~ Pergamon - USP · Cannabinoid issue of euphoria induced by cannabinoids does not appear to...

~ Pergamon Progress in Neurobiology Vol. 48, pp. 275 to 305, 1996 Copyright © 1996 Elsevier Science Ltd. All rights reserved

Printed in Great Britain 0301-0082/96/$32.00

o3oi-ooa2(95)ooo44-5

C A N N A B I N O I D RECEPTOR GENES

EMMANUEL S. ONAIVI*t, AMITABHA CHAKRABARTIt and GAUTAM CHAUDHURI:[:

tDepartment of Pharmacology, Meharry Medical College, Nashville, TN 37208, U.S.A. and ~Division of Biomedical Sciences, Meharry Medical College, Nashville, TN 37208, U.S.A.

(Received 28 September 1995)

Abstract--Can:aabinoids are the constituents of the marijuana plant (cannabis sativa) of which the major active ingredient is delta-9-tetrahydrocannabinol (Ag-THC). Rapid progress has been achieved in marijuana research in the last five years than in the thousands of years that marijuana has been used in human history. For many decades therefore, research on the molecular and neurobiological bases of the physiological and neurobehavioral effects of marijuana was hampered by the lack of specific research tools and technolog2~. The situation has started to change with the availability of molecular probes and other recombinant molecules that have led to major advances. Recent advances include the cloning of the cDNA sequences encoding the rat, human and the mouse peripheral and CNS cannabinoid receptors. In addition a putative ligand, anandamide, thought to represent the endogenous cannabis-like substance that binds the cannabinoid receptors, has been isolated from the brain. This achievement has openned a whole new neurochemical system particularly as the physiological and pharmacological properties of anandamide indicate a possible neuromodulatory or neurotransmitter role. The recent demonstration of a potent and selective antagonist for CB1 receptors may become an important and powerful investigative tool. Future progress on the neurobiology of cannabinoid research may include data on the use of antisense strategies and gene targeting approach to further understand the mechanism(s) of action of cannabinoids which has been slow to emerge. We conclude that these are exciting times for cannabis research which has given us anandamide - - a substance of inner bliss. Copyright © 1996 Elsevier Science Ltd

C O N T E N T S

I. Introduction 2. Evidence for the exJistence of cannabinoid receptors

2.1. General membrane perturbation theory 2.2. Activation of specific cannabinoid receptors

3. The synthesis of potent analogs and identification of endogenous cannabinoids 3.1. Synthesis of ca:anabinoid agonists 3.2. Identification of putative endogenous ligands

3.2.1. Pharmacological properties of anandamide 3.3. Synthesis of cannabinoid antagonists

4. Molecular biology of cannabinoid receptors: cloning of the mammalian cannabinoid receptor genes 4.1. Rat cannabinoid receptors 4.2. Human cannabinoid receptors 4.3. Mouse cannabinoid receptors 4.4. Alternative splicing of the CBI receptor 4.5. Cloning and characterization of peripheral tissue specific cannabinoid receptors

5. Molecular and structural characteristics of cannabinoid receptor genes 5.1. Are the coding regions of the cannabinoid receptor genes intronless? 5.2. Helix net of cannabinoid CB1 receptor protein 5.3. Protein sequence analysis of cannabinoid receptors

5.3.1. Amino acid composition and protein sequence analysis of the mammalian CBI, CBIA and CB2 receptors

5.3.2. Kyte--Doolittle hydrophilicity plot for human CB1, CBIA, CB2 and rat and mouse CB1 cannabinoid receptors

5.3.3. Kyte-Doolittle hydrophilicity plot for N-terminal 28 amino acids of human CBI, CBIA, CB2 and rat and mouse CBI cannabinoid receptors

5.3.4. Potential N-glycosylation and protein kinase sites in the human CBI, CBIA, CB2 and CBI of the rat and mouse 5.3.4.1. N-glycosylation sites 5.3.4.2. Protein kinase sites

5.3.5. Chromosomal mapping of the eannabinoid CB1 receptor genes

276 278 278 278 278 278 280 280 280 281 281 281 281 282 282 286 286 292 292

293

293

294

294 294 295 295

*Author for correspondence. Fax: 615-327-6632.

275

276 E.S. Onaivi et al.

6. Neurobehavioral effects of cannabinoids 6.1. Neurobehavioral specificity of cannabinoid receptor gene expression 6.2. Medical uses of cannabinoids

7. Concluding remarks and future directions Acknowledgements References

296 301 302 302 303 303

1. INTRODUCTION

More progress has been acheived in marijuana research in the last five years than in the thousands of years that marijuana has been used in recorded human history. Cannabinoids are the constituents of the marijuana plant (cannabis sativa) of which the principal psychoactive ingredient is Ag-tetrahydro - cannabinol (A9-THC). For many decades therefore, research on the molecular and neurobiological bases of the physiological and neurobehavioral effects of marijuana use was hampered by the lack of specific tools and technology. The situation has started to change with the availability of molecular probes and other recombinant molecules that have led to the major advances in cannabinoid research. The cannabinoid receptors are known to mediate the psychoactive effects of marijuana and induce the myriad neurobehavioral alterations in addition to affecting most cellular, biochemical and physiological processes (Martin, 1986).

Recent advances include the cloning of the cDNA sequences encoding the rat (Matsuda et al., 1990) human (Gerard et al., 1991; Munro et al., 1993) and the mouse (Chakrabarti et al., 1995) cannabinoid receptors. There has been no systematic nomencla- ture established for the cannabinoid receptors; therefore, CB1, CB1A and CB2 have been used here and by other investigators to denote the currently known receptor subtypes. These cannabinoid receptors are members of the G-protein linked super family of receptors. The genes encoding for these receptors are expressed in abundance in specific tissues (Matsuda et al., 1993; Herkenham et al., 1991; and Bouaboula et al., 1993). For example, the CB1 and CB1A are mainly expressed in certain areas of the brain and relatively poorly expressed in some peripheral tissues (e.g. spleen, testes and leucocytes) (Matsuda et al., 1990; Gerard et al., 1991; Herkenham et al., 1991; Bouaboula et al., 1993). Using RNA (Northern) blot hybridization and reverse transcription PCR Das et al. (1995) demonstrated that the CB1 m R N A but not CB2 mRNA is expressed in the mouse uterus and that the uterus can synthesize anandamide, the putative endogenous iigand. The CB2 on the other hand is not expressed in the brain but in some peripheral tissues (Munro et al., 1993; Facci et al., 1995). Other areas of recent advancement in cannabinoid research include the identification of an endogenous ligand, anandamide [5, 8, 11, 14-eicosatetraenamide (N-2-hy- droxyethyl)] (Devane et al., 1992a; Deutsch and Chin, 1993; Fride and Mechoulam, 1993; Vogel et al., 1993) and the development of potent synthetic cannabinoid agonists (Martin et al., 1994) and antagonists (Rinaldi-Carmona et al., 1994).

In comparison to other G-protein coupled receptors (GPCR) the pharmacology of the cannabinoid receptors is still poorly understood and very

scanty information exists on how these genes are regulated. The emerging picture of the signal transduction pathways associated with the activation of the cannabinoid receptors may be related to the two major hypothesis concerning the mechanism of action of cannabinoids (Hillard and Auchampach, 1994). Based on the current evidence for receptor mediated effects, the cannabinoid receptors are coupled to the inhibition of adenylyl cyclase activity and/or Ca 2+ through voltage dependent Ca ~+ channels in neuronal systems (Bidaut-Russel et al., 1990; Caulfield and Brown, 1992; Mackie and Hille, 1992). The second hypothesis reflects the non receptor-mediated signal transduction systems associated with cannabinomimetic effects on membrane perturbation. Thus, there is empirical support that the cannabinoids have effects on biological membranes and the biophysical properties of lipid bilayer (Bruggemann and Melchior, 1983; Leuschner et al., 1984; Hillard et al., 1985; Makriyannis et al., 1989). Presently therefore, the contribution of receptor- and non-receptor- mediated signal transduction pathways following activation of cannabinoid receptors remains largely unresolved. The recent demonstration by Hillard and Auchampach (1994), that cannabinoids can activate brain protein kinase C in vitro independent of receptor mediated mechanisms lend further support to the notion of non-receptor mediated effects of cannabinoids involving alterations in membrane lipid structural order.

Cannabinoid research and the use of cannabis products continues to attract scientific, socio-political and law-enforcement attention. It is opined that increased scientific research and knowledge will contribute to a better policy on the use of marijuana. For example, preliminary studies with the recently synthesized cannabinoid antagonists (Rinaldi-Car- mona et al., 1994; Pertwee et al., 1995b) has started to resolve some long standing debates about the potential to become addicted to marijauna. Therefore the controversial question of physical dependence on psychoactive cannabinoids was addressed by using the antagonist SR141716A [N-(piperidin-l-yl)- 5-(4-chlorophenyl)- 1 (2,4-dichlorophenyl)-4- methyl- 1H-pyrazole-3carboxamidehydrochloride] (Fig. 1) to precipitate withdrawal reactions in rats injected with increasing doses of Ag-THC. Ace, to et al. (1995) reported a precipitated withdrawal syndrome that was absent in control animals, providing evidence that Ag-THC can produce physical dependency.

In general it had been claimed that the psychoactivity or euphoria induced by cannabinoids limit their use in the clinic for the numerous therapeutic applications for which they are currently being evaluated (Cohen and Stillman, 1976; Bhargava, 1978; Lemberger, 1980; Milne et al., 1981). Two such potential uses are as an antiemetic or as an appetite stimulant in patients with cancer or AIDS (Plasse et al., 1991; Mattes et al., 1994). In such cases the

Cannabinoid

issue of euphoria induced by cannabinoids does not appear to outweigh the the overall quality of life in the terminally ill patients. There are, however, a number of medical uses of marijuana and cannabinoids in the treatment of glaucoma, asthma, hyperthermia, conwdsion, muscle spasticity, anxiety, hypertension, pain and inflammation that can certainly benefit from the dissociation of the psychoactivity induced by cannabinoids from the therapeutic effects. The purpose of the present review is to update the e:~citing and significant progress made in cannabinoid research especially on the

Receptor Genes 277

cannabinoid receptor genes. This includes earlier evidence for the existence of cannabinoid receptors in the mammalian central nervous system and the serendipitous cloning of the CBI receptor gene in the rat followed by the cloning of the genes in other species. The synthesis of potent cannabinoid agonists and antagonists were pivotal to these current advances. With the availability of these genes and gene products it is speculated that the properties of these genes will be intensely studied as to reveal how the psychoactivity can be dissociated from the therapeutic properties of cannabinoids (Table 1).

1. (~,

CsHI I 0

Ag.THC

WINS5212-2

2.

~ ~ H O CsH l t

Cannablnol

3 . ~ ~ H C H CsHII

Cannabidiol

4. 0

Nabllone

5. OH

9. O

AH2 Pravadollne 6 7. OH

CP 55,940

WIN 5608

8.

11.

C_H20H

HU243

CI f ~ ~ ] C]

SR141716A

_•IOCH3 I .CH3

H

Levonantradol

12. O ~ ~ O H

Anandamid,

Fig. 1. Structures of cannabinoid ligands, including some natural cannabinoids, Ag-THC, cannabinol, cannabidiol; the putative endogenous ligand, anandamide; some synthetic cannabinoid agonist, WIN 55212-2, CP ';5940, HU 243 and some synthetic cannabinoid antagonist, WIN 5608, pravadoline and

SR141716A.

278 E. S. Onaivi et al.

Table 1. Molecular Biological Characteristics of G Protein-Coupled Cannabinoid Receptors

Second Species Chromosomal Amino acid GeneBank Receptor messenger cloned location sequence accession Primary reference

CBI

CBIA

CB2

"Inhibition of adenylate cyclase bInhibition Ca -~+

channels a and b Human 6q14-15 a and b Rat a and b Mouse Prox.4

a and b Human a and b Rat a and b Mouse a and b Human a and b Rat a and b Mouse

472 X54937 Gerard et al., 1991 473 X55812 Matsuda et al., 1990 473 U17985 Chakrabarti et al., 1995;

Stubbs et al., 1995 411 X81120 Shire et al., 1995 411 X81121 Shire et al., 1995

360 x74328 Munro et al., 1993

2. EVIDENCE FOR THE EXISTENCE OF CANNABINOID RECEPTORS

2.1. General Membrane Perturbation Theory

The hypothesis that cannabinoids produce cellular effects as a result of general membrane perturbations in membrane lipid structural order has been extensively studied and has experimental support (Lawrence and Gill, 1975; Bach et al . , 1976; Tamir and Lichtenberg, 1983; Bruggemann and Melchior, 1983; Makriyannis et al . , 1989; Leuschner et al. , 1984; Hillard et al . , 1985). Thus, there is available evidence that cannabinoids have effects on biological membranes and on the biophysical properties of lipid bilayer. The in-depth studies over the years therefore indicate that the psychoactive cannabinoids, Ag-THC and ll-OH-A9-THC decreases neuronal membrane lipid ordering while cannabinoids devoid of psychoactivity, e.g. cannabinol and cannabidiol, do not decrease this lipid ordering (Hillard et al . , 1985). Since the current attention on the specific genes that codes for the specific cannabinoid receptors has shifted attention away from the membrane perturbation theories of cannabinomimetic action, the relative roles of lipid and receptor-mediated effects to the neurobehavioral effects of cannabinoids remains to be established in different systems (Table 2).

2.2. Activation of Specific Cannabinoid Receptors

The idea of marijuana acting via specific receptors had been the subject of decades of intensive research and debate (Harris e t al . , 1978; Binder e t al . , 1979; Binder and Franke, 1982; Nye et al . , 1985; Pertwee, 1988) and evidence for the existence of cannabinoid receptors has been reviewed exhaustively (Pertwee et al . , 1993). Thus for many decades research on the molecular and neurobiological bases of the physiological and neurobiological effects of marijuana use was hampered by lack of specific research tools and technology. The situation has started to change with the availability of molecular probes and other recombinant molecules that have recently led to major advances in cannabinoid research. The cloning of the cannabinoid receptor gene in the rat (Matsuda et al . , 1990), in the human (Gerard e t al . , 1991; Munro et al . , 1993) and in the mouse (Chakrabarti

et al. , 1995), coupled with the identification of an endogenous ligand, anandamide (Devane et al . , 1992a; Deutsch and Chin, 1993; Fride and Mechou- lam, 1993; Mackie e t al . , 1993 and Vogel e t al. , 1993) and the synthesis of potent cannabinoid agonists (Howlett e t al . , 1988; Devane et al. , 1992b) and antagonist (Rinaidi-Carmona e t al . , 1994) have enhanced our understanding of the characteristic effects and properties of cannabis and cannabinoids. These recent advances and developments have provided the convincing evidence for the existence of cannabinoid receptors. Experimental evidence thus far obtained for the cannabinoid receptors tend to fulfil the criteria used to indicate whether or not a drug action is mediated by a specific receptor. Therefore, the synthesis of the potent cannabinoid ligands demonstrating stereoselectivity with known structure-activity relationship profiles at cannabinoid binding sites, coupled with the cloning of the genes encoding the receptors for which an antagonist now exists has opened a new window of oportunity in cannabinoid research (Pertwee et al . , 1993; Devane, 1994). The previous studies on the structure-activity relationships and stereoslectivity of potent cannabinoids had unmasked the problem of the high degree of non-specific binding to reveal the presence of binding sites specific for cannabinoid receptors.

3. THE SYNTHESIS OF POTENT ANALOGS AND IDENTIFICATION OF ENDOGENOUS

CANNABINOIDS

All of the rapid progress including the identification of an endogenous cannabinoid, anandamide and the cloning of the central and peripheral nervous system cannabinoid receptor genes have openned a new window of opportunities in cannabinoid research (Devane, 1994). As newer subtypes of the receptor genes are cloned, it is a major goal to synthesize novel compounds or the use ofantisense strategies, that will have specific and selective therapeutic application in the clinic.

3.1. Synthesis of Cannabinoid Monists

The term cannabinoid is used for the typical C21 compounds present in C a n n a b i s sa t i va L . and

Cannabinoid

includes their analogs; and transformation products (Razdan, 1986). The synthesis of cannabinoid agonists was difficult because of the capricious and complex nature of reaction mixtures which were difficult to separate (Razdan, 1986). Most of the earlier problems were surmounted and numerous synthetic cannabinoid derivatives and affinity ligands for the cannabinoi6 receptors continues to be developed. In addition some limited success have been achieved with the synthesis and development of Ag-THC-Iike compottnds that are now currently available for clinical use. For example nabilone and dronabinol (Fig. 1) have been used as anti-emetic and appetite stimulant in ]patients with cancer and AIDS (Razdan, 1986; Formukong et al . , 1989; Plasse et al . , 1991; Mattes et al . , 1994). The concept of developing therapeutically useful drugs has been attractive because of the mild dependency potential and particularly of its low toxicities in animals and humans. The separation of undesirable side effects from clinically usefid effects has been intensely researched for decades. It could be said that some degree of success has been achieved in the structural modification of Ag-TI-tC that has resulted in a series of novel THC analogs and derivatives which show some degree of selectivity in the treatment of glaucoma, nausea and vomiting, hypertension,

Receptor Genes 279

convulsions, pain and insomnia. It is therefore not surprising that intense search continues on the synthesis of compounds by altering structural changes in the THC molecule which may lead to further selectivity of therapeutic action. Over the years quantitative structure-activity relationship analysis of the affinity for binding to the cannabinoid receptor of a number of agonist ligands have been developed (Howlett et al . , 1988). More potent cannabinoid ligands have been synthesized from isothiocyanate and azido derivatives which bind tightly and can act as photoaffinity labels (Richard- son et al., 1989; Howlett et al . , 1988; Burstein et al. , 1991). Furthermore, Little et al. (1989) and Howlett et al . (1988) have tested numerous classical and nonclassical cannabinoids in behavioral and biochemical systems. In most of the tests a high degree of enantioselectivity, perhaps because of well defined structure-activity relationship and high affinity saturable binding was evident. Some series of compounds known as aminoalkylindoles (AAI) have been shown to bind to the cannabinoid receptors as only cannabinoids inhibit the binding (Pacheco et al . , 1991; Jansen et al . , 1992; Compton et al . , 1992; Kuster et al . , 1993). WIN55212-2 (Fig. 1) is a potent AAI with analgesic properties. The binding of [3H]WIN 55212-2 to neuronal membranes is similar

"]Fable 2. The Physiological and Pharmacological Actions of Anandamide

Anandamide References*

Able to cross the blood-brain barrier; rapid onset and shorter duration of action than cannabinoids. 4,6,11,12

Rapidly degraded by a~aidase activity which can be prevented by Phenylmethylsulphonyl fluoride (PMSF).

Substitutes for Ag-THC incompletely in the rat drug discrimination tests in vivo. 31 Induces the classical cannabinoid tetrad effects on motor activity temperature, nociception and

catalepsy. Low doses inhibit pharmacological effects of Ag-THC. Fluoroanandamide more potent than

anandamide. Inhibits radiolabelled probes that bind to cannabinid receptors. 5 Inhibits the binding of 1,4-dihydropyridine to L-type calcium channels and 15 Inhibits N-type calcium channel currents. 17 Inhibits forskolin stimulated cAMP production in CHO cells transfected with cannabinoid

receptors Blocks adenylate cyclase activity and the fog neuromuscular junction. Inhibits electrically evoked twitch response and exhibits cross tolerance with other cannabinoid

agonist in 19,20,21 the mouse Vas deferens and G. pig myentric plexus preparations. Reversibly inhibits the fertilizing capacity of sea urchin sperm. 22 Produces receptor independent effects. 9,10,14 Induces circling behavior following unilateral administration into the striatum -an action

blocked by dopamine antagonists. 25 Induces 5-HT-induced current in rat no dose ganglion neurons. 8 Decreases naloxone-precipitated withdrawal signs in mice treated with morphine. 27 Can be synthesized in the mouse uterus. 3 Mast cells express CB2 receptor with differential sensitivity to anandamide and

palmitoylethanolamide. 7 Stimulates the release of ACTH and corticosterone while depleting CRF-41 from the 29 hypothalamo-pituitary adrenal axis. Metabolized by mouse hepatic cytochrome P450. 1 Inhibits lymphocyte proliferation and induces apoptosis. 23

2,11,12,13,18,24,30

9,10,16,26,28

* 1. Bornheim et al., 1'993; 2. Crawley et al., 1993; 3. Das et al., 1995; 4. Deutsch and Chin, 1993; 5. Devane et al., 1992b; 6. Devane, 1994; 7. Facc, i et al., 1995; 8. Fan, 1995; 9. Felder et al., 1992; 10. Fride and Mechoulam, 1993; ! 1. Fride et al., 1995; 12. Johnson et al., 1993; 13. Mackie and Hille, 1992; 14. Mackie et al., 1993; 15. Martin et al., 1994; 16. Pertwee et al., 1993; 17. Pertwee et al., 1994; 18. Pertwee et al., 1995a; 19. Schuel et al., 1994; 20. Schwarz et al., 1994; 21. Smith et al., 1994; 22. Souilhac et al., 1995; 23. Van der Kloot, 1994; 24. Vela et al., 1995; 25. Vogel et al., 1993; 26. Weidenfeld et al., 1994; 27. Welch et al., 1995; 28. Wiley et al., 1995


to [3H]CP55, 940 - - a synthetic cannabinoid (Fig. 1) (Jansen et al., 1992). With the growing body of experimental evidence on the neurobiological events following cannabinoid receptor activation and the discovery of cannabinoid receptor subtypes has created therapeutic potential for the development of novel immuno-suppressive, anti-inflammatory compounds that may be devoid of psychoactivity.

3.2. Identification of Putative Endogenous Ligands

A natural brain lipid, anandamide, [N-arachidonylethanolamide], first identified by Devane et al., 1992b) is thought to represent the endogenous cannabis-like substance that binds to the cannabinoid receptor in the brain. The cloning of the genes that encode for the cannabinoid receptors and identification of anandamide as a possible endogenous ligand will facilitate and aid in the study of the physiological role of the cannabinoids in normal and diseased brain. As pointed out by Dr. Martin, (1992) the discovery of an endogenous cannabinoid ligand opens up a new neurochemical system. Studying this system will add significant knowledge to our understanding of the CNS. The discovery tends to validate earlier experimental evidence for the existence of a cannabinoid receptor which in turn had suggested that an endogenous ligand for this system might exist (Devane et al., 1988).

Anandamide was isolated from porcine brains that were extracted with organic solvents using chromato- graphic separation techniques appropriate for lipid constituents (Devane et al., 1992a). A number of fractions from the brain extracts were assayed for their ability to displace a novel cannabinoid ligand [3H] HU-243 binding in a centrifugation-based binding assay. One constituent, anandamide inhib- ited the specific binding of [3H] HU-243 to the cannabinoid receptor. Anandamide which showed one spot on TLC and eluted as one peak on gas chromatograph also elicited a concentration-dependent inhibition of the murine vas deferens (MVD). The MVD is a bioassay system that is known to be sensitive to cannabinoids, anandamide and its congeners (Pertwee et al., 1994). Following the structural identification from mass spectrometric and nuclear magnetic resonance measurements, Devane et al., 1992a confirmed that the structure of anandamide isolated from the brain was similar to that obtained by synthesis since they gave identical spot on the TLC, and retention time and fragmenta- tion pattern on NMR and GC-MS. Although, anandamide is the only putative endogenous ligand currently known for the cannabinoid receptor, two other brain constituents were reported by Devane et al., 1992b) to inhibit both binding of [SH] HU-243 to cannabinoid receptor and the stimulated twitch response to the MVD by Pertwee et al. (1994).

3.2.1. Pharmacological Properties o f Anandamide

Most of the available data indicate that anandamide produces effects similar to cannabinoids in in vivo and in in vitro test systems. Although, the exact mechanisms involved in the biosythesis and degradation of anandamide has not been completely

resolved (Di Marzo et al., 1994; Devane and Axelrod, 1994; Kruszka and Gross, 1994), the properties summarized in Table 2, indicate a possible neuromodulatory or neurotransmitter role for anandamide. The cloning of cannabinoid receptors with the preferential expression of subtypes in the periphery (Munro et al., 1993) and in the brain (Matsuda et al., 1990; Gerard et al., 1991; Munro et al., 1993) suggest the possibility of other cannabinomimetic compounds. The localization of anandamide in the brain and in the periphery has yet to be mapped since a method of quantification remains to be developed. However, the recent experiments by Di Marzo et al. (1994) argue against the hypothesis by Devane and Axelrod (1994) and Kruszka and Gross (1994), that anandamide is formed by the condensation reaction because of the very low levels of free ethanolamine and arachidonate - - the starting materials for the synthesis of anandamide. These recent studies (Di Marzo et al., 1994; Devane and Axelrod, 1994; Kruszka and Gross, 1994) lend further support that the biosyn- thesis of anandamide may be regulated physiologically, and demonstrates putative neurotransmitter status by been stimulated by increased neuronal intracellular Ca 2 ÷ with a reuptake mechanism for its termination. Thus the discovery of anandamide and the search for other cannabinoids provides exciting times for cannabinoid research. While preparing this review, Priller et al., 1995 reported that Mead ethanolamide demonstrated agonist activities at the CBl and CB2 receptors and could be another potential candidate as an endogenous ligand for CB1 receptors. Anandamide is known to be easily degraded and this can be prevented by penylmethyl- sulphonyl fluoride (PMSF). One anandamide analog that was utilized recently is the methanandamide and fluoroanandamide which were found to exhibit high affinity for the CB1 receptor and possesses a remarkable stability to aminopeptidase hydrolysis (Abadji et al., 1994; Welch et al., 1995)

3.3. Synthesis of Cannabinoid Antagonists

The search for cannabinoid antagonists and the utility of many existing compounds acting via other receptor systems to block cannabinomimetic effects have been well studied with little success in securing a robust antagonism at the cannabinoid receptor. Previous studies had also utilized some metabolites of cannabinoids for possible antagonistic properties. In one study, Onaivi et al. (1990) used benzodiazepine ligands and inactive doses of other cannabinoids to attempt to antagonize the anxiogenic effects of A9-THC and the anxiolytic effects of nabilone and cannabidiol in the rodent model of anxiety. In another study, Pacheco et al., 1991 conducted a series of in vitro assays and reported that an aminoalkylindole antagonist selectively attenuated AAI-induced inhibition of the electrically stimulated mouse vas deferens. In those experiments, physiologically relevant doses were used to demonstrate that the antagonist WIN56098 (Fig. 1) produced 16- to 40- fold rightward shifts in the concentration-effect curves for AAI agonists and did not have a similar effect on the inhibitory actions of other agonists (Pacheco et al., 1991). However, Compton et al.,

Cannabinoid Receptor Genes 281

1992 could not demonstrate any antagonist effect of the AAI analog in: vivo. Therefore the search continued for cannabinoid receptor antagonists. AM630 (Iodopravadoline), another AAI was reported to be a competitive cannabinoid receptor antagonist by Pertwee et al., 1995b). They demonstrated that iodopravadoline was a competitive antagonist to anandamide, WIN55212-2 and CP 55940 and reduced cannabinoid inhibition of electrically-evoked txvitches of the isolated mouse vas deferens. The authors speculate that the mouse vas deferens may contain more than one type of cannabinoid receptor since iodopravadoline was more potent as an antagonist of Ag-THC and CP 55940 than as an antagonist of WIN 55212-2 or anandamide.

Further characterization of iodopravadoline is required to establish it as an antagonist of the cannabinoid receptors. On the basis of radioligand binding and functional data, Rinaldi-Carmona et al. (1994) demonstrated that SR 141716A [N-piperidin- 1- yl)- 5 - (4- chloropher~yl) - 1 - (2,4- dichlorophenyi) - 4- methyl - 1H - pyrazole - 3 - caroxamidehydro- chloride] (Fig. 1) is a potent and selective antagonist of the brain cannabinoid receptor. Unlike the WIN56098, which was reported to have activity in the in vitro assays but not in in vivo tests; SR141716A antagonized the inhibitory effects of cannabinoid agonists on stimulated MVD and adenyly cyclase activity in vitro and also antagonized classical pharmacological and behavioral effects of cannabinoid receptor agonists in vivo (Rinaldi-Carmona et al., 1994 and Aceto et al., 1995). It is important to mention that Rinaldi-Carmona et al., 1994 also showed that SR141716A was active at nanomolar affinity for the central cannabinoid receptor but was not active on the peripheral CB2 receptor. The value of a cannabinoid receptor antagonist will prove to be an important and powerful investigative research tool to further understartd the myriad neurobehavioral profile of marijuana and perhaps contribute in dissociating the role of the cannabinoid receptor subtypes in the central and peripheral nervous system.

4. MOLECULAR BIOLOGY OF CANNABINOID RECEPTORS: CLONING OF

THE MAMMALIAN CANNABINOID RECEPTOR GENES

The marijuana receptor gene had been elusive to clone but evidence for the existence of the receptor had been demonstrated since the 1980's (Howlett et al., 1988; and Devane et al., 1988). It has been shown and now recognized that cannabinoids have specific receptors that inhibit adenylate cyclase. Although a number of approaches are now available for the cloning of genes encoding different receptors, the most common methods previously available which involved the purification to homogeneity of the gene protein product did not work for the cannabinoid receptors. Even with the availability of molecular probes and recombinant molecules the cloning of the fir,;t CBI gene in the rat was serendipitous.

4.1. Rat Cannabinoid Receptors

The rat CB1 cDNA was the first to be cloned by Matsuda et al. (1990) from a rat cerebral cortex eDNA library, using Substance P oligonucleotide probe. This group of investigators were studying genes that code for pain peptides and Substance P when they cloned a cDNA that turned out to be the first cannabinoid receptor (CBI) gene. This was an example of classical scientific serendipity since the 56-base oligonucleotide probe designed by the group was from the second transmembrane domain sequence of bovine Substance-P receptor.

4.2. Human Cannabinoid Receptors

The next report of the CBi gene for the human cannabinoid receptor was a cDNA isolated by Gerard et al., 1991 from a human brain stem cDNA library using a 600 bp DNA probe and polymerase chain reaction. The deduced amino acid sequences of the rat and human receptors showed that they encode protein residues of 473 and 472 amino acids respectively with 97.3% homology. These proteins share a number of structural properties like the presence of the seven highly hydrophobic domains and many residues that are common among the family of G-protein coupled receptors (Matsuda et al., 1990; Gerard et al., 1991; Shire et al., 1995) (Fig. 3). The human and rat CB1 receptors also share a number of pharmacological characteristics including the inhibition of adenylate cyclase activity in a stereoselective and pertusis sensitive manner following activation by cannabinoids (Devane et al., 1988; Matsuda et al., 1990; Gerard et al., 1991).

4.3. Mouse Cannabinoid Receptors

We routinely use the mouse model in studying the molecular bases of the myriad neurobehavioral effects of cannabinoids. The mouse CBI receptor gene sequence was therefore required not only as a probe for Northern blot analysis but also to design antisense oligonucleotides for specific in vivo inactivation of CB1 gene expression in the mouse model. Therefore the mouse CB1 receptor gene was cloned, sequenced and compared with rat and human sequences (Table 1 and Figs 2-4). During the cloning, a C57BL/6 mouse cDNA library in lgtl0 was screened (Ausubel et al., 1994; Sambrook et al., 1989) using a rat CBl-specific probe (Matsuda et al., 1990). Several clones were purified to homogeneity by repeated screening (Ausubel et al., 1994; Sambrook et al., 1989) and inserts were subcloned into pBluescript KS ( + ) . Inserts were sequenced by primer walking (Ausubel et al., 1994; Sambrook et al., 1989) using the dideoxy chain termination method (Ausubel et al., 1994) in an ABI automated DNA sequencer. The mouse CB1 cDNA sequence has been submitted to the GENBANK data base (#U17985) and a report of this work is in press (Chakrabarti et al., 1995). The mouse CB1 eDNA has a 96% homology with the rat CBI cDNA and 91% homology with human CB1 cDNA in its nucleotide sequence. The peptide sequences of the mouse CB1 has 99% homology with that of the rat CB1 and 97%


A.

CB1 gene

Intron I (1.8 kbp) Intron II (167 bp) I--

B.

CB1 mRNAs AUG~ UGA

~ I A I I sp I

AUG2 UGA

Fig. 2. Putative structures of CB1 gene (A) and two mRNAs derived from it (B). CBI gene contains two introns. The 1.8 Kbp intron I is in the 5'-untranslated region and the 167 bp intron II is inside the coding region of the gene. These two introns may be alternatively spliced to generate several mRNA species including the CB1 and CB1A mRNAs (B). AUGI and AUG2 are the translation initiation codons for CB1 and CB1A, respectively. The polypeptide sequences coded by the regions between AUG1 and the splice site (sp) or AUG2 and sp are entirely different. But the amino acid sequence coded by the region between sp and the termination codon UGA are identical in both CB 1 and CB IA. Obviously, alternative

splicing of the intron I does not influence the amino acid sequences of either CB1 and CBIA.

homology with that of the human CB1 (Fig. 4). The sequence analysis of the CB1 clones todate revealed a high level of homology with G-protein coupled receptors (GPCR). Like the GPCRs, the cannabinoid receptors contains an N-terminal extracellular domain that possesses glycosylation sites, seven transmembrane segements and a C-terminal intracellular domain that may be coupled to a G-protein complex. One distinguishing feature of the CB1 receptor is its long extracellular extremity (Shire et al., 1995).

4.4. Alternative Splicing of The CB1 Receptor

The initial evidence of the alternative splicing of the CB1 was reported by Bonner and Matsuda, 1994. Recently, Shire et al. (1995), confirmed and reported the presence and expression of an isoform, CB1A resulting from alternative splicing of the human and rat CB1 gene transcript. They found that the amino-terminal coding region of the CB 1 differs from the CB1A and lacks two of the potential glycosylation sites seen in CB1 (Fig. 2). Although, there is currently very scanty information on the flanking noncoding regions of the CB1 genes; preliminary information exist on the flanking noncoding regions that was obtained from two overlapping clones isolated from a human lung eDNA library with CB 1 eDNA inserts by Shire et al. (1995). Additional unpublished observations from the cosmids spanning 56 kb of the human CBI gene has been cloned by Bonner et al. (1994), and analyzed partially. The emerging CBI receptor gene structure contains two polyadenylation signals in the 3'-untranslated region (UTR) in comparision to the CBIA which may have only one polyadenylation signal at the 3'-UTR (Shire

et al., 1995). The partial sequence analysis reported by Bonner and Matsuda (1994) on the human CBl indicates that there are two exons containing the 5'-untranslated sequence and that the entire coding sequence is contained within a single exon with 63 bases of Y-untranslated sequence along with the 3.8 kb 3'-untranslated sequence (Fig. 2).

4.5. Cloning and Characterization of Peripheral Tissue Specific Cannabinoid Receptors

A new subtype of cannabinoid receptor which is expressed in the peripheral nervous system and has not been detected in the brain was reported by Munro et al. (1993). This peripheral type of cannabinoid receptor, refered to as CB2, was cloned by these workers in an attempt to identify GPCRs expressed in myeloid cells (Munro et al., 1993). Using polymerase chain reaction (PCR) and degenerate primers on eDNA obtained from human leukemic cell line HL60, they identified six clones that demonstrated homology to GPCRs. One of the clones termed "CX5", showed some nucleotide sequence homology with that of CB! the first cannabinoid receptor to be cloned in the rat by Matsuda et al., 1990. The cDNA of "CX5" insert was used to screen the HL60 cDNA library and two eDNA clones were obtained. Upon transfection and expression of the most complete clone into tissue culture, it became clear that the protein product bound with high affinity to two cannabinoid radioligands, WIN 55212-2 and CP 55940. Ag-THC displaced these ligands with high affinity. The control cells that were not transfected (hCX5.36) did not express the receptor and therefore do not bind to the cannabinoid radioligands. It was concluded that CB2

f,"

u

m ~ m

°

@

"i' [ ~ - i¢~k . .~K , ' W " k u ~ ' ~ "~" z ~

,/,.

L .

w m

m m

m

e , , m

__2 0

.=_

e-

3

e-

~2

e'-,

r..)

e'-

e-,

e-,

-v

283

C a n n a b i n o i d R e c e p t o r G e n e s 285

m ,-I ~ , . - I H H H

• ,-~ ~ ~ I~ ~ ~ - ~

~¢1 M M ~ J

e,-t t~ m

• H ~

~ H H H

~ u l mmul

I~m U L ) ~

H H H

H H ~

H H H ~ H H ~

H H N ~ 1

• N H H I ~ U ~ H H ~ ~ H H ~

~ H H ~ '

v - l O O k 0 O k 0

H H ~

r-4 ~ t0 "0

H H ~ ¢.) ¢.) "t~ torz~

®

~ t a ~ t o

~ D3

a~ a~ a~

H ~--4 H H H ~>

O ¢ . ) ~

O~ t0 t0

(",1 r---I t ~ r-4

t 0 r . q

r-t r-4

~ U

,=,.~

O

0~ ~r

.¢q

O ¢o

< . ~

,sZ ~'--"

to

e.

<


Table 3. Oligodeoxyribonucleotide Primer Pars used for the Polymerase Chain Reactions

Primer specific Expected size (bp) of the to cDNA Name* Position? Nucleotide Sequences (5'- > 3') amplified band~

CB1

CBI

CBI

CBI

F 1 2 3 - 4 4 TTGCAGACACCACCTTCCGTAC B1 5 9 1 - 5 7 1 AACCCCACCCAGTTGAACAG 569 F2 588-611 GGTTACAGCCTCCTTCACAGCTTC B2 1100-1078 TCATACACCATGATCGCAAGCAG 513 F3 8 5 3 - 8 7 4 AGTGTGCTGCTGCTGTTCATTG B3 1373-1350 GCGATCTTAACGGTGCTCTTGATG 521 F4 1200-1222 GAGGAGCAAGGACCTGAGACATG B4 1438-1415 CCACAAAAGCAGCAGCTCACAGAG 239

CB2

CB2

CB2

CB2

CB2

F5 5-28 AGGAATGCTGGGTAGACAGAGATAG B5 3 3 8 - 3 1 8 ACGCTGCCAATCTTCAGCAGG 334 F6 11-34 GCTGGGTGACAGAGATAGCCAATG B6 9 1 4 - 8 9 4 TCTCCACTCCGTAGAGCATAG 904 F7 4 6 4 - 4 8 2 GCATCATGTGGGTCCTCTC B6 91 4-894 TCTCCACTCCGTAGAGCATAG 451 F8 7 0 6 - 7 2 3 CGAATGAGGCTGGATGTG B8 1134-1111 GGGAGTGAACTGATTTCTGACTTG 429 F5 5 -28 AGGAATGCTGGGTGACAGAGATAG B8 1134-1111 GGGAGTGAACTGATTTCTGACTTG 1130

*F = Forward primer; B = Reverse or backward primer. tThe 'A' of the protein initiation codon, ATG, in the cDNA sequence is designated as 1. The length of the cDNA coding

regions of rat CBI and human CB2 are 1440 bp and 1134 bp, respectively. ~:The size of the amplified band is given for a specific pair of forward and reverse primers

gene encodes a selective, high-affinity receptor for cannabinoids. They also found that cannabinol may have a preference for the CB2 over the CB 1 receptors. This was confirmed by experiments which demonstrated that the expression of the mRNA for the CB2 gene could only be detected in the spleen and not in the brain, thymus, lung, kidney, nasal membranes and liver.

The significance of the expression of this gene in the marginal zones around the periarteriolar lymphoid sheaths, in addition to being active in the macrophages of the spleen suggest a possible role in immune function and inflammation. A comparison of the human CB2 and CB1 gene and protein structure and properties are shown in Table 1 and Fig. 2 and Fig. 4 and 5. The human CB2 receptor shares about 44% homology with the human CB1 receptor. There are however some similar interactions of the CB1 and CB2 receptors with the cannabinoids ligands in addition to the mediation of the inhibition of adenylyl cyclase (Munro et al., 1993; Rinaldi-Car- mona et al., 1994; Matsuda et al., 1990; Gerard et al., 1991). Although, the apparent redundancy between CB1 and Cb2 and their regulatory mechanisms remains to be resolved, it may be possible to design selective compounds targeted at the CB2 receptors; such compounds may be immunosuppressants or have anti-inflammatory properties (Iversen, 1993; Devane, 1994).

5. MOLECULAR AND STRUCTURAL CHARACTERISTICS OF CANNABINOID

RECEPTOR GENES

5.1. Are the Coding Regions of the Cannabinoid Receptor Genes lntronless?

There is currently little information available about the flanking noncoding regions of the cannabinoid receptor genes. The structural features of these genes

and the mechanisms by which they regulate the function of the receptors are poorly understood. We and others (Onaivi et al., 1996; Shire et al., 1995; Chakrabarti et al., 1995; Stubbs et al., 1995) have started attempting to anwser a number of these questions. In order to determine whether there are introns in the coding sequences of human, rat and mouse CB1 and CB2 genes, we used computer generated multiple primer pairs spanning the eDNA sequences of these genes to test whether the DNA fragments amplified by these primer pairs are identical with both genomic DNA and cDNA templates. Our hypothesis is that if the amplified DNA fragment sizes are identical with both templates, the gene is intronless; if not, the intron location, size and structure can be determined.

To determine whether the structure of testis CBI receptor gene or its transcript is different from those of brain, we isolated DNA and RNA from rat testes and brain and used them as templates for PCR with four pairs of primers (Table 3). There was no difference in sizes of the PCR amplified DNA bands between the brain DNA (Fig. 5Aa) and RNA (Fig. 5Ba), between testis DNA (Fig. 5Ab) and RNA (Fig. 5Bb) or between the brain and testis DNA (Fig. 5A) or RNA (Fig. 5B). Specific amplified DNA bands were identified by Southern hybridization with human CB1 eDNA as probe (Fig. 5Aa' , 5Ab', 5Ba' and 5Bb') and the data conform with those expected. The DNA bands that are amplified along with those expected appeared to be due to mispriming, as they did not hybridize with the CBI eDNA probe (Fig. 5). Because GPCRs genes have many parts in common (O'Dowd, 1993), it is possible that some of the primer pairs are amplifying parts of other GPCRs. Cannabinoids have effects on male fertility by their ability to lower testosterone levels in testis (see Iversen, 1993). CB1 gene was also found to be expressed in testis (Gerard et al., 1991). Northern analysis of CB1 mRNA levels in rat brain and testis

(A)

(a) M 1 2 3 4 (b) M 1 2 3 4

(a') M 1 2 3 4 (b') M 1 2 3 4

Fig. 5(A). Caption overleaf.

287

(B)

(a) M 1 2 3 4 (b) M 1 2 3 4

;i!~i

(a') M 1 2 3 4 (b') M 1 2 3 4

Fig. 5(B).

Fig. 5. (A) Analysis of the structure of the CBI gene and its transcript in rat brain and testis. Ethidium bromide-stained agarose gels (2%) (a, b) or corresponding autoradiograms (a', b') of blots hybridized with human CB1 cDNA as probe (a', b') showing PCR amplification of DNA segments from total genomic DNA (A) from rat brain (a, a') and rat testis (b, b') using different primer pairs designed from rat CBI cDNA sequence. M: DNA size standards containing a mixture of Hind III-digested 7-DNA and Hae III-digested fX174 RF DNA. The arrowheads in the figures indicate the highest size DNA fragment (1.4 kb) of the fX174 RF DNA. The bands that follow (downwards) are of 1.1 kb, 0.9 kb, 0.6 kb, 0.31 kb, 0.28 kb, 0.27 kb, 0.23 kb, 0.19 kb, 0.12 kb and 0.07 kb in size, respectively; Lane h Primer pairs FI/BI; lane 2: Primer pairs F2/B2; lane 3: Primer pairs F3/B3; lane 4: Primer pairs F4/B4. (B) Analysis of the structure of the CB1 gene and its transcript in rat brain and testis. Ethidium bromide-stained agarose gels (2%) (a, b) or corresponding autoradiograms (a', b') of blots hybridized with human CBI cDNA as probe (a', b') showing PCR amplification of DNA segments from cDNA (B) from rat brain (a, a') and rat testis (b, b') using different primer pairs designed from rat CB1 cDNA sequence. M: DNA size standards containing a mixture of Hind I II-digested I-DNA and Hae Ill-digested fX174 RF DNA. The arrowheads in the figures indicate the highest size DNA fragment (1.4 kb) of the fX174 RF DNA. The bands that follow (downwards) are of 1.1 kb, 0.9 kb, 0.6 kb, 0.31 kb, 0.28 kb, 0.27 kb, 0.23 kb, 0.19 kb, 0.12 kb and 0.07 kb in size, respectively; Lane h Primer pairs F1/BI; lane 2: Primer pairs F2/B2; lane 3: Primer

pairs F3/B3; lane 4: Primer pairs F4/B4.

288

(A) 1 M (B) 1 M

m

Fig. 6. Analysis of the structure of human CB1 gene. Ethidium bromide-stained agarose gel (2%) (A) and corresponding autoradiogram (B) of the blot hybridized with human CB1 cDNA as probe, showing PCR amplification of DNA segments from total genomic DNA isolated from human leukocytes using F 1/B4 primer pair designed from rat CB 1 cDNA sequence. M: DNA size standards containing a mixture of Hind Ill-digested I-DNA and Hae III-digested fX 174 RF DNA. The arrowheads in the figures indicate the highest size DNA fragment (1.4 kb) of the fX174 RF DNA. The bands that follow (downwards) are of 1.1 kb, 0.9 kb, 0.6 kb, 0.31 kb, 0.28 kb, 0.27 kb, 0.23 kb, 0.19 kb, 0.12 kb and 0.07 kb in size,

respectively.

289

(A) M 1 2 3 4 5 (B) M 1 2 3 4 5

b D

(A') M 1 2 3 4 5 (B') M 1 2 3 4 5

Fig. 7. Analysis of the structure of human CB2 gene. Ethidium bromide-stained agarose gel (2%) (A and B) and corresponding autoradiogram (A' and B') of the blot hybridized with human CB2 cDNA as probe, showing PCR amplification of DNA segments from human blood DNA (A, A') and RNA (B, B'). The additional PCR amplified DNA bands are shown by an arrow in Figs. A' and B'. The insets in A' and B' show the over exposed (48 h) lanes 3 and 4. M: DNA size standards containing a mixture of Hind IlI-digested y-DNA and Hae Ill-digested fX174 RF DNA. The arrowheads in the figures A and B indicate the highest size DNA fragment (1.4 kb) of the fX174 RF DNA. The bands that follow (downwards) are of 1.1 kb, 0.9 kb, 0.6 kb, 0.31 kb, 0.28 kb, 0.27 kb, 0.23 kb, 0.19 kb, 0.12 kb and 0.07 kb in size, respectively.; Lane 1: Primer pairs F5/B5; lane 2: Primer pairs F6/B6; lane 3: Primer pairs F7/B6;

lane 4: Primer pairs F8/B8; lane 5: Primer pairs F5/B8.

290


shows that testis expresses this gene about 20-25-fold less than the brain tJLssue (see Gerard et al., 1991). Low level amplification of DNA fragments (Fig. 5Bb) with the cDNA generated from testis RNA may be reflecting low level of CB1 transcripts in this tissue (Gerard et al., 1991). These data indicate that there is no apparent CBI gene rearrangement in testis and there are no size variants of this gene in rat brain and testis. Such variations are known for D2 dopamine receptor transcripts which arise from alternate splicing (O'Dowd, 1993). If there is any testis-specific subtype of the cannabinoid receptor, it is likely to be coded by a largely dissimilar gene. CB2 is a good candidate for a cannabinoid receptor subtype in testis (Bouaboula et al., 1993). Primer pairs specific for human CB2 eDNA (Table 3) failed to amplify specific DNA molecules from rat testis DNA or RNA templates under conditions when human DNA or RNA yielded positive: results (see below). Whether rat CB2 gene is different from that of humans is yet to be determined.

Similar experiments were performed with DNA and RNA isolated from brains of three different strains of mice, namely C57BL/6, DBA/2 or ICR. These mouse strains show marked differences in cannabinoid-induced neurobehavioral patterns (On- aivi et al., 1996). We have investigated whether the mouse CB 1 gene is also intronless, whether the mouse strains differ from each other in the cannabinoid gene (CB 1) structure or whether there are any size variants in the CBI transcripts in their brains. The DNA PCR data shows that the CB1 gene in the three strains of mice appears to be identical and intronless. The additional DNA bands of higher molecular sizes, amplified from the brain DNAs with the primer pair F4/B4 (Table 3), are probably due to mispriming because Southern hybridization with human CB1 eDNA probe did not recognize those bands. Interestingly, the reverse PCR data with F3/B3 primer pair (Table 3) showed marked difference among three strains of mice. The C57BL/6 mouse brain RNA appears 1:o have directed amplification of two additional DNAs (0.24 kb and 0.95 kb) along with the expected 0.52 kb DNA. The brain DNA from the C57BL/6 mouse failed to yield these additional amplified DNAs. The ICR or DBA/2 mice did not have those additional DNAs amplified from their brain DNAs or RNAs. Whether these data suggest induced RNA splicing (to generate the lower size mRNA) or reverse RNA splicing (to generate the higher size mRNA) in black mouse brain cells, or whether these additional DNAs are PCR artifacts, is yet to be determined. We have cloned these two additional DNAs. Sequence information of these DNAs and screenirLg of a C57BL/6 mouse brain eDNA library with CBI cDNA probe to get those additional cDNAs will help us to answer these questions. Like rat brain DNA, mouse brain DNA also failed to yield C132-specific amplified DNAs with CB2 eDNA-specific primers.

We also tested the CBI and CB2 gene structures in human blood cells. Rat and human CBI cDNA sequences are very similar (Matsuda et al., 1990; Gerard et al., 1991),. Using Fi/B4 primer pair, we have shown (Fig. 6A and 6B) that a 1.4 kb DNA is amplified from the human blood cell DNA. The size

of the coding region of rat CB1 eDNA is 1.44 kb. Thus, these data indicate that the human CBI gene might also be intronless, at least in its coding region. Whether the additional DNA band of about 1.2 kb (Fig. 6A), which hybridizes with human CB! eDNA probe (Fig. 6B), is indicative of a shorter version of the human CB1 gene or is a PCR artifact, is yet to be determined. Individual primer pairs of CB 1 eDNA (Table 3) yielded many amplified DNA bands along with the specific band. Other bands did not hybridize with the human CB1 cDNA probe, but the yield of the specific expected DNA band is very poor. Blood cell RNA failed to yield any amplified DNA with F1/B4 primer pair.

Primer pairs designed from the coding region of the human CB2 eDNA sequence (Table 3) amplified DNAs of expected sizes from both DNA and RNA isolated from human blood cells (Fig. 7A and 7B). Southern hybridization of the blots from these gels with the human CB2 cDNA probe, hybridizes with the amplified DNAs of expected sizes (Fig. 7A' and 7B') along with two other not-expected bands. Whether these additional bands represent CB2 subtypes in human cells or are mere PCR artifacts are yet to be determined. Identities of the amplified DNAs were also confirmed by sequencing of their 50-70 terminal nucleotides. All these observations indicate that the CB2 gene in human cells is intronless in its coding region. The CB2 gene appears to be different from that of the CB2 gene in rodents (if there is one). Information about the CB2 gene of rats or mice may be important for the study of the biological role of this receptor, because most neurobehavioral models are developed in these rodents.

To further verify the intronlessness of the human CB1 and CB2 genes, we screened human genomic library. Five independent clones for CB1 gene and 2 independent clones for CB2 gene were isolated after screening of 300,000 plaques of the lambda EMBL-3 library. All of those clones contained full length copy of the respective gene as was revealed by restriction mapping, PCR and probing with 5'- or 3'-segments of the corresponding cDNAs.

Although many of the GPCRs are found to be intronless (O'Dowd, 1993), there are exceptions, such as some of the dopamine receptors (O'Dowd, 1993). In common with many of the genes encoding members of the GPCRs, the genes encoding the dopgmine, DA1 and DA5 receptors lack introns in their coding regions (O'Dowd, 1993). But the dopamine DAI receptor gene is reported (see O'Dowd, 1993) to have an intron at the 5" non-coding region. The dopamine, DA2, DA3 and DA4 receptor genes which have large introns, are distinguishable from many members of the GPCR family, where the entire protein is encoded by just one exon (O'Dowd, 1993). It is interesting to find that both of the subtypes of the cannabinoid receptors may be coded by single-exon genes. There is of course the possibility of these genes having intron(s) at the upstream or downstream non-coding regions. We did not test that possibility but Shire et al., recently discovered the presence of two introns in the CB1 gene, one in the 5'-UTR and the second in the coding region of the receptor. The advantages or disadvantages of being


intronless are subject to speculation (Lambowitz and Belfort, 1993). One obvious advantage is that the expression of these genes have one major RNA processing event to skip, thus making the conditions of their expression relatively quick and simple. This advantage may have implications related to the biological functions of these receptor proteins. The issue may be complex than it seems at the moment. The recent discovery of the presence of two introns in the CB1 gene (Shire et al., 1995), confirms some of our observations and those of Pettit et al. (1994), that the variants of the CBI may not be degradation products but may be translation products of probable other CB genes as was the case with the alternatively spliced isoform, CB1A. Therefore alternative splicing of the precursor mRNA is a possible mechanism for the generation of the different subtypes of the cannabinoid receptor if coded by multiple-exon genes as is known for other receptors (Green, 1991; Maniatis, 1991; Rio, 1992).

5.2. Helix Net of Cannabinoid CB1 Receptor Protein

Bramblett et al. (1995) have constructed the 3D model of CB1 receptor protein using the human and rat sequences and determined the helix ends and helix orientation, to obtain a tentative helix bundle arrangement. They used the primary amino acid sequence of the human and rat CBI receptor to construct the three dimensional structure of the CB 1 receptor in these species. After we cloned and sequenced the mouse CB 1 receptor gene (Chakrabarti et al., 1995), the lengths and orientations of the transmembrane helices of the mouse CB 1 were determined

by Bramblett and Reggio (unpublished data) to build the 3D model of the receptor shown in Fig. 3.

Briefly, Bramblett et al. (1995) used the proposed transmembrane helix bundle arrangement they obtained for the human and rat CBI receptor as a template for the construction of the mouse CBI receptor. Along with the sequence alignment, Fourier transform was used with nPRIFT hydrophobicity scale and variability calculations to determine the or-helical periodicity in the amino acid sequence of the human and rat CB1 receptors. Like in the rat and human, helices 1 and 4 in the mouse CB1 are lipid exposed, unlike helix 3 which has small lipid exposed face. However, helices 2 and 7 were found to have slightly greater lipid exposure than helix 3. Overall, the three mammalian cannabinoid, CBI currently cloned and sequenced share many of the highly conserved residues of the GPCRs with some striking differences. For example, there is no Cys at the top of helix 3 and no Pro in helix 5. Therefore, the transmembrane helix bundle arrangement obtained for the CB 1 receptors is consistent with that obtained for other GPCRs.

5.3. Protein Sequence Analysis of Cannabinoid Receptors

The recently cloned cannabinoid receptors, CBI, CBIA and CB2 appear to be members of the superfamily of receptors that mediate their intracellular actions by a pathway that involves activation of one or more guanine nucleotide-binding regulatory proteins, which responds to cannabinoids including the putative endogenous ligand, anandamide. We have analyzed and compared the amino acids and protein sequences, properties and structures of the

Table 4. Comparison of the Composition of N-Terminal 28 Amino Acids Between Human CB1, CBIA and CB2

CBl(N-ter 28 aa) CBIA(N-ter 28 aa) CB2(N-ter 28 aa)

Amino acids No. % No. % No. %

Non-polar: Ala 1 3.6 3 10.7 1 3.6 Val 1 3.6 0 0.0 1 3.6 Leu 4 14.3 2 7.1 2 7.1 lie 3 10.7 1 3.6 2 7.1 Pro 0 0.0 4 14.3 1 3.6 Met 1 3.6 2 7.1 3 10.7 Phe 1 3.6 1 3.6 0 0.0 Trp 0 0.0 I 3.6 1 3.6

Total non-polar 11 39.4 14 50.0 11 39.3

Polar: Gly 2 7.1 ~ 0 0.0 2 7.1 Ser 2 7.1 5 17.9 2 7.1 Thr 5 17.9 5 17.9 1 3.6 Cys 0 0.0 I 3.6 I 3.6 Tyr 1 3.6 0 0.0 1 3.6 Asn 1 3.6 0 0.0 2 7.1 Gin 0 0.0 2 7.1 0 0.0

Total Polar 11 39.3 13 46.5 9 32.1

Acidic: Asp 4 14.3 0 0.0 3 10.7 Glu 0 0.0 0 0.0 3 10.7

Total acidic 4 14.3 0 0.0 6 21.4

Basic: Lys 1 3.5 1 3.5 2 7.2 Agr 1 3.5 0 0.0 0 0.0 His 0 0.0 0 0.0 0 0.0

Total basic 2 8.0 1 3.5 2 7.0


Table 5. Comparison of the Composition of N-Terminal 28 Amino Acids Between Human, Rat and Mouse CBI

Human CBl(N-ter 28 aa) Rat CBl(N-ter 28 aa) Mouse CBl(N-ter 28 aa)


Non-polar: Ala 1 3.6 1 3.6 0 0.0 Val 1 3.6 1 3.6 1 3.6 Leu 4 14.3 4 14.3 4 14.3 lie 3 10.7 3 10.7 3 10.7 Pro 0 0.0 0 0.0 0 0.0 Met 1 3.6 1 3.6 1 3.6 Phe 1 3.6 1 3.6 1 3.6 Trp 0.0 0 0.0 0 0.0

Total non-polar 11 39.4 11 39.4 10 35.8

Polar: Gly 2 7.1 2 7.1 3 10.7 Ser 2 7.1 2 7.1 2 7.1 Thr 5 17.9 5 17.9 5 17.9 Cys 0 0.0 0 0.0 0 0.0 Tyr 1 3.6 1 3.6 1 3.6 Asn 1 3.6 1 3.6 1 3.6 Gin 0.0 0 0.0 0 0.0

Total polar 11 39.3 11 39.3 12 42.9

Acidic: Asp 4 14.3 4 14.3 4 14.3 Glu 0 0.0 0 0.0 0 0.0

Total acidic 4 14.3 4 14.3 4 14.3

Basic: Lys 1 3.5 1 3.5 1 3.5 Arg 1 3.5 1 3.5 1 3.5 His 0 0.0 0 0.0 0 0.0

Total basic 2 7.0 2 7.0 2 7.0

human CB1, CB1A and CB2 and the rat and mouse CBI cannabinoid receptors.

5.3.1. Amino Acid Composition and Protein Sequence Analysis of the .Mammalian CB1, CBla and

CB2 Receptors

The compostion a:ad protein sequence analysis were determined using the MacVector sequence analysis software (IBI, 1994). There is considerable structural homology and distribution in the CNS between CB1 and CB1A with substantial amino acid conservation and significant divergence with the CB2 cannabinoid receptor. Like other GPCRs, the ftprimary structures of the cannabinoid receptor is characterized by the seven hydrophobic stretches of 20-25 amino acids, predicted to form tr~.nsmembrane ct helices, connected by alternating extracellular and intracellular loops (Fig. 3). We have c ampared the composition of the N-terminal 28 ami:ao acids between human CB1, CB1A and CB2 (Table 4) and also between human, rat and mouse CBI (Table 5). The human and rat N-terminal 28 amino acids in the CBI receptors were similar in the total number of non-polar, polar, acidic and basic amino acids. The mouse CB 1 N-terminal 28 amino acids differed from the rat and human CB1 in number and composition of the total non-polar and polar amino acids. There was however significant differences in the total non-polar, polar, acidic and basic amino acid composition of the N-terminal 28 amino acids between the human CBI, CB1A and CB2 receptors (Table 4).

We have also estimated the molecular weights of human, rat and mouse CBI receptor to be similar

(Table 7). The amino acid composition of the human, rat and mouse CB1 however shows strong conservation as depicted in the similarities in Table 6. In contrast the human CBI, CB1A and CB2 receptors differ in molecular weights and amino acid composition (Table 7).

5.3.2. Kyte-Doolittle Hydrophilicity Plot for Human CBI, CBIa, CB2 and Rat And Mouse CB1

Cannabinoid Receptors

A number of amino acid hydropathy scales have been developed for hydrophilicity profiles and the Kyte-Doolittle scale is the most commonly used hydropathy scale. The hydrophilicity plot and analysis were performed using the MacVector sequence analysis software (IBI, 1994). The MacVec- tor program uses each of 20 amino acids at a time and is assigned a hydropathy value based on standard empirical measure in the algorithm. We have used a standard window of size 2 and 7 (Figs 8 and 9) to run along the length of the cannabinoid receptor protein. The values have been plotted on the graph at the center of each window. Values above the axis denote hydrophilic regions which may be exposed on the outside of the molecule; values below the axis indicate hydrophobic regions which tend to be buried inside the membrane.

The Kyte-Doolittle hydrophilicity plot was utilized to identify the transmembrane regions and the hydrophobicity analysis. It was apparent that the mammalian CBI receptors have the seven transmembrane regions like the GPCRs. The Kyte-Doolittle hydrophilicity plot for the human, rat and mouse


CB1 (Fig. 8) and the hydrophilicity analysis for human CB1, CB1A and CB2 cannabinoid receptors (Fig. 9). Although the Kyte-Doolittle hydrophobicity analysis has been used in the past to identify the transmembrane regions of GPCRs, the plots do not provide enough detail to determine the helix length with a high degree of accuracy (Bramblett et al., 1995). Therefore, Bramblett et al., utilized a convergence of approach to determine the lengths and orientation of the transmembrane helices of the CB1 receptor for the human and rat, Bramblett et al., 1995 and recently in the mouse (unpublished data) (Fig. 3).

5.3.4. Potential N-Glycosylation and Protein Kinase Sites in the Human CBI, CBla, CB2 and CBI o f

the Rat and Mouse

We have identified several potential sites for N-glycosylation (NXS/T) Rademacher et al. (1988), and for the action of protein kinase C (R /KS/TXR/ K) (Nishizuka, 1986), cAMP-dependent protein kinase ( K R X X S / T . R R X S / T (Taylor, 1989)) and Ca-calmodulin-dependent protein kinase II (RXXS/ TI/L/V/F/Y/W (Edelman et al., 1987)) in the derived amino acid sequence of the cannabinoid receptor proteins.

5.3.3. Kyte-Doolittle Hydrophilicity Plot for N-Terminal 28 Amino Acids o f Human CB1,

CBla, CB2 and Rat qnd Mouse CB1 Cannabinoid Receptors

The hydrophilicity plot for the N-terminal 28 amino acids of human CBI, CB1A, CB2 and rat and mouse CB1 cannabinoid receptors was determined using the MacVector sequence analysis software (IBI, 1994). As shown in Fig. 10 there was little or no variation in the Kyte-Doolittle hydrophilicity plot for the N-terminal 28 amino acids of the human, rat and mouse CB1 receptors in agreement with the amino acid analysis. There is however, differences in the Kyte-Doolittle hydrophilicity plot for the N-terminal 28 amino acids for the human CB1, CB1A and CB2 receptors as shown in Fig. 11. The profile graphs the hydrophilicity of the cannabinoid receptor protein along the amino acid sequence.

5.3.4.1. N-glycosylation sites

Most, but not all, GPCRs are glycoproteins. Consensus sites for N-glycosylation are mainly concentrated at the N-terminus of the protein. There are three potential N-glycosylation sites highly conserved in the CB1 proteins of human, rat and mouse (Fig. 12). Rodent CBI protein has an additional potential N-glycosylation site at the C-terminal segment which is absent in the human CB1 protein, as shown in (Fig. 12). One potential N-glycosylation site is present in human and rat CB 1 protein but that site is missing in mouse CB1 Fig. 12. Whether all of these potential N-glycosylation sites are naturally glycosylated in CB 1 proteins or whether these N-glycosylation are essential for the receptor function of the protein and whether additional N-glycosylation in the CB1 of different mammalian species imparts differential activity of this protein

Table 6. Amino acid comparison between human, rat and mouse CB1

Human(472 aa) Rat(473 aa) Mouse(473 aa)


Non-polar Ala 34 7.2 33 7.0 32 6.8 Val 38 8.0 36 7.6 36 7.6 Leu 53 11.2 54 11.4 54 I 1.4 lie 38 8.0 37 7.9 37 7.8 Pro 16 3.4 17 3.6 17 3.6 Met 16 3.4 18 3.8 18 3.8 Phe 28 5.9 28 5.9 28 5.9 Trp 5 1.1 5 1.1 5 1.1

Total non-polar 228 48.2 228 48.3 227 48.0

Polar: Gly 21 4.4 22 4.6 23 4.9 Ser 40 8.5 41 8.7 40 8.4 Thr 29 6.1 32 6.8 31 6.5 Cys 13 2.8 13 2.7 13 2.7 Tyr 14 3.0 14 3.0 14 3.0 Asn 17 3.6 17 3.6 17 3.6 Gin 14 3.0 12 2.5 12 2.5

Total Polar 148 31.4 151 31.9 150 31.6

Acidic: Asp 24 5.1 24 5.1 25 53 Glu 15 3.2 14 3.0 13 2.7

Total Acidic 39 8.3 38 8.1 38 8.9

Basic: Lys 24 5.1 25 5.3 25 5.3 Arg 20 4.2 19 4.0 21 4.4 His 13 2.8 12 2.5 12 2.5

Total Basic 57 12.1 56 11.8 58 12.2

Estimated pI 9.0 9.1 9.2 Calc. Molecular Weight 52854.1 52841.1 52937.3

Cannabinoid Receptor Genes

Table 7. Amino Acid Composition Comparison Between Human CBI, CBIA and CB2

295

CB1(472 aa) CBIA(411 aa) CB2(360 aa)


Non-polar Ala 34 7.2 33 8.0 31 8.6 Val 38 8.0 35 8.5 28 7.8 Leu 53 11.2 47 11.4 57 15.8 Ile 38 8.0 34 8.3 16 4.4 Pro 16 3.4 15 3.6 16 4.4 Met 16 3.4 15 3.6 11 3.1 Phe 28 5.95.9 22 5.3 15 4.2 Trp 5 1.11.0 6 1.5 8 2.2

Total non-polar 228 48.2 207 50.4 182 50.6

Polar: Gly 21 4.4 15 3.6 22 4.96.1 Ser 40 8.5 37 9.0 34 9.4 Thr 29 6.1 26 6.3 17 4.7 Cys 13 2.8 14 3.4 13 3.6 Tyr 14 3.0 10 2.4 11 3. I Asn 17 3.6 13 3.2 7 1.9 Gin 14 3.0 11 2.7 6 1.7

Total Polar 148 31.4 126 30.6 110 30.5

Acidic: Asp 24 5.1 16 3.9 15 4.2 Glu 15 3.2 12 2.9 11 3.0

Total Acidic 39 8.3 28 6.8 26 7.2

Basic: Lys 24 5.1 19 4.6 15 4.2 Arg 20 4.2 18 4.4 16 4.4 His 13 2.8 13 3.2 11 3.1

Total Basic 57 12.1 50 12.2 42 11.7

Estimated pI 9.0 9.5 9.2 Calc. Molecular Wei~:ht 52854.1 45870.9 39664.0

are yet to be determined. However, mutation of N-glycosylation sites in similar GPCRs, e.g., fl-adrenergic receptors and muscarinic receptors, abolishes glycosylation but has essentially no effect on receptor expression and function (Dohlman et al., 1991).

The human cannabinoid receptor subtypes CB1, CB1A and CB2, although supposed to be similar in their receptor function, appears to differ in the number and distribution of their potential N-glycosylation sites (Fig. 13). Due to the modification of the N-terminal region, CB1A has lost two potential N-glycosylation sites which are present in CB1 protein (Fig. 13). CB2 has only one potential N-glycosylation site whereas CBI has five. There is no potential N-glycosylation site at the C-terminal segement of CB2. The biological significance (if any) of these differences is yet to be determined.

5.3.4.2. Protein kinase sites

The C-terminal regions and the third intracellular loop of GPCRs are known to be rich in serine and threonine residues. In the case of rhodopsin, fl-adrenergic receptors and some muscarinic receptors, some of these residues are targets of cAMP-dependent protein kinase and other protein kinases (Strader et al., 1994). These phosphorylations are often agonist dependent and result in desensitization and uncoupling of the receptor from the G-protein. There are four clusters of potential cAMP-dependent protein kinase and Ca-calmodulin-dependent protein kinase sites in CB1 protein which are conserved in

human, rat and mouse proteins (Fig. 12). There is a single potential protein kinase C site which is also conserved in all these CBI proteins (Fig. 12). Human CBIA protein has an additional protein kinase C site at the N-terminus whereas CB2 protein has no such site (Fig. 13). The N-terminal potential cAMP is missing in CB1A but the other such clusters present in CB1 receptor protein, are conserved (Fig. 13). The CB2 protein has two such potential sites. None of the cannabinoid receptor proteins has any potential protein kinase site at the C-terminal regions. The biological significance of these potential protein phosphorylation sites in these receptor molecules is yet to be determined.

5.3.5. Chromosomal Mapping of the Cannabinoid CB1 Receptor Genes

Using genetic linkage mapping and chromosomal in situ hybridization Hoehe et al. (1991), have determined the genomic location of the human cannabinoid receptor gene. With in situ hybridization using a biotinylated cosmid probe the cannabinoid receptor gene was localized at 6q14--q15, thus confirming the linkage analysis and defining a precise alignment of the genetic and cytogentic maps (Hoehe et al., 1991). These investigators found that the location of the human cannabinoid receptor gene (CB1) is very near the gene encoding the alpha subunit of chorionic gonadotropin (CGA).

We have recently cloned and sequenced the murine cannabinoid (CBI) receptor gene (Chakrabarti et al.,


1995). In collaboration with Stubbs et al. , the murine CBI receptor gene was found to be located in proximal chromosome 4. This location is within a region to which other homologs of human 6q genes are located. In order to localize the murine CBI gene in the mouse genome, Stubbs et al . , traced the inheritance of species-specific variants of the gene in 160 progeny of an interspecific backcross, The results of the chromosomal location of the human (Hoehe et al., 1991) and the mouse (Stubbs et al . , 1995) CB1 genes adds a new marker to this region of mouse-human homology, and confirms the close linkage of cannabinoid CB1 genes in both species. The location of the rat CBI in the rat genome has not been determined, but may be expected to fit the rodent-human homology as the CB i genes are highly conserved in the mammalian species. As the neurobiological effects of marijuana and other cannabinoids suggests the involvent of the cannabinoid receptor genes in mental and neurological

disturbances, the mapping of the genes will undoubtedly enhance our understanding of the linkage and possible cannabinoid genetic abnormali- ties.

6. NEUROBEHAVIORAL EFFECTS OF CANNABINOIDS

Ag-THC, the major psychoactive constituent in marijuana, exerts a myriad of central effects in laboratory animals and man. In man, the behavioral syndrome has been studied extensively and known to include euphoria, excitement, dissociation of ideas, delusion, illusions, hallucinations and depression (Hollister, 1986; Dewey, 1986). There are reports to indicate that marijuana or A9-THC may be involved in other effects including analgesia, anti-inflammation, immunosuppression, anticonvulsion, allevia- tion of intraocular pressure in glaucoma and attenuation of vomiting (Munro et al . , 1993 and

A. Kyte-Doolittle hydrophilicity plot for human CB1.

H y d r o p h i l i c i t y W indow Size - 7 Scale - K y t e - D o o l i t t l e 5 . 0 0 , 4 . 0 0 -

• ,., 3 . 0 0 - "~ Z . 0 0 - ;= 1.00-

0.00-

-1.00 - , g - 2 . 0 0 - :z:: - 3 . 0 0 -

- 4 . 0 0 - - 5 . 0 0 l , i , i i , , i

5 0 1 0 0 1 5 0 Z 0 O Z 5 0 3 0 0 3 5 0 4 0 0 4 5 0

B. Kyte-Doolittle hydrophilicity plot for rat CB1.

H y d r o p h i l i c i t y Window Size - 7 5 . 0 0

S c a l e = K y t e - D o o l i t t l e

4 . 0 0 - • ,-, 3 . 0 0 - "~ 2 . 0 0 - ~" 1 . 0 0 -

0 . 0 0 - - 1 . 0 0 -

, g - z . 0 0 - -I- - 3 . 0 0 -

- 4 . 0 0 -5.00

. . . . . . . . . ~ .......... ! ........... t ............. i ............ i ................ ~ .................. ~ ............... t . . . . . . . . . ~ .....

~ ~ ~ ! : . . . . . . . . . . . i ...................................... : .................. ............................. : . . . . 1 .............. i ....

I i~ " ii ........ IT .............. It ........... ~ i . . . . . . . . ~ . . . . . . . . . . . . IL . . . . . . . . . . . . Ii ...... 5 0 1 0 O 1 5 0 ZOO 2 5 0 3 0 0 3 5 0 4 0 0 4 5 0

C. Kyte-Doolittle hydrophilicity plot for mouse CB1

H y d r o p h i l i c i t y W indow Size ,, 7 Scale = K y t e - D o o l i t t l e 5 . O 0 - I , , , , 1 4 . R - t . . . . " ~ . . . . . . ! i I 3 . 0 0 . . . . . . ~ ~ : ;

' ~ 2 . 0 0 : . . . . . :

} , r l • r , II ' l g v" "1 :l:g::t v " , v I - 5 . 0 0 v v i v i i I J

5 0 1 0 0 1 5 0 Z 0 0 Z S e 3 0 0 3 5 0 4 0 0 4 5 0

Fig. 8. Kyte-Doolittle hydrophilicity plot for the human (A), rat (B) and mouse (C) cannabinoid CBI receptors obtained using the MacVector sequence analysis software.


A. Kyte-Doolittle hydrophilicity plot for human CB1

Hydroph i l i c i ty W i n d o w Size = 7 Scale = K y t e - D o o l i t t l e

4.00

i 3.00 "" Z .00

1.00 0.00

-1.00 -Z.00 -3.00 -4.00 -5.00 u I u I I I I I I

50 100 150 200 250 300 350 400 450

B. Kyte-Doolittle hydrophilicity plot for human CB1A

Hydroph i l i c i ty W i n d o w Size = 7 Scale = K y t e - D o o l i t t l e 5,00 , . 007 . . . . . . . . . . . . I

"- 2.00 - . . . . . .

-5.00 I i i I i I I I 50 100 150 200 250 300 350 400

C. Kyte-Doolittle hydrophilicity plot for human CB2

H y d r o p h i l i c i t y W indow Size = 7 Scale = K y t e - D o o l i t t l e 5 . 0 e , .00q 1

i 3.00 4 1.00 _ ,l .. l ,.i .l ) - _l

-1.ood' ~ ~lvlr' n R F • I I" l w I - z . 0 0 - t I v ' I ' H . v - .~ ~ ~ r I -3 .ood " ' v • I

-5.00 u u n u u n u 50 100 150 200 250 300 350

Fig. 9. Kyte-Doolittle hydrophilicity plot for the human CBI (A), CB1A (B) and CB2 (C) cannabinoid receptors obtained using the MacVector sequence analysis software.

references therein). The clinical usefulness of marijuana and other cannabinoids has been limited by their psycho activity. However, the cloning of a cannabinoid receptor that is not expressed in the brain (Munro et ai'., 1993) may usher in a new era in the development of novel therapeutic cannabinoids that may be devoid of psychotomimetic effects. Cannabinoids have also been shown to produce a number of pharmacological effects in a wide variety of laboratory ani~aals. The range of the behavioral syndrome in the animals are dose dependent and a combination of antinociception, hypoaetivity, catalepsy, anxiogenesis and hypothermia are induced in mice. These observations are in agreement with the behavioral effects of Ag-THC reported by others (Abood and Martin, 1992). The mechanism(s) by which cannabinoids produce this multiplicity of behavioral effects and alter the activity of most biochemical systems are not completely understood (Abood and Martin, 1992; Hollister, 1986; Dewey,

1986). What is becoming clear is that at least some of the effects are mediated through specific receptors. Traditionally however, the notion that cannabinoids produce some of their effects by non-specific membrane perturbations cannot be ruled out. That notion had been due to the high partition coefficients and high lipophilicity of cannabinoids (Roth and Williams, 1979). For many years, Burstein and coworkers have expounded the role of arachidonic acid metabolites in the actions of cannabinoids (Burstein and Hunter, 1984a, 1984b). It is noteworthy that the recently cloned peripheral receptor has close association with macrophages and anandamide had some ability to displace radioligands from this receptor (Munro et al., 1993). Taken together, our present knowledge suggests that some cannabinoid behavioral effects (Lawrence and Gill, 1975), catalepsy (Moss et al., 1981), anxiety (Onaivi et al., 1990), hypothermia (Davies and Graham, 1980) and analgesia (Razdan and Howes, 1983; Fairbain and


Pickens, 1979) may be mediated through its own endogenous ligands e.g. anandamide, or other neurotransmitter systems and/or alterations in arachidonic acid metabolism.

Different subjective effects are known to occur in individuals who have smoked marijuana or have received an injection of cannabis extract, and in some instances opposite effects have been reported (Smart and Adlaf, 1982; Foltin and Fischman, 1988). Although there are numerous chemical components in the plant cannabis, the role of cannabinoids in the subjective effects in humans and in animal model of anxiety has been characterized (Onaivi et al. , 1990). It has been reported that the most common subjective effect appears to be time distortion, although other effects vary from pleasant relaxation to acute anxiety, loss of contact with reality, hallucinations and panic. Many studies have described the anxiogenic reactions produced by marijuana in humans (Fishman et al . ,

1988; Meyer, 1978; Halikas et al . , 1985). Adminis- tration of Ag-THC itself has been shown to produce anxiety in humans (Zuardi et al. , 1982; Gregg e t al. , 1976; Malit e t al . , 1975). Conversely, one area of therapeutic promise is the development of agents for the treatment of anxiety and panic disorders. Interestingly, nabilone, a synthetic cannabinoid, has been shown to have anxiolytic effects in anxious volunteers (Glass e t al . , 1975; Fabre and McClendon, 1981). It may be puzzling that nabilone and Ag-THC can share some of the same behavioral properties while simultaneously exhibiting opposite anxiolytic and anxiogenic properties in humans. In an animal model we (Onaivi et al. , 1990) and others have shown that ALTHC, Ag-II-THC, 12-b-NH2-ALTHC, Ievo- nantradol and (-)-1 l-ALTHC-DMH produced anxiogenesis while cannabidiol and nabilone induced anxiolysis in the elevated plus-maze test, an effect similar to that produced by diazepam, a standard

A . Kyte-Doolittle hydrophilicity plot for N-terminal 28 amino acids of human CB1

Hydrophilicity Window Size - 2 Scale - Kvte-Doolittle

o

* r .

M K S I 10 15 2e 25

O G L A D T T F R T I T T D L L Y V G S N D I

B. Kyte-Doolittle hydrophilicity plot for N-terminal 28 amino acids of rat CB1

5 . N , HydrophilidW Window Size - 2 Scale - Kyte-Doolittle

4 . N "

3.ee - / k -

= ql.eO -

-4.1ND - - 5 . N

5 16 15 2e 25 M K S I L D G L k D T T F R T I T T D L L Y V G S N D I

C. Kyte-Doolittle hydrophilicity plot for N-terminal 28 amino acids of mouse CB1

r AA

P

: ¢ :

Hydrophilicity Window Size - Z Scale - Kyte-Doolittle

K S I t D G L G D T T F R T I T T D L L Y V G S N D I

Fig. 10. Kyte-Doolittle hydrophilicity plot for the N-terminal 28 amino acids of human (A), rat (B) and mouse (C) cannabinoid CBI receptors obtained using the MacVector sequence analysis software.


A. Kyte-Doolittle hydmphilicity pie, for N-terminal 28 amino acids of human CB1

I-lydrophilicity Window Size - 2 5 . N 4 . N

• ,-. 3.00 "~ 2 . N ;= 1.(N)

o - 1 . 1 ~ i . -g - z . ~ z -3.1~

- 4 . N -5 . ee

Scale = K y t e - D o o l i t t l e

I I I I

5 l e 15 2e 25 N K S I L D G L A D T T F R T Z T T D L L Y V G S N D I

B. Kyte-Doolittle hydrophilicity plot for N-terminal 28 amino acids of human CB1A

14ydrophilicity Window Size = 2 5 .ee

Scale = K y t e - D o o l i t t l e

4 . N 3.ee

~ z.ee " - 1 . N Zo. 0 , N

- t . m -7.ee

-,,- - 3 . N - 4 . N - 5 . N

5 10 15 20 25 M A L Q I P P S A P S P L T S C T W A Q M T F S T K T S

C. Kyte-Doolittle hydrophilicity plot for N-terminal 28 amino acids of human CB2

5 . N 4 . N

"~ 2 . N ° ~ • - 1 . N

e . e o -z.em - z . m

-,.- -3.(N) - 4 . N - 5 . N

H E E C W V T E X A N G S K D G t D S N P H K 0 y H Z L

Fig. 11. Kyte-Doolittle hydrophilicity plot for the N-terminal 28 amino acids of the human CBI (A), CB1A (B) and CB2 (C) cannabinoid receptors obtained using the MacVector sequence analysis software.

anxiolytic. These recent advancements in cannabinoid pharmacology offers us the opportunity to investigate the mechanism by which cannabinoid provoke anxiogenesis and induce anxiolysis using multidisciplinary approaches involving neurobehavioral and molecular biological techniques. The recent synthesis of pharmacological antagonists for this receptor has started to unravel the contribution of this receptor towards the mediation of Ag-THC - induced neurobehavioral changes in the animal models. Prior to the development of an antagonist a number of studies have been performed to attempt to block the effects of Ag-THC. For example the depressant effects cf Ag-THC have been blocked by amphetamine, cannabidiol and cannabinol (Lew and Richardson, 1981; Karniol et al., 1974; Karniol and Carlini, 1973; Kranz et al., 1971). In addition we

have shown that the bi-directional inverse agonist carboline-3-carboxylate or diazepam and l l-nor-A 9- THC-9-carboxylic acid were effective at blocking the effects of Ag-THC, cannabidiol and nabilone in the elevated plus maze test (Onaivi et al., 1990). We are currently determining the nature of the interaction between cannabinoids and other neurotransmitter systems and the contribution of the receptors to ALTHC-induced neurobehavioral changes by selectively ablating the expression of the CB1 receptor protein in the whole animal brain using antisense oligonucleotides. This will indicate whether there are other subtypes of the receptor which are responsible for the modulation of defined brain functions regulated by anandamide or any other endogenous ligand for these receptors that may not have been identified.


A . Potential N-glycosylation and protein kinase sites in human CB1.

so 1,oo 3so 4,oo 4so

cAMP_Kin cAMP_Kin ,Ca_Kinll

.~o zoo zso 3oo .N_Glycos

ProKinC

I cAMP_Kin cAMP_Kin Ca_Kinll

I-cAMP_Kin tcAMP_Kin I-Ca_Kinll " .cAMP_Kin

I [ I o

tN_Glycos N_Glycos

B . Potential N-glycosylation and protein kinase sites in rat CB1

so lqo ~so zqo z.~o 3qo 3~o 4~o 4~o

,ProKinC cAMP_Kin

: cAMP_KIn ! Ca_Kinll

.cAMP_Kin

• cAMP_Kin ,cAMP_Kin .cAMP_Kin .cAMP_Kin -N_Glycos

[N'~cos ,N_Glycos

C . Potential N-glycosylation and protein kinase sites in mouse CB1

so ~qo ~.~0 z,oo z~o 3qo 3~0 4,oo 4~0

ProXinC


cAMP_Kin 'cAMP_Kin

,cAMP_Kin Ca_Kinll

r N-GlycOs I cAMP_Kin N_Glycos Ca_Kinll /rN_GIVCOS I Cl_Kinll I ,N t

Fig. 12. Comparison of P0tential N-glycosylation (N-glycos) and protein kinase (ProKinC: Protein kinase C; cAMP-Kin: cAMP-dependent protein kinase; Ca-KinlI: Ca-dependent protein kinase II) sites in the human, (A), rat (B) and mouse cannabinoid CBI receptor proteins obtained using the MacVector

sequence analysis software.


A . Potential N-glycosylation and protein kinase sites in human CB1

5p 100 330 400 450

.cAMP_Kin

.cAMP_Kin ,Ca_Kinll

s,o z,oo zs, o 300 N_Glycos

.ProKinC


[cAMP_Kin J'cAMP_Kin J'Ca_Kinll " .cAMP_Kin

tN_G~cos N_Glycos

B. Potential N-slycosylation and protein kinase sites in CB1A

so 1,oo ~s,o .N_Glycos

ProKinC .cAMP_Kin .cAMP_Kin .Ca_Kinll

Z90 250 3,00 350 490

cAMP_Kin cAMP_Kin

"' Glycos

.ProKinC

C . Potential N-glycosylat ion and protein kinase sites in CB2

50 ~ ,oo ~ so 200 z so 300 3s, o

Fig. 13. Potential N-glycosylation (N-glycos) and protein kinase (ProKinC: Protein kinase C; cAMP-Kin: cAMP-dependent protein kinase; Ca-KinlI: Ca-dependent protein kinase II) sites in the human CBI (A), CBIA (B) and CB2 (C) cannabinoid receptor proteins obtained using the MacVector sequence analysis

software.

6.1. Neurobeha~ioral Specificity of Cannabinoid Receptor Gene Expression

Despite the decades of extensive investigations and recent advancements in cannabinoid research, the

identification of specific mechanisms for the actions of cannabinoids has been slow to emerge. We have consistently hypothesized that there might exist in the central nervous system a multiplicity of cannabinoid receptors. The basis for the hypothesis has been the


myraid neurobehavioral effects produced after smoking marijuana or the administration of cannabinoids to humans and animals. Recently, Onaivi et al. (1996) have studied the neurobehavioral specificity of CBI receptor gene expression and whether Ag-THC induced neurobehavioral changes are attributable to genetic differences. We also examined whether some of these neurobehavioral changes were mediated by specific brain regions in the mouse model. We found that the differential sensitivity following the administration of A9-THC to three mouse strains, C57BL/6, DBA/2 and ICR mice, indicated that some of the neurobehavioral changes may be attributable to genetic differences. The objective of the study was to determine the extent to which the cannabinoid (CB1) receptor is involved in the observed behavioral changes following Ag-THC administration. This objective was addressed by experiments using: (1) DNA-PCR and reverse PCR; (2) systemic administration of Ag-THC; (3) intracerebral microinjection of A9-THC. The site specificity of action of Ag-THC in the brain was determined using stereotaxic surgical approaches. The intracerebral microinjection of A9-THC into the nucleus accum- bens was found to induce catalepsy, while injection of A9-THC into the central nucleus of amygdala resulted in the production of an anxiogenic-like response. Although the DNA-PCR data indicated that the CBI gene appeared to be identical and intronless in all three mouse strains, the reverse PCR data showed two additional distinct CB1 mRNAs in the C57BL/6 mouse which also differed in pain sensitivity and rectal temperature changes following the administration of A9-THC. We therefore suggested that the diverse neurobehavioral alterations induced by Ag-THC may not be mediated solely by the CB1 receptors in the brain and that the CB 1 genes may not be uniform in the mouse strains.

In other studies, Mclaughlin et al. (1994) have determined the postnatal ontogeny of the cannabinoid receptor and its mRNA in whole brain using Northern analysis and radioligang binding techniques. Their results indicated that in the rat the cannabinoid receptor mRNA was present at postnatal day 3 before the appearance of the receptor protein. Whether, this pattern of ontogeny is similar in other mammalian species and with other unidentified cannabinoid receptors remains to be determined.

6.2. Medical Uses of Cannabinoids

The medicinal properties of cannabis extracts and the active cannabinoids have been used and recognized in China, Middle East and India (Reynolds, 1980; Synder, 1971; Li, 1974). These herbal extracts and preparations of cannabis have been used over time to treat a number of medical conditions including muscle spasms associated with multiple sclerosis, relief of pain and inflammation, epilepsy, menstrual cramps, to increase uterine contractions and reduce pain in child birth, glaucoma, asthma, anxiety and as a sedative, hyperthermia, hypertension, and nausea associated with cancer chemotherapy (for a review see Formukong et al. , 1989). More recently, there is

increasing attention and clinical trials on the use of cannabinoids as appetite stimulants in AIDS patients (Plasse et al., 1991; Mattes et al., 1994). Progress in modern synthetic chemistry has led to the discovery of cannabinoids that have replaced the use of crude herbal extracts. The problems encountered with the use of crude extracts include difficulty in obtaining standard dose-regimen and potency, the irregular absorption of the drug mixtures and its efficacy in the various medical indications for which the extracts were intended. These problems are further com- pounded by the inability to dissociate the desired central therapeutic effects from the marijuana high.

The recent advances in cannabinoid research, the cloning of the genes encoding the cannabinoid receptors and the identification of putative endogenous ligands, calls for a renewed interest in the development of more selective cannabinoidal medi- cations. It must be recognized however that this will have to compete with other therapeutic advances which have shown some advantage over the cannabinoid pharmacotherapeutic agents. For example, the development and use of the 5-HT3 receptor antagonist, odansetron in the treatment of nausea associated with cancer chemotherapy, or the use of fl-adrenoceptor blockers in the treatment of glaucoma. However, the cloning of CB2 receptor gene that is present in the peripheral but not detectable in the brain tissues may lead to the development of new immunosuppressants or anti- inflammatory agents (Iversen, 1993).

7. CONCLUDING REMARKS AND FUTURE DIRECTIONS

It will not be surprising if in the coming years other subtypes of cannabinoid receptors are identified in the central and peripheral nervous system. It appears that novel therapeutic agents could be developed following the rapid progress in the neurobiology of cannabinoid receptor research. As synthetic oligonucleotides represent promising tools for gene inhibition in live systems, it can be used to control expression of specific genes and they have been shown to work in vivo and in vitro (Wahlestedt et al., 1993; Crooke, 1992; Mirabelli et al., 1991; Helene and Toulme, 1990). When targeted to messenger RNAs, as is the case in our current studies, antisense oligonucleotides can inhibit expression of specific gene product producing a block in mRNA processing, transport, or translation (Kim and Wold, 1985; Melton, 1985). A similar antisense strategy was demonstrated recently (Wahlestedt et al., 1993). The elevated plus-maze test was used to study the influence of the neuropetide Y-Y 1 receptors by antisense oligodeoxynucleotides (Wahlestedt et al., 1993). Our approach is similar to the one described. We are therefore utilizing multidisciplinary approaches to study the cannabinoid receptor gene structure and expression and to determine its contribution to the diverse neurobehavioral effects that are known to occur following marijuana use. Future studies will use the gene targeting approach for precise and selective means of assessing the specific action of the cannabinoid receptor subtypes as they are cloned. In


order to assign specific receptor subtype , e.g. CB 1 any o f the mult iple effects o f cannab ino ids , a CBI receptor m u t a n t mice will have to be generated. We believe tha t the appl ica t ion o f a c o m b i n a t i o n o f m o d e r n recombina:at D N A technology will be useful in elucidat ing the mechan i sm(s ) o f act ion o f c annab ino ids which has been slow to emerge.

A c k n o w l e d g e m e n t s - - T h e authors would like to acknowl- edge two major agencies whose support partially resulted in the preparation of this manuscript and data generated: NSF-Research Center for Excellence in Cell and Molecular Biology Grant #Rl18714805 and NSF-MRCE, HRD- 9255157 and RCMI-NIH 5G12RR0303298. Dr. Onaivi acknowledges the support of Ms. Iris McDuffle and the Post-doctoral support of NIDA Grant DA 0372 while at MCV in Dr. Martins laboratory. We would also like to thank Dr. Lee Limbird for the continued support.

R E F E R E N C E S

Abadji, V., Lin, S., Taha, G., Griffin, G., Stevenson, L. A., Pertwee, R. G. and MakriyannLs, A. (1994) (R)-methanandamide: a chiral novel anandamide possessing higher potency and metabolic stability. J. Med. Chem. 37, 1889-1893.

Abood, M. E. and Martin, B. R. (1992) Neurobiology of marijuana abuse. Trends Phamatol. Sci. 13, 201-206.

Aceto, M. D., Martin, B. R., Scates, S. M. and Lowe, J. (1995) Cannabinoid precipitated withdrawal: Induction by the antagonist SRI41716A. Faseb J. 9, 3, 2320.

Bach, D., Raz, A. and ,Goldman, R. 0976) The effect of hashish compounds of phospl'tolipid phase transition. Biochim. Biophys. Acta. 436, 889-894.

Bhargava, H. N. (1978) Potential therapeutic applications of naturally occuring and synthetic cannabinoids. Gen. Pharmacol. 9, 195-213.

Bidaut-Russel, M., De~ane, W. A. and Howlett, A. C. (1990) Cannabinoid receptor:~ and modulation of cyclic AMP accumu- lation in the rat brain. J. Neurochem. 55, 21-26.

Binder, M. and Franke, 1. (1982) ls there a THC receptor? Current perspectives and approaches to the elucidation of the molecular mechanisms of action of the psychotropic constituents of Cannabis sativa L. In: Neuroreceptors, pp. 151-156. Eds. Walter de Gruyter, Berlin.

Binder, M., Edery, H. and Porath, G. (1979) Delta-7-tetrahydrocannabinol, a non-psychotropic cannabinoid: structure activity considerations in the cannabinoid series. In: Marijuana: Biological effects, pp. 71-80. Eds. G. G. Nahas and W. D. M. Paton. Pergamon Press, Oxford.

Bornheim, L. M., Kim, ]¢,. Y., Chen, B. and Correia, M. A. (1993) The effect of cannabidiol on mouse hepatic microsomal cytochrome P450-dependent anandamide metabolism. Bioehem. Biophys. Res. CommuJ~. 197, 740-746.

Bouaboula, M., Rinaldi, M., Carayon, P., Carrilon, C., Delpecb, B., Shire, D., Le Fur, G. and Casellas, P. (1993) Cannabinoid receptor expression in human L~ukocytes. Eur. J. Biochem. 214, 173-180.

Bramblett, R. D., Panu, A. M., Ballesteros, J. A. and Reggio, P. H. (1995) Construction of a 3D model of the cannabinoids CBI receptor: Determinatic,n of helix ends and helix orientation. Life Sci. 56, 1971-1982.

Bruggemann, E. P. and Melchior, D. L. (1983) Alterations in the organization of phosphatidylcholine/cholestrol bilayers by tetrahydrocannabinol. J. fi~iol, chem. 258, 8298-8303.

Burstein, S. and Hunter, S.A. (1984a) The biochemistry of the cannabinoids. Rev. Pare Appl. Pharmacol. Sci. 2, 155-226

Burstein, S, and Hunter, S. A. (1984b) The role of prostaglandins in the actions of the cannabinoids. In: The Cannabinoids: Chemical, Pharmacologic and Therapeutic Aspects, pp. 729-738 Eds. S. Agurell, W. L. Dewey and R. E. Willette, Acad. Press, Orlando.

Burstein, S. H., Audette, C. A., Charalambous, A., Doyle, S. A., Guo, Y., Hunter, S. A. and Makriyannis, A. (1991) Detection of cannabinoid receptors by photoaffinity labelling. Biochem. Biophy. Res. Comm. 176, 492-497.

Caulfield, M. P. and Brown, D. A. (1992) Cannabinoid receptor agonist inhibit Ca current in NGI08-15 neuroblastomer cells via a Pertussis toxin-sensitive mechanism. Brit. J. Pharmac. 106, 231-232.

Chakrabarti, A.. Onaivi, E. S. and Chaudhuri, G. (In press, 1995) Cloning and sequencing of a cDNA encoding the mouse brain-type cannabinoid receptor protein. DNA Sequence.

Cohen, S. and Stillman, R. C. (Eds.) (1976) The therapeutic potential of marijuana. Plenum Med. Book Co. New York.

Compton, D. R., Gold, L. H., Ward, S. J., Balster, R. L. and Martin, B. R. (1992) Aminoalkylindolen analogs: cannabinomimetic activity of a class of compounds structurally distinct from delta-9-tetrahydrocannabinol. J. Pharmacol. Exp. Ther. 263, 1118-1126.

Crawley, J. N., Corwin, R. L., Robinson, J. K., Felder, C. C., Devane, W. A. and Axelrod, J. (1993) Anandamide, an endogenous ligand of the cannabinoid receptor, induces hypermotility and hypothermia in vivo in rodents. Pharmacol. Biochem. Behav. 46, 967-972.

Crooke, S. T. (1992) Therapeutic applications of oligonucleotides. Annu. Rev Pharmacol. Toxicol. 32, 329-376.

Das, S. K., Paria, B. C., Chakraborty, I. and Dey, S. K. (1995) Cannabinoid ligand-receptor signaling in the mouse uterus. Proc. Natl. Acad. Sci. 92, 4332-4336.

Davies, J. A. and Graham, J. D. P. (1980) The mechanism of action of Ag-THC on body temperature in mice. Psychopharmacol. 69, 229-305.

Deutsch, D. G. and Chin, S. A. (1993) Enzymatic synthesis of anandamide, a cannabinoid receptor agonist. Biochem. Pharma- col. 46, 791-796.

Devane, W. A. (1994) New dawn of cannabinoid pharmacology. Trends Pharmacol. Sci. 15, 40-41.

Devane, W. A. and Axelrod, J. (1994) Enzymatic synthesis of anandamide, an endogenous ligand for the cannabinoid receptor, by brain membranes. Proc. Natl. Acad. Sci. U.S.A. 91, 6698-6701.

Devane, W.A., Breuer, A., Sheskin, T., Jarbe, T.U.C., Eisen, M.S. and Mechoulam, R. (1992a) A novel probe for the cannabinoid receptor. J. Med. Chem. 35, 2065-2069.

Devane, W.A., Hanus, L., Breuer, A., Pertwee, R.G., Stevenson, LA., Griffin, G., Gibson, D., Mandelbaum, A., Etinger, A. and Mechoulam, R. (1992b) Isolation and structure of a brain constituent that binds to the cannabinoid receptor. Science 258, 1946-1949.

Devane, W. A., Dysarz, F. A., Johnson, M. R., Melvin, L. S. and Howlett, A. C. (1988) Determination and characterization of cannabinoid receptor in rat brain. Mol. Pharmacol. 34, 605-613.

Dewey, W. L. (1986) Cannabinoid pharmacology. Phamarcol. Rev. 38, 151-178.

Di Marzo, V., Fontana, A., Cadas, H., Scinelli, S., Cimino, G., Schwartz, J. C. and Piomelli, D. (1994) Formation and inactivation of endogenous cannabinoid anandamide in central neurons. Nature 37Z, 686-691.

Edelman, A. E., Blumental, D. K. and Krebs, E. G. (1987) Protein serine/threonine kinases. Ann. Rev. Biochem

Fabre, L. F. and McClendon, D. (1981) The efficacy and safety of nabilone (a synthetic cannabinoid) in the treatment of anxiety. J. Clio. Pharmaeol. 21, 377S-382S.

Facci, L., Dal Toso, R., Romanello, S., Buriani, A., Skaper, S. D. and Leon, A. (1995) Mast cells express a peripheral cannabinoid receptor with differential sensitivity to anandamide and palmitoylethanolamide. Proc. natl. Aead. Sci. U.S.A. 92, 3376-3380.

Fairbain, J. W. and Pickens, J. T. (1979) The oral activity of AI-THC and its dependence on prostaglandin E2. Brit. J. Pharmacol. 67, 379-385.

Fan, P. (1995) Cannabinoid agonist inhibit the activation of 5-HT3 receptors in rat nodose ganglion neurons. J. NeurophysioL 73, 907-910.

Felder, C. C., Veluz, J. S., Williams, H. L., Briley, E. M. and Matsuda, L. A. (1992) Cannabinoid agonists stimulate both receptor- and non-receptor mediated signal transduction pathways in cells transfected with and expressing cannabinoid receptor clones. Molec. Pharmacol. 42, 838-845.

Fishman, S. M., Rosenbaum, J. F., Yabusaki, D. I. and Carr, D. B. (1988) Marijuana relaxed anxiety: A questionaire based pilot study of normal and psychiatric populations. Res. Commun. Substance Abuse. 9, 219-226.


Foltin, R. W. and Fischman, M. W. (1988) Effects of smoked marijuana on human social behavior in small groups. Pharmacol. Biochem. Behav. 30, 539 541.

Formukong, E. A., Evans, A. T. and Evans, F. J. (1989) The medicinal uses of cannabis and its constituents. Phytotherapy Res. 3, 219-231.

Fride, E. and Mechoutam, R. (1993) Pharmacological activity of the cannabinoid receptor agonist, anandamide, a brain constitutent. Fur. J. Pharmacol. 231, 313-314.

Fride, E., Barg, J., Levy, R., Saya, D., Heldman, E., Mechoulam, R. and Vogel, Z. (1995) Low doses of anandamides inhibit pharmacological effects of delta-9-tetrahydrocannabinol. J. Pharmacol. Exp. Ther. 272, 699-707.

Gerard, C. M., M ollereau, C., Vassart, G. and Parmentier, M. (1991) Molecular cloning of a human cannabinoid receptor which is also expressed in testis. Biochem. J. 279, 129-134.

Glass, R. M., Uhlenhuth, E. H., Hartel, F. W., Schuster, C. R. and Fischman, M. W. (1975) Single-dose study of nabilone in anxious volunteers. J. Clin. Pharmacol. 21, 383-396.

Green, M. R. (1991) Biochemical mechanisms of constitutive and regulated pre-mRNA splicing. Annu. Rev. Cell Biol. 7, 559-599.

Gregg, J. M., Small, E. W., Moore, R., Raft, D. and Tommy, T. L. (1976) Emotional response to intravenous Ag-THC during oral surgery. J. Oral Surg. 34, 301-313.

Halikas, J. A., Weller, R. A., Mouse, C. L. and Hoffman, R. A. (1985) A longitudinal study of marijuana effects. Int. J. Addict. 20, 701-71 I.

Harris, L. S., Carchman, R. A. and Martin, B. R. (1978) Evidence for the existence of specific cannabinoid binding sites. Life Sci. 22, 1131-1138.

Helene, C. and Toulme, J. J. (1990) Specifc regulation of gene expression by antisense, sense and antigene nucleic acids. Bioehim. Biophys. Acta. 1049, 99-125.

Herkenham, M.. Lynn, A. B., Johnson, M. R., Melvin, L. S., de Costa, B. R. and Rice, K. C. (1991) Characterization and localization of cannabinoid receptors in rat brain: A quantitative in vitro autoradiographic study. J. Neurosci. 11, 563-583.

Hillard, C. J. and Auchampach, J. A. (1994) In vitro activation of brain protein kinase C by the cannabinoids. Biochim. Biophys. Acta. 1220, 163-170.

Hillard, C. J., Harris, R. A. and Bloom, A. S. (1985) Effects of the cannabinoids on physical properties of brain membranes and phospholipid vesicles: Fluorescence studies. J. Pharmac. E>:p. Ther. 232, 579-588.

Hollister, L. E. (1986) Health aspects of cannabis. Pharmacol. Rev. 38, 1-20.

Howlett, A. C., Johnson, M. R., Melvin, L. S. and Milne, G. M. (1988) Nonclassical cannabinoid analgetics inhibit adenylate cyclase: development of a cannabinoid model. Molec. Pharmac. 33, 297-302.

Iversen, L. L. (1993) Medical uses of marijuana?. Nature 365, 12-13. Jansen, E. M., Haycock, D. A., Ward, S. J. and Seybold, V, S. (1992)

Distribution of cannabinoid receptors in rat brain determined with aminoalkylindoles. Brain Res. 575, 93-102.

Johnson, D. E.. Heald, S. L., Dally, R. D. and Janis, R. A. (1993) Isolation, identification and synthesis of an endogenous arachidonic amide that inhibits calcium channel antagonist 1, 4-dihydropyridine binding. Prostaglandins Leukot. Essent. Fatty Acids. 48, 429-437.

Karniol, I. G. and Carlini. E. A. (1973) Pharmacological interaction between cannabidiol and Ag-THC. Psychopharmaeol. 33, 53-70.

Karniol, 1. G., Shirakawa, 1,, Kasinski, N., Pfeferman, A. and Carlini, E. A. (1974) Cannabidiol interferes with the effects of Ag-THC in man. Eur. J. Pharmacol. 28, 172-177.

Kim, S. K. and Wold, B. J. (1985) Stable reduction in thymidine kinase activity in cells expressing high levels of antisense RNA. Cell 42, 129-138.

Kranz, J. C., Berger, H. J. and Welch, B. L. (1971) Blockade of (-)-trans-A~-THC depressant effect by cannabinol in mice. Amer. J. Pharm. 143, 149-152.

Kruszka, K. K. and Gross, K. W. (1994) The ATP- and CoA-independent synthesis of arachidonoylethanolamide. A novel mechanism underlying the synthesis of the endogenous ligand of the cannabinoid receptor. J. Biol. Chem. /.69, 14345-14348.

Kuster, J. E., Stevenson, J. 1.. Ward, S. J., D' Ambra, T. E. and Haycock, D. A. (1993) Aminoalkylindole binding in rat

cerebellum: selective displacement by natural and synthetic cannabinoids. J. Pharmacol Exp. Ther. 264, 1352-1363.

Lambowitz, A. M. and Belfort, M. (1993) Introns as mobile genetic elements. Annu. Ret,. Biochem. 62, 587-622.

Lawrence, D. K. and Gill, E. W. (1975) The effects of A~-THC and other cannabinoids on spin labeled liposomes and their relationship to mechanism of general anesthesia. Mol. Pharmcol. 11, 595~02.

Lemberger, L. (1980) Potential therapeutic usefulness of marijuana. Annu. Rev. Pharmacol. Toxicol. 20, 151-157.

Leuschner, J. T. A., Wing, D. R., Harvey, D. J., Brent, G. A., Dempsey, C. E., Watts, A. and Paton, W. D. M. (1984) The partitioning of delta

I-tetrahydrocannabinol into erythrocyte membranes in vivo and its effect on membrane fluidity. Experientia 40, 886--888.

Lew, E. O. H. and Richardson, J. S. (1981) Neurochemical and behavioral correlates of the interaction between amphetamine and Ag-THC in the rat. Drug Alcohol Depend. 8, 93-101.

Li, H. C. (1974) An archeological and historical account of cannabis in China. Econ. Bot. 28, 437-448.

Mackie, K. and Hille, B. (1992) Cannabinoids inhibit N-type calcium channels in neuroblastoma-glioma cells, Proc. nam. Acad. Sci. 89, 3825-3829.

Mackie, K., Devane, W. A. and Hille, B. (1993) Anandamide, an endogenous cannabinoid, inhibits calcium currents as a partial agonist in N 18 neuroblastoma cells. Mol. Pharmacol. 44, 498-503.

MacVector sequence analysis software (1994) Users manual, Scientific imaging systems, Rochester, New York.

Makriyannis, A., Banijamali, A., Jarrell, H. C. and Yang, D.-P. (1989) The orientation of (-)-delta 9-tetrahydrocannabinol in DPPC bilayers as determined by solid state 2H-NMR. Bichim. Biophys. Acta. 986, 141-145.

Malit, L. E., Johnstone, R. E., Bourke, D. !., Kulp, R. A., Klein, V. and Smith, T. C. (1975) Intravenous Ag-THC: effects of ventillatory control and cardiovascular dynamics. Anesthesiology 42, 666-673.

Maniatis, T. (1991) Mechanisms of alternative pre-mRNA splicing. Science 251, 33-34.

Martin, B. R, (1986) Cellular effects of cannabinoids. Pharmaeol. Rev. 38, 45-74.

Martin, B. R., Childers, S., Howlett, A., Mechoulam, R. and Pertwee, R. (1994) Cannabinoid receptors: Pharmacology, second messenger systems and endogenous ligands. NIDA Res. Mono- graph 140, 55-60.

Matsuda, L. A., Bonner, T. I. and Lolait, S. J. (1993) Localization of cannabinoid receptor mRNA in rat brain. J. Comp. Neurol. 327, 535-550.

Matsuda, L. A., Lolait, S. J., Brownstein, M. J., Young, A. C. and Bonner, T. I. (1990) Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature 346, 561-564.

Mattes, R. D., Engelman, K., Shaw, L. M. and Elsohly, M. A. (1994) Cannabinoids and appetite stimulation. Pharmaeol. Biochem. Behav. 49, 187-195.

Melton, D. A. (1985) Injected antisense RNAs specifically block messenger RNA translation in vivo. Proe. natl. Acad. Sci. USA 82, 144-148.

Meyer, R. E. (1978) Behavioral pharmacology of marijuana. In: Psychopharmacology, a generation of progress, pp. 1634-1652. Eds. M. A. Lipton, A. Dimascio, K. F. Killam. Raven press, New York.

Milne, G. M., Johnson, M. R., Wiseman, E. H. and Hutcbeon, D. E. (1981) Therapeutic progress in cannabinoid research. J. Clin. Pharmacol. 21, 34-47.

Mirabelli, C. K., Bennett, C. F., Anderson, K. and Crooke, S. T. (1991) In vitro and in vivo activities of antisense oligonucleotides. Anti-cancer drug design 6, 647-661.

Moss, D. E., MeMaster, S. B. and Rogers, J. (1981) Tetrahydrocan- nabinol potentiates reserpine-induced hypokinesia. Pharmacol. Biochem. Behav. 15, 779-783.

Munro, S., Thomas, K. L. and Abu-Shaar, M. (1993) Molecular characterization of a peripheral receptor for cannabinoids. Nature 365, 61-65.

Nye, J. S., Seltzman, H. H., Pitt, C. G. and Snyder, S. H. (1985) High affinity cannabinoid binding sites in brain membranes labeled with [3H]-5"-trimethylammonium delta-8-tetrahydrocannabinol. J. Pharmac, Exp. Ther. 234, 784-791.

O'Dowd, B. F. (1993) Structures of dopamine receptors. J. Neurochem. 60, 804--816.

C a n n a b i n o i d Receptor Genes 305

Onaivi, E. S., Chakrabarti, A., Gwebu, E. T. and Chaudhuri, G. (In press, 1996) Neurobehavioral specificity of cannabinoid receptor gene expression in mice. Behat,. Brain Res.

Onaivi, E. S., Green, M. R. and Martin, B. R. (1990) Pharmacological characterization of cannabinoids in the elevated plus maze. J. Pharmac9l. Exp. Ther. 253, 1002-1009.

Pacheco, M., Childers, S. R., Arnold, R., Casiano, F. and Ward, S. J. (1991) Aminoalkylindc,les: Actions on specific G-protein-linked receptors. J. Pharmacol. Exp. Ther. 257, 170-183.

Pertwee, R. G., Stevenson, L. A. and Griffin, G. (1993) Cross-tolerance between delta-9-tetrahydrocannabinol and the cannabinomimetic agents, CP 55, 940, WIN 55, 212-2 and anandamide. Brit. J. Pharmacol. 110, 1483-1490.

Pertwee, R.G., Fernando, S.R., Griffin, G., Abadji, V. and Makriyannis, A. (I 995a) Effect of phenylmethylsulphonyl fluoride on the potency of anandamide as an inhibitor of electrically evoked contractions in two isolated tissue preparations. Eur. J. Pharmacol. 272, 73-78.

Pertwee, R., Griffin, G., iFernando, S., Li, X. and Makriyannis, A. (1995b) AM630, a competitive cannabinoid receptor antagonist. Life Sci. 56, 1949-1955.

Pertwee, R., Griffin, G.~ Hanus, L. and Mechoulam, R. (1994) Effects of two endogenous fatty acid ethanolamides on mouse vas deferentia. Eur. J. Pharmacol. 259, 115-120.

Plasse, T. F., Gorter, R. W., Krasnow, S. H., Lane, M., Shepard, K. V. and Wadleigh, R. G. (1991) Recent clinical experience with dron~Lbinol. Pharmacol. Biochem. Behav. 40, 695-700.

Priller, J., Briley, E. M., Mansouri, J., Devane, W. A., Mackie, K. and Felder, C. C. (1995) Mead ethanolamide, a novel eicosanoid, is an agonist for the central (CBI) and peripheral (CB2) cannabinoid receptor. Molec. Pharmacol. 48, 288-292.

Rademacher, T. W., Parekh, R. B. and Dwek, R. A. (1988) Glycobiology. Ann. Rev. Biochem. 57, 785-838.

Razdan, R. J. (1986) Stucture-activity relationships in cannabinoids. Pharmacol. Rer,. 38, 75-149.

Razdan, R. K. and Howes, J. F. (1983) Drugs related to tetrahydrocannabinol. Med. Res. Rev. 3, 119-146.

Reynolds, R. (1980) On the therapeutic uses and toxic effects of cannabis sativa. Lance! 1, 637-638.

Rinaldi-Carmona, M., Barth, F., Heaulme, M., Shire, D., Calandra, B., Congy, C., Martinez, S., Maruani, J., Neliat, G., Caput, D., Ferrara, P., Soubrie, P., Breliere, J. C. and Le Fur, G. (1994) SRI41716A, a potent and selective antagonist of the brain cannabinoid receptor. FEBS lett. 350, 240-244.

Rio, D. C. (1992) RNA binding proteins, splice site selection, and alternative pre-mRNA splicing. Gene Expr. 2, I-5.

Roth, S. H. and William:~, P. J. (1979) The non-specific membrane binding properties of Ag-THC and the effects of various solubilizers. J. Pharm. Pharmacol. 31, 224-230.

Schuel, H., Goldstein, E.. Mechoulam, R., Zimmerman, A. M. and Zimmerman, S. (1994) Anandamide (arachidonylethanolamide), a brain cannabinoid receptor agonist, reduces sperm fertilizing capacity in sea urchins by inhibiting the acrosome reaction. Proc Natl. Acad. Sci. U.S.A. 91, 7678-7682.

Schwarz, H., Blanco, F. J. and Lotz, M. (1994) Anandamide, an endogenous cannabinoid receptor agonist inhibits lymphocyte proliferation and induces apoptosis. J. Neuroimmuno. 55, 107-115.

Smart, R. G. and Adlaf, E. M. (1982) Adverse reactions and seeking medical treatment among student cannabis users. Drug Alcohol Depend. 9, 201-211.

Smith, P. B., Compton, D. R., Welch, S. P., Razdan, R. K., Mechoulam, R. and Martin, B. R. (1994) The pharmacological activity of anandamide, a putative endogenous cannabinoid, in mice. J. Pharmacol. Exp. Ther. 270, 219-227.

Souilhac, J., Poncelet, M., Rinaldi-Carmona, M., Le Fur, G. and Soubrie, P. (1995) lntrastriatal injection of cannabinoid receptor agonists induced turning behavior in mice. Pharmacol. Bioehem. Behav. 51, 3-7.

Strader, C. D., Fong, T. M., Tota, M. R., Underwood, D. and Dixon, R. A. F. (1994) Structure and function of G protein-coupled receptors. Annu. Rev. Biochem. 63, 101 132.

Stubbs, L., Chittenden, L., Chakrabarti, A and Onaivi E. S. (1995) The mouse cannabinoid receptor gene is located in proximal chromosome 4. Mammalian Genome. In Press.

Synder, H. (1971) The uses of marijuana. Oxford University Press, Oxford.

Tamir, 1. and Lichtenberg, D. (1983) Correlation between the psychotropic potency of cannabinoids and their effect on the ~H-NMR spectra of model membranes. J. Pharm. Sci. 72, 458~-61.

Van der Kloot, W. (1994) Anandamide, a naturally-occurring agonist of the cannabinoid receptor, blocks adenylate cyclase at the frog neuromuscular junction. Brain Res. 649, 181-184.

Vela, G., Ruiz-Gayo, M. and Fuentes, J. A. (1995) Anandamide decreases naloxone-precipitated withdrawal signs in mice chroni- cally treated with morphine. Neuropharmacol. 34, 665~668.

Vogel, Z., Barg, J., Levy, R., Saya, D., Heldman, E. and Mechoulam, R. (1993) Anandamide, a brain endogenous compound, interacts specifically with cannabinoid receptors and inhibits adenylate cyclase. J. Neurochem. 61, 352-355.

Wahlestedt, C., Pich, E. M., Koob, G. F., Yee, F. and Heilig, M. (1993) Modulation of anxiety and neuropeptide Y-Y 1 receptors by antisense oligodeoxynucleotides. Science 259, 528-531.

Weidenfeld, J., Feldman, S. and Mechoulam, R. (1994) Effect of the brain constituent anandamide, a cannabinoid receptor agonist, on the hypothalamo-pituitary axis in the rat. Neuroendocrinol. 59, 110-112.

Welch, S. P., Dunlow, L. D., Patrick, G. S. and Razdan, R. K. (1995) Characterization of anandamide- and fluoroanandamide- induced antinociception and cross- tolerance to delta 9-THC after intrathecal administration to mice: blockade of delta 9-THC- induced antinociception. J. Pharmacol. Exp. Ther. 273, 1235- 1244.

Wiley, J., Balster, R. and Martin, B. (1995) Discriminative stimulus effects of ananadamide in rats. Eur. J. Pharmacol. 276, 49-54.

Zuardi, A. W., Shirakawa, I., Finkleford, E. and Karniol, I. G. (1982) Action of cannabinol on anxiety and otherb effects produced by Ag-THC in normal subjects. Psychopharmacology 76, 245-250.

~ Pergamon - USP · Cannabinoid issue of euphoria induced by cannabinoids does not appear to...

Documents

Transcript of ~ Pergamon - USP · Cannabinoid issue of euphoria induced by cannabinoids does not appear to...