0 287 JLGGC

Supplementary Notes

Note S1 Neonatal grafts consist mainly of mature cortical neurons

Very few proliferating or apoptotic cells were found within the graft, and no markers of

endodermal, mesodermal, epidermal or ES cell lineages could be detected, suggesting that no

teratoma formation had occurred (Suppl. Figure 9e,f and Suppl. Table 3). Among the grafted

neurons, we found expression of the same cortical neuron markers as in vitro, although some

were downregulated, as observed for the same markers in adult cortical neurons (Suppl.

Figure 10, and data not shown and 22). When examining the morphology of single GFP+

neurons surrounding the graft, the vast majority (89+/-3,13%) of them were unipolar with a

PMI pyramidal index comparable to genuine pyramidal cortical neurons (Figure 5d). In

addition we found no or marginal expression of markers of non-pyramidal neurons among the

GFP+ grafted neurons (Suppl. Table 3). Altogether these data indicate that most of the grafted

cells correspond to fully differentiated cortical pyramidal neurons.

Note S2 In utero grafting experiments

ES cells were differentiated into neural progenitors and neurons for 14 days in DDM-cyclo

conditions, then grafted in utero into the lateral ventricles of E13.5 mouse embryos, and the

GFP+ neurons were examined postnatally. In most animals where GFP+ neurons could be

detected, they integrated preferentially into telencephalic structures and the cerebral cortex

(Suppl. Table 5, Suppl. Figure 11), as previously described for genuine cortical progenitors

29,30. When integrated into the cortex, the grafted neurons displayed the major landmarks of

genuine cortical neurons, including radial orientation, pyramidal morphology, and appropriate

expression of layer-specific markers (Suppl. Figure 11a-c). Thus ES-derived neural cells

behave like genuine cortical cells when grafted in utero.

SUPPLEMENTARY INFORMATION

doi: 10.1038/nature07287

www.nature.com/nature 1

Supplementary Methods

Methods S1 List of antibodies

Primary antibodies were mouse monoclonal anti-beta-tubulin III (Tuj1, 1/1000; Covance),

anti-microtubule associated protein 2 (MAP2, clone AP20, 1/500; Sigma), anti-reelin (clone

G10, 1/2000; a kind gift from A. Goffinet), anti-Mash1 (1/500; Pharmingen) anti-p73 (ER-

15, 1/150; Labvision/Neomarkers), anti-HNF4 (1/50, Abcam), anti-pan-cytokeratin (1/50,

Sigma) andti-BrdU (1/50 Beckton Dickinson), and anti-rhodopsin (RET-P1, 1/100; Abcam),

rabbit polyclonal anti-Pax6 (1/2500; Covance), anti-Otx1+2 (1/2000; Chemicon), anti-

Nkx2.1 (1/5000; a gift from R. Di Lauro), anti-Gsh2 (1/2000; a gift from Y. Sasai), anti-

Oct4 (1/500, Abcam), anti-caspase 3 (1/500, Promega), anti-Ki67 (1/200, Novocastra), anti-

Tbr1 (1/20000; a gift from R. Hevner and Chemicon), anti-Tbr2 (1/2500; a gift from R.

Hevner and Chemicon), anti-Nestin (long tail, 1/5000; Covance), anti-beta-tubulin III

(1/2000; Covance), anti-GFAP (1/500; Sigma), anti-calretinin (1/10000; Swant), anti-green

fluorescent protein (1/3000, Molecular Probes), anti-VGluT1 (1/2000; Synaptic Systems),

anti-VGluT2 (1/2500; Synaptic Systems), anti-VGAT (1/3000; Synaptic Systems), anti-

tyrosine hydroxylase (1/500; Chemicon), anti-choline acetyltransferase (1/500; Chemicon),

anti GABA-A alpha-6 receptor (1/1000; Chemicon), anti-FoxP2 (1/1000; Abcam), anti-

Satb2 (1/2000; a gift from V. Tarabykin), anti-ER81 (1/1000; a gift from S. Arber), anti-

Cux1 (1/1000, Santa Cruz), anti-Tle4 (1/3000, a gift from S. Stifani), anti-COUP-TFI and

anti-COUP-TFII (1/1000, a gift from M. Studer), rat monoclonal anti-CTIP2 (1/1000;

Abcam), and anti-BrdU (1/250, Abcam), goat anti-Sox5 (1/250, Santa Cruz), and anti-

PECAM (1/1000, Beckton-Dickinson), and chick anti-beta-tubulin III (1/300, Chemicon).

The RAT-401 antibody (anti-Nestin; 1/5) developed by S. Hockfield, the 74-5A5 antibody

(anti-Nkx2.2; 1/20) developed by T.M. Jessell, the anti-Math1 (1/10) developed by J.

Johnson, the Otx-5F5 (anti-Otx1; 1/10) developed by S.K. McConnell, the 4G11 antibody

doi: 10.1038/nature07287 SUPPLEMENTARY INFORMATION


(anti-Engrailed-1; 1/50) developed by T.M. Jessell and S. Morton and the MF-20 (anti-

myosin; 1/20) developed by D.A. Fischman were obtained from the Developmental Studies

Hybridoma Bank developed under the auspices of the NICHD and maintained by The

University of Iowa, Department of Biological Sciences, Iowa City, IA 52242.

Secondary antibodies were donkey anti-mouse,anti-rabbit, anti-rat, anti-goat or anti-chick

coupled to Cyanin 3 or Cyanin 5 (1/1000, Jackson Immunoresearch) or to AlexaFluor 488

(1/1000, Molecular Probes).

Methods S2 RTPCR

For total RNA preparation, cells were trypsinized, dissociated, centrifuged and rinsed once in

PBS before being flash-frozen in liquid nitrogen. RNA preparation was made using RNeasy

RNA preparation minikit (Qiagen). Reverse transcription was done using Superscript II kit

and protocol (Invitrogen). PCR primers used are summarized in Supplementary Table 1. RT-

PCR were performed at least three times for each gene at each time-point studied.

Methods S3 Electrophysiology

Electrophysiological recordings were performed at room temperature (20-25°C) in an

external solution (ACSF) containing 120mM NaCl, 26mM NaHCO3, 11mM D-glucose,

2mM KCl, 2mM CaCl2, 1.2mM MgSO4 and 1.2mM KH2PO4 with an osmolarity of 290

mOsm. The recording chamber was constantly superfused at a flow rate of 1 ml/min. The

recording patch pipettes were made of borosilicate GC100TF-10 capillary tubing (Clark

Electrical Instruments, Reading, UK) pulled on a P-2000 micropipette puller (Sutter

Instrument Co, Novato, CA, USA) and presented resistances of 4 -6 MΩ when filled with



the patch pipette solution containing either 150mM KCl, 10mM 4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid (HEPES), 4.6mM MgCl2, 4mM Na2ATP (adenosine

triphosphate) and 0.4mM Na3GTP (guanosine triphosphate) or 110mM CsF, 0.1 mM

ethylene glycol bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), 0.035mM

CaCl2, 1mM MgCl2, 10mM D-glucose and 10mM HEPES, this latter solution being used for

the recording of spontaneous inhibitory postsynaptic currents (sIPSC). Both pipette solutions

were adjusted to pH 7.3 and 300-330mOsm/l. Whole-cell patch clamp recordings were

carried out with an EPC10 amplifier (HEKA, Elektronik, Lambrecht/Pfalz, Germany) in

voltage clamp mode. Signals were filtered at 4kHz using the built-in filter of EPC10 and

digitally sampled at 20kHz except spontaneous postsynaptic currents signals that were

filtered at 2.5kHz and digitally sampled at 5kHz. Voltage protocol generation, data

acquisition and analysis were made with Pulse 8.65 (HEKA, Elektronik, Lambrecht/Pfalz,

Germany). The presence of spontaneous excitatory postsynaptic currents (sEPSCs) was

assessed by clamping neurons to -60 mV in the presence of 100 µM picrotoxin. The

presence of inhibitory postsynaptic currents (sIPSCs) was assessed by clamping neurons to –

20mV in the presence of 1µM TTX, 5µM 2,3-dioxo-6-nitro-1,2,3,4-

tetrahydrobenzo[f]quinoxaline-7-sulfonamide disodium salt (NBQX) and 50µM D-(-)-2-

amino-5-phosphonopentanoic acid (APV). To further check the nature of spontaneous

postsynaptic currents, NBQX (5µM) and APV (50µM) were used to block AMPA and

NMDA receptors respectively and picrotoxin (100µM) was used to block GABAA receptors.

Fifteen neurons were recorded for each type of PSC and for each condition (DDM or

DDM+cyclo).

Methods S4 Grafting in neonatal mice



Cells were trypsinized and thoroughly dissociated with a Pasteur pipette then centrifuged at

1200 rpm for 3 minutes. Supernatant was carefully discarded and the pellet was resuspended

in ice cold PBS at a final density of 50x103 with a 200µl tip and placed on ice.P0-P1 mouse

pups were anesthesized on ice. A small incision was performed through the skin and the skull

1mm rostrally and laterally to the bregma, just above the motor area. A small cortical lesion

was made with the tip of a 25-gauge needle and 1µl of the cell suspension was injected with a

Hamilton syringe in the rostral side of the lesion. After 4 weeks, the recipient animals were

anesthesized and brains were vibrosectioned and processed for immunofluorescence as

described above.

Methods S5 In utero grafting experiments

ES-derived progenitors and neurons derived from Tau-GFP ES cells (after 14 days in

DDM+cyclo) were trypsinized and mechanically dissociated into a single-cell suspension.

E13.5 pregnant mice were anesthesized with xylazine and ketamine. The uterine horns were

exposed and the telencephalic vesicles were identified under transillumination. 10 to 30x103

cells (10-30x103 cells/ul) were injected in the lateral ventricles using a glass capillary and the

injected embryos were placed back in the abdominal cavity for spontaneous delivery.

Animals were analyzed at post-natal days 12-14. The percentage of live-born transplanted

animals was 67,3% (N=35 out of 52). Donor-derived neurons were found in 22 out of 35

analyzed recipients.

Methods S6 Analysis of the grafting experiments

All sections from each grafted animal (N=30 animals) were systematically reviewed after

immunostaining. The location of the graft was noted and the presence of GFP+ axons was

systematically checked in all of the following structures: the cortex, including the archi – and



paleocortices, the corpus callosum, the external and internal capsules, the cingulum, the

septum, the striatum, the thalamus (primary and associative nuclei), the cerebral peduncles,

the superior and inferior colliculi, the midbrain and hindbrain nuclei, including the

periaqueductal grey matter and the pediculopontine nuclei, and the pyramidal tracts down to

the cervical spinal cord. Axonal fibers in each thalamic nucleus (LG, LP, LD, MG, VB, VL,

VM), in visual areas and superior colliculus were manually scored in the grafted animals

showing axonal growth to the thalamus (N=28 grafted animals). Scoring was done under

conventional microscopy (Zeiss Axioplan) in each section where the thalamus was present,

and the sum of the fibers scored in each section for each nucleus was considered the total

number of fibers per nucleus. For the comparison of the projections from grafts emanating

from cells differentiated at different time points (days 12, 14, 17 in vitro), the number of

fibers in each analyzed structure (ipsi-and contralateral visual areas, thalamic LGN, midbrain

superior colliculus) was normalized to the total number of fibers counted among all 4

structures in the same brain, thus providing the proportion of fibers innervating each

structure, depending on the timing of in vitro differentiation. The pattern of projections of

the different populations emanating from different time points was compared using the χ²

test.

For quantification of the expression of layer markers at 1 month after grafting, at least 300

cells were quantified for each marker in at least 2 different animals for each condition. The

total number of animals used was 15. Data for each condition were compared using the χ²

test.



Supplementary Figures

Supplementary Figure 1: Efficient neuralization of ES cells in a default defined medium (DDM). Expression

of the neural progenitor marker Nestin (a-c), the early neuronal marker β-tubulin III (d-f), the astrocyte marker

GFAP (g), and the late neuronal marker MAP2 (h) following 4 (a,d), 14 (b,e), 21 (c,f) and 28 (g,h) days of

cultures of adherent monocultures of ES cells in DDM default medium. Nestin, β-tubulin III and MAP2 are in

green, GFAP in red, and Hoechst nuclear staining in blue. Scale bar represents 20µm.



Supplementary Figure 2: Differentiation in a default defined medium (DDM) converts ES cells to neural

progenitors of anterior identity.

(a-d) Expression of the early regionalization markers Nkx2.2 (a,d) Engrailed (b), MATH1 (c) in neural

progenitors following differentiation in DDM or DDM+cyclo. Nestin is in green, markers in red, and Hoechst

nuclear staining in blue. Scale bar represents 20µm. (e) Schematic representation of the localization of the

regional markers used in this study with respect to the early developing forebrain and the rest of the neural

tube. (adapted from Puelles and Rubenstein, 1993, 2003)



Supplementary Figure 3: Electrical properties of neurons derived from ES cells in DDM with or without

cyclopamine.

(a-d) Electrophysiological maturation. Representative traces from experiments in maturating DDM ES-derived

neurons at days 22 (a), 24 (b), 26 (c) and 28 (d) of differentiation displaying increasing sodium and potassium

currents (right panels; voltage-clamp mode) as well as increasing evoked action potential activity (left panels;

current-clamp mode). (e-i) ES cells derived neurons in DDM (left panels) or DDM+cyclo (right panels) display

spontaneous (f) or evoked (e) action potentials and inward sodium current (g). Action potentials and sodium

currents can both be blocked by tetrodotoxin (h-i).



Supplementary Figure 4: Pyramidal Morphology Index (PMI) measured in acutely dissociated cortical

neurons and ES-cell derived neurons.

(a) PMI (determined as the ratio between the width of the largest dandrite (LD) divided by the number of

neurites (N)) distribution among native cortical neurons (dissociated at postnatal day 2) cultured for 1 day in

vitro, and stained for glutamatergic (white bar) and GABAergic markers (black bar). A cut-off value of 1.2

enables to discriminate efficiently between the two populations, with glutamatergic neurons displaying higher

values and GABA-ergic neurons displaying lower values. (b) PMI distribution of neurons derived from ES

cells in DDM (white bar) or DDM+cyclo (black bar) conditions. Note the shift of the distribution towards

higher PMIs in DDM+cyclo conditions.



Supplementary Figure 5: Evolution in time of the proportion of marker expressing Tuj1+ neurons dissociated

at serial embryonic stages and cultured for one day in vitro.

Colored arrows indicate the first day of appearance of each marker in neurons during the course of

differentiation. Note the distinct waves of neuronal generation, from an early wave of generation of

reelin+/Tbr1+ neurons, to CTIP2+ or Otx1+ neurons, to Satb2+/Cux1 neurons. Data are represented as mean

+/- S.E.M. (N=3 experiments).



Supplementary Figure 6: Generation of a comprehensive repertoire of cortical neurons from ES cells

differentiated in DDM+cyclo.

(a-f) Expression of a repertoire of markers of distinct cortical neuron subtypes neurons differentiated for 12-16

days following DDM+cyclo conditions. Markers (in red) reelin (a), Tbr1 (b), CTIP2 (c), FoxP2 (d), Tle4 (e),

Otx1 (f), Er81 (g), Satb2 (h), Cux1 (i) are all present in a proportion of Tuj1+ neurons (in green). (j-l) Co-

staining for markers showing partial co-expression of Tbr1 (red) and CTIP2 (green), with Tbr1+ neurons (white

arrowhead), CTIP2+ neurons (black arrowhead), Tbr1+/CTIP2+ neurons (arrow) (j), and mutually exclusive

expression of CTIP2 (in red, white arrowhead) and Satb2 (in green, black arrowhead) (k), and of reelin (green,

white arrowhead) and Satb2 (in red, black arrowhead) (l). Scale bar represents 20µm.



Supplementary Figure 7: Characterization of presumptive Cajal-Retzius neurons after 21 days of

differentiation following DDM+cyclo conditions.

(a-f) Markers include reelin (a) , p73 (b), reelin and Tbr1 (c), reelin and calretinin (d), reelin and Tbr2 (e), Note

the typical aspect of the reelin staining (arrowheads) (a), co-expression of reelin in some (arrow in c) but not all

Tbr1+ neurons (arrowhead), in some calretinin+ neurons (arrow in d) but not all (arrowhead), in some Tbr2+

cells (arrow in e) but not all (full and empty arrowheads) (f) Co-staining for markers showing mutually

exclusive expression of Cux1 (red) and reelin (green) (e). (g) Some neurons derived from ES cells in

DDM+cyclo conditions spread tangentially like Cajal-Retzius neurons when grafted in the marginal zone of the

postnatal cortex. GFP is in green and MAP2 in red. Apical surface of the cortical slices are up. Scale bars

represent 20µm.



Supplementary Figure 8: ES cell derived neurons display layer-specific and area-specific patterns of neuronal

projections when grafted in vivo.

ES cells expressing GFP under the Tau promoter were differentiated in vitro for 12-17 days, then grafted into

the frontal cortex of neonatal mice. Patterns of projections were determined by GFP stainings 1 month later.

Pictures show projections through the external capsule (a), to the limbic cortex: perirhinal cortex (b) and

retrosplenial cortex (c), the internal capsule underlying the thalamus (d) and the pediculopontine nuclei (e).

Scale bars represent 100µm (a-c) or 50µm (d,e). Dorsal is up and medial is left in all figures. (f,g). CoupTFI (f)

and CoupTFII (g) stained nuclei (red) among Nestin+ (green) neural progenitors differentiated for 14 days in

DDM+cyclo conditions. Scale bars represent 20 µm (f,g).



Supplementary Figure 9: Grafts consist mainly of mature neurons.

(a) Expression of GFP under the control of the neuronal-specific Tau promoter and of the neuronal marker

MAP2 (a). Most of the GFP-positive cells are MAP2-positive (contoured in the higher magnification insets

corresponding to the dashed squares in the middle panels). Scale bar represents 20 µm in the left panels and 6.6

µm in the insets. (b-f) Expression of GFP and non-neuronal markers in the graft: glial marker GFAP (b), neural

progenitor marker nestin (c), proliferative marker Ki67 (d), apoptotic marker activated caspase 3 (e), PECAM-

positive vessel-like structures (f). Only a few cells are positive for the non-neuronal markers, and correspond to

GFP-negative domains of the grafts (arrowheads in the higher magnification insets corresponding to the dashed

squares in the middle panels).

Scale bar represents 20 µm in the left panels and 4 µm in the insets. Left panels are GFP (green) and right

panels are additional markers (red).



Supplementary Figure 10: Most neurons in the DDM+cyclopamine grafts express markers of cortical

pyramidal neurons.

(a-e) Expression of GFP under the control of the neuronal-specific Tau promoter and of the following cortical

layer markers: CTIP2 (a), Tle4 (b), FoxP2 (c), Tbr1 (d) and Cux1 (e). Panels show the GFP expression in

green, the Hoechst nuclear staining in blue and the expression of the markers in red, and their corresponding

two-colours overlays. Most of the cells are GFP-positive, with a distinctive proportion that are positive for a

cortical marker (nuclei of some of them are laid out with dashed contours), while only a few GFP-negative

cells can be detected (some are pointed with arrows), that are all negative for the cortical markers. Scale bar

represents 20 µm.



Supplementary Figure 11. ES-derived Tau-GFP neural precursors and neurons grafted in the embryonic brain

integrate and project like genuine cortical progenitors and neurons. Cells were grafted into the lateral ventricles

of E13 embryos, and their pattern of integration and projections examined at postnatal days 12-14.

(a-c) Representative cases of pyramidal neurons integrated in cortical layers and expressing appropriate layer-

specific marker: Sox5 in layer VI (a), CTIP2 in layer V (b) and layer III (c). GFP is in green and marker in red

in all panels. Scale bar represent 20um (a-b) or 40um (c). Layers are demarcated by dotted lines in all panels

and layer IV cortical barrels are underlined in (c).

(d-g) Grafted ES-derived neurons send axonal projections like cortical pyramidal neurons. Axons can be seen

in the internal capsule in the striatum (d), in the internal capsule under the thalamus (e), in several thalamic

nuclei, including the LGN (dLG and vLG) (f) and in the superior colliculus in the tectum of the midbrain (g).

Scale bar represent 50um (e) or 100um (d, f, g). Dorsal is up and medial is left in all panels.



Supplementary Figure 12: ES cell-derived neurons and progenitors differentiated in DDM send axonal

projections different from cortical pyramidal neurons.

(a-e) Expression of GFP under the control of the neuronal-specific Tau promoter. (a) Representative case of a

DDM graft located under the cerebral cortex. Note the paucity of axonal projections compared to

DDM+cyclopamine (b), through the internal capsule (small arrows), the external capsule (arrowheads) and the

corpus callosum (large arrow). Only a very small number of fibers are found in the corpus callosum (c) or the

internal capsule (d, arrows). (e) GFP+ neurons that migrated out of the graft display a multipolar morphology.

Scale bars represent 500 µm (a-b), 200 µm (c,d) or 20 µm (e).



Supplementary Table1

Primers used in the RT-PCR experiments.

Gene Forward primer sequence Reverse primer sequence Annealing t° (°C)

Amplicon size (bp)

FoxG1 TGAAGAGGAGGTGGAGTGCC GCTGAACGAGGACTTGGGAA 60 514 Emx2 CACCTTCTACCCCTGGCTCA TTCTCGGTGGATGTGTGTGC 59 522 Emx1 CCCCTCACTCTCTTTCTTGAGCG CAGCCCATTCTCTTGTCCCTC 58 622 Dlx1 CCAAAAGGGAAGCAGAGGAG CCCAGATGAGGAGTTCGGAT 59 722 Dlx5 CACCACCCGTCTCAGGAATC GTTACACGCCATAGGGTCGC 57 567 Lhx6 TAGAGCCTCCCCATGTACGCC TGCTGCGGTGTATGCTTTTT 55 723 Nkx2.1 AACCTGGGCAACATGAGCGAGCTG ATCTTGACCTGCGTGGGTGTCAGG 66 352 Shh CACCACCCGTCTCAGGAATC GTGCACGGTGGCGGATCC 60 447



Supplementary Table 2

Summary of the immunofluorescence data comparing the expression of layer-specific markers and their co-

expression in ES cell-derived neurons and cortical neurons cultured ex vivo (this study) or as described in vivo

(references). N=3 independent experiments and n>300 cells counted for the ES cell-derived neurons and

progenitors at day 21 or 14, respectively. N=2 independent experiments and n>200 cells counted for acutely

dissociated neurons at P0. Values are displayed as means +/- SEM of the proportion of labelled cells.

Laminar pattern of expression

ES cells-derived at day 21 (N=3; n>300; mean+/-SEM)

Ex vivo at P0 (N=2; n>200; mean+/-SEM)

Reelin-positive neurons Cajal-Retzius cells 20.20 +/- 1.26% 4.70 +/- 1.00%

Tbr1-positive neurons among Reelin-positive neurons 54.10 +/- 3.19% 48.72 +/- 4.62%

CTIP2-positive neurons among Reelin-positive neurons 27.00 +/- 3.14% 14.07 +/- 2.99

Cux1-positive neurons among Reelin-positive neurons 0% 0%

Satb2-positive neurons among Reelin-positive neurons 0% 0%

Tbr1-positive neurons Cajal-Retzius cells, subplate, layers VI and V 39.14 +/- 1.54% 32.50 +/- 4.28%

CTIP2-positive neurons among Tbr1-positive neurons 45.00 +/- 3.35% Coexpression in layer VI and V (Molyneaux et

al., Neuron 2005)

Tle4-positive neurons Layers VI and V 24.84 +/- 2.42% 27.94 +/- 2.27%

FoxP2-positive neurons Layer VI 11.25 +/- 1.79% ND

CTIP2-positive neurons Layers VI and V 36.01 +/- 1.52% 29.66 +/- 2.55%

Tbr1-positive neurons among CTIP2-positive neurons 54.10 +/-3.19% Coexpression in layer VI and V (Molyneaux et

al., Neuron 2005)

Cux1-positive neurons among CTIP2-positive neurons <1% 0%

Satb2-positive neurons among CTIP2-positive neurons <1% 0%

Otx1-positive neurons Layer V 15.42 +/- 1.06% 6.15 +/- 0.87%

ER81-positive neurons Layer V 5.05 +/- 0.66% 3.30 +/- 0.86%

Cux1-positive neurons Layers II-IV 10.56 +/- 0.80% 32.11 +/- 2.10%

Satb2-positive neurons Layers II-IV 7.60 +/- 0.78% 37.50 +/- 4.32%

Tbr1-positive progenitors 0% 0% (Bulfone et al., Neuron 1995)

CTIP2-positive progenitors 0% 0% (Leid et al., Gene Expr Patterns 2004)

Satb2-positive progenitors 0% 0% (Britanova et al., Eur J Neurosci 2005)

Reelin-positive progenitors 0% 0% (D'Arcangelo et al., Nature 1995)

Pax6-positive neurons <1% <1% (Edlund et al., J Neurosci 2005)



Summary of the immunofluorescence data on the cellular composition of the grafts and the identity of the

grafted neurons following grafting in neonatal cortex. N=11 animals.

Marker Abundance Notes GFP (Tau) >90% MAP-2 >90% Nestin <5% May originate from the host GFAP <5% May originate from the host Oct4 Absent ES cells marker Pan-cytokeratin Absent Epithelial marker MF20 Absent Muscle marker HNF-4 Absent Pre-hepatic endoderm marker PECAM <5%

Vascular endothelium marker; likely to reflect vascularization of the graft by the host

Activated caspase-3 <1% Ki67 <1% GAD67 <1% GABAergic neurons ChAT <1% Cholinergic neurons TH Absent Dopaminergic neurons Rhodopsin 0% Photoreceptors GABA-A receptor alpha6 0% Cerebellar granule cells Laminar specificity at late postnatal ages and in adulthood CTIP2 47 +/- 2% Most neurons in layers VI and V Tbr1 14 +/- 3% A subpopulation of neurons in layer VI and V Tle4 23 +/- 3% Most neurons in layer VI and a subpopulation of neurons in layer V FoxP2 12 +/- 2% A subpopulation of neurons in layer VI and V Cux1 11 +/- 2% Upper layers and a subpopulation of neurons in layer V



Semi-quantitative scoring of the axonal projections of ES-derived neurons in several cortical and sub-cortical

structures following grafting in neonatal cortex. Scoring used: (-) means no axon, (+) 1-10 axons, (++) 11-100

axons and (+++) more than 100 axons. N=30 animals.

Age of grafted cells/host D12/P0 D14/P0 D17/P0 Animals 1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 Cortex Visual il ++ + + ++ ++ ++ + ++ ++ ++ ++ +++ +++ - +++ ++ ++ ++ ++ ++ +++ +++ ++ ++ +++ ++ +++ ++ ++ ++

Visual cl - - - - + - - + + - + ++ ++ - ++ + + + ++ ++ +++ ++ ++ ++ +++ ++ ++ ++ ++ +

Somatosensory cl - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Auditory cl - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Motor cl - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Limbic cl ++ + ++ + ++ ++ ++ +++ ++ ++ +++ +++ +++ + +++ ++ ++ ++ +++ ++ +++ +++ +++ ++ +++ +++ +++ ++ ++ +++

Thalamic nuclei

Anterior - - - - - - - ++ ++ ++ + ++ ++ - ++ ++ - - + - +++ ++ - - - ++ - - + -

Lateral geniculate +++ ++ ++ ++ +++ ++ - ++ ++ ++ ++ ++ ++ + ++ ++ + ++ ++ + ++ ++ ++ - ++ ++ + + - -

Lateral posterior +++ ++ + ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ + + ++ + + ++ + ++ + ++ - ++ ++ ++ ++ - -

Latero-dorsal +++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ + ++ ++ - ++ ++ + ++ ++ ++ - ++ ++ ++ ++ - -

Medio-dorsal ++ ++ + - ++ - - ++ - - - ++ ++ - ++ ++ - + + - ++ + + - + ++ + + - -

Ventrobasal/Ventral-lateral and Ventral-medial

++ ++ - - + + - - + + - + ++ - + ++ - - - - ++ - + - - - ++ + - -

Medial geniculate + - - - + - - + - - - - - - + - - - - - + - - - + - + - - -

Midbrain

Superior colliculus +++ ++ + - ++ - - ++ ++ ++ - +++ +++ - +++ ++ - - ++ ++ +++ - ++ - ++ ++ ++ ++ - -

Inferior colliculus - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Periaqueductal grey matter + + + - ++ - - ++ + + - ++ ++ - ++ + - - + + ++ ++ + - ++ + + - - -

Hindbrain

Pediculopontine nuclei + + - - - - - - + - - ++ ++ - ++ + - - ++ - ++ ++ + - ++ + + - - -

Pyramidal tracts - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Spinal Cord - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -


Cortex Septum Striatum Thalamus Hypothalamus Midbrain 1-1 + - - - - - 1-7 - - - + - - 2-2 + + + - - - 2-4 - + - + + - 2-6 - + - + + - 2-8 - + + - + - 2-2b - ++ - - - + 2-4b - + ++ - - + 2-5b ++ - + + + - 2-6b ++ + + - - - 2-7b - + - - + - 2-10b - + - - + - 2-11b + - - ++ - ++ 3-1 ++ + + - - - 3-3 + + + + + - 3-4 ++ - - - + + 3-5 + - - ++ ++ + 3-6 - + + ++ + - 3-7 + + - - + - 3-8 + + - - ++ - 3-9 + + + + + + 3-10 + - + + + +


Semi-quantitative scoring of the integration of ES-derived grafted neurons in several cortical and sub-cortical

structures following in utero grafting in E13 embryonic brain. Scoring used: (-) means no cells, (+) 1-5

cells/section, (++) 5-20 cells/section. N=22 animals.



D14 DDM+Cyclopamine D14 DDM 1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6

Internal capsule +++ +++ ++ +++ +++ ++ ++ +++ +++ +++ +++ + + + + + +

Corpus callsoum ++ ++ + ++ + + + ++ ++ +++ ++ - + + - + +

Cortex Visual cl ++ ++ - ++ + + + ++ ++ +++ ++ - - - - - - Thalamus

nuclei

Anterior ++ ++ - ++ ++ - - + - +++ ++ + ++ ++ + + ++ Lateral

geniculate ++ ++ + ++ ++ + ++ ++ + ++ ++ - + - - + +

Midbrain Superior colliculus +++ +++ - +++ ++ - - ++ ++ +++ ++ - + - - + +

Periaqueductal gray matter ++ ++ - ++ + - - + + ++ ++ ++ ++ ++ ++ ++ ++


Semi-quantitative scoring of the axonal projections of DDM vs. DMM+cyclopamine ES-derived neurons in

one section of the internal capsule, the corpus callosum and several cortical and sub-cortical structures

following grafting in neonatal cortex. Scoring used: (-) means no axon, (+) 1-10 axons, (++) 11-100 axons and

(+++) more than 100 axons. N=11 (DDM+cyclopamine) and 6 (DDM) animals.



0 287 JLGGC

Documents

Transcript of 0 287 JLGGC