the DC-6Mut defect. To identify the 248
function of CndA, the recombinant plasmid pBBRcndA containing cndA was 249
introduced into mutant DC-6Mut. Whole-cell transformation experiments revealed 250
that strain DC-6Mut(pBBRcndA) restored the abilities to degrade alachlor, acetochlor 251
and butachlor (Fig. S3, 4, 5), confirming that CndA is involved in the N-dealkylation 252
of chloroacetanilide herbicides. Furthermore, similar to strain DC-6, 253
DC-6Mut(pBBRcndA) was able to form a visible transparent halo around the colonies 254
on LB agar supplemented with 0.5 mM butachlor (Fig. S1), also demonstrating the 255
N-dealkylation activity of CndA. However, E. coli DH5α harboring pBBRcndA failed 256
to degrade butachlor, which obviously is due to the absence of suitable electron 257
transport component (ETC). 258
259
Identification of the ferredoxin and reductase required for CndA. All reported 260
RHOs require an ETC to facilitate electron transfer. However, it is interesting that 261
there was no evidence for genes coding for ferredoxin or reductase that can serve as 262
the ETC located in the immediate vicinity of cndA. The strategy to identify the 263
ferredoxin and reductase components was based on the assumption that since the 264
function of CndA is dealkylation and it showed the highest sequence identifies with 265
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
15
the oxygenase components of some reported N- or O-demethylases, the ETC for 266
CndA should share homology with the ETC components of these N- or 267
O-demethylases. Thus, the ferredoxin and reductase components of DMO (31), 268
vanillate O-demethylase (30) and caffeine N-demethylases (17) were used to search 269
the genomes of strains DC-6 and DC-2. Vanillate O-demethylase and caffeine 270
N-demethylases are two-component RHOs consisting of an oxygenase and an FNRC 271
(ferredoxin-NADP+ reductase with the [2Fe-2S] ferredoxin domain connected to the 272
C-terminus of the NAD domain)-type reductase; when VanB, the reductase of 273
vanillate O-demethylase, and NdmD, the reductase of caffeine N-demethylases, were 274
used for the search, no target reductase was retrieved. DMO is a three-component 275
RHO consisting of an oxygenase DdmC, a [2Fe-2S]-type ferredoxin DdmB and a 276
GR-type reductase DdmA. When DdmB and DdmA were used for the search, two 277
ferredoxins, designated CndB1 and CndB2, and one reductase, designated CndC1, 278
were retrieved from strain DC-6, and another two ferredoxins, designated Fdx1and 279
Fdx2, and one reductase, designated Red1, were retrieved from strain DC-2. The four 280
ferredoxins share 64-72% identities to DdmB and form a subclade with DdmB in the 281
phylogenetic tree of the ferredoxin components of many RHOs; the two reductases 282
share 59-65% identities to DdmA and RedA2 and clustered in a subclade with the two 283
reductases in the phylogenetic tree of the reductase components of many RHOs (Fig. 284
2, 3). 285
286
Expression of cndA, ferredoxins and reductases genes and reconstruction of the 287
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
16
chloroacetanilide herbicide N-dealkylase in vitro. cndA and the retrieved four 288
ferredoxins and two reductases genes were expressed in E. coli BL21(DE3) using the 289
pET29a(+) expression system, the recombinant proteins were purified by Ni-affinity 290
chromatography (Fig. S6). The purified ferredoxins and reductases were used to mix 291
with CndA-His6 in various combinations in vitro. The results of enzyme assays 292
showed that the enzyme mixture displayed no N-dealkylase activity when tested 293
individually or in pairs. N-dealkylase activity was only obtained when the mixture 294
contained CndA-His6, one of the four ferredoxins and one of the two reductases, 295
indicating that the chloroacetanilide herbicide N-dealkylase consists of three 296
components: a homo-oligomer oxygenase, a [2Fe-2S] ferredoxin and a GR-type 297
reductase. The combination of CndA, CndB1 and CndC1 showed the highest 298
N-dealkylase activities, which was approximately 2-29% higher than those of the 299
combinations of CndA with other ferredoxins and reductases (Table 4). Comparison 300
of the N-dealkylation rates of alachlor, acetochlor and butachlor and their molecular 301
structures suggested a possible negative correlation between the length of the 302
N-alkoxymethyl and the catalytic efficiency of the enzyme toward these substrates. 303
The N-dealkylase was unable to degrade pretilachlor, propisochlor, metolachlor and 304
some other N- or O-methyl-containing compounds such as caffeine, vanillate, 305
dicamba and isoproturon. GC/MS analysis demonstrated that the N-dealkylase 306
converted alachlor to CDEPA and methoxymethanol, acetochlor to CMEPA and 307
ethoxymethanol, and butachlor to CDEPA and butoxymethanol (Fig. S7, 8, 9). 308
309
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
17
Characterization of the N-dealkylase. The effects of 1.0 mM monovalent and 310
divalent cations and 10 mM metal chelating-agent EDTA on the N-dealkylase 311
(mixture of CndA, CndB1 and CndC1) are shown in Table S1. The N-dealkylase 312
activity was notably enhanced by Fe2+ and Mg2+, but it was not obviously affected by 313
monovalent cations K+, Na+ and Li+. Divalent cations Ca2+, Cr2+, Co2+ and Mn2+ 314
showed moderate inhibition on the enzyme, whereas heavy metal ions Ag+, Cu2+, Pb2+, 315
Hg2+, Ni2+ and Zn2+ severely inhibited the activity. EDTA significantly inhibited the 316
N-dealkylase activity, indicating that the enzyme requires metal ions for its activity. 317
The N-dealkylase activity was detected from 5 to 65°C and at pH values ranging from 318
3.8 to 10.6, with the greatest N-dealkylase activity at 35°C and pH 7.0 (Fig. S10 A, B). 319
NADH, but not NADPH, supported the N-dealkylase activity, indicating that the 320
N-dealkylase is specific for NADH. Mg2+ and Fe2+ were necessary for N-dealkylase 321
activity. Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) 322
produced little or no stimulation of the N-dealkylase activity. 323
324
325
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
18
DISCUSSION 326
In the present study, we identified and characterized a RHO type N-dealkylase 327
catalyzing the N-dealkylation of chloroacetanilide herbicides alachlor, acetochlor and 328
butachlor. The chloroacetanilide herbicide N-dealkylase consists of a homo-oligomer 329
oxygenase CndA, a [2Fe-2S] ferredoxin and a GR-type reductase, and is obviously 330
different from previously reported oxidative herbicide N-dealkylases, such as 331
PudmAB (18), CYP116B1 (15) and CYP116A1 (34). PudmAB, catalyzing the 332
N-demethyl of phenylurea herbicides, is a hetero-oligomeric oxygenase consisting of 333
an alpha and a beta subunits (18); CYP116B1 and CYP116A1, catalyzing the 334
hydroxylation of S-ethyl dipropylthiocarbamate and S-propyl dipropylthiocarbamate, 335
are cytochrome P450-based N-dealkylases (15, 34). In the phylogenetic tree of CndA 336
with the oxygenase components of 71 characterized RHOs (Fig. S11), CndA is 337
clustered with the oxygenases components of many RHOs responsible for the 338
C-O/C-N bond-cleaving reactions, and forms a subclade with VanA (30), DdmC (31), 339
TsaM (35), NdmA, NdmB and NdmC (17). However, the chloroacetanilide herbicide 340
N-dealkylase differs in some essential genetic and biochemical characteristics from 341
these RHOs. First, CndA shares only 24-42% identities with these oxygenases. 342
Second, CndA has substrate spectrum that is different from these RHOs. Third, the 343
chloroacetanilide herbicide N-dealkylase is a three-component RHO, while all of its 344
neighbors in the subclade, except DMO, are two-component RHOs. Furthermore, the 345
chloroacetanilide herbicide N-dealkylase has some biochemical characteristics 346
different from its most related neighbor DMO (31), e.g., the chloroacetanilide 347
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
19
herbicide N-dealkylase cannot transform dicamba, which is the preferred substrate of 348
DMO; the chloroacetanilide herbicide N-dealkylase utilizes NADH, but not NADPH, 349
as reducing power, whereas DMO can utilize both NADH and NADPH. 350
351
RHOs are remarkably diverse with respect to their functions and structures. In the 352
RHO classification system based on the sequence phylogenetic information as well as 353
the interactions between components (16), RHOs were classified into five distinct 354
types: Type I [a homo-oligomeric or hetero-oligomeric oxygenase and an FNRC-type 355
reductase], Type II [an oxygenase and an FNRN (ferredoxin-NADP+ reductase with 356
the [2Fe-2S] ferredoxin domain connected to the N-terminus of the flavin-binding 357
domain)-type reductase], Type III (a homo-oligomeric or hetero-oligomeric 358
oxygenase, a [2Fe-2S]-type ferredoxin and an FNRN-type reductase), Type IV (an 359
hetero-oligomeric oxygenase, a [2Fe-2S]-type ferredoxin and a GR-type reductase) 360
and Type V (an hetero-oligomeric oxygenase, a [3Fe-4S]-type ferredoxin and a 361
GR-type reductase). The chloroacetanilide herbicide N-dealkylase and DMO are most 362
related to Type IV RHOs, but distinguishable from reported Type IV RHOs in term of 363
oxygenase type. Thus we suggest that Type IV should be amended and subdivided 364
into two subtypes: type IVαβ (the oxygenase component is hetero-oligomeric), and 365
type IVα (the oxygenase component is homo-oligomeric) to accommodate the 366
chloroacetanilide herbicide N-dealkylase and DMO. 367
368
In the opinion of Kweom et al., three-component RHOs (type IV and V) are more 369
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
20
evolutionarily advanced and more efficient than two-component RHOs (type I and II) 370
due to that the ferredoxin component is relatively short and simple compared to the 371
reductase component, and thus has been evolutionarily chosen as a buffer between the 372
reductase and oxygenase components for rapid adaption toward environmental 373
transitions (16). It is interesting that chloroacetanilide herbicides and the substrates of 374
many recently reported three-component RHOs, such as phenylurea herbicides (18), 375
dicamba (31) and dioxin (36), are man-made xenobiotics that have been present in the 376
environment for no more than one hundred years. The facts that bacteria have evolved 377
three-component RHOs to degrade these xenobiotics provide new evidence to support 378
the above proposal that three-component RHOs have the potential to promptly adapt 379
to environmental change. 380
381
CndA is highly conserved and located in a putative transposable element, which is 382
present in the genomes of both sphingomonads DC-6 and DC-2. These two 383
sphingomonads were isolated from the same activated sludge sample (10, 11). These 384
results indicate that cndA can be horizontally transferred among sphingomonads. In 385
general, the genes encoding the components of RHOs are clustered together and 386
organized in a transcriptional unit (36, 37). However, the genes coding the ferredoxins 387
and reductase that served as the ETC are not located in the immediate vicinity of cndA. 388
The similar phenomena are also found in some other RHO genes responsible for the 389
metabolism of xenobiotics (18, 31, 36). In addition, CndA can use more than one 390
[2Fe-2S]-type ferredoxins and GR-type reductases as the ETC, suggesting that CndA 391
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
21
has a low specificity for ETC. Such gene organization may increase the gene 392
utilization flexibility and efficiency, and thus facilitates bacteria to rapidly evolve new 393
catabolic pathways to degrade xenobiotics. 394
395
396
ACKNOWLEDGMENTS 397
We are grateful to Prof. NingYi Zhou (School of Life Sciences & Biotechnology, 398
Shanghai Jiao Tong University, Shanghai, China) for valuable suggestions on the 399
enzyme study. This work was supported by grants from the National Natural Science 400
Foundation of China (31270157) and the National High Technology Research and 401
Development Program of China (2012AA101403). 402
403
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
22
REFERENCES 404
1. Tomlin CDS. 2006. The Pesticide Manual: A World Compendium, The 14th ed. 405
British Crop Protection Council, Farnham, Surry, UK. 406
2. Hildebrandt A, Guillamón M, Lacort S, Tauler R, Barceló D. 2008. Impact of 407
pesticides used in agriculture and vineyards to surface and groundwater quality 408
(North Spain). Water. Res. 42:3315-3326. 409
3. USEPA. 1995. EPA-738-F-95–007. R.E.D. Facts: metolachlor. Available from: 410
http://www.epa.gov/pesticides/reregistration/REDs/factsheets/0001fact.pdf. 411
4. USEPA. 1998. EPA-738-F-98–018. R.E.D. Facts: alachlor. Available from: 412
http://www.epa.gov/oppsrrd1/REDs/factsheets/0063fact.pdf. 413
5. USEPA. 2006. EPA738-R-00–009. Report of the food quality protection act 414
(FQPA) tolerance reassessment progress and risk management decision (TRED) 415
for acetochlor. Available from: 416
http://www.epa.gov/pesticides/reregistration/REDs/acetochlor_tred.pdf. 417
6. Beestman GB, Deming JM. 1974. Dissipation of acetanilide herbicides from 418
soils. Agron. J. 66:308-311. 419
7. Wang YS, Liu JC, Chen WC, Yen JH. 2008. Characterization of acetanilide 420
herbicides degrading bacteria isolated from tea garden soil. Microb. Ecol. 421
55:435-443. 422
8. Dwivedi S, Singh BR, Al-Khedhairy AA, Alarifi S, Musarrat J. 2010. Isolation 423
and characterization of butachlor-catabolizing bacterial strain Stenotrophomonas 424
acidaminiphila JS-1 from soil and assessment of its biodegradation potential. Lett. 425
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
23
Appl. Microbiol. 51:54-60. 426
9. Zhang J, Zheng JW, Liang B, Wang CH, Cai S, Ni YY, He J, Li SP. 2011. 427
Biodegradation of chloroacetanilide herbicides by Paracoccus sp. FLY-8 in vitro. 428
J. Agric. Food. Chem. 59:4614-4621. 429
10. Chen Q, Yao L, Wang CH, Deng SK, Chu CW, He J. 2013. Isolation and 430
characterization of acetochlor-degrading strain Sphingomonas sp. DC-6 and 431
preliminary studies on its metabolic pathway. J. Agri. Sci. Tech. 15:67-74. 432
11. Li Y, Chen Q, Wang CH, Cai S, He J, Huang X, Li SP. 2013. Degradation of 433
acetochlor by consortium of two bacterial strains and cloning of a novel amidase 434
gene involved in acetochlor-degrading pathway. Bioresour. Technol. 435
148:628-631. 436
12. Stamper DM, Tuovinen OH. 1998. Biodegradation of the acetanilide herbicides 437
alachlor, metolachlor, and propachlor. Crit. Rev. Microbiol. 24:1-22. 438
13. Denisov IG, Makris TM, Sligar SG, Schlichting I. 2005. Structure and 439
chemistry of cytochrome P450. Chem. Rev. 105:2253-2278. 440
14. Barry SM, Challis GL. 2013. Mechanism and catalytic diversity of Rieske 441
non-hemeiron-dependent oxygenases. ACS Catal. 3:2362-2370. 442
15. Warman AJ, Robinson JW, Luciakova D, Lawrence AD, Marshal KR, 443
Warren MJ, Cheesman MR, Rigby SE, Munro AW, McLean KJ. 2012. 444
Characterization of Cupriavidus metallidurans CYP116B1-A thiocarbamate 445
herbicide oxygenating P450-phthalate dioxygenase reductase fusion protein. 446
FEBS. J. 279:1675-1693. 447
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
24
16. Kweon O, Kim SJ, Baek S, Chae JC, Adjei MD, Baek DH, Kim YC, 448
Cerniglia CE. 2008. A new classification system for bacterial Rieske non-heme 449
iron aromatic ring-hydroxylating oxygenases. BMC Biochem. 9:11. 450
17. Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, 451
Subramanian M. 2012. Novel, highly specific N-demethylases enable bacteria 452
to live on caffeine and related purine alkaloids. J. Bacteriol. 194:2041-2049. 453
18. Gu T, Zhou CY, Sørensen SR, Zhang J, He J, Yu PW, Yan X, Li SP. 2013. The 454
novel bacterial N-demethylase PudmAB is responsible for the initial step of N, 455
N-dimethyl-substituted phenylurea herbicides degradation. Appl. Environ. 456
Microbiol. 79:7846-7856. 457
19. Sambrook J, Russell D. 2001. Molecular cloning: a laboratory manual, the 3rd 458
ed. Cold Spring Horbor laboratory, Cold Spring Harbor, New York, NY. 459
20. Darling AC, Mau B, Blattner FR, Perna NT. 2004. Mauve: multiple alignment 460
of conserved genomic sequence with rearrangements. Genome Res. 461
14:1394-1403. 462
21. Wang SM, He J, Cui ZL, Li SP. 2007. Self-formed adaptor PCR: a simple and 463
efficient method for chromosome walking. Appl. Environ. Microbiol. 464
73:5048-5051. 465
22. Larkin M, Blackshields G, Brown N, Chenna R, McGettigan PA, McWilliam 466
H, Valentin F, Wallace IM, Wilm A, Lopez R. 2007. Clustal W and Clustal X 467
version 2.0. Bioinformatics. 23:2947-2948. 468
23. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for 469
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
25
reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425. 470
24. Kimura M. 1980. A simple method for estimating evolutionary rates of base 471
substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 472
16:111-120. 473
25. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. 474
MEGA5: molecular evolutionary genetics analysis using maximum likelihood, 475
evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 476
28:2731-2739. 477
26. Kovach ME, Elzer PH, Steven Hill D, Robertson GT, Farris MA, Roop II 478
RM, Peterson KM. 1995. Four new derivatives of the broad-host-range cloning 479
vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 480
166:175-176. 481
27. Liu H, Wang SJ, Zhang JJ, Dai H, Tang H, Zhou NY. 2011. Patchwork 482
assembly of nag-like nitroarene dioxygenase genes and the 3-chlorocatechol 483
degradation cluster for evolution of the 2-chloronitrobenzene catabolism pathway 484
in Pseudomonas stutzeri ZWLR2-1. Appl. Environ. Microbiol. 77:4547-4552. 485
28. Fang T, Zhou NY. 2014. Purification and characterization of salicylate 486
5-hydroxylase, a three-component monooxygenase from Ralstonia sp. strain U2. 487
Appl. Microbiol. Biotechnol. 98:671-679. 488
29. Bradford MM. 1976. A rapid and sensitive method for the quantitation of 489
microgram quantities of protein utilizing the principle of protein-dye binding. 490
Anal. Biochem. 72:248-254. 491
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
26
30. Brunel F, Davison J. 1988. Cloning and sequencing of Pseudomonas genes 492
encoding vanillate demethylase. J. Bacteriol. 170:4924-4930. 493
31. Herman PL, Behrens M, Chakraborty S, Chrastil BM, Barycki J, Weeks DP. 494
2005. A three-component dicamba O-demethylase from Pseudomonas 495
maltophilia, Strain DI-6 gene isolation, characterization, and heterologous 496
expression. J. Biol. Chem. 280:24759-24767. 497
32. Hashimoto M, Fukui M, Hayano K, Hayatsu M. 2002. Nucleotide sequence 498
and genetic structure of a novel carbaryl hydrolase gene (cehA) from Rhizobium 499
sp. strain AC100. Appl. Environ. Microbiol. 68:1220-1227. 500
33. Woodford N, Carattoli A, Karisik E, Underwood A, Ellington MJ, Livermore 501
DM. 2009. Complete nucleotide sequences of plasmids pEK204, pEK499, and 502
pEK516, encoding CTX-M enzymes in three major Escherichia coli lineages 503
from the United Kingdom, all belonging to the international O25: H4-ST131 504
clone. Antimicrob. Agents. Chemother. 53:4472-4482. 505
34. Nagy I, Schoofs G, Compernolle F, Proost P, Vanderleyden J, de Mot R. 1995. 506
Degradation of the thiocarbamate herbicide EPTC (S-ethyl 507
dipropylcarbamothioate) and biosafening by Rhodococcus sp. strain NI86/21 508
involve an inducible cytochrome P-450 system and aldehyde dehydrogenase. J. 509
Bacteriol. 177:676-687. 510
35. Tralau T, Cook AM, Ruff J. 2001. Map of the IncP1β plasmid pTSA encoding 511
the widespread genes (tsa) for p-Toluenesulfonate degradation in Comamonas 512
testosteroni T-2. Appl. Environ. Microbiol. 67:1508-1516. 513
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
27
36. Armengaud J, Happe B, Timmis KN. 1998. Genetic analysis of dioxin 514
dioxygenase of Sphingomonas sp. strain RW1: catabolic genes dispersed on the 515
genome. J. Bacteriol. 180:3954-3966. 516
37. Tang HZ, Wang LJ, Wang WW, Yu H, Zhang KZ, Yao YX, Xu P. 2013. 517
Systematic unraveling of the unsolved pathway of nicotine degradation in 518
Pseudomonas. PLoS Genet. 9:e1003923. 519
520
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
28
FIGURE LEGENDS 521
Fig. 1 Organization of the genes involved in the N-dealkylation of 522
chloroacetanilide herbicides. Arrows indicate the length and transcription direction 523
of each gene or ORF. 524
525
Fig. 2 Phylogenetic tree constructed based on the alignment of CndB1, CndB2, 526
Fdx1 and Fdx2 with the ferredoxin components of some characterized RHOs. 527
The trees were constructed by the Neighbor-Joining method. Branches corresponding 528
to partitions reproduced in less than 50% bootstrap replicates are collapsed. Name of 529
the proteins, strains and their GI numbers are displayed in the phylogenetic tree. 530
531
Fig. 3 Phylogenetic tree constructed based on the alignment of CndC1 and Red1 532
with the reductase components of some characterized RHOs. The trees were 533
constructed by the Neighbor-Joining method. Branches corresponding to partitions 534
reproduced in less than 50% bootstrap replicates are collapsed. Name of the proteins, 535
strains and their GI numbers are displayed in the phylogenetic tree. 536
537
Table 1 Strains and plasmids used in this study. 538
539
Table 2 PCR primers used in this study. 540
541
Table 3 Deduced function of each ORF within the 19,932 bp sequence containing 542
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
29
the 4,265 bp missing fragment. 543
544
Table 4 The activities for alachlor, acetochlor and butachlor of different 545
combinations of oxygenase, ferredoxin and reductase. 546
547
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
30
Table 1 Strains and plasmids used in this study. 548
Strains or plasmids Characteristics Source or reference
Strains
Sphingomonas wittichii DC-6
(=KACC 16600)
Degrades alachlor, acetochlor and butachlor, Smr 10
Sphingomonas wittichii DC-6Mut Mutant of DC-6; unable to degrade alachlor, acetochlor and butachlor, Smr
This study
Sphingobium quisquiliarum DC-2 (=KACC 17149)
Degrades acetochlor, butachlor and alachlor, Smr 11
Escherichia coli DH5α F− recA1 endA1 thi-1 supE44 relA1 deoR
Δ(lacZYA-argF) U169 80d/lacZ ΔM15
TaKaRa
Escherichia coli BL21(DE3) F− ompT hsdS(rB− mB−) gal dcm lacY1(DE3) Invitrogen
Escherichia coli HB101(pRK600) Conjugation helper strain, Cmr This Lab
Plasmids
pBBR1MCS-5 Broad host range cloning vector; Gmr 26
pBBRcndA pBBR1MCS-5 derivative containing cndA; Gmr This study
pET29a(+) Expression vector; Kmr Novagen
pETcndA pET-29a(+) derivative carrying cndA; Kmr This study
pETcndB1 pET-29a(+) derivative carrying cndB1; Kmr This study
pETcndB2 pET-29a(+) derivative carrying cndB2; Kmr This study
pETfdx1 pET-29a(+) derivative carrying fdx1; Kmr This study
pETfdx2 pET-29a(+) derivative carrying fdx2; Kmr This study
pETcndC1 pET-29a(+) derivative carrying cndC1; Kmr This study
pETred1 pET-29a(+) derivative carrying red1; Kmr This study
549
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
31
Table 2 PCR primers used in this study. 550
Primer DNA Sequence (5´ to 3´)a Purpose
pBBRcndAf CGGGGTACCATGTTTCTCCAGAATGCC
TGGTACG
Forward primer to amplify cndA
with a KpnI site
pBBRcndAr CCGGAATTCCTACCCCGCCGACACAGC
GACGACCTTG
Reverse primer to amplify cndA
with an EcoRI site
pET-NdeI-cndA-f GGAATTCCATATGTTTCTCCAGAATGCC
TGGTACG
Forward primer to amplify cndA
with a NdeI site
pET-XhoI-cndA-r AATCCCCTCGAGCCCCGCCGACACAGC
GACGACCTTG
Reverse primer to amplify cndA
with an XhoI site
pET-NdeI-cndB1-f GATCTAGGGACCCATATGCCGACCATCA
TCGTCACC
Forward primer to amplify cndB1
with a NdeI site
pET-XhoI-cndB1-r CATGACCTGAAACTCGAGATCCTCCGG
CGCGATGGCGAC
Reverse primer to amplify cndB1
with an XhoI site
pET-NdeI-cndB2-f ATCTAGGGACCCATATGCCCAAGTTGG
TTGTCGTTA
Forward primer to amplify cndB2
with a NdeI site
pET-XhoI-cndB2-r CATGACCTGAAACTCGAGATCTTCCGG
CGCGATCGTGAC
Reverse primer to amplify cndB2
with an XhoI site
pET-NdeI-fdx1-f ATCTAGGGACCCATATGCCCAAGTTGAT
TGTGGTCAACC
Forward primer to amplify fdx1 with
a NdeI site
pET-XhoI-fdx1-r CATGACCTGAAACTCGAGGTCTTCCGG
CGCGATGGTGACG
Reverse primer to amplify fdx1 with
an XhoI site
pET-NdeI-fdx2-f ATCTAGGGACCCATATGACGACGATTG
AAGTGACCACCC
Forward primer to amplify fdx2 with
a NdeI site
pET-XhoI-fdx2-r CATGACCTGAAACTCGAGATCTTCGGG
CGCGAGTGTCACC
Reverse primer to amplify fdx2 with
an XhoI site
pET-NdeI-cndC1-f GGAATTCCATATGGCCCAGTATGACGTT
CTGATCG
Forward primer to amplify cndC1
with a NdeI site
pET-HindIII-cndC1-r AATCCCAAGCTTGGCAGGGAGCAGGG
TCTTCAACGG
Reverse primer to amplify cndC1
with a HindIII site
pET-NdeI-red1-f ATCTAGGGACCCATATGAACCATTATGA
CGTTGTGATCG
Forward primer to amplify red1 with
a NdeI site
pET-XhoI-red1-r CATGACCTGAAACTCGAGGGCCAGAC
CGACTTCCTTGAGA
Reverse primer to amplify red1 with
an XhoI site
a restriction sites are underlined. 551
552
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
32
Table 3 Deduced function of each ORF within the 19,932 bp sequence containing 553
the 4,265 bp missing fragment. 554
Gene name, proposed
product(s)
Position in the 19,932
bp fragment, product
size (amino acids)
Homologous protein (GenBank accession
no.) and source
%
Identity
orf1, Hypothetical protein 241-744, 168 Hypothetical protein (WP_016698448.1),
Actinoalloteichus spitiensis
29
orf2, Hypothetical protein 925-1359, 145 Hypothetical protein (WP_010339728.1),
Sphingobium yanoikuyae
72
orf3, Conserved hypothetical
protein
2959-4308, 450 Conserved hypothetical protein
(XP_002536264.1), Ricinus communis
47
itsA1, Transposase 5593-7110, 506 Transposase (BAB85624.1), Rhizobium sp.
AC100
100
itsB1, IstB-like ATP-binding
protein
7103-7879, 259 Mobile element protein (BAB85621.1),
Rhizobium sp. AC100
99
cndA, Oxygenase 7988-9031, 348 Vanillate monooxygenase
(YP_001262782.1), Sphingomonas wittichii
RW1
48
tnpA1, Transposase 9658-10451, 258 Transposase IS6100 (YP_003108355.1),
Escherichia coli
99
tnpA2, Transposase 11562-12353, 264 Transposase IS6100 (YP_003108355.1),
Escherichia coli
99
orf4, Hypothetical protein 12793-13809, 339 Hypothetical protein (YP_006962357.1),
Pseudomonas sp. K-62
33
orf5, Hypothetical protein 14082-15440, 453 Hypothetical protein G432_22025
(YP_007618333.1), Sphingomonas sp.
MM-1
100
orf6, Resolvase 15440-16075, 212 Resolvase domain-containing protein
(YP_007618300.1), Sphingomonas sp.
MM-1
100
tn3A, Transposase 16177-19104, 976 Transposase Tn3 family protein
(YP_007618331.1), Sphingomonas sp.
MM-1
100
555
556
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from
33
Table 4 The activities for alachlor, acetochlor and butachlor of different 557
combinations of oxygenase, ferredoxin and reductase. 558
559
Alachlor
(nmol/min/mg)
Acetochlor
(nmol/min/mg)
Butachlor
(nmol/min/mg)
CndA-B1-C1 205.3 ± 20.5 145.9 ± 12.7 112.4 ± 16.4
CndA-B1-R1 195.7 ± 7.4 143.2 ± 19.4 91.8 ± 6.5
CndA-B2-C1 186.3 ± 12.4 124.7 ± 7.8 87.1 ± 9.4
CndA-B2-R1 176.5 ± 15.7 119.5 ± 18.4 83.3 ± 21.5
CndA-F1-C1 167.1± 19.3 141.6 ± 20.2 79.6 ± 5.3
CndA-F1-R1 169.4 ± 21.2 138.1 ± 11.5 85.4 ± 17.1
CndA-F2-C1 174.8 ± 15.6 132.5 ± 23.7 86.9 ± 14.7
CndA-F2-R1 161.5 ± 6.6 129.1 ± 17.6 79.2 ±12.6
Abbreviations : B1, CndB1; B2, CndB2; C1, CndC1; F1, Fdx1; F2, Fdx2; R1, Red1. 560
on May 27, 2018 by guest
http://aem.asm
.org/D
ownloaded from