04 ozone hole

The ozone hole

© NOAA

O OO

© 2007 Paul Billiet ODWS

Ultra Violet light


UV light and life UV light is high energy light When it strikes molecules it can cause

them to beak into ions or free radicals The free radicals in turn damage large

molecules such as proteins and DNA Damage to DNA causes mutations It is a mutagen Mutations can lead to cancer


UV light and life UV light can have beneficial effects too It stimulates the transformation dietary

steroids into Vit D (calciferol) UV light is used to sterilise foods and

medical equipment Some animals can see UV light Insects use it to guide them to nectar

sources in flowers


UV light & DNA UV-B has a direct effect on DNA DNA absorbs UV light of 260nm The action of UV forms thymine dimers This can cause a gene mutation when the

DNA replicates

UV-B Thymine dimer

ACGCTGGCTTAGTTGCGACCGAATGA

ACGCTGGCT=TAGTTGCGACCGAATGA

DNA


Specific damage by UV light Sunburn Clouding of the cornea and formation of

cataract Skin cancer (melanoma) Reduced rates of photosynthesis


Ozone in the atmosphere Ozone (O3) forms under the effect of UV

light in the stratosphere Ozone can also form in the troposphere Naturally it forms from volcanic activity It is produced by motor vehicules so it is a

pollutant Sunlight acts on NOx to produce O3


Atmospheric O3 Paris 6eme arr 2006-2007Data Airparif

0102030405060708090

100110120130140150160

02/07/2006 10/10/2006 18/01/2007 28/04/2007 06/08/2007 14/11/2007 22/02/2008

O3

/ µg

m-3

© Airparif

Ozone pollution in the troposphere

Safety limit

The ozone layer Ozone is an unstable gas It rapidly breaks down The ozone layer is only a few cm thick If the rate of breakdown is faster than the

rate of formation the ozone layer thins This could develop into hole An ozone hole was first observed over the

Antarctic in 1985


The cause of the hole Chlorofluorocarbons (CFCs) The breakdown under the effect of UV

light to release chlorine radicals (Cl) Especially under cold conditions The chlorine radicals react with O3

converting it to O2 and more radicals ClO


What are CFCs? Used as propellants in aerosol spray cans Used as refrigerants in fridges, freezers

and air conditioning units


What can be done? Reduce the use of CFCs They are already banned in aerosols

(1987) BUT they are still used as refrigerants Recycle fridges and air conditioning plants


The current situation The holes developing over the pole

suggest that they may be show an improvement

BUT CFC molecules take 30 years to rise up to the stratosphere

The chlorine radicals last a long time The peak ozone damage was supposed to

be in 2000 Damage could go on another 50 years


04 ozone hole

Education

Transcript of 04 ozone hole