1 A Novel Three-Component Rieske Non-Heme...

* Author for correspondence: Jian He. Tel: +86-25-84396685, Fax: +86-25-84395326;

E-mail: [email protected]

1

A Novel Three-Component Rieske Non-Heme Iron Oxygenase 1

(RHO) System Catalyzing the N-Dealkylation of 2

Chloroacetanilide Herbicides in Sphingomonads DC-6 and DC-2 3

4

Qing Chen, Cheng-Hong Wang, Shi-Kai Deng, Ya-Dong Wu, Yi Li, Li Yao, 5

Jian-Dong Jiang, Xin Yan, Jian He*, and Shun-Peng Li 6

Key Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, 7

College of Life Sciences, Nanjing Agricultural University, Nanjing, China 8

9

AEM Accepts, published online ahead of print on 13 June 2014Appl. Environ. Microbiol. doi:10.1128/AEM.00659-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on May 27, 2018 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

ABSTRACT 10

Sphingomonads DC-6 and DC-2 degrade chloroacetanilide herbicides alachlor, 11

acetochlor and butachlor via N-dealkylation. In this study, we report a three- 12

component Rieske non-heme iron oxygenase (RHO) system catalyzing the 13

N-dealkylation of these herbicides. The oxygenase component gene cndA is located in 14

a transposable element that is highly conserved in the two strains. CndA shares 15

24-42% identities with the oxygenase components of some RHOs that catalyze the N- 16

or O-demethylation. Two putative [2Fe-2S] ferredoxins and one GR (glutathione 17

reductase)-type reductase genes were retrieved from the genome of each strain, these 18

genes were not located in the immediate vicinity of cndA. The four ferredoxins share 19

64-72% identities to the ferredoxin component of dicamba O-demethylase (DMO), 20

and the two reductases share 62-65% identities to the reductase component of DMO. 21

cndA, the four ferredoxins and two reductases genes were expressed in Escherichia 22

coli and the recombinant proteins were purified using Ni-affinity chromatography. 23

The individual components or in pairs displayed no activity; only when CndA-His6 24

plus one of the four ferredoxins and one of the two reductases did the enzyme mixture 25

show N-dealkylase activities toward alachlor, acetochlor and butachlor, suggesting 26

that the enzyme consists of three components: a homo-oligomer oxygenase, a [2Fe-2S] 27

ferredoxin and a GR-type reductase, and CndA has a low specificity for electron 28

transport component (ETC). The N-dealkylase utilizes NADH, but not NADPH, as 29

electron donor. 30

31


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

INTRODUCTION 32

Chloroacetanilide herbicides are a class of highly efficient pre-emergence herbicides 33

that are widely used in corn, cotton, soybean and many other crops for the control of 34

annual grass and broadleaf weeds (1). The majority of commonly used 35

chloroacetanilide herbicides, such as alachlor, acetochlor, butachlor and metolachlor, 36

are N-alkoxyalkyl-N-chloroacetyl-substituted aniline derivatives in structure. Due to 37

their widespread use, long persistence and high water solubility, some of these 38

herbicides and their metabolites have been frequently detected in soil and 39

underground water (2). Chloroacetanilide herbicides are suspected to be carcinogenic, 40

e.g., alachlor and acetochlor are characterized as class B2 (probable human 41

carcinogens), whereas butachlor and metolachlor are listed as class L2 (likely to be 42

carcinogenic to humans) and C (possible human carcinogens), respectively, by the US 43

Environmental Protection Agency (3-5). Furthermore, these herbicides have a high 44

chronic toxicity toward some aquatic organisms, and the residues in soil frequently 45

injure subsequent rotation crops, especially in sandy soils with low organic matter 46

contents (3-5). Therefore, the degradation mechanisms for chloroacetanilide 47

herbicides in the environment have received considerable attention. 48

49

Microbial metabolism is the most important factor in the degradation of 50

chloroacetanilide herbicides in the environment (6). A variety of bacterial strains that 51

are able to degrade butachlor, alachlor, acetochlor and metolachlor have been 52

characterized (7-11). The microbial degradation of chloroacetanilide herbicides can be 53


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

initiated by two reactions: formation of a glutathione conjugate (12) or N-dealkylation 54

(9-11). In the N-dealkylation pathway, these herbicides are N-dealkylated to 55

2-chloro-N-(2, 6-diethylphenyl) acetamide (CDEPA) (for alachlor and butachlor) or 56

2-chloro-N-(2-methyl-6-ethylphenyl) acetamide (CMEPA) (for acetochlor and 57

metolachlor), which are then converted to 2,6-diethylaniline (DEA) or 58

2-methyl-6-ethylaniline (MEA), respectively (9-11). A gene, cmeH, encoding an 59

amidase that catalyzes the amide bond cleavage of CDEPA or CMEPA was cloned 60

from Sphingobium quisquiliarum DC-2 (11). However, the molecular basis for the 61

N-dealkylation of chloroacetanilide herbicides in microorganisms is still unknown. 62

63

In living organisms, N-Dealkylation by members of cytochrome P450 and Rieske 64

non-heme iron oxygenase (RHO) families are important metabolic or detoxification 65

mechanisms for many N-alkyl-containing natural or xenobiotic compounds (13-15). 66

RHOs are characterized by utilizing Rieske-type non-heme Fe(II) as the catalytic 67

centers, and they are important enzymes for the degradation of xenobiotics and the 68

biosynthesis of bioactive natural compounds (14, 16). To date, more than 130 RHOs 69

have been reported, but only a few RHOs are N-demethylases. Summers et al. 70

described three RHO monooxygenases, NdmA, NdmB and NdmC, which catalyze the 71

N1-, N3- and N7-specific demethylation of caffeine, respectively, in Pseudomonas 72

putida CBB5 (17). Recently, Gu et al. identified an N-demethylase PudmA catalyzing 73

the demethylation of phenylurea herbicides in Sphingobium sp. YLB-2 (18). To the 74

best of our knowledge, there is no description of an RHO that is involved in the 75


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

N-dealkylation of chloroacetanilide herbicides. 76

77

Previously, two sphingomonads Sphingomonas wittichii DC-6 and Sphingobium 78

quisquiliarum DC-2 were isolated from activated sludge of a wastewater treatment 79

facility of a herbicide manufacturer (10, 11). Strain DC-6 mineralizes 80

chloroacetanilide herbicides such as alachlor, acetochlor and butachlor, while strain 81

DC-2 can only transform them to final products DEA or MEA. In both strains, the 82

initial metabolic reaction is N-dealkylation. In this study, a three-component RHO 83

responsible for the N-dealkylation of alachlor, acetochlor and butachlor was identified 84

in the two sphingomonads. 85

86


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

MATERIALS AND METHODS 87

Chemicals and media. Alachlor, acetochlor, pretilachlor, butachlor, propisochlor, 88

metolachlor, CDEPA, DEA and MEA were purchased from Sigma-Aldrich (Shanghai, 89

China); CMEPA was purchased from Alfa-Aesar (Tianjin, China). All chemicals and 90

reagents were of analytical grade. Luria-Bertani (LB) agar and LB broth were 91

obtained from Difco Laboratories (Detroit, MI). The minimal salts medium (MSM) 92

consisted of the following components (in g liter-1): K2HPO4 1.5, KH2PO4 0.5, 93

NH4NO3 1.0, NaCl 1.0, MgSO4·7H2O 0.2, yeast extract 0.02; pH 7.0. 94

95

Bacterial strains, plasmids and culture conditions. The strains and plasmids used in 96

this study are listed in Table 1. Escherichia coli strains were routinely grown 97

aerobically at 37°C in LB broth or on LB agar. The sphingomonads were grown 98

aerobically at 30°C in LB medium, unless otherwise indicated. 99

100

Sequencing, assembly, annotation and genome comparison. DNA manipulation 101

was performed according to standard protocols as described by Sambrook et al. (19). 102

Draft genome sequencing was performed by Shanghai Majorbio Bio-pharm 103

Technology Co., Ltd. (Shanghai, China) using Illumina HiSeq 2000 system. 300 bp 104

shotgun libraries were constructed for each strain, the raw reads was assembled using 105

SOAPdenovo software (http://soap.genomics.org.cn/soapdenovo.html; version: 1.05). 106

De novo gene prediction was performed through Glimmer software 107

(http://cbcb.umd.edu/software/glimmer; version: 3.0). Functional annotation was 108


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

accomplished by BLAST analysis of protein sequences in Kyoto Encyclopedia of 109

Genes and Genomes database (KEGG), Swiss-Prot database, Non-Redundant protein 110

database (NR) and Cluster of Orthologous Groups database (COG) using E-value 111

cutoff of 1E-5. To find the missing DNA fragment in DC-6Mut, an all-versus-all 112

analysis was carried out between the genomes of strains DC-6 and DC-6Mut using 113

MAUVE1.2.3 software package with its default setting (20). The analysis of 114

nucleotide and deduced amino acid sequences were performed through Omiga 115

software (version: 3.0). DNA walking was performed by SEFA-PCR (21). For the 116

phylogenetic analysis, all protein sequences were aligned by Clustal X (version: 2.0) 117

(22); the phylogenetic tree was constructed by Neighbor-Joining method (23) with 118

Kimura two-parameter distance model (24) in MEGA software (version: 5.0) (25). 119

120

Functional complement of the DC-6Mut defect with CndA. A 1,047 bp 121

KpnI-EcoRI-digested PCR fragment containing cndA was ligated into the 122

corresponding site of broad-host-range plasmid pBBR1MCS-5 (26). The resulting 123

plasmid, pBBRcndA, was transformed into E. coli DH5α. The inserted fragment of 124

pBBRcndA was verified by sequencing, and pBBRcndA was then introduced into the 125

DC-6Mut by triparental mating with pRK600 as the helper. The abilities of the strains 126

harboring pBBRcndA to degrade alachlor, acetochlor and butachlor were determined 127

by a whole-cell biotransformation test as described by Liu et al. (27) with some 128

modification. Briefly, the post-log phase cells were harvested by centrifugation, 129

washed with MSM and resuspended in 30 ml MSM to a final OD600 of 1.0. The cell 130


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

suspension was added with 0.5 mM of each substrate and incubated aerobically on a 131

rotary shaker at 30°C with 150 rpm. Samples were taken at regular intervals and 132

concentrations of the substrates were determined by high-performance liquid 133

chromatography (HPLC) analysis as described below. 134

135

Expression of the oxygenase, ferredoxin and reductase genes and purification of 136

the recombinant proteins. The genes coding the oxygenase, ferredoxins and 137

reductases were amplified from the genomic DNA of strain DC-6 or DC-2 with the 138

primers listed in Table 2 using PrimeSTAR HS DNA polymerase. The amplified 139

products were digested with NdeI and XhoI (or HindIII) and ligated into the 140

corresponding site of plasmid pET29a(+). All the recombinant plasmids were 141

sequenced to verify that the coding sequence of each gene was in-frame with the 142

vector sequence that encodes an C-terminal His6 tag and then transformed into E. coli 143

BL21(DE3). The expression of the genes and purification of the recombinant proteins 144

were carried out according to the methods described by Fang et al. (28). The 145

molecular weight was determined by SDS-PAGE, and the protein concentrations were 146

quantified by the Bradford method using bovine serum albumin as the standard (29). 147

148

Enzyme activity assays. The activity of the oxidative N-dealkylase toward various 149

chloroacetanilide herbicides was determined in 1 ml mixture containing 20 mM 150

acetate buffer (pH 7.0), 0.19 μg oxygenase, 0.64 μg ferredoxin, 0.18 μg reductase, 1 151

mM NADH, 0.5 mM Fe2+ and 1 mM Mg2+. The assays were initiated by addition of 152


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

the substrate at a final concentration of 0.5 mM to the enzyme mixture; the reactions 153

were performed at 30°C for 60 min and then terminated by boiling at 100°C for 3 min. 154

The disappearance of the substrates was monitored by HPLC, and the products were 155

identified by gas chromatography-mass spectrometry (GC-MS) as described below. 156

One unit of N-dealkylase activity was defined as the consumption of 1 nmol substrate 157

per minute. 158

159

Biochemical characterization. The pH range of the enzyme was determined by 160

incubating the enzyme with 0.5 mM acetochlor as the substrate for 60 min at 30°C 161

between pH 3.8 and 10.6. Three different buffering systems were used: 20 mM citric 162

acid buffer (pH 3.8 to 5.8), 20 mM acetate buffer (pH 5.4 to 8.6) and 20 mM 163

glycine-NaOH buffer (pH 7.8 to 10.6). The relative activity was calculated by 164

assuming that the activity observed at pH 7.0 was 100%. The optimal reaction 165

temperature was determined under standard conditions at pH 7.0 and different 166

temperatures (5-70 at 5°C intervals); the relative activity was calculated by assuming 167

that the activity observed at 30°C was 100%. The effects of potential inhibitors on the 168

enzyme were determined by addition of various monovalent and divalent cations 169

(each 1.0 mM) and metal chelating-agent EDTA (10 mM) to the reaction mixture and 170

incubation at 30°C for 60 min. N-dealkylase activity was assayed as described above 171

and expressed as a percentage of the activity obtained in the absence of the added 172

compounds. 173

174


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

HPLC and GC-MS analyses. The samples were freeze-dried, dissolved in 500 μL 175

methanol and filtered through a 0.22 µm Millipore membrane to remove particles. A 176

separation column (4.6 mm×250 mm×5 µm, Kromasil 100-5C18) was used for HPLC 177

analysis. The mobile phase was a mixture of methanol and water at 80:15 (vol/vol) 178

and the flow rate was 0.8 mL per min. The detection wavelength was 225 nm, and the 179

injection volume was 20 μL. GC-MS analysis was performed in electron ionization 180

(EI) mode (70 eV) with a Finnigan gas chromatograph equipped with an MS detector. 181

Gas chromatography was conducted using an RTX-5MS column (15 m×0.25 182

mm×0.25 µm, RESTEK CORP, US). The column temperature was programmed from 183

50°C (1.5 min hold) to 220°C at 20°C per min and held for 1 min and then increased 184

to 260°C at 50°C per min and held at 260°C for 10 min. Helium was used as the 185

carrier gas at a constant flow of 1.0 ml per min. The samples were analyzed in split 186

mode (1:20) at an injection temperature of 220°C and an EI source temperature of 187

250°C and scanned in the mass range from 50 m/z to 400 m/z. 188

189

Nucleotide sequence accession numbers. The GenBank accession no. of the 19,932 190

bp DNA fragment containing the oxygenase gene cndA is KJ461679. The GenBank 191

accession nos. of the ferredoxin genes cndB1, cndB2, fdx1 and fdx2 are KJ020542, 192

KJ020543, KJ186091 and KJ186092, respectively. The GenBank accession nos. of the 193

reductase genes cndC1 and red1 are KJ020540 and KJ020538, respectively. The draft 194

genome sequences of strain DC-6 and strain DC-2 have been deposited at 195

DDBJ/EMBL/GenBank under the accession JMUB00000000 and JNAC00000000, 196


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

respectively. The versions described in this paper are version JMUB01000000 and 197

version JNAC01000000, respectively. 198

199


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

RESULTS 200

Screen of a mutant DC-6Mut defective in herbicide degradation. When grow on 201

LB agar supplemented with 0.5 mM butachlor, sphingomonads DC-6 and DC-2 202

produce a visible transparent halo around the colony due to the lowly water-soluble 203

butachlor being mineralized or transformed to water-soluble product DEA. 204

Occasionally, we found that a few colonies of strain DC-6 lost the ability to produce 205

the transparent halo after successive streaking on LB agar; one of such mutant was 206

designated as DC-6Mut (Fig. S1). Whole-cell transformation experiments showed that 207

DC-6Mut could completely degrade CMEPA, CDEPA, MEA and DEA, which were 208

the metabolites of chloroacetanilide herbicides, but not alachlor, acetochlor or 209

butachlor, indicating that the gene responsible for the inital step (N-dealkylation) of 210

chloroacetanilide herbicide degradation was lost or disrupted in mutant DC-6Mut. 211

212

Genome comparison of strains DC-6, DC-6Mut and DC-2. The draft genomes of 213

strains DC-6, DC-6Mut and DC-2 consist of 6,334,837 bp, 6,325,634 bp and 214

5,004,271 bp in length, respectively. By comparing the genomes of strains DC-6 and 215

DC-6Mut, a 3,496 bp fragment of strain DC-6 was found to be absent in mutant 216

DC-6Mut, which was confirmed by PCR. Subsequently, the genomic regions flanking 217

the 3,496 bp fragment were obtained by DNA walking, and finally, a 19,932 bp 218

fragment was assembled. Sequence comparison and PCR analysis revealed that a 219

portion (18,183 bp) of the 19,932 bp sequence was also present in the genome of 220

strain DC-2, and a 4,265 bp fragment within the 18,183 bp was missing in mutant 221


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

DC-6Mut (Fig. 1). 222

223

ORF analysis of the missing fragment. ORF search revealed that an oxygenase gene, 224

designated cndA, was present in the 4,265 bp fragment (Table 3, Fig. 1). cndA consists 225

of 1,047 bp and encods a protein of 348 amino acids. BLAST analysis showed that 226

CndA shares homologies with the oxygenase components of some RHOs catalyzing 227

N- or O-demethylation reactions, e.g., VanA (vanillate O-demethylase, 42% identity) 228

from Pseudomonas sp. ATCC 19151 (30), DdmC (dicamba O-demethylase, 40% 229

identity) from Pseudomonas maltophilia DI-6 (31), PudmA (phenylurea herbicides 230

N-demethylase, 30% identity) from Sphingobium sp. YBL2 (18) and NdmA (27% 231

identity), NdmB (25% identity) and NdmC (24% identity), which are involved in the 232

N1-, N3- and N7-specific demethylation of caffeine in Pseudomonas putida CBB5 233

(17), respectively. Sequence alignment revealed that CndA contains conserved 234

sequences for a Rieske [2Fe-2S] domain (CXHX17CX2H) and a non-heme Fe(II) 235

domain (DX2HX4H) (Fig. S2), suggesting that CndA is a member of the RHO family. 236

Notably, two classes of transposon genes are found in the upstream and downstream 237

of cndA. Upstream of cndA, there were two genes, istA1 and istB1. IstA1 and IstB1 238

share 100% and 99% identities to IstA and IstB from Rhizobium sp. AC100, 239

respectively (32). Downstream of cndA, there are also two genes, tnpA1 and tnpA2. 240

TnpA1 and TnpA2 exhibit 99% identities to the IS6100 transposase-like proteins from 241

E. coli (33). The results indicated that gene cndA is located in a transposable element. 242

The homologies of CndA with some N- or O-demethylation oxygenases, the existence 243


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

of cndA in DC-6 and DC-2 and its absence in mutant DC-6Mut, suggested that cndA 244

is most likely the oxygenase component of an RHO that is responsible for the 245

N-dealkylation of chloroacetanilide herbicides. 246

247

CndA could functionally complement the DC-6Mut defect. To identify the 248

function of CndA, the recombinant plasmid pBBRcndA containing cndA was 249

introduced into mutant DC-6Mut. Whole-cell transformation experiments revealed 250

that strain DC-6Mut(pBBRcndA) restored the abilities to degrade alachlor, acetochlor 251

and butachlor (Fig. S3, 4, 5), confirming that CndA is involved in the N-dealkylation 252

of chloroacetanilide herbicides. Furthermore, similar to strain DC-6, 253

DC-6Mut(pBBRcndA) was able to form a visible transparent halo around the colonies 254

on LB agar supplemented with 0.5 mM butachlor (Fig. S1), also demonstrating the 255

N-dealkylation activity of CndA. However, E. coli DH5α harboring pBBRcndA failed 256

to degrade butachlor, which obviously is due to the absence of suitable electron 257

transport component (ETC). 258

259

Identification of the ferredoxin and reductase required for CndA. All reported 260

RHOs require an ETC to facilitate electron transfer. However, it is interesting that 261

there was no evidence for genes coding for ferredoxin or reductase that can serve as 262

the ETC located in the immediate vicinity of cndA. The strategy to identify the 263

ferredoxin and reductase components was based on the assumption that since the 264

function of CndA is dealkylation and it showed the highest sequence identifies with 265


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

the oxygenase components of some reported N- or O-demethylases, the ETC for 266

CndA should share homology with the ETC components of these N- or 267

O-demethylases. Thus, the ferredoxin and reductase components of DMO (31), 268

vanillate O-demethylase (30) and caffeine N-demethylases (17) were used to search 269

the genomes of strains DC-6 and DC-2. Vanillate O-demethylase and caffeine 270

N-demethylases are two-component RHOs consisting of an oxygenase and an FNRC 271

(ferredoxin-NADP+ reductase with the [2Fe-2S] ferredoxin domain connected to the 272

C-terminus of the NAD domain)-type reductase; when VanB, the reductase of 273

vanillate O-demethylase, and NdmD, the reductase of caffeine N-demethylases, were 274

used for the search, no target reductase was retrieved. DMO is a three-component 275

RHO consisting of an oxygenase DdmC, a [2Fe-2S]-type ferredoxin DdmB and a 276

GR-type reductase DdmA. When DdmB and DdmA were used for the search, two 277

ferredoxins, designated CndB1 and CndB2, and one reductase, designated CndC1, 278

were retrieved from strain DC-6, and another two ferredoxins, designated Fdx1and 279

Fdx2, and one reductase, designated Red1, were retrieved from strain DC-2. The four 280

ferredoxins share 64-72% identities to DdmB and form a subclade with DdmB in the 281

phylogenetic tree of the ferredoxin components of many RHOs; the two reductases 282

share 59-65% identities to DdmA and RedA2 and clustered in a subclade with the two 283

reductases in the phylogenetic tree of the reductase components of many RHOs (Fig. 284

2, 3). 285

286

Expression of cndA, ferredoxins and reductases genes and reconstruction of the 287


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

chloroacetanilide herbicide N-dealkylase in vitro. cndA and the retrieved four 288

ferredoxins and two reductases genes were expressed in E. coli BL21(DE3) using the 289

pET29a(+) expression system, the recombinant proteins were purified by Ni-affinity 290

chromatography (Fig. S6). The purified ferredoxins and reductases were used to mix 291

with CndA-His6 in various combinations in vitro. The results of enzyme assays 292

showed that the enzyme mixture displayed no N-dealkylase activity when tested 293

individually or in pairs. N-dealkylase activity was only obtained when the mixture 294

contained CndA-His6, one of the four ferredoxins and one of the two reductases, 295

indicating that the chloroacetanilide herbicide N-dealkylase consists of three 296

components: a homo-oligomer oxygenase, a [2Fe-2S] ferredoxin and a GR-type 297

reductase. The combination of CndA, CndB1 and CndC1 showed the highest 298

N-dealkylase activities, which was approximately 2-29% higher than those of the 299

combinations of CndA with other ferredoxins and reductases (Table 4). Comparison 300

of the N-dealkylation rates of alachlor, acetochlor and butachlor and their molecular 301

structures suggested a possible negative correlation between the length of the 302

N-alkoxymethyl and the catalytic efficiency of the enzyme toward these substrates. 303

The N-dealkylase was unable to degrade pretilachlor, propisochlor, metolachlor and 304

some other N- or O-methyl-containing compounds such as caffeine, vanillate, 305

dicamba and isoproturon. GC/MS analysis demonstrated that the N-dealkylase 306

converted alachlor to CDEPA and methoxymethanol, acetochlor to CMEPA and 307

ethoxymethanol, and butachlor to CDEPA and butoxymethanol (Fig. S7, 8, 9). 308

309


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

Characterization of the N-dealkylase. The effects of 1.0 mM monovalent and 310

divalent cations and 10 mM metal chelating-agent EDTA on the N-dealkylase 311

(mixture of CndA, CndB1 and CndC1) are shown in Table S1. The N-dealkylase 312

activity was notably enhanced by Fe2+ and Mg2+, but it was not obviously affected by 313

monovalent cations K+, Na+ and Li+. Divalent cations Ca2+, Cr2+, Co2+ and Mn2+ 314

showed moderate inhibition on the enzyme, whereas heavy metal ions Ag+, Cu2+, Pb2+, 315

Hg2+, Ni2+ and Zn2+ severely inhibited the activity. EDTA significantly inhibited the 316

N-dealkylase activity, indicating that the enzyme requires metal ions for its activity. 317

The N-dealkylase activity was detected from 5 to 65°C and at pH values ranging from 318

3.8 to 10.6, with the greatest N-dealkylase activity at 35°C and pH 7.0 (Fig. S10 A, B). 319

NADH, but not NADPH, supported the N-dealkylase activity, indicating that the 320

N-dealkylase is specific for NADH. Mg2+ and Fe2+ were necessary for N-dealkylase 321

activity. Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) 322

produced little or no stimulation of the N-dealkylase activity. 323

324

325


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

DISCUSSION 326

In the present study, we identified and characterized a RHO type N-dealkylase 327

catalyzing the N-dealkylation of chloroacetanilide herbicides alachlor, acetochlor and 328

butachlor. The chloroacetanilide herbicide N-dealkylase consists of a homo-oligomer 329

oxygenase CndA, a [2Fe-2S] ferredoxin and a GR-type reductase, and is obviously 330

different from previously reported oxidative herbicide N-dealkylases, such as 331

PudmAB (18), CYP116B1 (15) and CYP116A1 (34). PudmAB, catalyzing the 332

N-demethyl of phenylurea herbicides, is a hetero-oligomeric oxygenase consisting of 333

an alpha and a beta subunits (18); CYP116B1 and CYP116A1, catalyzing the 334

hydroxylation of S-ethyl dipropylthiocarbamate and S-propyl dipropylthiocarbamate, 335

are cytochrome P450-based N-dealkylases (15, 34). In the phylogenetic tree of CndA 336

with the oxygenase components of 71 characterized RHOs (Fig. S11), CndA is 337

clustered with the oxygenases components of many RHOs responsible for the 338

C-O/C-N bond-cleaving reactions, and forms a subclade with VanA (30), DdmC (31), 339

TsaM (35), NdmA, NdmB and NdmC (17). However, the chloroacetanilide herbicide 340

N-dealkylase differs in some essential genetic and biochemical characteristics from 341

these RHOs. First, CndA shares only 24-42% identities with these oxygenases. 342

Second, CndA has substrate spectrum that is different from these RHOs. Third, the 343

chloroacetanilide herbicide N-dealkylase is a three-component RHO, while all of its 344

neighbors in the subclade, except DMO, are two-component RHOs. Furthermore, the 345

chloroacetanilide herbicide N-dealkylase has some biochemical characteristics 346

different from its most related neighbor DMO (31), e.g., the chloroacetanilide 347


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

herbicide N-dealkylase cannot transform dicamba, which is the preferred substrate of 348

DMO; the chloroacetanilide herbicide N-dealkylase utilizes NADH, but not NADPH, 349

as reducing power, whereas DMO can utilize both NADH and NADPH. 350

351

RHOs are remarkably diverse with respect to their functions and structures. In the 352

RHO classification system based on the sequence phylogenetic information as well as 353

the interactions between components (16), RHOs were classified into five distinct 354

types: Type I [a homo-oligomeric or hetero-oligomeric oxygenase and an FNRC-type 355

reductase], Type II [an oxygenase and an FNRN (ferredoxin-NADP+ reductase with 356

the [2Fe-2S] ferredoxin domain connected to the N-terminus of the flavin-binding 357

domain)-type reductase], Type III (a homo-oligomeric or hetero-oligomeric 358

oxygenase, a [2Fe-2S]-type ferredoxin and an FNRN-type reductase), Type IV (an 359

hetero-oligomeric oxygenase, a [2Fe-2S]-type ferredoxin and a GR-type reductase) 360

and Type V (an hetero-oligomeric oxygenase, a [3Fe-4S]-type ferredoxin and a 361

GR-type reductase). The chloroacetanilide herbicide N-dealkylase and DMO are most 362

related to Type IV RHOs, but distinguishable from reported Type IV RHOs in term of 363

oxygenase type. Thus we suggest that Type IV should be amended and subdivided 364

into two subtypes: type IVαβ (the oxygenase component is hetero-oligomeric), and 365

type IVα (the oxygenase component is homo-oligomeric) to accommodate the 366

chloroacetanilide herbicide N-dealkylase and DMO. 367

368

In the opinion of Kweom et al., three-component RHOs (type IV and V) are more 369


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

evolutionarily advanced and more efficient than two-component RHOs (type I and II) 370

due to that the ferredoxin component is relatively short and simple compared to the 371

reductase component, and thus has been evolutionarily chosen as a buffer between the 372

reductase and oxygenase components for rapid adaption toward environmental 373

transitions (16). It is interesting that chloroacetanilide herbicides and the substrates of 374

many recently reported three-component RHOs, such as phenylurea herbicides (18), 375

dicamba (31) and dioxin (36), are man-made xenobiotics that have been present in the 376

environment for no more than one hundred years. The facts that bacteria have evolved 377

three-component RHOs to degrade these xenobiotics provide new evidence to support 378

the above proposal that three-component RHOs have the potential to promptly adapt 379

to environmental change. 380

381

CndA is highly conserved and located in a putative transposable element, which is 382

present in the genomes of both sphingomonads DC-6 and DC-2. These two 383

sphingomonads were isolated from the same activated sludge sample (10, 11). These 384

results indicate that cndA can be horizontally transferred among sphingomonads. In 385

general, the genes encoding the components of RHOs are clustered together and 386

organized in a transcriptional unit (36, 37). However, the genes coding the ferredoxins 387

and reductase that served as the ETC are not located in the immediate vicinity of cndA. 388

The similar phenomena are also found in some other RHO genes responsible for the 389

metabolism of xenobiotics (18, 31, 36). In addition, CndA can use more than one 390

[2Fe-2S]-type ferredoxins and GR-type reductases as the ETC, suggesting that CndA 391


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

has a low specificity for ETC. Such gene organization may increase the gene 392

utilization flexibility and efficiency, and thus facilitates bacteria to rapidly evolve new 393

catabolic pathways to degrade xenobiotics. 394

395

396

ACKNOWLEDGMENTS 397

We are grateful to Prof. NingYi Zhou (School of Life Sciences & Biotechnology, 398

Shanghai Jiao Tong University, Shanghai, China) for valuable suggestions on the 399

enzyme study. This work was supported by grants from the National Natural Science 400

Foundation of China (31270157) and the National High Technology Research and 401

Development Program of China (2012AA101403). 402

403


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

REFERENCES 404

1. Tomlin CDS. 2006. The Pesticide Manual: A World Compendium, The 14th ed. 405

British Crop Protection Council, Farnham, Surry, UK. 406

2. Hildebrandt A, Guillamón M, Lacort S, Tauler R, Barceló D. 2008. Impact of 407

pesticides used in agriculture and vineyards to surface and groundwater quality 408

(North Spain). Water. Res. 42:3315-3326. 409

3. USEPA. 1995. EPA-738-F-95–007. R.E.D. Facts: metolachlor. Available from: 410

http://www.epa.gov/pesticides/reregistration/REDs/factsheets/0001fact.pdf. 411

4. USEPA. 1998. EPA-738-F-98–018. R.E.D. Facts: alachlor. Available from: 412

http://www.epa.gov/oppsrrd1/REDs/factsheets/0063fact.pdf. 413

5. USEPA. 2006. EPA738-R-00–009. Report of the food quality protection act 414

(FQPA) tolerance reassessment progress and risk management decision (TRED) 415

for acetochlor. Available from: 416

http://www.epa.gov/pesticides/reregistration/REDs/acetochlor_tred.pdf. 417

6. Beestman GB, Deming JM. 1974. Dissipation of acetanilide herbicides from 418

soils. Agron. J. 66:308-311. 419

7. Wang YS, Liu JC, Chen WC, Yen JH. 2008. Characterization of acetanilide 420

herbicides degrading bacteria isolated from tea garden soil. Microb. Ecol. 421

55:435-443. 422

8. Dwivedi S, Singh BR, Al-Khedhairy AA, Alarifi S, Musarrat J. 2010. Isolation 423

and characterization of butachlor-catabolizing bacterial strain Stenotrophomonas 424

acidaminiphila JS-1 from soil and assessment of its biodegradation potential. Lett. 425


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

Appl. Microbiol. 51:54-60. 426

9. Zhang J, Zheng JW, Liang B, Wang CH, Cai S, Ni YY, He J, Li SP. 2011. 427

Biodegradation of chloroacetanilide herbicides by Paracoccus sp. FLY-8 in vitro. 428

J. Agric. Food. Chem. 59:4614-4621. 429

10. Chen Q, Yao L, Wang CH, Deng SK, Chu CW, He J. 2013. Isolation and 430

characterization of acetochlor-degrading strain Sphingomonas sp. DC-6 and 431

preliminary studies on its metabolic pathway. J. Agri. Sci. Tech. 15:67-74. 432

11. Li Y, Chen Q, Wang CH, Cai S, He J, Huang X, Li SP. 2013. Degradation of 433

acetochlor by consortium of two bacterial strains and cloning of a novel amidase 434

gene involved in acetochlor-degrading pathway. Bioresour. Technol. 435

148:628-631. 436

12. Stamper DM, Tuovinen OH. 1998. Biodegradation of the acetanilide herbicides 437

alachlor, metolachlor, and propachlor. Crit. Rev. Microbiol. 24:1-22. 438

13. Denisov IG, Makris TM, Sligar SG, Schlichting I. 2005. Structure and 439

chemistry of cytochrome P450. Chem. Rev. 105:2253-2278. 440

14. Barry SM, Challis GL. 2013. Mechanism and catalytic diversity of Rieske 441

non-hemeiron-dependent oxygenases. ACS Catal. 3:2362-2370. 442

15. Warman AJ, Robinson JW, Luciakova D, Lawrence AD, Marshal KR, 443

Warren MJ, Cheesman MR, Rigby SE, Munro AW, McLean KJ. 2012. 444

Characterization of Cupriavidus metallidurans CYP116B1-A thiocarbamate 445

herbicide oxygenating P450-phthalate dioxygenase reductase fusion protein. 446

FEBS. J. 279:1675-1693. 447


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

16. Kweon O, Kim SJ, Baek S, Chae JC, Adjei MD, Baek DH, Kim YC, 448

Cerniglia CE. 2008. A new classification system for bacterial Rieske non-heme 449

iron aromatic ring-hydroxylating oxygenases. BMC Biochem. 9:11. 450

17. Summers RM, Louie TM, Yu CL, Gakhar L, Louie KC, 451

Subramanian M. 2012. Novel, highly specific N-demethylases enable bacteria 452

to live on caffeine and related purine alkaloids. J. Bacteriol. 194:2041-2049. 453

18. Gu T, Zhou CY, Sørensen SR, Zhang J, He J, Yu PW, Yan X, Li SP. 2013. The 454

novel bacterial N-demethylase PudmAB is responsible for the initial step of N, 455

N-dimethyl-substituted phenylurea herbicides degradation. Appl. Environ. 456

Microbiol. 79:7846-7856. 457

19. Sambrook J, Russell D. 2001. Molecular cloning: a laboratory manual, the 3rd 458

ed. Cold Spring Horbor laboratory, Cold Spring Harbor, New York, NY. 459

20. Darling AC, Mau B, Blattner FR, Perna NT. 2004. Mauve: multiple alignment 460

of conserved genomic sequence with rearrangements. Genome Res. 461

14:1394-1403. 462

21. Wang SM, He J, Cui ZL, Li SP. 2007. Self-formed adaptor PCR: a simple and 463

efficient method for chromosome walking. Appl. Environ. Microbiol. 464

73:5048-5051. 465

22. Larkin M, Blackshields G, Brown N, Chenna R, McGettigan PA, McWilliam 466

H, Valentin F, Wallace IM, Wilm A, Lopez R. 2007. Clustal W and Clustal X 467

version 2.0. Bioinformatics. 23:2947-2948. 468

23. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for 469


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425. 470

24. Kimura M. 1980. A simple method for estimating evolutionary rates of base 471

substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 472

16:111-120. 473

25. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. 474

MEGA5: molecular evolutionary genetics analysis using maximum likelihood, 475

evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 476

28:2731-2739. 477

26. Kovach ME, Elzer PH, Steven Hill D, Robertson GT, Farris MA, Roop II 478

RM, Peterson KM. 1995. Four new derivatives of the broad-host-range cloning 479

vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 480

166:175-176. 481

27. Liu H, Wang SJ, Zhang JJ, Dai H, Tang H, Zhou NY. 2011. Patchwork 482

assembly of nag-like nitroarene dioxygenase genes and the 3-chlorocatechol 483

degradation cluster for evolution of the 2-chloronitrobenzene catabolism pathway 484

in Pseudomonas stutzeri ZWLR2-1. Appl. Environ. Microbiol. 77:4547-4552. 485

28. Fang T, Zhou NY. 2014. Purification and characterization of salicylate 486

5-hydroxylase, a three-component monooxygenase from Ralstonia sp. strain U2. 487

Appl. Microbiol. Biotechnol. 98:671-679. 488

29. Bradford MM. 1976. A rapid and sensitive method for the quantitation of 489

microgram quantities of protein utilizing the principle of protein-dye binding. 490

Anal. Biochem. 72:248-254. 491


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

30. Brunel F, Davison J. 1988. Cloning and sequencing of Pseudomonas genes 492

encoding vanillate demethylase. J. Bacteriol. 170:4924-4930. 493

31. Herman PL, Behrens M, Chakraborty S, Chrastil BM, Barycki J, Weeks DP. 494

2005. A three-component dicamba O-demethylase from Pseudomonas 495

maltophilia, Strain DI-6 gene isolation, characterization, and heterologous 496

expression. J. Biol. Chem. 280:24759-24767. 497

32. Hashimoto M, Fukui M, Hayano K, Hayatsu M. 2002. Nucleotide sequence 498

and genetic structure of a novel carbaryl hydrolase gene (cehA) from Rhizobium 499

sp. strain AC100. Appl. Environ. Microbiol. 68:1220-1227. 500

33. Woodford N, Carattoli A, Karisik E, Underwood A, Ellington MJ, Livermore 501

DM. 2009. Complete nucleotide sequences of plasmids pEK204, pEK499, and 502

pEK516, encoding CTX-M enzymes in three major Escherichia coli lineages 503

from the United Kingdom, all belonging to the international O25: H4-ST131 504

clone. Antimicrob. Agents. Chemother. 53:4472-4482. 505

34. Nagy I, Schoofs G, Compernolle F, Proost P, Vanderleyden J, de Mot R. 1995. 506

Degradation of the thiocarbamate herbicide EPTC (S-ethyl 507

dipropylcarbamothioate) and biosafening by Rhodococcus sp. strain NI86/21 508

involve an inducible cytochrome P-450 system and aldehyde dehydrogenase. J. 509

Bacteriol. 177:676-687. 510

35. Tralau T, Cook AM, Ruff J. 2001. Map of the IncP1β plasmid pTSA encoding 511

the widespread genes (tsa) for p-Toluenesulfonate degradation in Comamonas 512

testosteroni T-2. Appl. Environ. Microbiol. 67:1508-1516. 513


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

36. Armengaud J, Happe B, Timmis KN. 1998. Genetic analysis of dioxin 514

dioxygenase of Sphingomonas sp. strain RW1: catabolic genes dispersed on the 515

genome. J. Bacteriol. 180:3954-3966. 516

37. Tang HZ, Wang LJ, Wang WW, Yu H, Zhang KZ, Yao YX, Xu P. 2013. 517

Systematic unraveling of the unsolved pathway of nicotine degradation in 518

Pseudomonas. PLoS Genet. 9:e1003923. 519

520


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

FIGURE LEGENDS 521

Fig. 1 Organization of the genes involved in the N-dealkylation of 522

chloroacetanilide herbicides. Arrows indicate the length and transcription direction 523

of each gene or ORF. 524

525

Fig. 2 Phylogenetic tree constructed based on the alignment of CndB1, CndB2, 526

Fdx1 and Fdx2 with the ferredoxin components of some characterized RHOs. 527

The trees were constructed by the Neighbor-Joining method. Branches corresponding 528

to partitions reproduced in less than 50% bootstrap replicates are collapsed. Name of 529

the proteins, strains and their GI numbers are displayed in the phylogenetic tree. 530

531

Fig. 3 Phylogenetic tree constructed based on the alignment of CndC1 and Red1 532

with the reductase components of some characterized RHOs. The trees were 533

constructed by the Neighbor-Joining method. Branches corresponding to partitions 534

reproduced in less than 50% bootstrap replicates are collapsed. Name of the proteins, 535

strains and their GI numbers are displayed in the phylogenetic tree. 536

537

Table 1 Strains and plasmids used in this study. 538

539

Table 2 PCR primers used in this study. 540

541

Table 3 Deduced function of each ORF within the 19,932 bp sequence containing 542


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

the 4,265 bp missing fragment. 543

544

Table 4 The activities for alachlor, acetochlor and butachlor of different 545

combinations of oxygenase, ferredoxin and reductase. 546

547


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

Table 1 Strains and plasmids used in this study. 548

Strains or plasmids Characteristics Source or reference

Strains

Sphingomonas wittichii DC-6

(=KACC 16600)

Degrades alachlor, acetochlor and butachlor, Smr 10

Sphingomonas wittichii DC-6Mut Mutant of DC-6; unable to degrade alachlor, acetochlor and butachlor, Smr

This study

Sphingobium quisquiliarum DC-2 (=KACC 17149)

Degrades acetochlor, butachlor and alachlor, Smr 11

Escherichia coli DH5α F− recA1 endA1 thi-1 supE44 relA1 deoR

Δ(lacZYA-argF) U169 80d/lacZ ΔM15

TaKaRa

Escherichia coli BL21(DE3) F− ompT hsdS(rB− mB−) gal dcm lacY1(DE3) Invitrogen

Escherichia coli HB101(pRK600) Conjugation helper strain, Cmr This Lab

Plasmids

pBBR1MCS-5 Broad host range cloning vector; Gmr 26

pBBRcndA pBBR1MCS-5 derivative containing cndA; Gmr This study

pET29a(+) Expression vector; Kmr Novagen

pETcndA pET-29a(+) derivative carrying cndA; Kmr This study

pETcndB1 pET-29a(+) derivative carrying cndB1; Kmr This study

pETcndB2 pET-29a(+) derivative carrying cndB2; Kmr This study

pETfdx1 pET-29a(+) derivative carrying fdx1; Kmr This study

pETfdx2 pET-29a(+) derivative carrying fdx2; Kmr This study

pETcndC1 pET-29a(+) derivative carrying cndC1; Kmr This study

pETred1 pET-29a(+) derivative carrying red1; Kmr This study

549


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

Table 2 PCR primers used in this study. 550

Primer DNA Sequence (5´ to 3´)a Purpose

pBBRcndAf CGGGGTACCATGTTTCTCCAGAATGCC

TGGTACG

Forward primer to amplify cndA

with a KpnI site

pBBRcndAr CCGGAATTCCTACCCCGCCGACACAGC

GACGACCTTG

Reverse primer to amplify cndA

with an EcoRI site

pET-NdeI-cndA-f GGAATTCCATATGTTTCTCCAGAATGCC

TGGTACG

Forward primer to amplify cndA

with a NdeI site

pET-XhoI-cndA-r AATCCCCTCGAGCCCCGCCGACACAGC

GACGACCTTG

Reverse primer to amplify cndA

with an XhoI site

pET-NdeI-cndB1-f GATCTAGGGACCCATATGCCGACCATCA

TCGTCACC

Forward primer to amplify cndB1

with a NdeI site

pET-XhoI-cndB1-r CATGACCTGAAACTCGAGATCCTCCGG

CGCGATGGCGAC

Reverse primer to amplify cndB1

with an XhoI site

pET-NdeI-cndB2-f ATCTAGGGACCCATATGCCCAAGTTGG

TTGTCGTTA

Forward primer to amplify cndB2

with a NdeI site

pET-XhoI-cndB2-r CATGACCTGAAACTCGAGATCTTCCGG

CGCGATCGTGAC

Reverse primer to amplify cndB2

with an XhoI site

pET-NdeI-fdx1-f ATCTAGGGACCCATATGCCCAAGTTGAT

TGTGGTCAACC

Forward primer to amplify fdx1 with

a NdeI site

pET-XhoI-fdx1-r CATGACCTGAAACTCGAGGTCTTCCGG

CGCGATGGTGACG

Reverse primer to amplify fdx1 with

an XhoI site

pET-NdeI-fdx2-f ATCTAGGGACCCATATGACGACGATTG

AAGTGACCACCC

Forward primer to amplify fdx2 with

a NdeI site

pET-XhoI-fdx2-r CATGACCTGAAACTCGAGATCTTCGGG

CGCGAGTGTCACC

Reverse primer to amplify fdx2 with

an XhoI site

pET-NdeI-cndC1-f GGAATTCCATATGGCCCAGTATGACGTT

CTGATCG

Forward primer to amplify cndC1

with a NdeI site

pET-HindIII-cndC1-r AATCCCAAGCTTGGCAGGGAGCAGGG

TCTTCAACGG

Reverse primer to amplify cndC1

with a HindIII site

pET-NdeI-red1-f ATCTAGGGACCCATATGAACCATTATGA

CGTTGTGATCG

Forward primer to amplify red1 with

a NdeI site

pET-XhoI-red1-r CATGACCTGAAACTCGAGGGCCAGAC

CGACTTCCTTGAGA

Reverse primer to amplify red1 with

an XhoI site

a restriction sites are underlined. 551

552


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

Table 3 Deduced function of each ORF within the 19,932 bp sequence containing 553

the 4,265 bp missing fragment. 554

Gene name, proposed

product(s)

Position in the 19,932

bp fragment, product

size (amino acids)

Homologous protein (GenBank accession

no.) and source

%

Identity

orf1, Hypothetical protein 241-744, 168 Hypothetical protein (WP_016698448.1),

Actinoalloteichus spitiensis

29

orf2, Hypothetical protein 925-1359, 145 Hypothetical protein (WP_010339728.1),

Sphingobium yanoikuyae

72

orf3, Conserved hypothetical

protein

2959-4308, 450 Conserved hypothetical protein

(XP_002536264.1), Ricinus communis

47

itsA1, Transposase 5593-7110, 506 Transposase (BAB85624.1), Rhizobium sp.

AC100

100

itsB1, IstB-like ATP-binding

protein

7103-7879, 259 Mobile element protein (BAB85621.1),

Rhizobium sp. AC100

99

cndA, Oxygenase 7988-9031, 348 Vanillate monooxygenase

(YP_001262782.1), Sphingomonas wittichii

RW1

48

tnpA1, Transposase 9658-10451, 258 Transposase IS6100 (YP_003108355.1),

Escherichia coli

99

tnpA2, Transposase 11562-12353, 264 Transposase IS6100 (YP_003108355.1),

Escherichia coli

99

orf4, Hypothetical protein 12793-13809, 339 Hypothetical protein (YP_006962357.1),

Pseudomonas sp. K-62

33

orf5, Hypothetical protein 14082-15440, 453 Hypothetical protein G432_22025

(YP_007618333.1), Sphingomonas sp.

MM-1

100

orf6, Resolvase 15440-16075, 212 Resolvase domain-containing protein


MM-1

100

tn3A, Transposase 16177-19104, 976 Transposase Tn3 family protein


MM-1

100

555

556


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

33

Table 4 The activities for alachlor, acetochlor and butachlor of different 557

combinations of oxygenase, ferredoxin and reductase. 558

559

Alachlor

(nmol/min/mg)

Acetochlor

(nmol/min/mg)

Butachlor

(nmol/min/mg)

CndA-B1-C1 205.3 ± 20.5 145.9 ± 12.7 112.4 ± 16.4

CndA-B1-R1 195.7 ± 7.4 143.2 ± 19.4 91.8 ± 6.5

CndA-B2-C1 186.3 ± 12.4 124.7 ± 7.8 87.1 ± 9.4

CndA-B2-R1 176.5 ± 15.7 119.5 ± 18.4 83.3 ± 21.5

CndA-F1-C1 167.1± 19.3 141.6 ± 20.2 79.6 ± 5.3

CndA-F1-R1 169.4 ± 21.2 138.1 ± 11.5 85.4 ± 17.1

CndA-F2-C1 174.8 ± 15.6 132.5 ± 23.7 86.9 ± 14.7

CndA-F2-R1 161.5 ± 6.6 129.1 ± 17.6 79.2 ±12.6

Abbreviations : B1, CndB1; B2, CndB2; C1, CndC1; F1, Fdx1; F2, Fdx2; R1, Red1. 560


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

1 A Novel Three-Component Rieske Non-Heme...

Documents

Transcript of 1 A Novel Three-Component Rieske Non-Heme...