UNC Asheville Women's Basketball Guide, 2012-13

Post on 09-Mar-2016

249 views 10 download

Tags:

description

UNC Asheville Women's Basketball Guide, 2012-13

Transcript of UNC Asheville Women's Basketball Guide, 2012-13

COAC

HING

STAF

F

SENI

ORS

JUNI

ORS

SOPH

OMOR

ES

FRES

HMEN

/// UNC ASHEVILLE BULLDOGS ///

1/// F E A R T H E D O G ///

General InformationMedia Information ..................................................................................................................2Primary Media Outlets ..........................................................................................................3

Season PreviewOutlook ................................................................................................................................. 4-6

PlayersRoster .........................................................................................................................................7Kelli Riles ................................................................................................................................ 8-9Gentry Manley ..................................................................................................................10-11Grace Blaylock ..................................................................................................................12-13Abra Sickles .......................................................................................................................14-15Blake Cokes .......................................................................................................................16-17Tacey Trammell .................................................................................................................18-19Brittany Gwyn ...................................................................................................................20-21Jeannie Buckner ................................................................................................................22-23Leah Wormack ..................................................................................................................24-25Shonese Jones ...................................................................................................................26-27Newcomers .......................................................................................................................28-29

Coaching Staff Head Coach Brenda Mock Kirkpatrick .......................................................................30-31Assistant Coach Honey Brown ...........................................................................................32Assistant Coach Janell Crayton...........................................................................................33Assistant Coach Russ Gardiner ..........................................................................................34Director of Basketball Operations .....................................................................................35

2011-12 Season2011-12 Season Stats ...........................................................................................................362011-12 Leaders .....................................................................................................................37 2011-12 Points-Rebounds-Assists ................................................................................38-392011-12 Game Highs.......................................................................................................40-412011-12 Results ......................................................................................................................42

Records Section1,000 Point Club .....................................................................................................................44All-Time Records .............................................................................................................45-46Year-By-Year Results ........................................................................................................47-531984 NAIA National Champions .......................................................................................54Sheila Ford ...............................................................................................................................55Hall Of Fame ...........................................................................................................................56All-Time Letterwinners ........................................................................................................57The Big South Conference .............................................................................................60-63The Kimmel Arena ...........................................................................................................64-65UNC Asheville ..................................................................................................................66-69Dr. Anne Ponder .....................................................................................................................70Janet R. Cone ....................................................................................................................71-72Support Staff ......................................................................................................................73-74UNC Asheville Head Coaches ............................................................................................75Rocky ........................................................................................................................................76The NCAA ..............................................................................................................................77Bulldog Athletics Association ...............................................................................................78

2011-12 Quick FactsHead Coach......................................Brenda Mock Kirkpatrick ...................................................................... (Wake Forest, 2001)Overall/years ..................................................................First Yearat Asheville ......................................................................First YearConference .....................................................................First YearAssistant Coach ....................................................Honey Brown .............................................................................(Maryville, 1994)Assistant Coach ....................................................Janell Crayton.............................................................................(Davidson, 2006)Assistant Coach ...................................................Russ GardinerDirector of Basketball Operations .............Jeniffer Brazelton

2011-12 Team Information2011-12 Record ..................................................................... 7-232011-12 Big South Record/Finish ...............................3-15/9thHome Record .......................................................................... 7-8Away Record .......................................................................... 0-14Neutral Record ....................................................................... 0-1Starters Returning/Lost ........................................................ 4/1Letterwinners Returning/Lost ............................................ 10/2

Women’s Basketball Support Staff Athletic Trainer .......................................... James Westfall, ATC Athletics Communication ..................................Matt Pellegrin

Kimmel ArenaCapacity ................................................................................. 3,200Press Box Phone ............................................... (828) 707-0302

Message To MediaThis edition of the 2012-13 UNC Asheville women’s basketball media guide has been prepared for you as you cover the Bulldogs during the season. For additional information, photographs, interviews with players and coaches, please contact Matt Pellegrin or Mike Gore in the Athletics Communication Offi ce.

CreditsDesigner:Matt PellegrinEditorMike GorePhotographers:Brett Whitsell, Blake Madden, Todd Drexler

UNC Asheville is a selective, public liberal arts institution. UNC Asheville’s Intercollegiate Athletics Program refl ects the attitudes and values underlying the University’s overall mission: academic excellence, diversity, equity, integrity, service, and accomplishment. The UNC Asheville athletics program contributes to this liberal arts culture in two ways. First, athletics programs foster a sense of community and pride by fi elding NCAA Division I teams and developing talented student-athletes who successfully represent UNC Asheville in competition and refl ect the University’s commitment to overall excellence. Accordingly, the athletics program encourages an atmosphere of respect for self and others through the development of ethical conduct, sportsmanship, leadership, and citizenship and provides equitable opportunities for all students and staff, including women, minorities and indivduals of all sexual identities. Second, the program provides an additional campus experience for capable students to grow and develop academically, personally, socially, and athletically. This experience promotes institutional commitment and pride on the part of students, faculty, staff, and alumni.

UNC ASHEVILLE MISSION STATEMENT

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

2 /// F E A R T H E D O G ///

Athletics Media Communication

Mike Gore Associate Athletics Director for

External AffairsOffi ce Phone: (828) 251-6923Cell Phone: (828) 575-6649

Email: mgore@unca.edu

Matt PellegrinDirector of Athletics Media Communication

/ Women’s Basketball ContactOffi ce Phone: (828) 251-6931Cell Phone: (828) 707-0302Email: mpellegr@unca.edu

Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com

Mailing Address:One University Heights

Justice Center, CPO #2600Asheville, N.C. 28804

COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.

Press Passes: Please contact the UNC Asheville Athletics Communication Offi ce as early as possible for press passes. Passes will be mailed if time permits.

Broadcasts: There are two phone lines at the Kimmel Arena for radio and internet broadcasts. If you would like to broadcast a game please call well in advance to see what arrangements can be made.

Photographers: Photo passes are limited to working press photo-graphers. All photo requests should be made as early as possible to the Offi ce of Athletics Communication.

Services: The UNC Asheville Offi ce of Athletics Communication will provide programs, notes and updated statistics at every home basketball game. After the contest, each media member will receive a box score of the game. Phone lines are available on press row and fax service is available upon request.

Press Row: UNC Asheville’s working facilities are located on the North side of the Kimmel Arena across from the benches. Space is limited, so please contact us early. We ask press, radio and television personnel to enter through the loading dock entrance. Only working press and game day operations personnel are allowed at the press table during games. No spouses, dates, children or friends are allowed. Your cooperation is appreciated.

Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the basketball coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Communication representative for that sport. Players will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.

Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communication Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.

Video Streaming: UNC Asheville will once again video stream all of its home basketball games live on www.bigsouthsports.com. This is a pay per view service. Archives of each broadcast will be available the day after each match. For game highlights or video of games please contact Matt Pellegrin

MEDIA INFORMATION

/// UNC ASHEVILLE BULLDOGS ///

3/// F E A R T H E D O G ///

NEWSPAPERS

Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585

Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319

The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665

The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506

WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078

TELEVISION

WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618

WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430

WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305

RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310

WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835

WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875

Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteArena (Capacity): Kimmel Arena (3,200)Chancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneAssociate Athletics Director of External Affairs: Mike GoreAthletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904

PRIMARY ATHLETICS LOGO

SECONDARY ATHLETICS LOGOS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

4 /// F E A R T H E D O G ///

A new era for the UNC Asheville women’s basketball program begins with the 2012-2013 season.

Brenda Mock Kirkpatrick, a standout player at Wake Forest and an assistant coach at successful programs such as Charlotte, Jacksonville, Georgia Tech and the University of Florida, became the program’s new head coach on May 7, 2012.

The head coaching position at Asheville is also a homecoming for Kirkpatrick. She’s a native of nearby Waynesville and enjoyed a stellar prep career at Tuscola HS as she was named Region Player of the Year for three consecutive seasons.

“I’m delighted to be at UNC Asheville,” stated Kirkpatrick. “It’s nice to be back in the mountains and so close to friends and family.”

Kirkpatrick is looking forward to the challenge of returning the Bull-dog program to the top of the Big South Conference. Asheville fi n-ished last season with a 7-23 record and 3-15 mark in the league. In the history of the Big South, only four schools have won league titles and advanced to the NCAA Tournament. The Bulldogs program ac-complished that in 2007.

“I want to return Asheville women’s basketball to the top of the Big South, while making this program something this university, our ath-letic department and the entire city of Asheville will be very proud of,” stated Kirkpatrick. “It won’t be easy, but we have a lot of things going for us at UNC Asheville that will make it a little easier.

“We have a great school and athletic department that graduate our student-athletes at a high rate and prepare them for the next step in life after their athletic careers are completed,” she added.

The Bulldogs return most of their team from last season that strug-gled with some key injuries throughout last season. Asheville has four starters and 10 letterwinners back, including center Kelli Riles, who fi nished 12th in the nation in rebounding; sophomore guard Shonese Jones who earned Big South Freshman of the Year honors; and sopho-more forward Leah Wormack, who made the Big South All-Rookie team.

“I’m really pleased with the effort of our team,” stated Kirkpatrick. “Everyone has bought into what we want to do and what we’re trying to accomplish.”The fi rst-year coach sees some potential strength in the post.

“We have some post depth and have some size,” admitted Kirkpat-rick. “We have some players up front who opponents are going to have to worry about, and that should help our perimeter game.”

A big concern for the Bulldogs in the early part of the season is inju-ries, especially in the backcourt.

“We’ve got to get healthy,” explained Kirkpatrick. “We have Grace Blaylock and Brittany Gwyn out at the start of practice, and that really hurts our perimeter presence. Hopefully, we can get both of them healthy once the season starts, and that will make a difference.”

Kirkpatrick would like to see her team play an up-tempo style this

season, but the Bulldogs must adopt an aggressive style on both of-fense and defense.

“We’re going to need to play better defense than we did last season,” said Kirkpatrick. “A big key to our defensive improvement is we need to have an aggressive tone. We need everyone to be aggressive on defense and that will get our offense going. We’ll be able to create of-fensive opportunities off that and play the way we want to play.”

Kirkpatrick is excited about her fi rst year in Asheville.

“I’m really looking forward to the season,” declared Kirkpatrick. “I’m enjoying the UNC Asheville experience, and everyone here has been a big help to our program.

“I believe we’ve hired a great coaching staff that shares the same vi-sion that I do, and all of us are working hard to make that vision come through,” added Kirkpatrick.

Grace Blaylock is one of the top three-point shooters in the Big South

GUARDS

As mentioned above, the Bulldogs need to get healthy in the back-court. Senior guard Grace Blaylock was hurt for the last half of the 2011-12 season but played through the pain. She’s been sidelined with a knee injury as practice began, but the Bulldogs are hopeful she will return once the season starts.Blaylock is one of the best three-point shooters in the Big South. She knocked down 46 last year, including a school-record seven at Win-throp. Blaylock averaged 5.1 points per game and had 50 assists plus 31 steals. She’ll also be one of the leaders of this year’s club.

2012-13: YEAR ONE OF THE BRENDA MOCK KIRKPATRICK ERA

/// UNC ASHEVILLE BULLDOGS ///

5/// F E A R T H E D O G ///

“Grace has a high basketball IQ. She understands the game, and we’re going to need her out there this year,” stated Kirkpatrick. “Grace has phenomenal range on her outside shot and is a good passer. We’re go-ing to want to put her in situations this season where she can stretch the defense with her range. She’s also very vocal on defense and holds her teammate accountable.”

Sophomore Brittany Gwyn just never could get healthy last year. She missed the fi rst six games of the season with a mouth injury. Gwyn was able to play in December and gave the Bulldogs an immediate lift with her play. She averaged 8.5 points per game and was shooting .476 (10-of-21) from beyond the arc. Gwyn injured her knee in January and missed the fi nal 13 games of the season. Asheville could only win one more game without her the rest of the year.

Shonese Jones was the Big South Freshman of the Year last season

“We’d really like to get Brittany healthy and in the lineup this season,” admitted Kirkpatrick. “She can play either guard spot and contribute on the wing. Brittany is an excellent passer along with being one of our better defenders. She’s a player her teammates will rely on to make plays.”

The Bulldogs are excited to have sophomore guard Shonese Jones returning. The former Brevard HS standout shook off a slow start to her freshman season and became Asheville’s leading scorer with a 15.6 average. She also led the team in three-pointers made (53) and steals (40). The Big South honored her as its Freshman of the Year.

“Shonese is an aggressive scorer who is a triple threat to score from the perimeter spot,” stated Kirkpatrick. “She’s embracing our defen-sive philosophy and is working hard on her defense. Shonese knows

she needs to play both ends of the fl oor. What’s great about her is that when the game is on the line, she wants the ball in her hands and wants to take the last shot of the game. We’re expecting a lot out of Shonese this season and are confi dent she’s ready to deliver.”

Sophomore Tacey Trammell gave the Bulldogs a lift at times last sea-son. She averaged 3.9 points per game and was second in assists with 61.

“Tacey is embracing her role as a fl oor leader. She’s learning that the point guard is an extension of her coach,” commented Kirkpatrick. “Tacey’s working hard to improve her ball-handling skills and being more consistent from the three-point line. She has an outstanding work ethic and is getting better with each day.”

Asheville has two freshmen competing for playing time in the back-court this year. Start with 5-8 rookie Paige Love from Wilkes Central HS in North Wilkesboro.

“Paige has already established herself as one of the hardest workers in our program,” said Kirkpatrick. “She’s one of our better guards defensively and fi ts into our aggressive style of play. We’re glad to have her on our team.”The other freshman in the backcourt is 5-11 guard Marissa Riles from Lake Norman HS in Mooresville.

“Marissa brings us some size on the perimeter,” explained Kirkpatrick. “She’ll help us rebounding and give us some depth in the backcourt.”

FORWARDS

One of Asheville’s three seniors is 5-10 forward Gentry Manley. The Asheville native is a walk-on who has steadily improved during her career and became a key inside player for the Bulldogs last season. Manley played in all 30 games and earned six starts. She averaged 5.8 points and 3.8 rebounds per game and shot .485 (64-of-132) from the fi eld.

“Gentry has a phenomenal work ethic,” commented Kirkpatrick. “She’s one of the toughest players we have on our roster. In addition, she’s a great leader who works well with her teammates. We look for Gentry to play inside at the strong forward spot. We’re confi dent that she’ll make plays inside and help us rebound.”

Sophomore Jeannie Buckner could play on the wing this season as her size (6-0) could help the Bulldogs out there.

“Jeannie is another hard worker who we hope to put in situations to be successful this year,” stated Kirkpatrick. “We think she has the ability to make three-pointers that will help spread the fl oor and help our inside game.”

Blake Cokes, a 6-1 junior, played in 19 games last season and showed some promise. However, she is another Bulldog battling a preseason injury.

“Blake is one of our strongest players,” admitted Kirkpatrick. “How-ever, she’s battling through a hip injury right now. Blake will give us some defense in the paint and provide depth to our inside game.”

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

6 /// F E A R T H E D O G ///

Gentry Manley gave the Bulldogs a real lift inside last year

Tyler Smith is a 5-11 freshman forward from St. Mary’s Ryken in Port Tobacco, Md.

“Tyler is a mobile post player who is not afraid to mix it up,” said Kirkpatrick. “She has a nice shot and some range with her shooting. We could use her to knock down some outside shots for us this year.”

Kelli Riles led the nation in rebounding early in the season

CENTER

The Bulldogs have a chance to be pretty good in the pivot spot this season with some talent returning.

Senior Kelli Riles led the nation in rebounding for much of the fi rst part of the season and set a Big South record with 28 rebounds against USC Upstate last December. She also had 24 rebounds in the opening game against Winston-Salem State. Riles fi nished the year averaging 8.3 points and 10.6 per game. She shot .506 from the fi eld (87-of-172) for the season.

“Kelli has embraced her leadership with this team and she under-stands that this is her senior season,” explained Kirkpatrick. “She is one of the most talented rebounders I’ve ever seen. Kelli also does a great job attacking the basket and drawing fouls. We need her to be more consistent this season and to be a lock-down defender.”

Sophomore Leah Wormack showed a lot of promise last season. She started in 23 straight games and was named Big South Freshman of

the Week three times. Wormack was Asheville’s third leading scorer with a 10.6 mark and second in rebounding at 5.3. She missed the fi nal six games of the year with an injury but is healthy for the upcoming campaign.

“It’s obvious that Leah is a good low-block scorer. We want her be at the free throw line more this year and be a little more consistent overall,” stated Kirkpatrick. “She’s a player who will give us great en-ergy and will be a force our opponents will be worried about. Leah’s play will open things up for our perimeter game.”

Abra Sickles, a 6-4 junior, has worked hard in the off-season, and that has paid off, according to Kirkpatrick.

“Abra is one of the most improved players we have in our program,” commented Kirkpatrick. “She’ll present match-up problems for our opponents. We need her to be a great rebounder this season and play good defense. She’s going to get an opportunity to play this year.”

Freshman Rachel McGirt comes to Asheville via Jordan HS in Dur-ham. The 6-1 rookie center will provide depth in the post.

“Rachel brings size, energy and a great work ethic,” declared Kirkpat-rick. “She’s a good teammate who is working hard on her defense and giving us a presence on the boards.”

Leah Wormack was Asheville’s third leading scorer in 2011-12

/// UNC ASHEVILLE BULLDOGS ///

7/// F E A R T H E D O G ///

No. Name Pos. Ht. Class Hometown (Previous School)

3 Marissa Riley G 5-11 Fr. Mooresville, N.C. (Lake Norman)

4 Tacey Trammell G 5-2 So. Robbinsville, N.C. (Robbinsville HS)

5 Rachel McGirt C 6-1 Fr. Durham, N.C. (Jordan)

10 Brittany Gwyn G 5-7 So. High Point, N.C. (High Point Central)

13 Kelli Riles F 6-1 RSr. Ellenwood, Ga. (Redan)

14 Tyler Smith F 5-11 Fr. Port Tobacco, Md. (St. Mary’s Ryken)

15 Jeannie Buckner F 6-0 So. Johns Island, S.C. (Humanities and Sciences Acad.)

20 Leah Wormack F 6-1 So. Cumberland, Md. (Allegany)

22 Gentry Manley G 5-10 Sr. Asheville, N.C. (Roberson HS)

23 Abra Sickles C 6-4 Jr. Harrodsburg, Ky. (Mercer County HS)

24 Grace Blaylock G 5-7 Sr. Blue Ridge , Va. (Lord Botetourt HS)

25 Blake Cokes F 6-1 Jr. Dayton, Ohio (Trotwood-Madison HS)

30 Paige Love G 5-8 Fr. North Wilkesboro, N.C. (Wilkes Central)

42 Shonese Jones G 5-2 So. Etowah, N.C. (Brevard)

Head Coach: Brenda Mock KirkpatrickAssistant Coach: Honey BrownAssistant Coach: Janell CraytonAssistant Coach: Russ Gardiner

Director of Basketball Operations: Jennifer Brazelton

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

8 /// F E A R T H E D O G ///

KELLI RILESF • 6-1 • R-SR • ELLENWOOD, GA

Overview: One of the best rebounders in the Big South and the nation as a junior...enjoyed an excellent junior season and should be one of the top inside players in the league this year... came to UNC Asheville after solid prep career at Redan HS in Stone Mountain, Ga....father is Ernest Riles, who enjoyed a solid major league baseball career from 1985-93 for Milwaukee Brewers, San Francisco Giants, Oakland A’s, Houston Astros and Boston Red Sox...red-shirted in 2008-2009 season.

2011-2012: Led Bulldogs in rebounding with 10.6 average...rebound aver-age was third-best in the conference and 12th nationally...set a Big South record with 28 rebounds vs. USC Upstate (11-30)...the 28 rebounds were the second most in school history...posted 10 double-doubles on the year...became fi rst Bulldog player in 28 years to have a double-double of more than 20 in each category when she scored 21 points and collected 24 rebounds vs. Winston-Salem State (11-12)...pumped in 17 points with 15 rebounds at George Mason (11-27)...scored 19 points and grabbed 16 rebounds in home victory vs. Brevard (12-28)...tallied 11 points with 16 rebounds during home win over Charleston Southern (1-9)...had 11 points and 11 rebounds in home win vs. Mercer (12-21)...led team in fi eld goal percentage with .506 mark...tied a school record by going 13-for-13 from the free throw line during Win-ston-Salem State win (11-12)...tallied 16 points with 10 rebounds at Radford (2-25)...led the nation in rebounding in the fi rst half of the season...collected 16 rebounds at home vs. Presbyterian College (2-11)...led team in fi eld goal percentage at .506 and 8.3 scoring average was fourth best on the team...second in the Big South in defensive rebounds with a 7.50 per game mark.

2010-2011: Finished the season as Asheville’s third leading scorer (11.1) and top rebounder (10.3)...led Bulldogs in fi eld goal shooting at 55.5 percent (116-of-209)...posted 12 double-doubles on the season...was ranked nation-ally in the fi rst part of the year in both fi eld goal percentage and rebounding...ended up second in the Big South in rebounding...pulled down at least 10 rebounds in 16 different games...scored in double fi gures 17 different times...had career-high of 22 points in two different games...tallied 22 and collected 16 rebounds in comeback win over South Carolina State (12-15)...pumped in 22 points and went 11-of-13 from the fi eld in another comeback win at

Mercer (12-22)...had 18 points and grabbed a career-high 22 rebounds in up-set win at Radford (2-5)...the 22 rebounds were the most by a Bulldog player in more than 20 years...scored 20 points and grabbed 11 rebounds in home game vs. Radford (1-3)...collected 14 rebounds in fi rst game of the year vs. Montreat (11-12)...had 19 points and 12 rebounds at Charleston Southern (1-17)...recorded 14 points and 14 rebounds vs. Brevard (11-29)...shot a solid 73.4 percent (80-of-109) from the free throw line. 2009-2010: Played in all 30 games and started the last four games of the sea-son...scored in double fi gures in six games...averaged 5.4 points per game...was second on team in rebounding with 4.9 mark...blocked 14 shots during the year...just missed double-double vs. Elon (12-21) as she scored 15 points and grabbed nine rebounds...tallied 12 points late in the season in back-to-back games vs. Gardner-Webb (2-15) and at High Point (2-20)...pumped in 11 points in three different games: at USC Upstate (11-28), vs. Western Michigan (12-29) and Charleston Southern (1-4)...grabbed nine rebounds vs. Campbell (11-24)...scored eight points with nine rebounds in home win vs. Southern Wesleyan (12-11)...made 10 straight free throws over a three-game stretch late in the season...tied career-high of nine rebounds in four different games...dished out a career-best three assists vs. Winthrop (3-5)...had three steals at Winthrop (1-30). Before UNC Asheville: Helped Redan HS advance to the Georgia state championship game as a senior...averaged 10 points, 10 rebounds, three as-sists and two blocked shots per game senior season...was named Player of the Month for the month of February as a senior...participated in the East-West Atlanta All-Star Game ...averaged 10 points and six rebounds per game as a junior...lettered in volleyball.

13

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2009-10 30-4 587/19.6 54-129 . 4 1 9 0-1 . 0 0 0 54-79 . 6 8 4 42 104 146 4.9 68 3 13 73 14 21 162 5.42010-11 28-26 777/27.8 116-209 . 5 5 5 0-0 . 0 0 0 80-109 . 7 3 4 83 205 288 10.3 65 1 10 70 5 29 312 11.12011-12 30-21 799/26.6 87-172 . 5 0 6 0-0 . 0 0 0 74-94 . 7 8 7 93 225 318 10.6 57 0 23 78 11 27 248 8.3TOTAL 88-51 2163/24.6 257-510 . 5 0 4 0-1 . 0 0 0 208-282 . 7 3 8 218 534 752 8.5 190 4 46 221 30 77 722 8.2

/// UNC ASHEVILLE BULLDOGS ///

9/// F E A R T H E D O G ///

Points: 22, South Carolina State -- 12/15/10; at Mercer -- 12/22/10Rebounds: 28, USC Upstate -- 11/30/11Assists: 3, at WINTHROP -- 01-14-12; Presbyterian College -- 02/11/12; WINTHROP -- 03-05-10Steals: 5, Coastal Carolina -- 02/21/11Blocks: 2, 4 timesFG made: 11, at Mercer -- 12/22/10FG attempts: 14, at Charleston Southern -- 1-17-11; at Radford -- 2/5/11FT made: 13, Winston-Salem State -- 11/12/11FT attempts: 13, Winston-Salem State -- 11/12/11

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

10 /// F E A R T H E D O G ///

GENTRY MANLEYG • 5-10 • SR • ASHEVILLE, N.C.

Overview: Walk-on who can play both in the backcourt and front court...transfer from Catawba Valley Community College...local product who played her high school ball at T.C. Roberson HS...has given the Bulldogs some solid minutes over the past two seasons and really became an inside scoring threat last year...went to Brazil in the summer of 2011 as a part of Sports Reach.

2011-2012: Earned six starts on the year and played in 30 games...averaged 5.8 points and 3.8 rebounds per game...shot .485 (64-of-132) from the fi eld...tallied career-high 17 points on 5-of-7 shooting from the fi eld in home win over Montreat (11-19)...also grabbed eight rebounds and went 7-of-8 from charity stripe...pumped in 11 points with seven rebounds vs. USC Upstate (11-30)...scored 16 points at South Carolina State (12-19)...registered 14 points and six rebounds at Coastal Carolina (2-6)...had nine points with six rebounds vs. Appalachian State (12-10)...blocked two shots at Kennesaw State (12-17).

2010-2011: Played in 12 games and earned one start vs. Charleston Southern (2-19)...really played well at the end of the season with a career-best nine points and fi ve rebounds at High Point (3-6)...pumped in seven points and collected career-high six rebounds in near upset at Liberty (3-4)...in Liberty game went 5-of-8 from free throw line...scored fi rst career basket and picked up two rebounds at Campbell (11-20)...grabbed fi ve rebounds in fi ve minutes of action vs. Brevard (11-29). Before UNC Asheville: Played in four games for CVCC during the 2009-10 season...graduated from Roberson in 2008 and was selected to play in Blue-White All-Star game.

22

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2010-11 12-1 106/8.8 7-17 . 4 1 2 0-0 . 0 0 0 8-13 . 6 1 5 8 12 20 1.7 12 0 2 5 0 2 22 1.82011-12 30-6 480/16.0 64-132 . 4 8 5 0-3 . 0 0 0 47-75 . 6 2 7 63 52 115 3.8 58 0 19 35 4 14 175 5.8TOTAL 42-7 586/14.0 71-149 . 4 7 7 0-3 . 0 0 0 55-88 . 6 2 5 71 64 135 3.2 70 0 21 40 4 16 197 4.7

/// UNC ASHEVILLE BULLDOGS ///

11/// F E A R T H E D O G ///

Points: 17, Montreat College -- 11/19/11Rebounds: 8, Montreat College -- 11/19/11Assists: 3, at George Mason -- 11/27/11Steals: 2, USC Upstate -- 11/30/11Blocks: 2, at Kennesaw State -- 12/17/11FG made: 5, at COASTAL -- 02/06/12; Montreat College -- 11/19/11; at South Carolina State -- 12/19/11FG attempts: 11, at Charleston Southern -- 02/04/123FG attempts: 1, at COASTAL -- 02/06/12; Presbyterian College -- 02/11/12; Campbell -- 03-02-12FT made: 7, Montreat College -- 11/19/11FT attempts: 9, at South Carolina State -- 12/19/11

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

12 /// F E A R T H E D O G ///

GRACE BLAYLOCKG • 5-7 • SR • BLUE RIDGE, VA

Overview: Hard worker who gets better and better each season...excellent three-point shooter who is an outstanding student...named to prestigious Division I-AAA Athletics Directors Association Scholar-Athlete Team for her work in the classroom and on the court in spring of 2011...was one of only 10 women’s basketball players to be honored.

2011-2012: Battled through nagging injuries to play in 30 games and earn 16 starts...set a school-record for three-pointers made in a game when she knocked down seven en route to a career-high 23 points at Winthrop (1-14)...second on team in three-pointers made with 46...scored 18 points and knocked down six treys in opening-game victory over Winston-Salem State (11-12)...tallied 13 points and scored 13 points at Western Carolina (11-16)...pumped in 12 points at Kennesaw State (12-17)...registered 11 points in home win over Charleston Southern (1-9)...grabbed career-best eight rebounds at Gardner-Webb (2-18)...collected seven rebounds at Radford (2-25)...contrib-uted four steals and pulled down six rebounds vs. Montreat (11-19)...12th in Big South Conference in three-pointers made with 1.5 per game.

2010-2011: Played in all 30 games and started 27 times, including 27 of the fi nal 28 games...averaged 7.2 points per game...second on team in three-pointers made with 59...fourth on club in assists with 42...had 70 fi eld goals on the season with 59 being treys...scored in double fi gures nine times with career-best 18 points in two different games...tallied 18 points and knocked down six 3-pointers in comeback victory at Mercer (12-22) and then had 18 points on fi ve treys at Longwood (2-8)...led team in three-point percentage at .321...went 17-of-20 from the charity stripe for 80 percent...came close to double-double at Campbell with 11 points and nine rebounds (11-20)...col-lected 3.2 rebounds per game...pumped in 12 points and knocked down four 3-pointers in home win over South Carolina State (12-15)...tallied 12 points and had three steals vs. Radford (1-3)...scored 17 points with six rebounds vs. Gardner-Webb (2-21)...fi fth in Big South Conference in three-pointers per game (2.0).

2009-2010: Played in 30 games and started 19 times...second on team in three-pointers made with 32...averaged 4.4 points per game...scored in dou-ble fi gures in three different games...top game was a career-high 15 points at Presbyterian College (1-11) where she knocked down three treys and went 6-of-7 from charity stripe...scored 13 points in win over Blue Hose (2-13) and helped spark Bulldog comeback by knocking down four treys, including three in the second half...tallied 11 points vs. 11 (12-21)...grabbed career-best nine rebounds and had four assists vs. Radford (3-1)...dished out fi ve assists vs. Lees-McRae (11-21)...scored nine points in four different games. Before UNC Asheville: Played at Lord Botetourt HS in Virginia...senior year averaged 17 points, six rebounds and three assists per game...helped lead pro-gram to 79-29 overall record and 20-9 mark as a senior...led Lord Botetourt to regular-season and tournament championship plus trip to Final Four for state championship...was named Blue Ridge District and Metro Player of the Year...fi rst team all-region and second team all-state...named Christmas Tour-nament MVP...junior year averaged 14 points, fi ve rebounds and three assists per game...played for coach Chuck Pound in high school.

24

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2009-10 30-19 578/19.3 42-145 . 2 9 0 32-118 . 2 7 1 17-25 . 6 8 0 29 42 71 2.4 50 0 37 57 2 20 133 4.42010-11 30-27 888/29.6 70-208 . 3 3 7 59-184 . 3 2 1 17-20 . 8 5 0 19 76 95 3.2 43 2 42 31 1 19 216 7.22011-12 30-16 727/24.2 49-178 . 2 7 5 46-156 . 2 9 5 8-13 . 6 1 5 25 74 99 3.3 45 0 50 39 2 31 152 5.1TOTAL 90-62 2193/24.4 161-531 . 3 0 3 137-458 . 2 9 9 42-58 . 7 2 4 73 192 265 2.9 138 2 129 127 5 70 501 5.6

/// UNC ASHEVILLE BULLDOGS ///

13/// F E A R T H E D O G ///

Points: 23, at WINTHROP -- 01-14-12Rebounds: 9, RADFORD -- 03-01-10; at Campbell -- 11/20/10Assists: 5, WINTHROP -- 02/13/12; Mars Hill -- 11-06-09; Appalachian State -- 12/10/11Steals: 4, Montreat College -- 11/19/11; at High Point -- 12-31-11Blocks: 1, 5 timesFG made: 7, at WINTHROP -- 01-14-12FG attempts: 14, at WINTHROP -- 01-14-123FG made: 7, at WINTHROP -- 01-14-123FG attempts: 14, at WINTHROP -- 01-14-12FT made: 4, High Point -- 01-08-11FT attempts: 4, High Point -- 01-08-11

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

14 /// F E A R T H E D O G ///

ABRA SICKLESC • 6-4 • JR • HARRODSBURG, KY

Overview: Will be the tallest player on the Bulldogs roster at 6-4...sopho-more post player who showed improvement as a sophomore and should play more of a role in 2012-2013...attended Mercer County HS in Harrodsburg, Ky.

2011-2012: Played in 16 games and started the opening game of the season vs. Winston-Salem State (11-12)...scored season-high four points at Presby-terian College (1-16) as she went 2-of-3 from the fi eld...also grabbed three rebounds in that contest...collected three rebounds vs. Winston-Salem State (11-12) and Radford (1-30)...scored two points in fi ve different contests.

2010-2011: Started the fi rst two games of the season and fi nal three...tal-lied season-high six points at High Point (3-6)...collected season-high six re-bounds at Liberty (3-4)...scored four points in her college debut vs. Montreat (11-12)...also had four rebounds at High Point (3-6)...blocked three shots in eight minutes of play in home victory vs. Furman (12-11)...tallied three points with two rebounds in late-season road win at Winthrop (2-28). Before UNC Asheville: Enjoyed a strong senior season at Mercer County where she averaged 11 points, eight rebounds and four blocked shots per game...earned fi rst team All-Area honors along with All-District and All-Re-gion accolades.

23

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2010-11 22-5 164/7.5 10-30 . 3 3 3 0-0 . 0 0 0 4-8 . 5 0 0 12 11 23 1.0 44 4 0 13 7 3 24 1.12011-12 16-1 84/5.3 7-14 . 5 0 0 0-0 . 0 0 0 2-6 . 3 3 3 5 9 14 0.9 19 0 3 7 0 1 16 1.0TOTAL 38-6 248/6.5 17-44 . 3 8 6 0-0 . 0 0 0 6-14 . 4 2 9 17 20 37 1.0 63 4 3 20 7 4 40 1.1

/// UNC ASHEVILLE BULLDOGS ///

15/// F E A R T H E D O G ///

Points: 6, at High Point -- 03-06-11Rebounds: 6, at Liberty -- 03-04-11Assists: 2, Winston-Salem State -- 11/12/11Steals: 1, 4 timesBlocks: 3, Furman -- 12/11/10FG made: 2, at Presbyterian College -- 01/16/12; at High Point -- 03-06-11; Montreat College -- 11/12/10FG attempts: 8, at High Point -- 03-06-11FT made: 2, at High Point -- 03-06-11FT attempts: 4, at George Mason -- 11/27/11; at WINTHROP -- 2-28-11

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

16 /// F E A R T H E D O G ///

BLAKE COKESF • 6-1 • JR • DAYTON, OH

Overview: Junior post player from Dayton, Ohio who could give Asheville’s inside game a real lift this season...very athletic and runs the fl oor quite well.

2011-2012: Played in 19 games...tallied season-high fi ve points vs. High Point (3-5)...scored four points as she went 4-of-4 from free throw line at Charles-ton Southern (2-4)...scored three points and collected two rebounds at Lib-erty (2-27)...blocked two shots at Furman (11-21).

2010-2011: Played in 16 games...top game was near double-double against Liberty (1-9) where she scored nine points and grabbed eight rebounds in 12 minutes of action...opened collegiate career vs. Montreat with fi ve points and seven rebounds (11-12)...pulled down four rebounds vs. Western Carolina (11-17)...had two steals at Charleston Southern (1-17). Before UNC Asheville: Played at Trotwood-Madison HS where she averaged 10 points and eight rebounds per game as a senior...helped lead school to conference title senior year...also played AAU ball for Cincinnati Finest.

25

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2010-11 16-0 143/8.9 8-18 . 4 4 4 0-0 . 0 0 0 8-24 . 3 3 3 15 9 24 1.5 20 0 0 16 3 5 24 1.52011-12 19-0 123/6.5 5-21 . 2 3 8 0-0 . 0 0 0 8-14 . 5 7 1 5 6 11 0.6 18 0 0 9 3 2 18 0.9TOTAL 35-0 266/7.6 13-39 . 3 3 3 0-0 . 0 0 0 16-38 . 4 2 1 20 15 35 1.0 38 0 0 25 6 7 42 1.2

/// UNC ASHEVILLE BULLDOGS ///

17/// F E A R T H E D O G ///

Points: 9, Liberty -- 01/09/11Rebounds: 8, Liberty -- 01/09/11Steals: 2, at Charleston Southern -- 1-17-11Blocks: 2, Montreat College -- 11/19/11FG made: 3, Liberty -- 01/09/11FG attempts: 6, High Point -- 03/05/12FT made: 4, at Charleston Southern -- 02/04/12FT attempts: 6, Liberty -- 01/09/11; Montreat College -- 11/12/10

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

18 /// F E A R T H E D O G ///

TACEY TRAMMELLG • 5-2 • SO • ROBBINSVILLE, N.C.

Overview: Sophomore guard who enjoyed some solid moments as a fresh-man...comes to Asheville from Robbinsville HS...played AAU basketball for the WNC Lady Royals.

2011-2012: Played in all 30 games and started 16 times...second on the team in assists with 61 and steals at 32...opened her college career in grand style vs. Winston-Salem State (11-12) with 13 points and fi ve steals...also had 13 points at Liberty (2-27) and Campbell (3-2)...pumped in 10 points at Charles-ton Southern (2-4)...season-high of seven steals came vs. Montreat (11-19)...career-best of seven assists vs. Liberty (1-28)...grabbed fi ve rebounds at Fur-man (11-21)...knocked down three 3-pointers at Liberty (2-27).

Before UNC Asheville: Four-year starter for Robbinsville and completed her career with 1,557 career points...is the school’s all-time leader in three-point-ers made with 101 and shot .432 from long distance...earned All-Conference honors for four consecutive years...was named Smoky Mountain Confer-ence Player of the Year as a sophomore, junior and senior...helped lead the Lady Knights to three straight conference championships and regular-season championships...also led Robbinsville to two sectional titles...was a starter on the WNC Lady Royals AAU State Championship team and a starter on team that placed fourth at the Junior Nationals in Washington, D.C...also lettered in cross country at Robbinsville where she was Smoky Mountain Conference Runner of the Year twice and led Lady Knights to 1-A state championship as a junior.

4

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2011-12 30-16 639/21.3 43-140 . 3 0 7 15-47 . 3 1 9 16-20 . 8 0 0 8 33 41 1.4 41 0 61 67 1 32 117 3.9TOTAL 30-16 639/21.3 43-140 . 3 0 7 15-47 . 3 1 9 16-20 . 8 0 0 8 33 41 1.4 41 0 61 67 1 32 117 3.9

/// UNC ASHEVILLE BULLDOGS ///

19/// F E A R T H E D O G ///

Points: 13, at Liberty -- 02-27-12; Campbell -- 03-02-12; Winston-Salem State -- 11/12/11Rebounds: 5, at Furman -- 11/21/11Assists: 7, Liberty -- 01/28/12Steals: 7, Montreat College -- 11/19/11Blocks: 1, Winston-Salem State -- 11/12/11FG made: 6, Campbell -- 03-02-12; Winston-Salem State -- 11/12/11FG attempts: 14, Winston-Salem State -- 11/12/113FG made: 3, at Liberty -- 02-27-12; at Charleston Southern -- 02/04/123FG attempts: 6, Winston-Salem State -- 11/12/11FT made: 3, at Western Carolina -- 11/16/11; Montreat College -- 11/19/11FT attempts: 5, Montreat College -- 11/19/11

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

20 /// F E A R T H E D O G ///

BRITTANY GWYNG • 5-7 • SO • HIGH POINT, N.C.

Overview: Sophomore guard who struggled through injuries her freshman year...showed real potential when healthy...excellent athlete and can score in a lot of different ways...comes to Asheville via North Carolina prep power High Point Central...fourth player from Central to play for the Bulldog pro-gram in the last 11 years.

2011-2012: Missed the fi rst six games of the season with a mouth injury...played for 10 games and started nine times before injuring her knee at Win-throp (1-14) and missing the rest of the season...opened her college career against Southern Conference foe Appalachian State (12-10) with 14 points, fi ve assists and three steals...tallied 18 points on 7-of-10 shooting at Ken-nesaw State (12-17)...pumped in 13 points at South Carolina State (12-19)...scored 17 points with seven rebuonds in thrilling win over Mercer (12-21)...averaged 8.5 points and 3.5 rebounds per game...grabbed seven rebounds at Campbell (1-2) and six vs. Brevard (12-28)...dished out four assists at Win-throp (1-14).

Before UNC Asheville: Averaged 12.4 points and 3.2 rebounds per game senior season at High Point Central...earned All-Conference honors...named team MVP as a senior.

10

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2011-12 10-9 290/29.0 28-77 . 3 6 4 10-21 . 4 7 6 19-27 . 7 0 4 16 19 35 3.5 17 0 25 28 3 11 85 8.5TOTAL 10-9 290/29.0 28-77 . 3 6 4 10-21 . 4 7 6 19-27 . 7 0 4 16 19 35 3.5 17 0 25 28 3 11 85 8.5

/// UNC ASHEVILLE BULLDOGS ///

21/// F E A R T H E D O G ///

Points: 18, at Kennesaw State -- 12/17/11Rebounds: 7, at Campbell -- 01/02/12; Mercer -- 12/21/11Assists: 5, Appalachian State -- 12/10/11Steals: 3, Appalachian State -- 12/10/11Blocks: 2, at WINTHROP -- 01-14-12FG made: 7, at Kennesaw State -- 12/17/11FG attempts: 11, Mercer -- 12/21/113FG made: 3, at Kennesaw State -- 12/17/11; Mercer -- 12/21/113FG attempts: 5, at Kennesaw State -- 12/17/11FT made: 8, Appalachian State -- 12/10/11FT attempts: 12, Appalachian State -- 12/10/11

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

22 /// F E A R T H E D O G ///

JEANNIE BUCKNERF • 6-0 • SO • JOHNS ISLAND, S.C.

Overview: Sophomore forward who will compete for playing time this sea-son...believed to be the fi rst home-schooled basketball player from South Carolina to ever sign Division I scholarship.

2011-2012: Played in 28 games and started four times...scored season-high seven points vs. Presbyterian College (2-11)...tallied six points at South Caro-lina State (12-19)...grabbed fi ve rebounds in thrilling home win vs. Mercer (12-21)...also had fi ve boards vs. PC (2-11) and Campbell (3-2)...dished out two assists in four different games...had two steals vs. High Point (3-5).

Before UNC Asheville: Played for Lowcountry Lady Wildcats home-school team for six years...averaged 22 points and 13 rebounds, three assists, three blocked shots and two steals per game...helped lead team to three straight South Carolina state championships and East Coast Homeschool titles...also captured the North Carolina/South Carolina state title once...also played for the Lowcountry Ballers, an AAU travel team...helped lead them to 15-Under DII National chamiopnship in 2009 and fi nished ninth in the 16-Under DI Nationals in 2010.

15

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2011-12 28-4 288/10.3 9-52 . 1 7 3 1-22 . 0 4 5 10-23 . 4 3 5 20 27 47 1.7 47 1 11 31 2 10 29 1.0TOTAL 28-4 288/10.3 9-52 . 1 7 3 1-22 . 0 4 5 10-23 . 4 3 5 20 27 47 1.7 47 1 11 31 2 10 29 1.0

/// UNC ASHEVILLE BULLDOGS ///

23/// F E A R T H E D O G ///

Points: 7, Presbyterian College -- 02/11/12Rebounds: 5, 4 timesAssists: 2, 4 timesSteals: 2, High Point -- 03/05/12Blocks: 1, at Campbell -- 01/02/12; Mercer -- 12/21/11FG made: 2, Presbyterian College -- 02/11/12FG attempts: 7, at High Point -- 12-31-113FG made: 1, Presbyterian College -- 02/11/123FG attempts: 3, at High Point -- 12-31-11FT made: 4, at South Carolina State -- 12/19/11FT attempts: 7, at South Carolina State -- 12/19/11

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

24 /// F E A R T H E D O G ///

LEAH WORMACKF • 6-1 • SO • CUMBERLAND, MD

Overview: Enjoyed an excellent rookie season with the Bulldogs and earned a spot on the Big South All-Freshman team along with teammate Shonese Jones...suffered season-ending injury toward the end of the year and missed the fi nal fi ve games...excellent low-post player who gave Bulldogs a lot of help both scoring and rebounding in her freshman season.

2011-2012: Finished the season as UNC Asheville’s third-leading scorer with a 10.6 ppg average...second on club in rebounding (5.3) and fi eld goal percent-age (.500)...led team in blocked shots with 28...named Big South Freshman of the Week three times during the year...started 23 straight games before being injured and missing the rest of the season...tallied career-high 21 points vs. USC Upstate (11-30)...was very consistent throughout the year in scoring as she tallied in double fi gures in 12 of the last 13 games she played...posted fi rst career double-double in home win over Coastal Carolina (1-7) with 17 points and 10 rebounds...tallied 10 points with career-high 11 rebounds in home victory over Gardner-Webb (1-21)...scored 17 points in near road upset of Charleston Southern (2-4)...pumped in 15 points at home vs. Pres-byterian College (2-11)...near double-double in fi rst career start vs. Montreat as she scored nine points with 10 rebounds (11-19)...named Freshman of the Week on Nov. 22, Dec. 6 and Jan. 10...scored 16 points during home game vs. Radford (1-30)...career-best of four blocked shots came at Winthrop (14)...blocked three shots in home win over Coastal Carolina (1-7) and at Presby-terian College (1-16)...had two blocks in fi ve other contests.

Before UNC Asheville: Averaged 20 points, 13 rebounds, four blocked shots and two steals per game...fi nished her career with 1,081points and became the all-time leading scorer for the girls program at Allegany... Player of the Year in her conference in 2009 and 2010 and was a fi rst team All-City hon-oree for three straight years.

20

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2011-12 24-23 623/26.0 98-196 . 5 0 0 0-0 . 0 0 0 58-81 . 7 1 6 51 77 128 5.3 76 4 14 46 28 13 254 10.6TOTAL 24-23 623/26.0 98-196 . 5 0 0 0-0 . 0 0 0 58-81 . 7 1 6 51 77 128 5.3 76 4 14 46 28 13 254 10.6

/// UNC ASHEVILLE BULLDOGS ///

25/// F E A R T H E D O G ///

Points: 21, USC Upstate -- 11/30/11Rebounds: 11, Gardner-Webb -- 01/21/12Assists: 2, at Kennesaw State -- 12/17/11; Brevard College -- 12/28/11Steals: 2, at Campbell -- 01/02/12; Gardner-Webb -- 01/21/12; at Western Carolina -- 11/16/11Blocks: 4, at WINTHROP -- 01-14-12FG made: 8, USC Upstate -- 11/30/11FG attempts: 13, Gardner-Webb -- 01/21/12; Radford -- 01/30/12; at George Mason -- 11/27/11FT made: 7, at Gardner-Webb -- 02/18/12FT attempts: 11, at Gardner-Webb -- 02/18/12

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

26 /// F E A R T H E D O G ///

SHONESE JONESG • 5-2 • SO • ETOWAH, N.C.

Overview: Sophomore Enjoyed a spectacular freshman season that culmi-nated with her being named Big South Freshman of the Year...exciting player who can score in a lot of different ways...local product from Brevard HS in Brevard.

2011-2012: Finished the year as Asheville’s leading scorer with a 15.6 average, which was ninth best in the Big South...got off to a bit of a slow start early in the season but ended up starting 27 games and also led club in three-pointers made (53) and percentage (.411)...named Big South Player of the Week on Dec. 20 and Freshman of the Week four times...earned that award on Jan. 3, 17, 31 and March 6...scored in double fi gures 24 times, including 15 of the last 16 games...tallied 30 points in two different contests, while becoming the fi rst UNC Asheville player to score 30 points in a game in 15 seasons...tallied 30 points at South Carolina State (12-19) and 30 vs. Radford (1-30)...had nine games of 20 points or more during the year...scored 20 points and tallied game-winning basket during home win over Mercer (12-21)...pumped in 27 points during home victory over Gardner-Webb (1-21)...had 25 points, all in the second half vs. High Point (3-5)...scored 26 points at Radford as she was 10-of-13 from the fi eld...went 9-of-11 from the fi eld at South Carolina State (12-19) and was perfect 4-of-4 from beyond the arc...scored 20 points at Kennesaw State (12-17)...had 22 points vs. Winthrop and was 6-of-10 from beyond the arc...registered 20 points vs. Liberty in Big South Tournament (3-9)...led team in steals with 40...had four steals vs. S.C. State (12-19) and Coastal Carolina (1-7)...grabbed at least two steals in 10 different games...dished out 59 assists...career-best of fi ve came vs. Brevard (12-28) and at Coastal Carolina (2-6)...her .411 three-point percentage led the Big South.

Before UNC Asheville: Completed her career as the school’s all-time leader in career points for both boys and girls with 2,112 points...career point total is seventh best all-time in Western North Carolina...averaged 24 points, six rebounds, three assists and three steals per game senior year at Brevard...named Hendersonville Times-News Player of the Year for three consecutive years..also earned All-Region and All-Conference honors as a senior...was Brevard’s MVP for four consecutive years.

42

Total 3-Point F-Throws Rebounds ScoringSeason gp-gs min/avg fg-fga pct fg-fga pct ft-fta pct off def tot avg pf fo ast to blk stl pts avg2011-12 30-27 888/29.6 176-431 . 4 0 8 53-129 . 4 1 1 62-87 . 7 1 3 33 67 100 3.3 66 3 59 86 2 40 467 15.6TOTAL 30-27 888/29.6 176-431 . 4 0 8 53-129 . 4 1 1 62-87 . 7 1 3 33 67 100 3.3 66 3 59 86 2 40 467 15.6

/// UNC ASHEVILLE BULLDOGS ///

27/// F E A R T H E D O G ///

Points: 30, Radford -- 01/30/12; at South Carolina State -- 12/19/11Rebounds: 11, COASTAL -- 01/07/12Assists: 5, at Liberty -- 02-27-12; at COASTAL -- 02/06/12; Brevard College -- 12/28/11Steals: 4, COASTAL -- 01/07/12; at South Carolina State -- 12/19/11Blocks: 1, at Furman -- 11/21/11; at George Mason -- 11/27/11FG made: 11, Gardner-Webb -- 01/21/12; High Point -- 03/05/12FG attempts: 22, Campbell -- 03-02-123FG made: 6, WINTHROP -- 02/13/123FG attempts: 10, WINTHROP -- 02/13/12; Campbell -- 03-02-12FT made: 9, Radford -- 01/30/12FT attempts: 12, Radford -- 01/30/12

CAREER-HIGHS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

28 /// F E A R T H E D O G ///

MARISSA RILEYG • 5-11 • FR • MOORESVILLE, N.C.

Overview: Offers 105 games of high school experience...effective scorer who should contribute from the perimeter...excellent student who plans to major in Biology and aspires to become a pediatric oncologist surgeon.

Before UNC Asheville: Helped guide Lake Norman to a 71-34 record as a four-year varsity starter...set school records for career points (1,297) and rebounds (704)...averaged 15 points and 5.5 rebounds as a senior and 14.9 points and 9.9 rebounds her junior season...named three times to the Char-lotte Observer All-Meck Conference and the Iredell All-County teams...also played soccer in high school.

3

RACHEL McGIRTC • 6-1 • FR • DURHAM, N.C.

Overview: Expected to provide depth inside and a defensive presence in the lane...sister Camille plays basketball for Hampton University...plans to major in Political Science with an eye toward a career in youth ministry, teaching or the law.

Before UNC Asheville: Contributed 10.4 points, 4.9 rebounds, 2.7 blocks per game as a senior for Jordan, which fi nished third in the Pac 6 conference and 13-13 overall...earned All-Conference honors and was chosen to the Durham Herald’s All-Area team...averaged 13 points and 10 rebounds as a junior.

5

/// UNC ASHEVILLE BULLDOGS ///

29/// F E A R T H E D O G ///

TYLER SMITHF • 5-11 • FR • PORT TOBACCO, MD

Overview: Aggressive inside player who should complement fellow Mary-land native, sophomore Leah Wormack, on the boards ...an all-around athlete who played four other sports...plans to major in Accounting.

Before UNC Asheville: Averaged 15 points, 12 rebounds and 2 assists per game as a senior while leading St. Mary’s Ryken to its fi rst winning record in the Washington Catholic Athletic Conference...selected to the All-Confer-ence and All-County teams...contributed 12 points and 9 rebounds per game as a junior while earning team MVP recognition...standout in cross country, soccer, softball and track and fi eld as well.

14

PAIGE LOVEG • 5-8 • FR • NORTH WILKESBORO, N.C.

Overview: Brings experience as the leader of a winning program...should have a role in the Bulldogs’ backcourt...plans to major in Health and Well-ness...career aspirations range from coaching basketball to becoming a physi-cian’s assistant.

Before UNC Asheville: Led Wilkes Central to a 30-2 record and a runner-up fi nish in the state 2-A tournament as a senior...honors include MVP of the East-West All-Star Game, Most Outstanding Player of the state champi-onship game, Max Preps All-State, Wilkes County Co-Player of the Year and All-District fi rst team...averaged 15 points, 4 assists and 2 steals per game...scored 12 points per game as a junior...also played four years for the vol-leyball team.

30

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

30 /// F E A R T H E D O G ///

BRENDA MOCK KIRKPATRICKHEAD COACH • FIRST SEASON • WAKE FOREST

Waynesville native and former Florida assistant coach Brenda Mock Kirkpatrick is the new head coach of the UNC Asheville wom-en’s basketball program.

Kirkpatrick joins the Bulldog program after serving as an assis-tant to Amanda Butler at the University of Florida for the past fi ve years. She has helped lead the Gator program to fi ve consecutive post-season berths, including two trips to the NCAA Tournament.

The former Tuscola HS standout succeeds Betsy Blose, who was reassigned following the Bulldogs’ 7-23 season last year.

“I am extremely excited to welcome back Brenda Mock Kirk-patrick to Western North Carolina,” declared Director of Athletics Janet Cone upon Kirkpatrick’s hire. “We believe Brenda is the perfect choice to lead the women’s basketball program at UNC Asheville.

“When we began to look at the applicants for this position, we were determined to fi nd a Champion in Athletics and a Leader in Life,” added Cone. “Brenda fi ts our vision perfectly. She has been a champion both as a player and a coach and has coached at four out-standing institutions.”

“Being entrusted with the head women’s basketball position at UNC Asheville with the combination of stellar academics and suc-cessful athletics is such an honor. I am so grateful to Chancellor Pon-der and Janet Cone for choosing me as the next leader of this pro-gram,” stated Kirkpatrick. “I am also grateful to head coach Amanda Butler and my entire Florida family for helping me prepare for the work ahead.”

“Returning to Western North Carolina after being away for 16 years is a very special moment for me,” Kirkpatrick added. “Under Janet Cone’s leadership and inspired by her energy, Asheville con-tinues to make strides in all facets of its athletics programs. I am particularly impressed by the high quality of student-athletes that call UNC Asheville home and their outstanding graduation rate. It dem-onstrates a high level of commitment from the athletic department as well as the university to prepare our student-athletes for the next step in life after their athletic careers are completed.

“The city of Asheville is one of the most beautiful and unique places on the East Coast, and I cannot wait to be a part of this com-munity,” she also said. “I look forward to working hard to return Asheville women’s basketball to the top of the Big South, while mak-ing this program something this university, our athletic department and the entire city of Asheville will be very proud of.” Before going to Florida, Kirkpatrick worked at Charlotte for two years when Butler was the head coach of the program. During their two years together in Charlotte, the 49ers compiled 40 wins, cap-tured a share of the 2006 Atlantic 10 regular-season championship and earned a pair of postseason berths. Kirkpatrick broke into the coaching ranks for the 2002-03 sea-son at Georgia Tech under then-head coach Agnus Berenato, help-ing the Yellow Jackets win 20 games and earn a bid into the NCAA Tournament for only the second time in program history. Berenato departed following that record-setting campaign for the University of Pittsburgh, while Kirkpatrick remained on staff in Atlanta for 2003-04 before heading to Jacksonville. A successful collegiate playing tenure afforded Kirkpatrick the opportunity to play professionally in France for Nantes-Reze 44 dur-ing the 2001-02 season before launching her coaching career. Kirkpatrick earned a bachelor’s of arts in history and sociology in 2000 and a master’s of arts in education in 2001 from Wake For-est University. She enjoyed an outstanding career in Winston-Salem, where the two-time captain averaged 7.2 points and 5.1 rebounds per contest during her four-year career. As a senior in 2000-01, the six-foot forward garnered honorable mention All-ACC honors after contributing 10 points and 6.2 rebounds per game. During her time as a Demon Deacon, Kirkpatrick was a fi rst-team academic all-dis-trict selection and a four-year member of the ACC Student-Athlete Honor Roll. Despite having to take a medical redshirt (ACL) for the 1996-97 season that delayed her collegiate debut, Kirkpatrick did not miss a game during her four-year career, appearing in all 111 contests and earning 57 starts.

/// UNC ASHEVILLE BULLDOGS ///

31/// F E A R T H E D O G ///

The daughter of Weaver and Brenda Kirkpatrick, she is most of-ten referred to as ‘Coach Mock’ or ‘Mock,’ which is her middle name, and also her mother’s maiden name.

A native of Waynesville, Mock graduated from Tuscola High School in 1996 as a decorated student and athlete. While maintaining a 4.2 grade-point average, she lettered in softball and volleyball in ad-dition to her stellar hoops career, where she was an honorable men-tion All-America selection by Street & Smith and USA Today in 1995 and 1996, while setting two state records for free throws: most in a game (25-of-25) and most consecutive (39), totaling 51 points in the game she hit 25 free throws. Kirkpatrick was the Asheville Citizen-Times Player of the Year for three consecutive seasons. She played for John Best at Tuscola in basketball.

What People Are Saying About Brenda Mock Kirkpatrick

“I’m so excited and proud for Brenda to have received this op-portunity, she’s earned it. For me personally, she added to my value as a head coach to have had an assistant like her. She worked very, very hard to recruit the type of student-athlete that Jeremy Foley and all of Gator Nation expects and did a fantastic job of developing those people into the type of players who compete and win at the highest level while doing so with a really high level of energy and integrity. I’m happy that her work has been noticed. UNC Asheville is getting a good one in Brenda.”

Amanda ButlerHead Coach, University of Florida

“Brenda Mock Kirkpatrick is one of the top recruiters in the Southeast! She is a tireless worker and a winner! Brenda is a bright young star in this profession and will be a great head coach.” Machelle JosephHead Coach, Georgia Tech “Intelligent, loyal, passionate, a motivator, a leader, a teacher, sin-cere, honest, team-oriented, and a tireless worker - these are just a few of the qualities the UNC Asheville community will come to know about their new women’s basketball coach, Brenda Mock Kirkpatrick. She had all those qualities, and more, as a student-athlete at Wake Forest University. Brenda is the right coach at the right time for UNC Asheville.”

Charlene CurtisBrenda’s college coach at Wake Forest and now the ACC Supervisor of Offi cials

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

32 /// F E A R T H E D O G ///

HONEY BROWNASSISTANT COACH • FIRST SEASON • MARYVILLE (TN)

UNC Asheville head coach Brenda Mock Kirkpatrick has named former Saint Louis University assistant coach Honey Brown as an as-sistant with the Bulldogs’ women’s basketball program.

“I am thrilled that Honey has decided to join the Bulldog family,” said Kirkpatrick. “She has valuable experience as an assistant coach at many different levels and a reputation as a tireless worker. People are immediately drawn to her enthusiasm and positive approach to all aspects of coaching. I have no doubt she will make an immediate impact on the culture of women’s basketball at UNC Asheville.”

During her career she has coached eight all-conference perform-ers, including one conference player of the year and one most im-proved player. She’s also coached six 1,000-point scorers.

Brown spent four seasons as an assistant with the Billikens’ pro-gram, working primarily with SLU’s point guards. She assisted with scouting opponents and all aspects of recruiting, while also serving as a liaison with the Saint Louis athletic academic coordinator.

Prior to her time with the Billikens, Brown served as director and head trainer at Performance Training, Inc., in Orlando, Fla. While there she managed all aspects of the company, including staffi ng issues, schedules and marketing.

Before her time at Performance Training, Brown spent four years as an assistant at Ohio University. Her primary focus was coaching guards for the Bobcats’ program, while also assisting with recruiting and scouting. She served as lead recruiting coordinator for one sea-son, and was in charge of the Bobcats’ summer camps.

Prior to her tenure with Ohio, Brown spent a season with Cen-tral Florida, working as an assistant coach with the UCF program. She helped guide the UCF program to the 1998-99 Atlantic Sun regular season and tournament championships, earning an NCAA Tourna-ment berth in the process.

Brown got her start in coaching as an assistant with Lenoir City High School in Lenoir, Tenn. While with LCHS she helped lead the Panthers to a state tournament appearance in 1998.

Brown is a 1994 graduate of Maryville College. She earned a bachelor’s degree in chemistry for secondary education. As a player with the Maryville women’s basketball team, she was third in the na-tion in 3-point percentage for Division III her junior year, while serv-ing as a team captain her fi nal two seasons.

The Scots made four consecutive appearances in the NCAA III Tournament during her career at Maryville, including two trips to the round of 16.

/// UNC ASHEVILLE BULLDOGS ///

33/// F E A R T H E D O G ///

JANELL CRAYTONASSISTANT COACH • FIRST SEASON • DAVIDSON

Former William & Mary assistant Janell Crayton is in her fi rst year as an assistant coach with the Bulldog program.

“Janell is a fantastic addition to our women’s basketball staff. She has worked at highly-regarded institutions and truly values the edu-cational piece of the student-athlete experience,” stated Kirkpatrick. “Her experiences at Davidson College as a student-athlete and as-sistant positions at Oglethorpe, Oberlin College, Colgate and Wil-liam and Mary prior to joining Asheville have prepared her for the important role she will play in building our program. Janell brings a tremendous amount of personality and energy to the table both of which will serve us and the entire UNC Asheville athletic department well.”

Crayton’s duties with the Tribe program included fi lm exchange, coordinating team travel, on-campus recruiting, team promotional ac-tivities, as well as other administrative responsibilities.Crayton joined the William and Mary staff after working as an assis-tant coach at Colgate University in 2010-11. While with the Raiders, her duties included recruiting, player development, scouting, travel, and special event planning. On the court, Crayton helped work with and develop the Colgate post players.

Prior to Colgate, she worked at Oberlin College, where she served as an assistant coach, interim head coach, and associate head coach during her three seasons. In these roles, Crayton’s responsibili-ties included team travel, scouting, coordinating community service, fi lm break down, recruiting, and player skill development. During her time at Oberlin, fi ve players earned all-conference honors. Before coaching at Oberlin, Crayton was an assistant coach at Oglethorpe University for a season. Crayton is a 2006 graduate of Davidson College, where she was a four-year letter-winner for the Wildcats. A two-year captain, Crayton was named First-Team All-Southern Conference and All-Tournament Team in 2006. Crayton was also a standout in the classroom, twice being named academic all-conference.

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

34 /// F E A R T H E D O G ///

RUSS GARDINERASSISTANT COACH • FIRST SEASON • UCLA

California native Russ Gardiner is in his fi rst year as an assistant coach for the UNC Asheville women’s basketball team.

“I am extremely excited about Russ Gardiner joining our staff,” declared fi rst-year head coach Brenda Mock Kirkpatrick. “He brings a wealth of experience not only from a coaching perspective but also a very successful career in the business arena. I knew from our fi rst conversation that he would be a tremendous contributor and differ-ence maker in our building process. His work ethic, innovation and forward thinking are just a few of his attributes that will help propel us back into the top half of the conference. With the fi nal addition of Russ, we have a wonderful blend of people on our staff to serve UNC Asheville Athletics and our community well.”

Gardiner brings a variety of experience to UNC Asheville. He was an entrepreneur for twenty years. Gardiner was the founder and C.E.O. of Promark Inc., a national promotional advertising agency, with major accounts such as Pepsi, Wells Fargo Bank, Frito-Lay, Pizza Hut, Gallo Winery and Robert Mondavi Winery.

Gardiner started a second career in coaching and athletic depart-ment administration after he sold Promark Inc. in 2001. He worked at Sonoma State University in Rohnert Park, Calif. from 2001-2006 in various roles. Gardiner served as assistant men’s basketball, assistant men’s golf coach and assistant athletic director for development and marketing. He was a part of a men’s basketball program that reached the 2003 Western Regional. In 2004, the NCAA awarded him with the “NCAA National Volunteer of the Year Award” for his fund raising, marketing and coaching accomplishments. Sonoma State University awarded him the “Spirit of the Seawolves Award”.

In 2006, he was named head varsity boys coach at Cardinal New-man High School in California and led them to a 27-7 record, the Northern California Champions title and a berth in the California State Championship game. He was named the Press Democrat All-Empire Co-Coach of the Year. From 2007-09, he served as head varsity girls coach at Sonoma Academy. The school had never had a winning record in basketball and his team fi nished the 2007-08 season with a record of 18-11. His 2008-09 team fi nished with a 26-3 record and won the Northern California sectional small schools championship. He won the UCLA All-University golf championships in 1972 and was a member of the nationally-ranked UCLA debate team. Gardin-er was also elected to the UCLA student council and was selected as one of seven fi nalists for the “UCLA Outstanding Senior Award”. While at UCLA, he was selected to intern for the United States Sen-ate (U.S. Senator Joseph Montoya) and also with the California Gov-ernor’s Offi ce for Governor Ronald Reagan. Russ also served on the Board of Directors of the NCAA Em-erald Bowl (now known as the Kraft Hunger Free Bowl) from 2003-2006. He has been active in Rotary International, Canine Companions for Independence and as a volunteer instructor in entrepreneurship for Junior Achievement. Russ has three children. Jennifer is a graduate of the University of Southern California. Michael is a graduate of St. Mary’s College in California. Kathleen is a graduate of the University of California, Santa Cruz where she was a member of the women’s soccer team.

/// UNC ASHEVILLE BULLDOGS ///

35/// F E A R T H E D O G ///

JENNIFER BRAZELTONDIRECTOR OF BASKETBALL OPERATIONS • FIRST SEASON

Jennifer Brazelton begins her fi rst year as Director of Basketball Operations for the UNC Asheville women’s basketball program.

She worked with the women’s program this past summer as an intern and was promoted this fall to her new post.

“We are thrilled with Jennifer’s decision to join us in the ca-pacity of Director of Basketball Operations,” stated fi rst-year UNC Asheville head coach Brenda Mock Kirkpatrick. “She did such a fan-tastic job interning with us in the women’s basketball offi ce this sum-mer. At the completion of her internship, I knew that we had to fi nd a way to keep her involved with our program because she was such an asset. Jennifer has passion for our vision and will be a big contributor to our process.”

Brazelton is a 2012 graduate of Western Carolina where she earned a degree in sports management. She was a member of the Catamount women’s tennis team her freshman year. Brazelton was a member of the Dean’s List during her time in Cullowhee.

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

36 /// F E A R T H E D O G ///

TOTAL 3-PTS REBOUNDS ## Player GP GS Min Avg FG FGA Pct 3FG FGA Pct FT FTA Pct Off Def Tot Avg PF FO A TO Blk Stl Pts Avg42 JONES, Shonese 30 27 888 29.6 176 431 .408 53 129 .411 62 87 .713 33 67 100 3.3 66 3 59 86 2 40 467 15.6 Conference-Only 18 17 582 32.3 118 296 .399 35 91 .385 36 54 .667 23 48 71 3.9 43 2 39 61 0 29 307 17.112 THOMPSON, Lindsey 30 23 838 27.9 109 317 .344 44 152 .289 66 75 .880 37 83 120 4.0 60 2 87 107 3 26 328 10.9 Conference-Only 18 17 527 29.3 65 207 .314 25 92 .272 33 36 .917 29 52 81 4.5 35 1 61 68 2 16 188 10.420 WORMACK, Leah 24 23 623 26.0 98 196 .500 0 0 .000 58 81 .716 51 77 128 5.3 76 4 14 46 28 13 254 10.6 Conference-Only 14 14 374 26.7 63 124 .508 0 0 .000 40 51 .784 33 45 78 5.6 52 2 7 30 18 8 166 11.910 GWYN, Brittany 10 9 290 29.0 28 77 .364 10 21 .476 19 27 .704 16 19 35 3.5 17 0 25 28 3 11 85 8.5 Conference-Only 5 5 138 27.6 7 32 .219 1 7 .143 5 6 .833 7 10 17 3.4 7 0 11 16 2 4 20 4.013 RILES, Kelli 30 21 799 26.6 87 172 .506 0 0 .000 74 94 .787 93 225 318 10.6 57 0 23 78 11 27 248 8.3 Conference-Only 18 16 473 26.3 43 90 .478 0 0 .000 31 45 .689 47 128 175 9.7 35 0 18 46 7 18 117 6.522 MANLEY, Gentry 30 6 480 16.0 64 132 .485 0 3 .000 47 75 .627 63 52 115 3.8 58 0 19 35 4 14 175 5.8 Conference-Only 18 2 279 15.5 37 81 .457 0 3 .000 19 33 .576 32 35 67 3.7 35 0 14 24 2 7 93 5.224 BLAYLOCK, Grace 30 16 727 24.2 49 178 .275 46 156 .295 8 13 .615 25 74 99 3.3 45 0 50 39 2 31 152 5.1 Conference-Only 18 11 466 25.9 25 102 .245 23 90 .256 4 7 .571 14 49 63 3.5 26 0 28 21 0 16 77 4.304 TRAMMELL, Tacey 30 16 639 21.3 43 140 .307 15 47 .319 16 20 .800 8 33 41 1.4 41 0 61 67 1 32 117 3.9 Conference-Only 18 5 359 19.9 26 66 .394 11 24 .458 8 10 .800 2 13 15 0.8 22 0 30 33 0 17 71 3.914 BARKSDALE, Breaira 8 0 96 12.0 5 33 .152 0 3 .000 2 8 .250 2 6 8 1.0 9 0 8 19 0 11 12 1.5 Conference-Only 0 0 0 0.0 0 0 .000 0 0 .000 0 0 .000 0 0 0 0.0 0 0 0 0 0 0 0 0.032 WISE, Katie 15 4 125 8.3 6 18 .333 1 4 .250 4 7 .571 7 12 19 1.3 18 0 4 6 4 5 17 1.1 Conference-Only 9 2 81 9.0 3 11 .273 0 2 .000 4 7 .571 4 8 12 1.3 10 0 3 4 3 4 10 1.115 BUCKNER, Jeannie 28 4 288 10.3 9 52 .173 1 22 .045 10 23 .435 20 27 47 1.7 47 1 11 31 2 10 29 1.0 Conference-Only 18 1 190 10.6 5 37 .135 1 16 .063 5 11 .455 13 16 29 1.6 30 0 8 19 1 7 16 0.923 SICKLES, Abra 16 1 84 5.3 7 14 .500 0 0 .000 2 6 .333 5 9 14 0.9 19 0 3 7 0 1 16 1.0 Conference-Only 11 0 51 4.6 6 10 .600 0 0 .000 0 0 .000 3 6 9 0.8 15 0 1 6 0 0 12 1.125 COKES, Blake 19 0 123 6.5 5 21 .238 0 0 .000 8 14 .571 5 6 11 0.6 18 0 0 9 3 2 18 0.9 Conference-Only 10 0 80 8.0 4 13 .308 0 0 .000 8 14 .571 4 5 9 0.9 10 0 0 5 0 2 16 1.6TM Team 65 64 129 4.3 0 10 0 Conference-Only 39 37 76 4.2 0 5 0 Total 30 686 1781 .385 170 537 .317 376 530 .709 430 754 1184 39.5 531 10 364 568 63 223 1918 63.9 Conference-Only 18 402 1069 .376 96 325 .295 193 274 .704 250 452 702 39.0 320 5 220 338 35 128 1093 60.7 Opponents 30 824 1980 .416 176 544 .324 419 594 .705 493 765 1258 41.9 486 - 467 434 136 298 2243 74.8 Conference-Only 18 491 1166 .421 113 331 .341 245 352 .696 276 470 746 41.4 270 2 286 250 70 186 1340 74.4

RECORD: OVERALL HOME AWAY NEUTRAL ALL GAMES 7-23 7-8 0-14 0-1CONFERENCE 3-15 3-6 0-9 0-0NON-CONFERENCE 4-8 4-2 0-5 0-1

Score by periods 1st 2nd Total UNC Asheville 937 981 1918Opponents 1079 1164 2243

TEAM STATISTICS AVL OPPSCORING 1918 2243 Points per game 63.9 74.8 Scoring margin -10.8 -FIELD GOALS-ATT 686-1781 824-1980 Field goal pct .385 .4163 POINT FG-ATT 170-537 176-544 3-point FG pct .317 .324 3-pt FG made per game 5.7 5.9FREE THROWS-ATT 376-530 419-594 Free throw pct .709 .705 F-Throws made per game 12.5 14.0REBOUNDS 1184 1258 Rebounds per game 39.5 41.9 Rebounding margin -2.5 -

ASSISTS 364 467 Assists per game 12.1 15.6TURNOVERS 568 434 Turnovers per game 18.9 14.5 Turnover margin -4.5 - Assist/turnover ratio 0.6 1.1STEALS 223 298 Steals per game 7.4 9.9BLOCKS 63 136 Blocks per game 2.1 4.5ATTENDANCE 9771 6838 Home games-Avg/Game 15-651 14-488 Neutral site-Avg/Game - 1-0

2011-12 UNC ASHEVILLE STATISTICS

/// UNC ASHEVILLE BULLDOGS ///

37/// F E A R T H E D O G ///

POINTS G Pts Pts/GJONES, Shonese 30 467 15.6THOMPSON, Lindsey 30 328 10.9WORMACK, Leah 24 254 10.6RILES, Kelli 30 248 8.3MANLEY, Gentry 30 175 5.8BLAYLOCK, Grace 30 152 5.1TRAMMELL, Tacey 30 117 3.9GWYN, Brittany 10 85 8.5BUCKNER, Jeannie 28 29 1.0COKES, Blake 19 18 0.9WISE, Katie 15 17 1.1SICKLES, Abra 16 16 1.0

SCORING AVERAGE G Pts Avg/GJONES, Shonese 30 467 15.6THOMPSON, Lindsey 30 328 10.9WORMACK, Leah 24 254 10.6GWYN, Brittany 10 85 8.5RILES, Kelli 30 248 8.3MANLEY, Gentry 30 175 5.8BLAYLOCK, Grace 30 152 5.1TRAMMELL, Tacey 30 117 3.9BARKSDALE, Breaira 8 12 1.5WISE, Katie 15 17 1.1BUCKNER, Jeannie 28 29 1.0SICKLES, Abra 16 16 1.0

FG % FG ATT PctRILES, Kelli 87 172 .506SICKLES, Abra 7 14 .500WORMACK, Leah 98 196 .500MANLEY, Gentry 64 132 .485JONES, Shonese 176 431 .408GWYN, Brittany 28 77 .364THOMPSON, Lindsey 109 317 .344WISE, Katie 6 18 .333TRAMMELL, Tacey 43 140 .307BLAYLOCK, Grace 49 178 .275COKES, Blake 5 21 .238BUCKNER, Jeannie 9 52 .173

FIELD GOAL ATT. G Att Att/GJONES, Shonese 30 431 14.4THOMPSON, Lindsey 30 317 10.6WORMACK, Leah 24 196 8.2BLAYLOCK, Grace 30 178 5.9RILES, Kelli 30 172 5.7

FIELD GOALS MADE G Made Made/GJONES, Shonese 30 176 5.9THOMPSON, Lindsey 30 109 3.6WORMACK, Leah 24 98 4.1RILES, Kelli 30 87 2.9MANLEY, Gentry 30 64 2.1

3-POINT % 3FG ATT PctGWYN, Brittany 10 21 .476JONES, Shonese 53 129 .411TRAMMELL, Tacey 15 47 .319BLAYLOCK, Grace 46 156 .295THOMPSON, Lindsey 44 152 .289WISE, Katie 1 4 .250BUCKNER, Jeannie 1 22 .045MANLEY, Gentry 0 3 .000BARKSDALE, Breaira 0 3 .000

3-POINT FG ATT. G Att Att/GBLAYLOCK, Grace 30 156 5.2THOMPSON, Lindsey 30 152 5.1JONES, Shonese 30 129 4.3TRAMMELL, Tacey 30 47 1.6BUCKNER, Jeannie 28 22 0.8

3-POINT FGS MADE G Made Made/GJONES, Shonese 30 53 1.8BLAYLOCK, Grace 30 46 1.5THOMPSON, Lindsey 30 44 1.5TRAMMELL, Tacey 30 15 0.5GWYN, Brittany 10 10 1.0

FT % FT ATT PctTHOMPSON, Lindsey 66 75 .880TRAMMELL, Tacey 16 20 .800RILES, Kelli 74 94 .787WORMACK, Leah 58 81 .716JONES, Shonese 62 87 .713GWYN, Brittany 19 27 .704MANLEY, Gentry 47 75 .627BLAYLOCK, Grace 8 13 .615COKES, Blake 8 14 .571WISE, Katie 4 7 .571BUCKNER, Jeannie 10 23 .435SICKLES, Abra 2 6 .333

FREE THROW ATT. G Att Att/GRILES, Kelli 30 94 3.1JONES, Shonese 30 87 2.9WORMACK, Leah 24 81 3.4THOMPSON, Lindsey 30 75 2.5MANLEY, Gentry 30 75 2.5

FREE THROWS MADE G Made Made/GRILES, Kelli 30 74 2.5THOMPSON, Lindsey 30 66 2.2JONES, Shonese 30 62 2.1WORMACK, Leah 24 58 2.4MANLEY, Gentry 30 47 1.6

REBOUNDS G Reb Reb/GRILES, Kelli 30 318 10.6WORMACK, Leah 24 128 5.3THOMPSON, Lindsey 30 120 4.0MANLEY, Gentry 30 115 3.8JONES, Shonese 30 100 3.3

REBOUND AVERAGE G Reb Avg/GRILES, Kelli 30 318 10.6WORMACK, Leah 24 128 5.3THOMPSON, Lindsey 30 120 4.0MANLEY, Gentry 30 115 3.8GWYN, Brittany 10 35 3.5

ASSISTS G No. A/GTHOMPSON, Lindsey 30 87 2.9TRAMMELL, Tacey 30 61 2.0JONES, Shonese 30 59 2.0BLAYLOCK, Grace 30 50 1.7GWYN, Brittany 10 25 2.5

STEALS G No. S/GJONES, Shonese 30 40 1.3TRAMMELL, Tacey 30 32 1.1BLAYLOCK, Grace 30 31 1.0RILES, Kelli 30 27 0.9THOMPSON, Lindsey 30 26 0.9

OFFENSIVE REBOUNDS G No. Avg/GRILES, Kelli 30 93 3.1MANLEY, Gentry 30 63 2.1WORMACK, Leah 24 51 2.1THOMPSON, Lindsey 30 37 1.2JONES, Shonese 30 33 1.1

DEFENSIVE REBOUNDS G No. Avg/GRILES, Kelli 30 225 7.5THOMPSON, Lindsey 30 83 2.8WORMACK, Leah 24 77 3.2BLAYLOCK, Grace 30 74 2.5JONES, Shonese 30 67 2.2

BLOCKED SHOTS G No. Blk/GWORMACK, Leah 24 28 1.2RILES, Kelli 30 11 0.4WISE, Katie 15 4 0.3MANLEY, Gentry 30 4 0.1GWYN, Brittany 10 3 0.3THOMPSON, Lindsey 30 3 0.1COKES, Blake 19 3 0.2

MINUTES G No. Min/GJONES, Shonese 30 888 29.6THOMPSON, Lindsey 30 838 27.9RILES, Kelli 30 799 26.6BLAYLOCK, Grace 30 727 24.2TRAMMELL, Tacey 30 639 21.3

FOULS G No. Per/GWORMACK, Leah 24 76 3.2JONES, Shonese 30 66 2.2THOMPSON, Lindsey 30 60 2.0MANLEY, Gentry 30 58 1.9RILES, Kelli 30 57 1.9

FOULOUTS G No.WORMACK, Leah 24 4JONES, Shonese 30 3THOMPSON, Lindsey 30 2BUCKNER, Jeannie 28 1

TURNOVERS G No. TO/GTHOMPSON, Lindsey 30 107 3.6JONES, Shonese 30 86 2.9RILES, Kelli 30 78 2.6TRAMMELL, Tacey 30 67 2.2WORMACK, Leah 24 46 1.9

2011-12 UNC ASHEVILLE LEADERS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

38 /// F E A R T H E D O G ///

2011-12 UNC ASHEVILLE POINTS • REBOUNDS • ASSISTS 04 10 12 13 Opponent Date Score W/L TRAMMELL GWYN THOMPSON RILES

Winston-Salem St. 11/12/11 83-74 W 13-2-3 DNP 22-5-7 21-24-0

at Wester Carolina 11/16/11 53-65 L 5-3-2 DNP 6-1-1 0-4-0

MONTREAT 11/19/11 73-64 W 6-4-4 DNP 18-4-1 16-7-1

at Furman 11/21/11 59-71 L 3-5-2 DNP 13-3-2 10-4-0

at George Mason 11/27/11 59-88 L 2-1-2 DNP 11-2-0 17-15-0

UPSTATE 11/30/11 66-73 L 4-0-3 DNP 2-7-2 13-28-2

Appalachian St. 12/10/11 71-85 L 0-0-3 14-2-5 19-4-3 4-11-0

at Kennesaw St. 12/17/11 79-83 L 0-0-1 18-0-2 11-2-3 10-14-1

at South Carolina St. 12/19/11 82-92 L 0-3-4 13-3-3 5-2-2 2-2-0

MERCER 12/21/11 76-75 W 6-3-2 17-7-1 9-5-3 11-9-1

BREVARD 12/28/11 74-62 W 7-3-3 3-6-3 11-3-2 19-16-0

at High Point 12/31/11 49-89 L 0-1-1 2-2-3 11-2-1 2-8-0

at Campbell 01/02/12 62-82 L 8-1-0 5-7-1 8-5-4 2-5-0

COASTAL 01/07/12 69-60 W 0-1-1 7-3-1 18-3-8 9-11-0

CSU 01/09/12 75-68 W 0-1-2 4-3-2 26-4-7 11-16-1

at Winthrop 01-14-12 68-84 L 0-2-0 2-2-4 4-6-7 12-14-3

at PC 01/16/12 54-62 L 2-1-0 DNP 8-10-0 2-12-0

GARDNER-WEBB 01/21/12 74-62 W 3-0-0 DNP 12-7-7 9-5-2

LIBERTY 01/28/12 56-78 L 6-0-7 DNP 10-4-2 2-8-2

RADFORD 01/30/12 62-72 L 0-2-5 DNP 0-0-4 7-9-1

at CSU 02/04/12 70-88 L 10-0-2 DNP 5-3-3 9-12-1

at Coastal 02/06/12 58-74 L 4-1-2 DNP 8-2-1 8-13-0

PC 02/11/12 45-62 L 0-1-0 DNP 8-6-1 7-16-3

WINTHROP 02/13/12 68-79 L 3-1-1 DNP 20-2-5 0-10-2

at Gardner-Webb 02/18/12 52-69 L 4-0-2 DNP 3-10-2 8-4-1

at Radford 02-25-12 67-79 L 3-2-3 DNP 12-5-2 16-10-1

at Liberty 02-27-12 53-84 L 13-0-2 DNP 15-3-2 0-1-0

CAMPBELL 03-02-12 55-74 L 13-0-1 DNP 11-4-4 9-16-0

HIGH POINT 03/05/12 56-74 L 2-1-1 DNP 9-5-1 4-5-1

vs Liberty 03-09-12 50-71 L 0-2-2 DNP 13-1-0 8-9-0

/// UNC ASHEVILLE BULLDOGS ///

39/// F E A R T H E D O G ///

14 15 20 22 23 24 25 32 42BARKSDALE BUCKNER WORMACK MANLEY SICKLES BLAYLOCK COKES WISE JONES

DNP DNP DNP 2-1-0 2-3-2 18-3-2 0-0-0 5-3-0 0-1-4

4-2-2 0-1-0 5-7-0 11-6-0 0-0-0 13-4-0 DNP 0-0-0 9-3-1

2-1-3 0-0-0 9-10-1 17-8-0 0-0-0 3-6-3 0-1-0 DNP 2-1-0

2-3-3 2-1-0 11-4-0 4-6-0 DNP 0-2-1 2-1-0 0-2-0 12-4-0

3-2-0 1-1-0 10-4-0 0-2-3 1-2-0 0-4-3 0-0-0 0-0-0 14-2-0

0-0-0 0-2-0 21-3-1 11-7-0 DNP 9-3-2 0-0-0 0-0-0 6-1-4

1-0-0 DNP 7-8-1 9-6-1 DNP 3-3-5 DNP DNP 14-0-0

0-0-0 2-1-0 2-0-2 4-5-0 DNP 12-2-2 0-0-0 DNP 20-4-2

0-0-0 6-1-0 4-1-0 16-4-0 DNP 6-0-1 0-0-0 DNP 30-3-1

DNP 0-5-1 6-6-0 2-1-1 DNP 5-2-1 DNP DNP 20-3-0

DNP 2-5-0 13-7-2 0-0-0 DNP 6-6-1 0-0-0 DNP 13-4-5

DNP 2-1-0 7-6-1 6-3-0 0-0-0 0-4-1 0-0-0 DNP 19-8-0

DNP 0-1-0 10-9-0 5-3-1 DNP 0-1-0 0-0-0 DNP 24-5-0

DNP 1-3-0 17-10-1 6-2-2 DNP 3-4-0 DNP DNP 8-11-1

DNP 0-2-0 11-4-1 2-1-1 0-0-0 11-5-1 DNP DNP 10-3-4

DNP 0-1-2 11-3-1 1-2-0 DNP 23-2-0 DNP DNP 15-1-1

DNP 0-1-0 14-5-0 0-0-0 4-3-0 8-3-1 DNP DNP 16-2-3

DNP 0-0-0 10-11-1 8-4-1 2-1-1 3-8-3 DNP DNP 27-6-4

DNP 2-1-0 11-5-1 4-3-1 2-2-0 0-4-3 0-1-0 0-0-0 19-2-2

DNP 0-1-0 16-6-0 4-2-1 2-3-0 3-5-1 DNP DNP 30-2-2

DNP 1-0-1 17-4-0 6-6-1 DNP 0-5-2 4-2-0 0-0-0 18-5-2

DNP 2-2-1 10-2-0 14-6-2 0-0-0 0-1-2 2-0-0 DNP 10-2-5

DNP 7-5-0 15-4-1 4-4-1 0-0-0 2-1-1 0-0-0 2-1-0 0-1-2

DNP 0-0-2 6-2-0 8-6-0 DNP 9-3-5 DNP 0-2-1 22-5-2

DNP 0-1-2 11-7-0 6-7-1 DNP 6-5-3 DNP 0-1-0 14-2-0

DNP 0-0-0 DNP 4-6-0 0-0-0 3-7-2 0-0-0 3-0-0 26-3-2

DNP 1-2-0 DNP 4-1-1 2-0-0 3-1-1 3-2-0 0-0-0 12-7-5

DNP 0-5-0 DNP 3-6-1 DNP 0-2-1 2-2-0 5-4-1 12-2-2

DNP 0-3-0 DNP 8-5-0 0-0-0 3-2-1 5-2-0 0-4-1 25-4-2

DNP 0-1-2 DNP 6-2-0 1-0-0 0-1-1 0-0-0 2-2-1 20-3-3

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

40 /// F E A R T H E D O G ///

UNC Asheville - TEAM GAME HIGHS

PPOINTS 83 WINSTON-SALEM STATE (11/12/11)

82 at South Carolina State (12/19/11)

79 at Kennesaw State (12/17/11)

76 MERCER (12/21/11)

75 CSU (01/09/12)

FIELD GOALS MADE 30 at Kennesaw State (12/17/11)

28 GARDNER-WEBB (01/21/12)

28 CSU (01/09/12)

FIELD GOAL ATTEMPTS 71 at Furman (11/21/11)

68 at Campbell (01/02/12)

68 BREVARD COLLEGE (12/28/11)

68 at George Mason (11/27/11)

FIELD GOAL PERCENTAGE .536 (30-56) at Kennesaw State (12/17/11)

.510 (25-49) at South Carolina St. (12/19/11)

3 PT FIELD GOALS MADE 14 WINTHROP (02/13/12)

11 WINSTON-SALEM STATE (11/12/11)

3 PT FG ATTEMPTS 30 WINTHROP (02/13/12)

29 at WINTHROP (01-14-12)

3 PT FG PERCENTAGE .500 (10-20) at Kennesaw State (12/17/11)

.467 (14-30) WINTHROP (02/13/12)

FREE THROWS MADE 23 at South Carolina State (12/19/11)

22 MERCER (12/21/11)

22 MONTREAT COLLEGE (11/19/11)

FREE THROW ATTEMPTS 33 at South Carolina State (12/19/11)

28 MERCER (12/21/11)

28 USC UPSTATE (11/30/11)

28 MONTREAT COLLEGE (11/19/11)

FREE THROW PERCENTAGE .947 (18-19) WINSTON-SALEM ST. (11/12/11)

.923 (12-13) at WINTHROP (01-14-12)

REBOUNDS 54 USC UPSTATE (11/30/11)

53 BREVARD COLLEGE (12/28/11)

ASSISTS 19 GARDNER-WEBB (01/21/12)

19 CSU (01/09/12)

STEALS 14 MONTREAT COLLEGE (11/19/11)

11 HIGH POINT (03/05/12)

11 COASTAL (01/07/12)

11 APPALACHIAN STATE (12/10/11)

11 WINSTON-SALEM STATE (11/12/11)

BLOCKED SHOTS 7 at WINTHROP (01-14-12)

5 COASTAL (01/07/12)

5 at Kennesaw State (12/17/11)

TURNOVERS 25 COASTAL (01/07/12)

25 USC UPSTATE (11/30/11)

FOULS 27 at South Carolina State (12/19/11)

24 at Charleston Southern (02/04/12)

Opponent - TEAM GAME HIGHS

POINTS 92 at South Carolina State (12/19/11)

89 at High Point (12-31-11)

88 at Charleston Southern (02/04/12)

88 at George Mason (11/27/11)

85 APPALACHIAN STATE (12/10/11)

FIELD GOALS MADE 37 at Kennesaw State (12/17/11)

35 at George Mason (11/27/11)

FIELD GOAL ATTEMPTS 78 WINTHROP (02/13/12)

78 WINSTON-SALEM STATE (11/12/11)

FIELD GOAL PERCENTAGE .582 (32-55) at Liberty (02-27-12)

.565 (35-62) at George Mason (11/27/11)

3 PT FIELD GOALS MADE 13 at Campbell (01/02/12)

11 at Liberty (02-27-12)

3 PT FG ATTEMPTS 28 WINTHROP (02/13/12)

28 MERCER (12/21/11)

3 PT FG PERCENTAGE .750 (6-8) at COASTAL (02/06/12)

.619 (13-21) at Campbell (01/02/12)

FREE THROWS MADE 27 at South Carolina State (12/19/11)

25 at Charleston Southern (02/04/12)

FREE THROW ATTEMPTS 37 at South Carolina State (12/19/11)

31 at Charleston Southern (02/04/12)

31 LIBERTY (01/28/12)

FREE THROW PERCENTAGE .857 (12-14) COASTAL (01/07/12)

.846 (11-13) CSU (01/09/12)

REBOUNDS 55 WINTHROP (02/13/12)

50 at High Point (12-31-11)

ASSISTS 25 at Campbell (01/02/12)

23 at High Point (12-31-11)

STEALS 16 at WINTHROP (01-14-12)

16 COASTAL (01/07/12)

BLOCKED SHOTS 9 at Campbell (01/02/12)

8 APPALACHIAN STATE (12/10/11)

8 USC UPSTATE (11/30/11)

8 at George Mason (11/27/11)

8 at Furman (11/21/11)

TURNOVERS 23 COASTAL (01/07/12)

21 LIBERTY (01/28/12)

FOULS 26 at South Carolina State (12/19/11)

24 at Gardner-Webb (02/18/12)

2011-12 UNC ASHEVILLE GAME HIGHS - TEAM

/// UNC ASHEVILLE BULLDOGS ///

41/// F E A R T H E D O G ///

UNC ASHEVILLE - INDIVIDUAL GAME HIGHS

Points 30 JONES, Shonese vs Radford (01/30/12)

30 JONES, Shonese at SC St.(12/19/11)

27 JONES, Shonese vs GWU (01/21/12)

Field Goals Made 11 JONES, Shonese vs High Point (03/05/12)

11 JONES, Shonese vs GWU (01/21/12)

Field Goal Att. 22 JONES, Shonese vs Campbell (03-02-12)

21 JONES, Shonese at Liberty (02-27-12)

21 JONES, Shonese at Campbell (01/02/12)

FG Pct .889 (8-9) RILES, Kelli vs Montreat (11/19/11)

.833 (5-6) MANLEY, Gentry at SC State (12/19/11)

3-Point FG Made 7 BLAYLOCK, Grace at WINTHROP (01-14-12)

6 JONES, Shonese vs WINTHROP (02/13/12)

6 BLAYLOCK, Grace vs WSSU (11/12/11)

3-Point FG Att. 14 BLAYLOCK at WINTHROP (01-14-12)

3-Pt FG Pct 1.000 (4-4) JONES, Shonese at SC State (12/19/11)

Free Throws Made 13 RILES, Kelli vs WSSU (11/12/11)

9 JONES, Shonese vs Radford (01/30/12)

Free Throw Att. 13 RILES, Kelli vs WSSU (11/12/11)

12 JONES, Shonese vs Radford (01/30/12)

12 GWYN, Brittany vs App. State (12/10/11)

FT Pct 1.000 (13-13) RILES, Kelli vs WSSU (11/12/11)

Rebounds 28 RILES, Kelli vs USC Upstate (11/30/11)

24 RILES, Kelli vs WSSU (11/12/11)

Assists 8 THOMPSON, Lindsey vs COASTAL (01/07/12)

7 TRAMMELL, Tacey vs Liberty (01/28/12)

7 THOMPSON, Lindsey vs GWU (01/21/12)

7 THOMPSON at WINTHROP (01-14-12)

7 THOMPSON, Lindsey vs CSU (01/09/12)

7 THOMPSON, Lindsey vs WSSU (11/12/11)

Steals 7 TRAMMELL, Tacey vs Montreat (11/19/11)

5 TRAMMELL, Tacey vs WSSU (11/12/11)

Blocked Shots 4 WORMACK, Leah at WINTHROP (01-14-12)

3 WORMACK, Leah at PC (01/16/12)

3 WORMACK, Leah vs COASTAL (01/07/12)

Turnovers 9 THOMPSONvs WINTHROP (02/13/12)

7 JONES, Shonese vs COASTAL (01/07/12)

OPPONENT - INDIVIDUAL GAME HIGHS

Points 34 COPNEY, Tee’Ara vs Upstate (11/30/11)

31 BAKER, Tonisha vs Campbell (03-02-12)

31 ALSTON, Lakeitha vs CSU (01/09/12)

Field Goals Made 14 Moton, Taleia at George Mason (11/27/11)

13 BAKER, Tonisha vs Campbell (03-02-12)

13 COPNEY, Tee’Ara vs Upstate (11/30/11)

Field Goal Att. 34 McClanahan vs WINTHROP (02/13/12)

27 COPNEY vs USC Upstate (11/30/11)

FG Pct .857 (6-7) CALVERT vs WINTHROP (02/13/12)

.833 (5-6) DAVID, Dria vs PC (02/11/12)

.833 (5-6) KOERNER, Tabby vs GWU (01/21/12)

3-Point FG Made 5 Five Times

3-Point FG Att. 14 WILLIAMS, Briana vs Mercer (12/21/11)

13 BUCKHANNON vs Radford (01/30/12)

3-Pt FG Pct 1.000 (4-4) MOORE, J. at Campbell (01/02/12)

1.000 (2-2) KIRKPATRICK, K. vs CSU (01/09/12)

Free Throws Made 8 Five Times

Free Throw Att. 13 GREEN, Catrina vs GWU (01/21/12)

11 McClanahan vs WINTHROP (02/13/12)

11 FLOWERS,Tracey at SC State (12/19/11)

FT Pct 1.000 (8-8) MURPHY at Furman (11/21/11)

1.000 (7-7) Menendez, at WCU (11/16/11)

Rebounds 19 CALVERT, vs WINTHROP (02/13/12)

16 GREEN, Catrina vs GWU (01/21/12)

Assists 12 McClanahan at WINTHROP (01-14-12)

9 Saunders at George Mason (11/27/11)

Steals 6 EPLEY, Taylor vs COASTAL (01/07/12)

6 SMITH, Tyra vs USC Upstate (11/30/11)

Blocked Shots 5 BOOKER, Lashana at Furman (11/21/11)

4 McROBERTS vs Upstate (11/30/11)

4 Pickard, Janaa at George Mason (11/27/11)

Turnovers 7 RUSSELL, Mykeia vs Montreat (11/19/11)

2011-12 UNC ASHEVILLE GAME HIGHS - INDIVIDUAL

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

42 /// F E A R T H E D O G ///

DATE TIME OPPONENT RESULT SCORE ATTEND HIGH POINTS HIGH REBOUNDS

11/12/11 2 pm WINSTON-SALEM STATE W 83-74 675 (22)THOMPSON, Lindsey (24)RILES, Kelli

11/16/11 7:00 p.m. at Western Carolina L 53-65 579 (13)BLAYLOCK, Grace (7)WORMACK, Leah

11/19/11 2 pm MONTREAT COLLEGE W 73-64 581 (18)THOMPSON, Lindsey (10)WORMACK, Leah

11/21/11 7:00 p.m. at Furman L 59-71 421 (13)THOMPSON, Lindsey (6)MANLEY, Gentry

11/27/11 2 p.m. at George Mason L 59-88 374 (17)RILES, Kelli (15)RILES, Kelli

11/30/11 7 pm USC UPSTATE L 66-73 508 (21)WORMACK, Leah (28)RILES, Kelli

12/10/11 4:30 pm APPALACHIAN STATE L 71-85 897 (19)THOMPSON, Lindsey (11)RILES, Kelli

12/17/11 5:00 p.m. at Kennesaw State L 79-83 310 (20)JONES, Shonese (14)RILES, Kelli

12/19/11 6 p.m. at South Carolina State L 82-92 189 (30)JONES, Shonese (4)MANLEY, Gentry

12/21/11 Noon MERCER W 76-75 761 (20)JONES, Shonese (9)RILES, Kelli

12/28/11 7 pm BREVARD COLLEGE W 74-62 581 (19)RILES, Kelli (16)RILES, Kelli

12-31-11 4:00 p.m. * at High Point L 49-89 464 (19)JONES, Shonese (8)RILES, Kelli

(8)JONES, Shonese

01/02/12 5:15 pm * at Campbell L 62-82 787 (24)JONES, Shonese (9)WORMACK, Leah

01/07/12 2 pm * COASTAL W 69-60 567 (18)THOMPSON, Lindsey (11)JONES, Shonese

(11)RILES, Kelli

01/09/12 7 pm * CHARLESTON SOUTHERN W 75-68 391 (26)THOMPSON, Lindsey (16)RILES, Kelli

01-14-12 1:10 p.m. * at WINTHROP L 68-84 409 (23)BLAYLOCK, Grace (14)RILES, Kelli

01/16/12 7 p.m. * at Presbyterian College L 54-62 201 (16)JONES, Shonese (12)RILES, Kelli

01/21/12 2 pm * GARDNER-WEBB W 74-62 783 (27)JONES, Shonese (11)WORMACK, Leah

01/28/12 2 pm * LIBERTY L 56-78 769 (19)JONES, Shonese (8)RILES, Kelli

01/30/12 7 pm * RADFORD L 62-72 649 (30)JONES, Shonese (9)RILES, Kelli

02/04/12 2 p.m. * at Charleston Southern L 70-88 659 (18)JONES, Shonese (12)RILES, Kelli

02/06/12 7 p.m. * at COASTAL L 58-74 486 (14)MANLEY, Gentry (13)RILES, Kelli

02/11/12 2 pm * PRESBYTERIAN COLLEGE L 45-62 859 (15)WORMACK, Leah (16)RILES, Kelli

02/13/12 7 pm * WINTHROP L 68-79 414 (22)JONES, Shonese (10)RILES, Kelli

02/18/12 5:00 p.m. * at Gardner-Webb L 52-69 435 (14)JONES, Shonese (10)THOMPSON, Lindsey

02-25-12 2:00 * at Radford L 67-79 942 (26)JONES, Shonese (10)RILES, Kelli

02-27-12 7 p.m. * at Liberty L 53-84 582 (15)THOMPSON, Lindsey (7)JONES, Shonese

03-02-12 7:30 p.m. * CAMPBELL L 55-74 880 (13)TRAMMELL, Tacey (16)RILES, Kelli

03/05/12 7 pm * HIGH POINT L 56-74 456 (25)JONES, Shonese (5)THOMPSON, Lindsey

(5)MANLEY, Gentry

(5)RILES, Kelli

03-09-12 12:00 p.m. vs Liberty L 50-71 (20)JONES, Shonese (9)RILES, Kelli

* - Big South Conference game

2011-12 UNC ASHEVILLE RESULTS

/// UNC ASHEVILLE BULLDOGS ///

43/// F E A R T H E D O G ///

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

44 /// F E A R T H E D O G ///

1,000 POINT SCORERSNAME YEARS GAMES POINTS AVG.Sheila Ford 1980-84 118 2,442 20.7

Kim Duncan 1981-85 129 1,975 15.3

Vicki Giffi n 1993-97 109 1,701 15.6

Trish Wyatt 1981-85 122 1,606 13.7

Wendy Beecher 1986-90 104 1,448 13.9

Kristal Hood 2002-05 111 1,304 11.7

Mechio Kornegay 1984-88 110 1,234 11.2

Emily Hill 1996-2001 110 1,234 11.2

Ashton Barton 2004-08106 1,139 10.7

Lindsey Montgomery 2008-1197 1,107 11.4

Tonisha Jackson 1999-2004 94 1,095 11.6

GAMES POINTS AVG.Kendall Shepard 2008-11119 1,087 9.1

Jessica Guarneri 1999-2002 75 1,082 14.4

Tara McMinn 1989-92 77 1,013 13.2

Lindsey Thompson 2008-12118 1,080 9.2

Name Years Games Rebs Avg.Sheila Ford 1980-84 118 2,200 18.6Wendy Beecher 1986-90 104 894 8.6Kim Duncan 1981-85 129 888 6.9Lindsey Montgomery 2008-11 97 777 8.0Stacy Shepard 2004-08 119 774 6.5Kelli Riles 2009-present 88 752 8.5Tonisha Jackson 1999-2004 94 720 7.7Jessica Guarneri 1999-2002 75 670 8.9Tara McMinn 1989-92 77 623 8.1Sheena West 1990-94 109 586 5.4

Career Rebounding Top 10

Name Years Games Rebs Avg.Sheila Ford 1983-84 37 690 18.6Sheila Ford 1982-83 32 627 19.6Sheila Ford 1981-82 27 507 18.8Sheila Ford 1980-81 22 376 17.1Kelli Riles 2011-12 30 318 10.6Stacy Shepard 2007-08 30 298 9.9Kelli Riles 2010-11 28 288 10.3Jennifer Guarneri 2001-02 28 274 9.8Lisa Davis 1985-86 26 265 10.2Tara McMinn 1990-91 27 256 9.5Wendy Beecher 1987-88 25 244 9.8

Name Years Games Points Avg.Sheila Ford 1983-84 37 874 23.6Kim Duncan 1983-84 37 659 17.8Sheila Ford 1982-83 32 640 20.0Kim Duncan 1984-85 33 586 17.8Trish Wyatt 1984-85 34 529 15.6Kim Duncan 1982-83 32 509 15.9Emily Hill 1997-98 28 506 18.1Sheila Ford 1981-82 27 488 18.0Trish Wyatt 1983-84 37 467 12.6Kendall Shepard 2010-11 29 456 15.2

Single Season Rebounding Top 10

Single-Season Scoring Top 10

/// UNC ASHEVILLE BULLDOGS ///

45/// F E A R T H E D O G ///

Individual All-Time RecordsMost PointsGame: 41, Sheila Ford vs. Dillard, 1/12/84Season: 874, Sheila Ford, 1983-84Career: 2,443, Sheila Ford, 1980-84

Most Field GoalsGame: 18, Sheila Ford, vs. UNCW, 12/3/83Season: 365, Sheila Ford, 1983-84Career: 1,080, Sheila Ford, 1980-84

Most Field Goal AttemptsGame: 33, Sheila Ford, vs. Dillard, 1/12/84Season: 639, Sheila Ford, 1983-84Career: 1,826, Sheila Ford, 1980-84

Field Goal AccuracyGame: 1.000, Amanda Brewer (7-7) vs. Morehead State, 11/27/96Season: .597, Vicki Giffi n, 1993-94Career: .581, Sheila Ford, 1980-84

Most Free Throws MadeGame: 15, Wendy Beecher vs. Fordham, 1/4/90Season: 146, Amanda Elder, 2006-07Career: 448, Vicki Giffi n, 1993-97

Most Free Throws AttemptedGame: 17, Sheila Ford, vs. Knoxville, 11/22/83 17, Jessica Guarneri, vs. High Point, 1/9/01Season: 214, Sheila Ford, 1983-84Career: 652, Sheila Ford, 1980-84

Free Throw AccuracyGame: 1.000, Tara McMinn, (14-14) vs. UNCW, 11/25/90Season: .818, Marcia Napier, 1996-97Career: .774, Kristal Hood, 2002-06

Most ReboundsGame: 32, Sheila Ford, vs. Gardner-Webb, 1982-83Season: 690, Sheila Ford, 1981-82Career: 2,200, Sheila Ford, 1980-84

Most Blocked ShotsGame: 6, Wendy Beecher, vs. UNCW, 1/8/87 6, Tonisha Jackson, vs. WCU, 1999-2000Season: 68, Sheila Ford, 1983-84Career: 225, Wendy Beecher, 1986-90

Most Three-PointersGame: 7, Grace Blaylock at Winthrop, 1/14/12Season: 71, Ashley Woods, 1990-91Career: 203, Lindsey Thompson, 2008-12

Most AssistsGame: 11, Julie Thompson, 1983-84Season: 169, Julie Thompson, 1983-84Career: 424, Trish Wyatt, 1981-85

Most StealsGame: 8, Christina Moore, 12/6/93 8, Vicki Giffi n, 12/8/93Season: 82, Kristal Hood, 2004-05Career: 267, Ana Baker, 2005-09

Individual All-Time Records (Division 1)

Most PointsGame: 39, Vicki Giffi n vs. UMBC 1/18/97Season: 506, Emily Hill, 1997-98Career: 1,701, Vicki Giffi n, 1993-97

Most Field GoalsGame: 15, Vicki Giffi n vs. UMBC 1/18/97Season: 172, Vicki Giffi n, 1993-94Career: 578, Vicki Giffi n, 1993-97

Most Field Goal AttemptsGame: 22, Kristal Hood vs. High Point 3/7/06Season: 334, Vicki Giffi n, 1996-97Career: 1,218, Vicki Giffi n, 1993-97

Field Goal AccuracyGame: 1.000, Amanda Brewer (7-7) vs. Morehead State, 11/27/96Season: .597, Vicki Giffi n, 1993-94Career: .474, Vicki Giffi n, 1993-97

Most Free Throws MadeGame: 15, Wendy Beecher vs. Fordham, 1/4/90Season: 146, Amanda Elder, 2006-07Career: 448, Vicki Giffi n, 1993-97

Most Free Throws AttemptedGame: 17, Jessica Guarneri, vs. High Point, 1/9/01Season: 172, Vicki Giffi n, 1995-96Career: 604, Vicki Giffi n, 1993-97

Free Throw Accuracy Game: 1.000, Tara McMinn, (14-14) vs. UNCW, 11/25/90Season: .818, Marcia Napier, 1996-97Career: .774, Kristal Hood, 2002-06

Most ReboundsGame: 28, Kelli Riles vs. USC Upstate, 11-30-11Season: 318, Kelli Riles, 2011-12Career: 894, Wedny Beecher, 1986-90

Most Blocked ShotsGame: 6, Wendy Beecher, vs. UNCW, 1/8/87 6, Tonisha Jackson, vs. WCU, 1999-2000Season: 67, Wendy Beecher 1987-88 Career: 225, Wendy Beecher, 1986-90

Most Three-PointersGame: 7, Grace Blaylock at Winthrop, 1/14/12Season: 71, Ashley Woods, 1990-91Career: 203, Lindsey Thompson, 2008-12

Most AssistsGame: 11, Ana Baker vs. Presbyterian, 12/8/07Season: 134, Ana Baker, 2007-08Career: 406, Ana Baker, 2005-09

Most StealsGame: 8, Christina Moore, 12/6/93 8, Vicki Giffi n, 12/8/93Season: 82, Kristal Hood, 2004-05Career: 267, Ana Baker, 2005-09

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

46 /// F E A R T H E D O G ///

UNC ASHEVILLE TEAM RECORDSMost PointsGame: 114, vs. Limestone, 1993-94Season: 2,242, 2006-07

Most Field GoalsGame: 48, Davidson, 1983-84Season: 1,137, 1983-84

Most Field Goal AttemptsGame: 92, vs. High Point, 1982-83Season: 2,359, 1983-84

Field Goal AccuracyGame: .631, vs. Montreat, 1996-97Season: .482, 1983-84 Most Free Throws MadeGame: 43, vs. Charleston Southern, 1988-89Season: 519, 2006-07

Most Free Throws AttemptedGame: 54, vs. Charleston Southern (1988-89)Season: 802, 2006-07

Free Throw AccuracyGame: 1.000 (23-23) vs. Winthrop, 3-5-10 1.000 (12-12) vs. Charleston Sou., 1996-97Season: .749, 1995-96

Most AssistsGame: 35, vs. Davidson, 1983-84Season: 616, 1983-84

Most Three-Pointers MadeGame: 14, vs. Winthrop, 2-13-12Season: 181, 2006-07

Most Three-Pointers AttemptedGame: 30, at Mercer, Dec. 30, 2006 30, vs. Winthrop, 2-13-12 Season: 540, 2006-07

Most ReboundsGame: 80 vs. Mars Hill, 1981-82Season: 1,477, 1984-85

Most StealsGame: 27, vs. Montreat, 1995-96Season: 449, 1983-84

Most Blocked ShotsGame: 11 vs. Mars Hill, Dec. 4, 2006 Season: 108, 2006-07

Game Records

Highest Score:UNCA 114, Limestone 59, 1994-95

Lowest Score:25, at N.C. State, 1998-99

Highest Opponents Score122, at Georgia, 1993-94

Highest Combined Score210-- Mercer 114, UNCA 96, 1984-85

Largest Winning Margin82-- UNCA 102, Davidson 20, 1983-84

Largest Losing Margin76-- Kansas 112, UNCA 36, 1993-94

Largest Winning Margin (Conference)38-- UNCA 98, Coastal Carolina 60, 1996-97

Largest Losing Margin (Conference)48-- High Point 106, UNC Asheville 58, 3-6-11

Kim Duncan is 2nd all-time on UNCA’s scoring list with 1,975 points from 1981-85.

/// UNC ASHEVILLE BULLDOGS ///

47/// F E A R T H E D O G ///

Year Won Lost .Pct. AVL Points Opp. Points Head Coach1975-76 10 5 .666 902 845 Tom Cochran1976-77 5 10 .333 NA NA Tom Cochran1977-78 10 10 .500 1,363 1,357 Tom Cochran1978-79 10 10 .500 1,413 1,448 Barbara Quinn1979-80 5 17 .227 NA NA Barbara Quinn1980-81 9 13 .375 1,523 1,606 Barbara Quinn1981-82 10 17 .370 1,713 1,806 Helen Carroll1982-83 22 9 .710 2,296 1,905 Helen Carroll1983-84 32 5 .865 2,680 2,103 Helen Carroll1984-85 20 14 .588 2,572 2,403 Ellen Evans1985-86 4 22 .154 1,611 2,048 Mary Ann Myers1986-87 6 20 .231 1,666 2,052 Mary Ann Myers1987-88 11 14 .440 1,768 1,784 Mary Ann Myers1988-89 7 19 .269 1,643 1,926 Mary Ann Myers1989-90 10 17 .370 1,972 2,143 Lalon Jones1990-91 8 19 .296 1,847 2,080 Lalon Jones1991-92 7 20 .259 1,811 2,058 Lalon Jones1992-93 0 27 .000 1,470 2,043 Lalon Jones1993-94 8 20 .286 1,869 2,157 Ray Ingram1994-95 10 17 .370 1,972 2,143 Ray Ingram1995-96 6 21 .222 1,771 2,075 Ray Ingram1996-97 14 13 .519 1,784 1,719 Ray Ingram1997-98 7 22 .241 1,835 2,096 Kathleen Weber1998-99 5 23 .178 1,475 1,960 Kathleen Weber1999-2000 9 17 .346 1,419 1,716 Kathleen Weber2000-01 6 21 .222 1,630 1,928 Kathleen Weber2001-02 1 28 .036 1,532 2,100 Kathleen Weber2002-03 3 25 .111 1,476 1,885 Betsy Blose2003-04 19 9 .679 1,700 1,534 Betsy Blose2004-05 18 12 .600 1,809 1,732 Betsy Blose2005-06 15 13 .536 1,805 1,779 Betsy Blose2006-07 21 12 .636 2,242 2,040 Betsy Blose2007-08 12 18 .400 1,927 2,037 Betsy Blose2008-09 10 20 .333 1,791 2,014 Betsy Blose2009-10 8 22 .267 1,770 2,005 Betsy Blose2010-11 12 18 .400 1,732 1,946 Betsy Blose2011-12 7 23 .233 1,918 2,243 Betsy BloseTotals 375 618 .378

UNC Asheville Head Coaching RecordsCoach Wins Losses Pct Tenure

Tom Cochran 25 25 .500 1975-1978

Barbara Quinn 24 40 .324 1978-1981

Helen Carroll 64 32 .666 1981-1984

Ellen Evans 20 14 .588 1984-1985

Mary Ann Myers 28 75 .231 1985-1989

Lalon Jones 25 83 .231 1989-1993

Ray Ingram 38 71 .349 1993-1997

Kathleen Weber 28 110 .203 1997-2002

Betsy Blose 125 172 .421 2002-12

YEAR-BY-YEAR RESULTS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

48 /// F E A R T H E D O G ///

1980-81 (9-13)Head Coach: Barbara Quinn

AVL Opponent78 Wingate 4875 Carson-Newman 8683 St. Augustine 7786 Furman 5889 Mars Hill 7174 Gardner-Webb 6675 Western Carolina 8958 High Point 10163 Gardner-Webb 8073 Western Carolina 8150 UNC Charlotte 7760 Wake Forest 8571 Belmont-Abbey 8254 Duke 8569 North Carolina A&T 6770 Lenoir-Rhyne 8995 Mars Hill 9470 Pembroke St. 8278 UNC Wilmington 7784 North Carolina A&T 7368 Belmont-Abbey 89

1981-82 (10-17)Head Coach: Helen Carroll

AVL Opponent54 Belmont-Abbey 7462 Carson-Newman 6762 Milligan 8868 UNC Charlotte 7056 Walters State 6663 Western Carolina 7487 Mars Hill 8064 High Point 6752 Walters State 5764 Lenoir-Rhyne 8779 Gardner-Webb 5961 Furman 4670 Campbell 6152 Pembroke St. 6959 UNC Wilmington 8857 Milligan 5870 Western Carolina 6342 East Tennessee St. 6574 Mars Hill 6356 North Carolina A&T 6881 Gardner-Webb 6657 Wingate 7145 Duke 6057 Belmont-Abbey 4671 Lenoir-Rhyne 65

NCAIAW State Tournament82 Gardner-Webb 6158 Campbell 65

1982-83 (22-10)Head Coach: Helen Carroll

AVL Opponent97 Warren Wilson 5359 Carson-Newman 6981 Lincoln Memorial 7469 Furman 7182 High Point 4864 Campbell 6082 Mars Hill 6151 Western Carolina 6984 Gardner-Webb 5944 Livingstone 5390 St. Leo’s 33106 Eckerd 5967 Tampa 5367 Florida International 7167 Armstrong St. 5894 Barber-Scotia 5275 Lincoln Memorial 4955 Lenoir-Rhyne 6359 Belmont-Abbey 7076 Livingstone 5756 Western Carolina 6974 Wingate 8170 Lenoir-Rhyne 4768 Barber-Scotia 5971 UNC Wilmington 5979 Gardner-Webb 4963 Belmont-Abbey 6463 Milligan 5779 Warren Wilson 4868 Mars Hill 49

NAIA District 26 Playoffs75 Wingate 7147 Belmont-Abbey 60

1983-84 (32-5)• NAIA National Champions •

Head Coach: Helen CarrollAVL Opponent80 Furman 6065 Milligan 5270 Knoxville 6956 Campbell 5860 UNC Wilmington 7486 Barber-Scotia 4874 Gardner-Webb 6657 Western Carolina 6176 West Florida 62 63 Phillips College 4656 Dillard 7067 Xavier (La.) 60103 Davidson 2675 High Point 4964 Appalachian St. 5466 Mars Hill 5362 Belmont-Abbey 4573 Campbell 62102 Davidson 2074 Wingate 6264 Lenoir-Rhyne 5067 Barber-Scotia 3178 Mars Hill 6591 UNC Wilmington 7494 Gardner-Webb 6171 Belmont-Abbey 5778 Furman 74

62 Knoxville 6368 Lenoir-Rhyne 50

NAIA District 26 Playoffs94 Atlantic Christian 6278 UNC Wilmington 6662 Pembroke St. 56

NAIA Bi-District XII Playoff87 Spring Garden 59

NAIA National Tournament62 Central Arkansas 6057 SW Oklahoma 5481 Dillard 6472 Portland 70

1984-85 (20-14)Head Coach: Ellen Evans

AVL Opponent83 Milligan 7057 @Tenn.-Wesleyan 7577 Mars Hill 7075 Furman 7081 Newberry 6085 Shorter 8489 @USC-Spartanburg 6283 @Milligan 7276 Western Carolina 6370 @Furman 6766 Barber-Scotia 6961 @Carson-Newman 8496 @Mercer 11458 Campbell 5988 @Winston-Salem St. 8557 Mississippi St. 5886 Southern Methodist 7471 @Baptist 5669 @College of Char. 7664 Appalachian St. 6981 Gardner-Webb 7470 @Mars Hill 6268 @Belmont-Abbey 6279 @Western Carolina 6297 USC Spartanburg 7349 @Campbell 5883 @Barber-Scotia 7377 Lenoir-Rhyne 7665 Francis Marion 8758 @Winthrop 56109 Gardner-Webb 8076 Belmont-Abbey 6270 Mars Hill 64102 Belmont-Abbey 78

ALL-TIME RESULTS (SINCE 1980)

/// UNC ASHEVILLE BULLDOGS ///

49/// F E A R T H E D O G ///

1985-86 (4-22)Head Coach: Mary Ann Myers

AVL Opponent66 Western Carolina 7943 @Appalachian St. 9271 Mars Hill 7862 Berry 8852 @East Tennessee St. 6961 @Benedict 8182 N.C. Central 6745 @Mars Hill 8177 Armstrong St. 7250 Campbell 5961 @Berry 9480 Shorter 9066 Winthrop 8271 @Armstrong St. 8564 Benedict 6776 @N.C. Central 8772 @Warren Wilson 7372 @Georgia College 7368 @Baptist 7658 @Campbell 7141 @Duke 9572 Baptist 7155 @Winthrop 7036 @South Carolina 11177 Warren Wilson 61

1986-87 (6-20)Head Coach: Mary Ann Myers

AVL Opponent48 @UNC Charlotte 10371 Furman 8971 Wofford 6979 Winthrop 7669 Campbell 8856 @N.C. State 10159 Milligan 7061 @Campbell 7349 @Radford 7454 @Winthrop 7560 UNC Wilmington 9979 Coastal Carolina 4468 @Augusta 7277 Mars Hill 8987 Baptist 6563 @Appalachian St. 9647 Radford 5445 Augusta 9485 @Milligan 9562 @Western Carolina 6359 @Baptist 7175 @Coastal Carolina 64

Big South Conference Tournament 69 Winthrop 5668 @Radford 89

1987-88 (11-14)Head Coach: Mary Ann Myers

AVL Opponent77 Gardner-Webb 6282 Erskine 4274 UNC Wilmington 7184 @Furman 9956 @N.C. State 6972 Brown 5772 @Coastal Carolina 7772 Baptist 7067 Wofford 6567 @Campbell 9066 Augusta 8061 @Western Carolina 7272 Campbell 8487 Coastal Carolina 7061 @Winthrop 7391 @Mars Hill 8364 Radford 6867 Western Carolina 6071 Appalachian St. 7885 @Baptist 7660 @Augusta 6273 @Radford 8658 UNC Charlotte 7167 Winthrop 62

Big South Conference Tournament 62 Winthrop 77

1988-89 (7-19)Head Coach: Mary Ann Myers

AVL Opponent77 Limestone 5386 Wofford 6958 @Florida State 9963 Georgia Tech 7861 Furman 8382 @Erskine 5943 N.C. State 9249 @Furman 6153 @UNC Wilmington 7161 Coastal Carolina 5650 Middle Tennessee 8864 Augusta 7653 Western Carolina 5993 Tusculum 7859 Winthrop 7482 @Baptist 8151 @Augusta 5667 Radford 9767 @Coastal Carolina 7160 @Appalachian St. 8699 Baptist 6856 @Radford 10352 Campbell 6859 @Winthrop 69

Big South Conference Tournament 45 Campbell 64

1989-90 (10-17)Head Coach: Lalon Jones

AVL Opponent84 Tusculum 7667 East Tennessee 7881 Limestone 7166 N.E. Louisiana 11374 Fordham 9882 East Tennessee 8893 Coastal Carolina 6861 @Middle Tennessee 9058 Radford 8391 @Baptist 7872 @College of Charleston 8170 Liberty 7662 Campbell 7772 Furman 10578 Augusta 7669 @Winthrop 6873 @Western Carolina 7779 @East Tennessee 9064 @Radford 8481 @Liberty 7855 @Augusta 6485 @Coastal Carolina 6674 Winthrop 8393 Baptist 4671 College of Charleston 7062 @Campbell 86

Big South Conference Tournament 60 Winthrop 75

1990-91 (8-19)Head Coach: Lalon Jones

AVL Opponent71 UNC Wilmington 7061 @Furman 9068 Radford 8268 @Eastern Kentucky 9460 Georgia Southern 10756 @South Alabama 9249 Nicholls St. 6277 @Radford 6354 @Liberty 7872 Coastal Carolina 7692 Western Carolina 8568 Baptist 5860 College of Char. 6860 @UNC Wilmington 7564 @Campbell 8384 @Augusta 9781 @Winthrop 6661 @Western Carolina 6374 Liberty 8159 Augusta 6384 @Coastal Carolina 6979 Winthrop 6382 @Baptist 6557 @College of Char. 8680 Eastern Kentucky 9656 Campbell 72

Big South Conference Tournament 70 Coastal Carolina 76

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

50 /// F E A R T H E D O G ///

1991-92 (7-20)Head Coach: Lalon Jones

AVL Opponent61 UNC Wilmington 6076 @Georgia State 8966 Campbell 6870 @Western Carolina 6847 East Tennessee 7242 @Duke 10072 Liberty 6270 @Charleston So. 7766 @College of Charleston 8572 UNC Greensboro 8576 Coastal Carolina 5665 Campbell 8567 @Radford 8861 Western Carolina 6759 @Campbell 7683 @Coastal Carolina 9065 Charleston Southern 5337 College of Charleston 5567 Furman 8279 @Winthrop 7774 @UNC Greensboro 8665 @Liberty 7985 @East Tennessee 9678 Radford 8863 East Carolina 8382 Winthrop 69

Big South Conference Tournament 59 Winthrop 66

1992-93 (0-27)Head Coach: Lalon Jones

AVL Opponent49 @Appalachian St. 10073 East Tennessee St. 9437 @Marshall 9263 Western Carolina 6848 Davidson 6258 @East Carolina 9257 UMBC 8049 @Towson St. 8167 @Campbell 9564 @Winthrop 7257 @Radford 7967 @UNC Greensboro 8156 @Coastal Carolina 7964 @Western Carolina 9050 @Liberty 6851 Winthrop 6761 @Charleston Southern 6441 UNC Greensboro 8045 Charleston Southern 4961 Coastal Carolina 8046 Radford 8253 Towson St. 8355 @UMBC 7049 @Davidson 5948 Liberty 4952 Campbell 55

Big South Conference Tournament49 Coastal Carolina 72

1993-94 (8-20)Head Coach: Ray Ingram

AVL Opponent59 @Georgia 12268 Elon 4852 @North Carolina 9267 @Western Carolina 7776 Davidson 6178 @East Tennessee 9654 @UMBC 6269 @Towson St. 7169 UNC Greensboro 8668 Campbell 6064 Coastal Carolina 7593 Charleston Southern 7787 Wofford 10056 @Radford 7969 @Liberty 7469 @Winthrop 7063 UMBC 6669 Towson St. 7354 @UNC Greensboro 9051 @Campbell 8949 @Coastal Carolina 6566 @Charleston Southern 7077 Radford 6984 Liberty 7136 @Kansas 11274 Winthrop 67

Big South Conference Tournament 74 Charleston Southern 5774 UNC Greensboro 77

1994-95 (10-17)Head Coach: Ray Ingram

AVL Opponent57 @Duke 114114 Limestone 5976 High Point 6761 @Wake Forest 7148 @St. John’s 10246 Alabama 11974 Charleston Southern 7059 Coastal Carolina 5276 Liberty 7161 UNC Greensboro 6774 Radford 8781 Winthrop 7231 @Georgia 10260 @UMBC 6357 @Towson St. 7455 Kentucky 7071 @Coastal Carolina 7782 Western Carolina 8152 @Liberty 6871 @Radford 7867 Rice 9068 @Winthrop 6661 UMBC 5984 Towson St. 5572 @UNC Greensboro 8664 @Charleston Southern 66

Big South Conference Tournament 74 @Radford 85

1995-96 (6-21)Head Coach: Ray Ingram

AVL Opponent76 @Kentucky 9858 West Virginia 8057 Duke 9595 Montreat 6565 @Wofford 6354 @North Carolina 8858 Wake Forest 10470 Mercer 7173 East Tennessee St. 7656 @Hampton 5836 @Georgia 10167 Coastal Carolina 7870 Liberty 5754 @UNC Greensboro 7352 @UMBC 6466 Winthrop 7781 Radford 8655 @East Tennessee St. 7489 @Coastal Carolina 7071 @Liberty 7271 UNC Greensboro 5356 UMBC 7366 @Winthrop 7058 @Radford 8673 @Charleston Southern 7879 Charleston Southern 67

Big South Conference Tournament65 @Radford 98

1996-97 (14-13)Head Coach: Ray Ingram

AVL Opponent52 @Duke 9068 Morehead St. 5595 Montreat 3755 @UNC Charlotte 4151 @Mercer 5567 @Liberty 6857 @UT-Chattanooga 6272 Morehead St. 6375 Western Carolina 7065 Georgia St. 6366 @Coastal Carolina 6748 @College of Charleston 6772 UNC Greensboro 7673 UMBC 7082 @Winthrop 6462 @Radford 6061 @Western Carolina 6966 @Charleston Southern 6998 Coastal Carolina 6044 @Georgia 8368 Liberty 5963 Winthrop 6968 @UMBC 4667 Charleston Southern 5577 Radford 61

Big South Conference Tournament 60 Winthrop 70

/// UNC ASHEVILLE BULLDOGS ///

51/// F E A R T H E D O G ///

1997-98 (7-22)Head Coach: Kathleen Weber

AVL Opponent61 UNC Greensboro 7847 UNC Charlotte 5648 @North Carolina 9064 @Richmond 9361 @High Point 7762 @Georgia State 7654 @Cincinnati 8274 Chattanooga 7968 UNC Wilmington 7563 @Western Carolina 5054 @UMBC 6280 @Radford 8161 Liberty 7278 Coastal Carolina 6379 Winthrop 7757 Charleston Southern 6766 @Coastal Carolina 7866 @Elon 6963 @Charleston Southern 7565 Elon 7076 Radford 7761 @Liberty 8359 UMBC 5150 @Clemson 8764 @Winthrop 6160 Western Carolina 69

Big South Conference Tournament 60 Coastal Carolina 5981 Radford 7453 @Liberty 65

1998-99 (5-23)Head Coach: Kathleen Weber

AVL Opponent26 @Clemson 9353 @UNC Greensboro 6925 @N.C. State 9347 @UNC Wilmington 7042 @Auburn 7461 @Western Carolina 6840 @South Carolina 8055 @Appalachian St. 7163 Middle Tennessee 7727 @Duke 9466 Morehead St. 6455 Temple 4859 College of Char. 7256 Liberty 7170 @Radford 7147 @Elon 5841 @High Point 6856 @Coastal Carolina 6158 Charleston Southern 5664 Winthrop 6767 Radford 6850 High Point 5143 @Charleston Southern 8668 Coastal Carolina 5253 @Liberty 7446 @Winthrop 82

Big South Conference Tournament 61 Radford 66

1999-00 (9-17)Head Coach: Kathleen Weber

AVL Opponent56 @Louisville 7936 @LSU 9132 @Tulane 9650 Western Carolina 5268 Appalachian State 7730 @Auburn 8683 @Morehead State 6961 @Middle Tennessee 7460 Tennessee Tech 7356 Clemson 7548 Georgia State 6463 @Charleston Southern 5666 Liberty 7148 Radford 5655 Elon 5157 @High Point 4367 Winthrop 5954 @Coastal Carolina 6455 @Radford 5950 @Elon 4749 @Liberty 8351 High Point 6153 Coastal Carolina 4963 Charleston Southern 6166 @Winthrop 61

Big South Conference Tournament 39 Elon 58

2000-01 (6-21)Head Coach: Kathleen Weber

AVL Opponent55 @Georgia State 7464 @Florida State 8931 @Auburn 7069 @Appalachian State 6763 William & Mary 5947 @College of Charleston 6351 @Vanderbilt 10759 @Tennessee Tech 8057 Western Carolina 7547 @Virginia Tech 8573 Marshall 8586 Gardner-Webb 6676 @Elon 8870 High Point 7651 @Radford 5353 Liberty 6880 Charleston Southern 7056 @Winthrop 6452 Coastal Carolina 5881 Radford 6258 @Liberty 6661 Elon 8549 @High Point 5857 @Coastal Carolina 6560 @Charleston Southern 7475 Winthrop 64

Big South Conference Tournament 49 Liberty 57

2001-02 (1-27)Head Coach: Kathleen Weber

AVL Opponent48 Appalachian State 8154 Belmont 8156 @Georgia Tech 8851 Harford 8953 @Western Carolina 8068 East Tennessee 7861 Gardner-Webb 6646 Tennessee Tech 8946 @Wake Forest 7669 @William & Mary 9646 @Coastal Carolina 6271 High Point 7434 @Charlotte 6753 @Liberty 7346 Birmingham-Southern 6857 Elon 8054 @Radford 7368 Charleston Southern 7471 Winthrop 6152 @Birmingham-Southern 6859 Liberty 7141 @Elon 6836 @High Point 6561 Radford 6957 Coastal Carolina 6960 @Charleston Southern 7662 @Winthrop 82

Big South Conference Tournament 52 Liberty 76

2002-03 (3-25)Head Coach: Betsy Blose

AVL Opponent35 @Appalachian State 6881 North Carolina A&T 6255 Western Carolina 7173 @South Carolina State 8967 Mars Hill 6062 @Belmont 7646 @Tennessee Tech 6962 Samford 5678 Tennessee-Martin 8577 @East Tennessee 8440 @High Point 5947 Charlotte 8544 @Elon 5230 @Birmingham-Southern 6745 Liberty 8057 Charleston Southern 7543 @Radford 5549 Coastal Carolina 6447 @Winthrop 6439 High Point 6942 @Liberty 6147 Birmingham-Southern 5358 @Charleston Southern 6347 @Coastal Carolina 5360 Radford 7044 Elon 6162 Winthrop 64

Big South Conference Tournament 39 @Liberty 70

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

52 /// F E A R T H E D O G ///

2003-04 (19-9)Head Coach: Betsy Blose

AVL Opponent48 @American 5252 @Towson 7183 Montreat 4659 Tennessee St. 4755 East Tennessee 4951 @Western Carolina 4145 @Samford 5370 Appalachian St. 6164 @North Carolina A&T 5464 @Jacksonville 4156 UT-Martin 5367 South Carolina St. 5278 @Wofford 5951 Birmingham-Southern 4364 @Winthrop 4768 High Point 6645 @Radford 3946 Liberty 6567 @Charleston Southern 8154 @Coastal Carolina 6878 Winthrop 6252 @High Point 5866 Radford 4850 @Liberty 6768 Coastal Carolina 4167 Charleston Southern 4483 @Birmingham-Southern 70

Big South Conference Tournament 49 Birmingham-Southern 56

2004-05 (18-12)Head Coach: Betsy Blose

AVL Opponent51 vs. Lehigh 6162 vs. Texas-Pan American 6565 @ Furman 7946 American 4881 Montreat 5083 Western Carolina 7282 Wofford 80 79 North Carolina A&T 5951 vs. Delaware State 5752 vs. Morehead State 4764 Gardner-Webb 5864 @Tennessee State 5358 @Birmingham-Southern* 4652 @Winthrop* 3343 Liberty* 7055 Radford* 5262 @High Point* 6566 Longwood 5072 Coastal Carolina* 4363 Charleston Southern* 4962 @Liberty* 7469 @Radford* 7944 High Point* 6154 Winthrop* 4852 @Coastal Carolina* 4868 @Charleston Southern* 5456 Birmingham-Southern* 58

Big South Conference Tournament 47 Radford 3275 vs. High Point 5341 @ Liberty 88

2005-06 (15-13)Head Coach: Betsy Blose

AVL Opponent65 Jacksonville 4764 Campbell 6058 @Gardner-Webb 4643 @North Carolina 8377 @Western Carolina 6666 Furman 6259 Chattanooga 8479 Sewanee 3580 North Carolina A&T 6279 vs. North Dakota State 7352 @Montana 7073 Montreat 4071 @Longwood 7770 High Point* 7351 @Winthrop* 5468 @Coastal Carolina* 6580 @Charleston Southern* 5872 Radford* 6961 Birmingham-Southern* 6650 @Liberty* 6651 @High Point* 5049 Winthrop* 4764 Coastal Carolina* 5757 Charleston Southern* 6060 Liberty* 6752 @Radford* 7665 @Birmingham-Southern* 66

Big South Conference Tournament 89 @ High Point 100

2006-07 (21-12)• Big South Tournament Champs •

Head Coach: Betsy BloseAVL Opponent55 @Davidson 6763 Morgan State 4573 IPFW (ot) 6973 @ Campbell 8179 East Tennessee State 9178 Western Carolina 8168 Presbyterian 5262 Mars Hill 4759 @North Carolina A&T 6355 Gardner-Webb 3759 @Chattanooga 7283 vs. Kennesaw State 7664 @Mercer 5199 Montreat 4058 @Wake Forest 5360 @Winthrop* 4772 High Point* 6961 Coastal Carolina* 7372 Charleston Southern* 5572 @Birmingham-Southern 6162 Liberty* 6667 @Radford 7274 @Coastal Carolina* 4673 @Charleston Southern* 7689 Winthrop* 7453 @High Point* 5954 @Liberty* 5184 Radford* 7086 Birmingham-Southern* 58

Big South Conference Tournament 65 Coastal Carolina 5164 Winthrop 5367 Radford 57

NCAA Tournament 39 vs. LSU 77

The 2006-07 UNC Asheville women’s basketball team won the Big South Confer-ence tournament with victories over Coastal Carolina, Winthrop and Radford,

earning a berth in the NCAA Tournament for the fi rst time in the program’s history

/// UNC ASHEVILLE BULLDOGS ///

53/// F E A R T H E D O G ///

2007-08 (12-18)Head Coach: Betsy Blose

AVL Opponent75 Montreat 4856 Davidson 6976 Gardner-Webb 6079 Furman 6762 vs. North Carolina A&T 8877 @UNC Greensboro 7074 @Western Carolina 8953 @East Tennessee State 7287 Presbyterian 5468 Campbell 5570 @Gardner-Webb 8266 Mercer 6063 vs. Alabama A&M 6660 vs. Holy Cross 7952 @South Carolina 8068 @Presbyterian 6462 USC Upstate 5270 High Point* 8163 Coastal Carolina* 5461 @Charleston Southern* 7449 @Radford* 6854 Winthrop* 7555 @Liberty* 6946 @Coastal Carolina* 5479 @High Point* 6371 Charleston Southern* 8258 Radford* 7046 Liberty* 6063 @Winthrop* 60

Big South Conference Tournament 64 Radford 72

2008-09 (10-20)Head Coach: Betsy Blose

AVL Opponent49 Fairfi eld 6950 William & Mary 6230 @ Furman 7139 @ Georgia Southern 5264 Montreat 5864 South Carolina State 6790 Western Carolina 7150 Charlotte 7284 Johnson C. Smith 7853 @ Campbell 6557 @ Maryland 9068 vs. Marshall 8955 @ Coastal Carolina* 6870 @ Charleston Southern* 6674 Carson-Newman 7867 Gardner-Webb* 5962 Presbyterian* 3652 Radford* 5048 Liberty* 7551 @ High Point* 5947 Winthrop* 5687 Charleston Southern* 8370 Coastal Carolina* 7567 at Presbyterian* 5861 at Gardner-Webb* 7468 High Point* 5941 at Liberty* 7748 @ Radford* 5358 @ Winthrop* 72

Big South Conference Tournament 67 @ High Point 72

2009-2010 (8-22)Head Coach: Betsy Blose

AVL Opponent53 Newberry 6667 @South Carolina State 6082 Lees-McRae 5867 Campbell 7860 @USC Upstate 7851 @Western Carolina 6237 @UNC Charlotte 5994 Southern Wesleyan 6338 Georgia Southern 5668 Elon 7353 vs. Western Michigan 6450 vs. Lafayette 4359 Coastal Carolina* 4850 Charleston Southern* 6754 @Gardner-Webb* 7054 @Presbyterian* 6550 @Radford* 6140 @LIberty* 8264 NC Central 5863 High Point* 7738 @Winthrop* 4487 @Charleston Southern* 9041 @Coastal Carolina* 6066 Presbyterian* 5963 Gardner-Webb* 7449 @High Point* 7866 Liberty* 9475 Radford* (ot) 6866 Winthrop* 73

Big South Conference Tournament65 Gardner-Webb 77

2010-11 (12-18)Head Coach: Betsy Blose

AVL Opponent78 Montreat 6559 Western Carolina 7878 @ Campbell 7595 USC Upstate 7661 Brevard College 7271 @ Appalachian State 9986 Furman 7584 South Carolina State 6946 @ Marquette 7576 @ Mercer 7367 @ North Carolina Central 5669 Radford* 8175 High Point* 9444 Liberty* 6165 @ Coastal Carolina* 5374 @ Charleston Southern* 8564 Winthrop* 7166 Longwood 7660 @ Gardner-Webb* 5951 @ Presbyterian College* 5370 @ Radford* 6073 @ Longwood* 7768 Presbyterian College* 7465 Gardner-Webb* 6879 Charleston Southern* 9867 Coastal Carolina* 6466 @ Winthrop* 6158 @ Liberty* 7258 @ High Point* 106

Big South Conference Tournament58 vs. Gardner-Webb 69

2011-12 (7-23)Head Coach: Betsy Blose

AVL Opponent83 Winston-Salem State 7453 @Western Carolina 6573 Montreat College 6459 @Furman 7159 @George Mason 8866 USC Upstate 7371 Appalachian State 8579 @Kennesaw State 8382 @South Carolina State 9276 Mercer 7574 Brevard College 6249 @High Point* 8962 @Campbell* 8269 Coastal Carolina* 6075 Charleston Southern* 6868 @Winthrop* 8454 @Presbyterian* 6274 Gardner-Webb* 6256 Liberty* 7862 Radford* 7270 @Charleston Southern* 8858 @Coastal Carolina* 7445 Presbyterian* 6268 Winthrop* 7952 @Gardner-Webb* 6967 @Radford* 7953 @Liberty* 8455 Campbell* 7456 High Point* 74

Big South Conference Tournament50 Liberty 71

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

54 /// F E A R T H E D O G ///

The 1983-84 women’s basketball season will always have a special place in the hearts of all UNC Asheville fans. In 1984, the women’s basketball team fi nished on top by winning a national championship. The Bulldogs with just 10 players, a coach retiring and a team with a lot of heart claimed the 1984 NAIA national championship in Cedar Rapids, Iowa with four thrilling victories.

UNCA began the 1983-84 season with a great deal of optimism as head coach Helen Carroll welcomed back all fi ve starters from a team that went 22-9 the previous year. Included in the mix was center Sheila Ford, who would become the fi rst player in college basketball history to score more than 2,000 points and grab 2,000 rebounds. UNCA also had talented starters back in Kim Duncan and Trish Wyatt. Duncan completed her career as the school’s second all-time leading scorer, while Wyatt would fi nish as the fourth leading scorer. Point guard Julie Thompson would do a great job running the offense.

The Bulldogs enjoyed an excellent regular season and was ready for the District 26 playoffs. They routed Atlantic Christian, 94-62 in the opening round of the playoffs and then stunned UNC Wilmington, 78-66 in the semifi nals. The District 26 championship game would mean a trip to heavily favored Pembroke State.

However, the Bulldogs and Ford would prove to be too tough for Pembroke. UNCA shocked the home team, 62-56 as Ford had 26 rebounds, outrebounding the entire Pembroke team that fi nished with just 24. Carroll’s club hit clutch shot after clutch shot to claim the program’s fi rst ever district championship.

To get to the NAIA national tournament, the Bulldogs would have to win a home game against Spring Garden in the NAIA Bi-District Playoff game. Asheville won easily, 87-59 and it was on to Iowa.

The Bulldogs came to Cedar Rapids unranked in the Top 20 polls and were lightly regarded. UNCA then played four of the most exciting games in tournament history.

In the opening game, the Bulldogs trailed by eight points late in the contest. However, Asheville roared back to win the game, 62-61. Ford had 21 points, while Duncan and Wyatt combined for 35 points.

The next night would be a pretty big test. Two-time defending NAIA national champion Southwest Oklahoma entered the quarterfi nals with a 47-game winning streak. They had been featured in Sports Illustrated, and the Bulldogs were supposed to be nothing but a warm-up game. However, Asheville stayed close the whole game and took the lead late. Ford fi nished with 23 points, and Thompson sank two free throws with three seconds left to seal the stunning upset, 57-54.

In the semifi nals, the Bulldogs would meet Dillard (La.). Dillard had routed UNCA earlier in the season at home, 70-56. Things were much different this time around. Ford was simply unstoppable with 41 points and 19 rebounds. Off the bench, reserve forward Dawn Snyder came off the bench to score seven crucial points as UNCA roared into the championship game, 81-64.

The championship game would be a classic as the Bulldogs would take on a strong Portland squad. There were numerous lead changes before Portland took a 65-63 late in the game. However, Duncan would score with seven seconds remaining to tie the game at 65-65 and send the game into overtime.

In overtime, the Bulldogs scored the fi rst fi ve points to grab a 70-65 lead. Portland countered with fi ve straight points to knot the game at 70-70. UNCA decided to hold for a last shot and with three seconds left, Wyatt nailed a jumper from the left of the lane to give the Bulldogs a 72-70 lead. Portland’s last shot missed and the Bulldogs were the 1984 NAIA national champions.

Ford led all scorers with 26 points and 21 rebounds. She fi nished the tournament with 111 points and 66 rebounds. Ford earned MVP honors, while Duncan earned all-tournament honors.

The Bulldogs fi nished the season with a 32-5 overall record and produced the perfect send-off for Carroll, who retired at the end of the season.

The championship was almost 30 years ago but will never be forgotten by Bulldog fans.

1984 NAIA NATIONAL CHAMPIONS

/// UNC ASHEVILLE BULLDOGS ///

55/// F E A R T H E D O G ///

The name Sheila Ford will always have a special place in UNC Asheville Athletics history. Never before and probably never again will a player distinguish herself the way Ford did during her sensational career at UNCA from 1980-1984.

One only needs to glance at Ford’s career’s statistics and honors to realize the magnitude of her accomplishments. The phrase weathers with age, but she will never be less than “The Franchise” as she led the Bulldog program to national recognition.

The 1984 NAIA national tournament was a career in miniature for Ford. She averaged an amazing 27.8 points and 16.5 rebounds to lead UNC Asheville to its fi rst and only national championship. Her amazing accomplishments earned her fi rst team All-American honors and she was also named as the Most Valuable Player for the NAIA Tournament that was played in Cedar Rapids, Iowa.

Ford was the fi rst player in the history of women’s collegiate basketball to collect over 2,000 points and 2,000 rebounds. More than 20 years later, she still holds 18 records at UNC Asheville. Her 2,200 rebounds are the most of any collegiate player on any level at this time.

Her dedication and hard work to improve are an example to all players. The Clarkton native was lightly recruited out of high school, but once she arrived at UNC Asheville in the fall of 1980, Ford set her goals high and never lost sight of them.

In the fall of 2003, Sheila was part of the UNC Asheville Athletics Hall of Fame inaugaral class. She and her family live in Bowling Green, Ky., where she is an instructor at Western Kentucky University.

Sheila Ford’s Career Statistics

YR GP-GS FGM-FGA .PCT FTM-FTA .PCT REB-AVG BL PTS-AVG FR 22-22 183-315 .580 75-117 .640 376-17.1 40 441-20.0SO 27-27 200-397 .504 200-397 .619 507-18.8 68 488-18.1JR 32-32 268-475 .564 104-187 .556 627-19.6 53 640-20.0SR 37-37 365-639 .571 144-214 .673 690-18.6 62 874-23.6_____________________________________________________________________________Totals 118-118 1060-1826 .581 406-652 .623 2200-18.6 223 2443-20.7

UNC Asheville’s Sheila Ford is being given the MVP trophy of the 1984 NAIA national tournament after leading the Bulldogs to the national championship in Cedar Rapids, Iowa.

SHEILA FORD

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

56 /// F E A R T H E D O G ///

UNC Asheville’s Athletics Hall of Fame was established in 2003 and has had fi ve classes inducted. A total of 26 athletes and administrators have been enshrined. Of those 26 inductees, three are former women’s basketball players: Sheila Ford Duncan, Kim Duncan, and Trish Wyatt. One is former coach Helen Carroll

Sheila Ford Duncan (1980-84)Inducted in 2003

Sheila Ford Duncan enjoyed a tremendous career at UNC Asheville. She played from 1980-84 and led UNCA to the NAIA national championship in 1984, earning MVP honors along the way. She is the school’s all-time leader in scoring (2,443) and rebounds (2,200). The Clarkton native holds 18 individual records at UNCA and earned fi rst team All-America honors as a senior. She was the fi rst player in women’s collegiate basketball history to collect more than 2,000 points and 2,000 rebounds. She and her family currently live in Bowling Green, Ky.

Kim Duncan (1980-84)Inducted in 2004

Kim Duncan enjoyed a fabulous career at UNC Asheville. She fi nished her career as the school’s second all-time leading scorer with 1,975 points and third leading rebounder with 888 rebounds. Kim helped lead the Bulldogs to three straight winning seasons and the NAIA national championship in 1984. She scored the second highest amount of points in school history with 659 in the 1983-84 season. Kim was UNC Asheville’s leading scorer in the 1984-85 season with a 17.8 average. She was named as a fi rst team NAIA All- Tournament performer in 1984. Kim was a four-year starter for the Bulldogs and is the school’s all-time leader in games played with 129.

UNC Asheville Hall of Fame InducteesHerb Coman, Contributor & Coach

Bob Hartman, Men’s Basketball Coach & Athletics Director

Jim McElhaney, Men’s BasketballSheila Ford Duncan, Women’ Basketball

Ilona Fekete Thimmer, VolleyballEd Harris, Athletics Director

Jerry Green, Men’s Basketball CoachKim Duncan, Women’s Basketball

Brian Shehan, BaseballTom Hunnicutt, Athletics Director

Jenee Cross Daniely, Women’s TennisUlrich Dietrich, Men’s Soccer

Mickey Gibson, Men’s BasketballMike Grace, Men’s BasketballPatrick Britz, Men’s Soccer

Danielle Meyer Harrison, VolleyballJill Young Booth, Women’s Soccer

Paul Allen, Men’s BasketballDave Hart, Contributor

Elissa Steffen Mount, VolleyballRebecca Vonderhaar Gallaher, XC & Track & Field

Aytekin Yildiz, Men’s SoccerTrish Wyatt, Women’s BasketballBamford Jones, Men’s Basketball

Helen Carroll, Women’s BasketballJosh Pittman, Men’s Basketball

George Gilbert, Men’s BasketballMackenzie Miller McCoy, Women’s Soccer

Ty Wigginton, Baseball

Trish Wyatt (1982-85)Inducted in 2009

Trish Wyatt was a member of the 1984 NAIA Women’s Basketball National Championship team. She was a four-year starter and fi nished her career as the program’s fourth all-time leading scorer with 1,606 points. The Asheville native is the school’s all-time leader in assists with 424. She hit the winning basket in the national championship game against Portland. Wyatt works as a Behavioral Specialist with the Swannanoa. Training Center

Helen Carroll (1981-84)Inducted in 2010

Helen Carroll guided UNC Asheville to the 1984 NAIA women’s national basketball championship in her third and fi nal season as head coach. The 1983-84 team fi nished with a 32-5 record, the best in the school’s athletic history. She compiled a career record of 64-32 for a winning percentage of .667 that is still unmatched by any UNC Asheville coach. She retired from coaching following the historic season and worked at UNC Asheville in Athletic Administration for three years before moving on to become the Director of Athletics at Mills College in Oakland, Calif.

UNC ASHEVILLE HALL OF FAME

/// UNC ASHEVILLE BULLDOGS ///

57/// F E A R T H E D O G ///

ATyronnica Alford 2005-06Jamie Allen 1986-88Linda Aughburns 2008-10

BJackie Bacoate 1981-83Ana Baker 2005-09Carrie Baker 1982-85Allison Baldwin 1993-94Katie Baldwin 2004-07Breiara Barksdale 2009-11Aretha Barnes 1986-90Ashton Barton 2004-08Wendy Beecher 1986-90Carla Berry 1989-91Lisa Berry 1979-82Ansley Bienvenu 2001-02Cathy Black 1983-84Grace Blaylock 2009-Tasha Branch 2005-07Amanda Brewer 1994-98Rebecca Brown 1988-89Misty Buchanan 1982-83Stephanie Buchanan 1982-83April Buckner 1981-82Jeannie Buckner 2011-

CUrsula Carswell 1992-94Lee Christiansen 1994-97Andrea Clapp 2003-05 Blake Cokes 2010-Mary Colbert 1980-81Renee Colbert 1980-81Meghan Conley 1995-99Candy Credito 1995-99

DHunter Daniel 1997-99Sherri Daniels 2001-03Lisa Davis 1984-85Tascha Davis 1989-91Tracey Demetris 1981-82Ipek Derici 2008-09Kim Duncan 1981-85

ECandi Earwood 1985-86Mandy Edwards 1994-98Amanda Elder 2003-07

FElisa Fellers 1995-99Sheila Ford 1980-84Fonda Frady 1985-87Amanda Frazier 1993-95Amy Freed 1994-98

GCary Gay 1994-98Vicki Giffi n 1993-97Dee Godette 1990-94Meridth Grant 1003-04Kim Groendal 1984-85Jessica Guarneri 1999-02

HShelly Hall 1988-92Terri Hall 1983-85Kristi Hancock 1988-92Rachel Harris 1979-81Brittany Hendley 2003-07Darlene Hewitt 1987-92Emily Hill 1996-01Tia Hill 1998-99Kristal Hood 2002-06Meredith Horne 1993-97Casey Hunter 1998-01Amanda Hyatt 1992-93

JTonisha Jackson 1999-04Jessica Januseski 1994-98Lori Jones 1992-93JeTonne Jones 1986-89Kyla Jones 2006-09Shonese Jones 2011-

KKim Keith 1984-85Shamry Kenley 1998-00Tynisha King 1998-00Kate Kinney 1990-91Laura Kirby 2001-05Beverly Knupp 1984-86Mechio Kornegay 1984-88Beth Krivda 1980-85Marion Kuehn 1996-99

LSherri Logan 1983-85Carol Lowery 1987-89

MLori MacKanin 1980-83Mary Mackey 1986-88Gentry Manley 2010-Joy Marschall 1999Diane Martin 1980-81Beth Matthews 1990-94Tara McMinn 1989-92Christy McNeil 1994-95Izrawit Medhanie 1998-01Jessica Monroe 2005-09Arescia Moore 2007-10Christina Moore 1990-94Lindsey Montgomery 2007-11Lisa Morgan 1979-81Amy Mulnix 2004-06Tia Murdock 1990-92Gillian Murray 1999-03Lisa Myers 1984-85

NMarcie Napier 1993-97Lynn Nestor 1990-92

OChioma Okoli 2007-11Alli Opfer 2003-05

PKaren Parker 1982-83Pam Parker 1984-86Phyllis Payne 1978-82Dana Polakowski 1995-98Kim Pride 1988-89

RKiana Rainey 2007-10Michelle Ray 1996-97Melanie Rhodarmer 1986-88Tawana Rickman 1983-84Kelli Riles 2009-Paula Roberts 1990-93Lisa Roberts 1981-84Lindsey Roche 2001-05Lisa Rowells 1980-83Susan Roy 1992-93

SNicole Sampson 1997-01Liz Sadtler 1980-81Mary Elizabeth Scherger 2000-01Kendall Shepard 2007-11Stacy Shepard 2004-08K’Shaki Short 1998-00Abra Sickles 2010-Myra Sims 1978-82Stephanie Smith 1991-94Cindy Smith 1985-88Monica Smith 1993-94Dawn Snyder 1982-86Donna Spratt 1986-87Joanne Stephenson 2000-03Julie Stephenson 2000-03

TJulie Thompson 1982-86Lindsey Thompson 2008-12Tacey Trammel 2011-

VVelinda Vuncannon 2003-05

WDana Wagner 2009-11Shantell Waiters 2002-04Tabby Welch 1984-85Sheena West 1990-94Mackenzie Wheaton 2009-10Stephanie White 1986-87Yvette Widmer 1980-81Denise Wilbanks 1999-01Rachel Williams 2006-07Katie Wise 2009-12Heather Woodfi n 1991-94Ashley Woods 1987-91Brianna Worley 2006-07Leah Wormack 2011-Trish Wyatt 1982-85

YLeslie Young 2003-07

Bold indicates returning player

ALL-TIME LETTERWINNERS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

58 /// F E A R T H E D O G ///

/// UNC ASHEVILLE BULLDOGS ///

59/// F E A R T H E D O G ///

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

60 /// F E A R T H E D O G ///

Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”

The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.

During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid -- receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation.

In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 15 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new heights. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.

Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and oversaw the additions of men’s and women’s indoor track & fi eld in 1997. The Conference’s 19th championship sport -- women’s lacrosse, will begin play in 2012-13 with seven members. At the same time, Kallander has solidifi ed Conference membership, as an all-time high 11 member institutions comprise the 28-year League in 2011-12. Recent additions include High Point, Gardner-Webb and Presbyterian College, plus the return of charter member Campbell University this year. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 700 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.

In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had an individual National Champion six times, more than 240 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in football, men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship six times in addition to the fi rst men’s tennis doubles at-large selection, had the fi rst women’s golf program advance to the national fi nals, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team fi ve consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, has had four NFL Draft picks, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships - the Conference’s highest-ever team fi nish in an NCAA event.

In 2006-07, the Big South was the only Conference nationwide to have an at-large participant in the football playoffs (Coastal Carolina), a team in the Second Round of the NCAA Men’s Basketball Tournament (Winthrop) and a No. 1 seed in the NCAA Baseball Regionals (Coastal Carolina). In fact, Coastal Carolina’s baseball program has been a No. 1 seed four out of the last seven years - including a national seed for the fi rst time in 2010, while the Chanticleers’ FCS playoff berth in 2006 came in just the fi fth-year of the Big South’s football existence. The 2009-10 season saw Liberty’s Sam Chelanga win two NCAA National Championships (cross country, 10,000-meter run), Coastal Carolina’s baseball team reach the Super Regionals for the second time in three years as well as being ranked No. 1 in the national RPI and as high as No. 3 in the national polls; and three women’s basketball teams reach the postseason for the fi rst time in Conference history. Last season, Chelanga won two more NCAA National Championships (cross country, outdoor 5,000-meter run), the Big South had its fi rst automatic bid recipient in football (Coastal Carolina), UNC Asheville reached the Second Round of the NCAA Men’s Basketball Tournament, Coastal Carolina’s women’s golf team was the fi rst in Conference history to advance to the NCAA Championship out of Regional play, and a League-record 18 baseball players were drafted in the 2011 MLB First-Year Player Draft.

Several former Big South student-athletes have also reached national prominence in recent years. Coastal Carolina’s Amber Campbell made the 2008 U.S. Olympic Team - one of fi ve former Big South athletes to compete in the Games; VMI’s Reggie Williams reached the NBA with the Golden State Warriors in 2010, UNC Asheville’s Ty Wigginton was named an American League All-Star in 2010, and Coastal Carolina’s Dustin Johnson has won four PGA Tour events since departing the Big South Conference in 2007 and tied for runner-up at the 2011 Open Championship.

The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its 27 years of existence. Furthermore, the Big South has a record number of NCAA Public Recognition Awards for APR progress the last two years.

THE BIG SOUTH CONFERENCE

/// UNC ASHEVILLE BULLDOGS ///

61/// F E A R T H E D O G ///

BIG SOUTH CONFERENCE7233 Pineville-Matthews Road, Suite 100

Charlotte, NC 28226Phone: (704) 341-7990

Fax: (704) 341-7991www.BigSouthSports.com

Founded 1983

PresidentPenelope W. Kyle, Radford University

Vice PresidentDr. Frank Bonner, Gardner-Webb University

SecretaryDr. Anne Ponder, UNC Asheville

CommissionerKyle B. Kallander

Associate CommissionerJames Companion

Associate CommissionerDawn Turner

Assistant Commissioner - Public RelationsMark Simpson

Assistant Commissioner - MarketingChad Cook

Director of Multimedia DevelopmentMark Bryant

Offi ce ManagerTerri Ballard

Assistant Director of MarketingMatt VanSandt

Assistant Director of Public RelationsNic Bowman

Assistant Director of ComplianceSherika McLean

Marketing AssistantMelissa Estepp

Public Relations AssistantBriana Mayes

Administration/Multimedia AssistantEarl Laing

Coordinator of Football Offi cialsDoug Rhoads

Coordinator of Men’s Basketball Offi cialsJoe Forte

Coordinator of Women’s Basketball Offi cialsCharlene Curtis

Coordinator of Baseball UmpiresTony Thompson

Coordinator of Softball UmpiresBetsy Kidd

Coordinator of Men’s Soccer Offi cialsPaul James

Coordinator of Volleyball Offi cialsDaniel Leake

Member Institutions (12): Campbell University, Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Longwood University, Presbyterian College, Radford University, UNC Asheville, Virginia Military Institute, Winthrop University

Geographical Breakdown (3 states): North Carolina (4) – Campbell University, Gardner-Webb University, High Point University, UNC Asheville; South Carolina (4) – Charleston Southern University, Coastal Carolina University, Presbyterian College, Winthrop University; Virginia (4) – Liberty University, Longwood University, Radford University, Virginia Military Institute

Associate Members: Stony Brook University (football), Davidson College (women’s lacrosse)

Championship Sports (19): Baseball, Men’s Basketball, Women’s Basketball, Men’s Cross Country, Women’s Cross Country, Football, Men’s Golf, Women’s Golf, Women’s Lacrosse, Men’s Soccer, Women’s Soccer, Softball, Men’s Tennis, Women’s Tennis, Men’s Indoor and Outdoor Track & Field, Women’s Indoor and Outdoor Track & Field, Volleyball

Council of Chief Executive Offi cers: Jerry Wallace, Campbell; Jairy C. Hunter, Jr., Charleston Southern; David DeCenzo, Coastal Carolina; Frank Bonner, Gardner-Webb; Nido Qubein, High Point; Jerry L. Falwell, Jr., Liberty; Marge Connelly, Longwood; Dr. Claude Lilly, Presbyterian; Penelope W. Kyle, Radford; Anne Ponder, UNC Asheville; J.H. Binford Peay III, VMI; Anthony J. DiGiorgio, Winthrop

BIG SOUTH QUICK FACTS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

62 /// F E A R T H E D O G ///

UNC Asheville in the Big SouthYear Won Lost .PCT Finish1986-1987 4 8 .333 5th1987-1988 4 8 .333 5th1988-1989 3 9 .250 6th1989-1990 6 6 .500 4th1990-1991 6 6 .500 4th1991-1992 5 7 .416 4th1992-1993 0 16 .000 10th1993-1994 5 13 .277 8th1994-1995 7 9 .437 5th1995-1996 4 10 .286 6th1996-1997 8 6 .571 3rd1997-1998 4 8 .333 Tie 5th1998-1999 2 8 .200 6th1999-2000 8 6 .571 4th2000-2001 3 11 .214 8th2001-2002 1 13 .071 8th2002-2003 0 14 .000 8th2003-2004 9 5 .643 2nd2004-2005 8 6 .571 3rd2005-2006 6 8 .429 7th2006-2007 9 5 .643 4th2007-2008 3 9 .250 Tie 6th2008-2009 7 9 .438 Tie 6th2009-2010 3 13 .188 8th2010-2011 5 11 .313 Tie 6th2011-12 3 15 .167 8thTotals 123 239 .340

First Team All-ConferenceWendy Beecher (1987, 1988)Mechio Kornegay (1988)Tara McMinn (1991)Vicki Giffi n (1995, 1996, 1997)Emily Hill (1998)Jessica Guarneri (2001, 2002)Kristal Hood (2006)Ana Baker (2009)

Second Team All-ConferenceWendy Beecher (1990)Shelly Hall (1992)Tonisha Jackson (2003)Kristal Hood (2004, 2005)Amanda Elder (2007)Ashton Barton (2008)Kendall Shepard (2011)

All-Rookie TeamVicki Giffi n (1994)Amanda Frazier (1994)Christy McNeil (1995)Emily Hill (1997)Tynisha King (1999)K’Shaki Short (1999)Jessica Guarneri (2000)Tonisha Jackson (2000)Ashley Sharpton (2002)Kristal Hood (2003)Brittany Hendley (2004)Stacy Shepard (2005)

Kyla Jones (2007)Linda Aughburns (2009)Shonese Jones (2012)Leah Wormack (2012)

Big South Player of the Year Vicki Giffi n (1997)

Big South Scholar-Athlete of the YearVicki Giffi n (1997)

Big South Rookie of the Year Tara McMinn (1990)Vicki Giffi n (1994)Kristal Hood (2003)Brittany Hendley (2004)Kyla Jones (2007)Shonese Jones (2012)

All-Tournament TeamEmily Hill (1998)Jessica Guarneri (2001)Stacy Shepard (2005)Amanda Elder (2007)Brittany Hendley (2007)

Big South Tournament MVPEmily Hill (1998)Amanda Elder (2007)

UNC Asheville’s All-Big South Performers

Championship Game Appearences

1998, 2005, 2007Championships

2007

Big South Tournament Results

Date Opponent Round W/L Score 3/3/87 Winthrop Quarters W 69-563/5/87 Radford Semifi nals L 89-682/27/88: Winthrop Quarters W 77-622/23/89: Campbell Semifi nals L 64-453/8/90: Winthrop Quarters L 75-603/7/91: Coastal Carolina Quarters L 76-703/12/92: Winthrop Quarters L 66-593/10/93: Coastal Carolina Quarters L 72-493/9/94: Charleston Sou. Quarters W 74-573/10/94: UNC Greensboro Semifi nals L 77-743/9/95: Radford Quarters L 85-743/7/96: Radford Quarters L 98-652/27/97: Winthrop Quarters L 70-602/26/98: Coastal Carolina Quarters W 60-592/27/98: Radford Semifi nals W 81-742/28/98: Liberty Finals L 65-532/25/99: Radford Quarters L 66-613/2/00: Elon Quarters L 58-392/28/01: Liberty Quarters L 57-492/27/02: Liberty Quarters L 76-523/4/03: Liberty Quarters L 70-393/9/04: BSC Quarters L 56-493/8/05: Radford Quarters W 47-323/11/05: High Point Semifi nals W 75-533/12/05: Liberty Finals L 88-413/7/06: High Point Quarters L 100-883/8/07: Coastal Carolina Quarters W 65-513/9/07: Winthrop Semifi nals W 64-533/10/07: Radford Finals W 67-573/14/08: Radford (2OT) Quarters L 64-723/13/09: High Point Quarters L 67-723/12/10: Gardner-Webb Quarters L 65-77 3/11/11: Gardner-Webb Quarters L 58-693/9/12: Liberty Quarters L 50-71

BULLDOGS IN THE BIG SOUTH

/// UNC ASHEVILLE BULLDOGS ///

63/// F E A R T H E D O G ///

UNC Asheville 67, Radford 57Big South Championship GameMarch 10, 2007 -- Asheville, N.C.

The Bulldogs picked up their fi rst ever Big South Conference championship with an exciting 67-57 title-game victory over second-seeded Radford before a packed crowd of 1,281 fans at Justice Center

The win was Asheville’s sixth straight and raised its record to 21-11, the most wins by a Bulldog team since the 1983-84 season.

UNC Asheville was led by Big South Tournament MVP Amanda Elder. The senior forward scored 16 points, grabbed nine rebounds and dished out four assists. She scored 14 of her 16 points in the second half as the Bulldogs rallied from a 27-24 halftime defi cit.

Also making the all-tournament team was senior guard Brittany Hendley who scored nine points and had three steals. She was 3-of-6 from beyond the arc. Freshman guard and Big South Rookie of the Year Kyla Jones added 11 points, 11 rebounds and four steals. Saturday’s championship culminated a spectacular turnaround for UNC Asheville under fi fth-year head coach Betsy Blose. Blose came to Asheville in spring of 2002 and inherited a team that went 1-27 the previous year. The Bulldogs fi nished 3-25 in her fi rst season but have had four straight winning seasons since then. The game was close the whole way. Asheville struggled with its offense in the fi rst half as it had 12 turnovers and struggled from the free throw line, going just 6-of-11. Radford struggled as well with 10 turnovers but got eight points from Kelli Darden to lead 27-24 at halftime. In the second half, both teams took turns taking the lead with no one leading by more than four in the fi rst 15 minutes of the half. Finally, the Bulldogs took charge in the fi nal fi ve minutes. Leading 52-51, the Bulldogs got a jumper from Ana Baker to push the lead to 54-51. Jones then got a steal and Elder knocked down a trey off a pass from Baker to get Asheville in front, 57-51. Radford got to 59-55 with 1:15 left on a jumper from Shavon Earp. Elder then knocked down a foul-line jumper with 58 seconds

left to get the lead to 61-55. She knocked down three more free throws and picked up two rebounds in the fi nal 50 seconds to seal Asheville’s fi rst ever trip to the NCAA Tournament. “I thought our defense was just tremendous the entire tournament,” stated Blose. “We never got on track the way we wanted to on offense, but our rebounding and defense was just great the whole time, especially today.

“We were fi nally able to get a little lead late in the game, and I just looked into the eyes of our players and just believed we were going to win,” added Blose. “We’re very excited to represent the Big South Conference into the NCAA Tournament. This is a great day for our team but it’s also a great day for UNC Asheville and our administration. Our administration did a great job getting the Big South Conference Tournament to come to Asheville and allowing us to play in front of a super atmosphere today.”

Asheville dominated the boards as it out-rebounded Radford, 44-27. The Bulldogs’ bench outscored the Highlanders, 24-13. Asheville shot 50 percent from the fi eld (13-of-26) in the second half and was a red-hot 71 percent (5-of-7) from beyond the arc.

The biggest key to the game was free throw shooting as the Bulldogs got to the line 30 times. Asheville was 18-of-30 from the charity stripe, while Radford was just 5-of-8.

Big South Championship GameGame 32: UNC Asheville 67, Radford 57Mar. 10, 2007 Justice Center Asheville, N.C.No. 4 UNC Asheville (21-11) No. Player MIN FGM-A FTM-A OFF REB AST PF PTS 10 Elder 36 3-7 9-15 2 9 4 1 1624 Monroe 16 3-7 1-2 2 3 0 1 720 Hendley 38 3-8 0-0 0 3 1 2 923 Baker 23 3-6 0-0 2 2 2 3 742 Baldwin 33 0-3 4-4 3 6 2 1 414 Jones 27 4-11 3-5 6 11 1 1 1122 Williams 11 4-5 0-0 0 0 0 0 850 Shepard 16 2-3 1-4 1 7 0 4 5 TOTALS 200 22-50 18-30 19 44 10 13 67 44.0% 60.0%TEAM REBS: 3 TURNOVERS: 23 (Elder-6, Monroe, Hendley-4, Baker-3, Baldwin, Jones-4, Williams-3, Shepard) BLOCKED SHOTS: 2 (Baldwin-2) STEALS: 10 (Elder-2, Hendley-3, Baker, Jones-4) 3-PT FGS: 5-12, 41.7% (Elder 1-2, Hendley 3-6, Baker 1-1, Baldwin 0-3) No. 2 Radford (20-11) No. Player MIN FGM-A FTM-A OFF REB AST PF PTS 20 Fertitta 35 5-18 0-0 1 6 1 3 1215 Darden 31 6-12 2-5 1 5 1 3 1403 Earp 33 2-5 0-0 1 1 1 1 421 Pullen 18 3-7 0-0 0 0 1 4 622 Walker 32 2-4 3-3 2 3 4 5 814 White 22 2-4 0-0 0 0 5 3 633 Hilligas 7 0-0 0-0 0 0 1 2 040 Carter 16 3-7 0-0 2 4 1 0 744 Stephens 6 0-1 0-0 0 2 0 0 0 TOTALS 200 23-58 5-8 11 27 15 21 57 39.7% 62.5%TEAM REBS: 6 TURNOVERS: 19 (Fertitta-2, Darden-4, Pullen-2, Walker-3, White-3, Carter-4, team) BLOCKED SHOTS: 7 (Fertitta-2, Dardne-4, Walker) STEALS: 8 (Elder-2, Hendley-3, Baker, Jones-4) 3-PT FGS: 6-17, 35.3% (Fertitta 2-7, Earp 0-1, Walker 1-1, White 2-4, Carter 1-4)

Scoring 1 2 TotalRadford 27 30 57UNC Asheville 24 43 67

Technicals: None, Attn: 1,281Offi cials: Joe Cunningham, Sue Blauch, Mark Hardcastle

2007 BIG SOUTH CHAMPIONS

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

64 /// F E A R T H E D O G ///

TThhee WWilmma Sherrill Centeerr aanndd KKiimmmmeell AArena – Hoommee ooff tthhee BBuullllddooggss

TThehe UUNCNC AAshshevevilillele mmen’s and women’s basa keetbtbalall l teteamams s plplayay t theeir home gamees inin tthehe K Kimim--mel Arena, wwhihichch is s lolocac tetedd inin t thehe W Wilmaa M. Sherrill Cennter.r

T Theh aarena has a capaccitty y ofof 33,2,200 for gammes, annd d isis ccapapabablele of hohoststining g upup t to o 3,3,80800 0 foforr coc ncerertsts, , spspeaeakekersrs, , coconfn erences, and otherer eeveentnts.s. K Kimimmemel l ArArenena a wiw ll serrveve a as s tht e e sisitete f foro U UNCNC Asheville’sDeDececembmberer g graraduduatatioon and as a back-up fforor t thehe S Sprprining g CoCommmmenencecemmentt. This is the fi rst facility onncampus tthahat t isis c capapabablele of aca coommodating the enentitirere c camampupus s cocommm unity.

L ocated in the hearart t ofof c camampupus,s, a andn aattttacched to the existinng g HeHealalthth a andnd F Fititnenessss CCenenteer,, theheeeeShShererririllll C Cenenteter is a state-of-the--arart t fafacicililityty d dededicicatatede tto supporting UNCC Ashshevevilillele’s’s e empmphahasisiisisisisiisssssssss ss s oooonoononononnonnonnnnnnnnnninteterdrdisisciciplplininarary y rereseseararchh, with an initial foocucus s onon t thrhreeee o of NoNortth h CaCarolina’s most urgegegegeentntntntntntntntntntn hhh hhhhhhhhhhhhhhhhheeeeaeaeaeaeaeaeaeeeaeaeeaeaeeaaltltltltltltttttttttthhhhhhhhhhhhhhhhhhhhhhhhhhhhhhconcerns: chili dhdhooood d obobesesitity,y, w wororkpkplace wellness,, aandnd aactctivive e agagining.g. T Thehe 1 13333,0,00000 ssququuararararararararareeeeee e fofofofffofofofofoofofofofofoofofofooooootototototttt bbbbb bb bbbbbbbbbbbbbbbbbbbbbbbbb iiiuiuiiiiuiuiuiuiuiuiuiuuiuiuiuiuiuiuiuiuiuiuiuiuildldldldldldldldldldlddldldldlddldldldldldlddd--------------------ing serves as an invalluablb e e reresosoururcece t to o ththe e ststata e by assese sing comommumuninityty-b-basasasasasssssedededededededededededede p p ppp p p p p pp p pp p p pp pppppprrrrororororroroogrgggrgrgrgrggrggrgrgrgrgrgrgrgrgrgrrgrgrgrgrgrgrgrgrgrgrgrgrggrgrgrg aamamamamamamamamamamamamamamamamamamaamamamamams s s s ss ssssssssssssss thththththththththththththththththththththhthhatatatatatatataatatatatatataatatatataaataaaaddress critical wellness issues, suppporortitingng U UNCNC A Ashshevevili lele’s pprogram in heheheeheeeeeeeaaallalalaalalalalaa thttththththththththhthththththththhthhth aa aaaaaaanddndndnddndnddndnddndndndndndddnddndndddnddnnndddnndddndddd w ww w wwww w w w ww w wwwwww wwweleleleleleleleleleleleelelelelellelele lnlnlnnlnlnlnlnlnlnlnlnnlnlnlnlnnlnesesesesesesesesesesesesesesesessesee s s s ss ssssssssssssss prprprprprprprprprprprprprprprprprprprprprpro-o-o-o-o-o-o-o-o-o-o-oo--o-o-o-o-o-oomom tion, and increasing collaboration amongg hheaealtlth h anandd wewellllnenessss p ppppprororororororoooooovvivivivivviviviviviviv ddddedededdedededededededededededeeddersrsrsrsrsrssss a aa aaaaaaaaaaaaaaaaaaaaaaaaaacccrcrcrcrcrcrcrcrcrcrccrccrccrcrcrccrcrcrcc osososososososososososososoosososososss s ssssssssssss ss s thththththththththththththththththththt e e e ee ee e e e e e e e e e eee WeWeWeWeWeWeWeWeWeWeWeeWeWeWeWeWeWeWeestststststststststststststtstststststerererererererererererereererrerererereernnnnnnnnnnnnnnnnnCaCarorolilinana rregioon n and the state. The Sherrill Center also extenssivivvvelelelelelelelellelelelyyyyyyyy yyyy yyyyyyyyyy ininininininininininininninnnninvovovovovovoooooooooooooooooolvlvllvllvlvlvvvvlvlvvlvlvvvvlvlvlvvvvvvvvlvvesesesesesesesesesesesesesesseseses t t t ttttttttttt thehehehehehehehehehehheheheheh m m m m mm m m m m mm mmm mememememememememememememememememembebebebebebebebebebebebebebebbeeb rsrsrsrsrsrsrsrsrsrsrsrsrsrsrsr o o o o o o oo o ooooooof f ffff ff ff f f ff ff ththththththhthththththththhthththht eeeeeeeeeeeeeeNoNoNoNortrtrtrthhhh CaCarorolilinana CCenter for Creaatitiveveeeveveeeeveveeeeveee RRRR RR RRRR RR RReteeee irement (NNCCCR).

T TTTTTTTTTTTTTTTTTTTTTTTTThhhhheheheheheehehehehehhehhehhehhehehehehehehehehhheeee f f f f f f ff ffff ffffffffffffffff acacacacacaacaacacacaacacaaccacacaacacaaacccccacccaccaaccccccililiiiiiiiiii ititty y alalalsosos p rovidededededeededeeeeeeeeeessssss ssss otoototototototototoototottotootottto hhhhhehehhheheeheeeeheeeeeeeeeeeeeheheeeeerrrrrrr rrrrr rrrrr r r rrrrrrrr rr opopopoopopopopopppopoooppppooopppopppppppppppopopopooppooopoppppp rtrtrtrtrtrrtrtrrr ununnnnnnnnnnitititititittitititittittttieieieieieieieieeieieieieeiees,s,s,s,s,s,sss,s,ss,s,s, a a a a a aaandndndndndndndndnd e e e e e espspspspspspspppececececeececececcccececiaiiaiaiaiaiaiaiaii llllyyy y yyyy y yyy y y yyyy yyyyyyyy tttttttototototototototttototootoo ttt t ttttthheheheheheeh c c ccamamammmammmamammmmmmmmppupupuppupupupupupupupupuppupupuppupupussssssssssssssss ssss cococococococococococcoccoccocococococococcococcommmmmmm ununununununnunununuununununititititititititititittty.y.y.y.y.y.yy.y.yy.yy.yy T T T T T TT TThehehehehehehehhhebubububuububbububububbubuuubbbbb ililillililillildidididiiiiiididididididiiidiiddiiingngnngngngnggnggnngnnngngnngggggg h h h hhhhhhhhhhhh hhhhhhhhhhhhhhhhhououououououououououououuouououoouoooouoouseseseessesesssesess s ss s a a aa WeWeWWelllllll neneneneeeeeeeneesssssssssssssssssssssssss CCC CCCCCCCCCCCCCCCCaafafafaffaa éé,é,é,,ééé,ééé,é, aaaaaaaaa aaa CCCCCCCCCCC CCCCChahhahahhhhahahahaaancncncnnn eleleelelelleleleeeleeleellololoololololoololoololoor’r’r’r’’r’r’r’r’r’r’r’’rrrrrr ssssssssssss ssss ssssssss CoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCoCCoCCoCCCCCooConfnfnfnffffnffnferererererererererrrrreneeneneneneneneneneneennneeee cccccececce R R RRRRRRRRRRRRRRRRRoooooooooooooooooooooooooooommsmmssmsmss f f ff ffororororororoo m m m mmeeeeetititiitiiiiiitit nngngngnngngngngnggngngngngngggggggggggsssssssss sss anananananananaananananananannanananaanandddddddddddddddddddddddd dd ototototototototototototoootoootootototthehehehehehehehehehhehehehehehehehhhehheheheheh r r r r rrrrrr rrrrr evevevevenennnnnnnennnenntstststststststststststsststs, , , ,,,,,,ththththththththththththhhththttttt eee e ee e eeeeee scscscscscscs hohohohohohoohohoohoohhhhhohhoololololollolloloooool’s’s’s’s’s’s’s’’s’’ssssssssssss HHHHHHHHH H H H H H H HHHHHH Heaeaeeeaeaeaeaeaeeaeeaeaeaeaeaeaeaeaeaeaeeaeaaaaltltltltlttlttttltltltltl hhhhhhhhhhhhh h &&&&& &&&&& && &&&& & && WWWWWWeWWeWeWeWeWeWWeWWeWeWeWWeWeWWWeWWWeeWWeWW llllllll neneesssss D DDDDDDepepepepepepeepepepepepe ararararararrrrraaaararararaararrrtmtmtmtmtmtmtmtmtmtmtmtmtmtmenenennenenenenenenennenent ttttttttttttt acacacacacccacacacacacacacacacacadaddddadddddadadadadadadadadadadadaadememememememememememememememmmmmicicicicicciciciciciciciciciciccciccicccccccc oo oooooo ooo oooo oo ffiffiffiffiffifffiffiffic c cc cccesessesesesses, , ,, nununununn memeeeroroususs c cclalalalaaaalaaaaaaaaassssssssssssss rorororooooooomommomommomoomomomomomommomoo sssss ss sssss s anannannnananannanananannaananannnaa ddddddddddddddddddddddd lalalaalalalalalaaalalalalaalalalalalaabsbsbsbssbsbssbsbsbsbsbsbsbbsbsbsbsbsbsb ,,,, ,, , ,, ,, ,,,,,,,,, aaaaDeDeDeDeDeDeDDeDDDDDDDemomomomomoomomomomomomom nsnsnsnsnnsnsnsnnsstrtrtrtrtrtrtrtrtrtrtratatatatatataatatatioioioioioiooioiioionnnnnnnn n nnnnnnn nn n KiKiKiKiiKiiKKiKiKiKiKiKiKiKiKiKiKiK ttttttctctctctttctctccccccchhhhhehehhhhehehehhhehehhhhhehheeeennn nnnnnnnn totoototototototttooto b bbbbbbbbbe eeeeeeeeee ususuuususuusussusededededededededede f fffffffffffffooroorrorororrororororoooooooo nnnnnnnnnnn nutututtutututututututtutriiriiirrriririirir tititittititititititititt ooononoonoo ttttttttt traraaaiiiiiiiininininnininininniinninininiininnninnngg,g,gg,g,g,g,gggg,,gggg, aa a aaaanddndndnddndndndnd aaaa aaa mmmmmmmm mmmmmmmmmmmmmm mm dedeedededdedededededededeededeedededededededede ititititiitititatatatatattataatatiooioioiooiooionnnn n nnnnnn rororororoorrororroomommmomoomomommomm. ... ThThThThThThhThhThThThTheee eeeeee ShShhSShShShShShShShhShShererererrrrerererererereeerrririririririririririrrririrrilllllllllllllllllllllllllllCeCeCCentntntntnttnttntererererereer o o ooooffffffffffffffff ererrerereee s s aa a aaaa DaDaDDaDaDaDaDaDaDaDaD ncncnccncncnccncncnnccn e eeeeeeeeee e stststststststststststststududududududududdudududuu ioioioiioioiiio, , FiFiFiFiFiiFiFFiFiFFiFFiF tttttttnese s ananaaaaa ddddddd dd WWWWWWWeWWe ggiggigigigigghththththhhhhhhh R Rooooo m,mmm,m,mm,,m,m,m,m,m,m aaaa aaaaa ll l l ararara gegegegegeeeggggggg gg g gg ggggggggggrorororooupupupupuppppp fi fi fifi fifififi tt tt t neenenenenennesssssssssssss r r r rroooooooooo m mmmm m m m ffofofofoforr rr r aeaeaerororororobibibibibicscscscs, , , ,,tatai ii chchchhhcchchchc i,iiii,,i,i,,, a aaaaaandndndndndddndndnddndndd o o o oooooththhthhhthththththttherrrrrrrrrerrrrrerererrreerrerererrrer ccccccccccccc claalaalalalaalalalalalaasssssssssssssssssssssssssssssseeeeeeeeseeeeeeeeseeeeeeeeeeee , , a aaaaaaaaaaa rerrrerererererererererr sosoososososososososossoouururururururrururuuururcececececeecececce rr r r rrrrrrrrooooooooooooooooooooooooooo mmmmmmmmmmmmmm m fofofofoffofofofffoorrrrr rrr ststststststtsts ududududududududududennenenenenenene tttttt t cococococococococoooooccooooocoollllllllllllllll abbababababababorororrorororatattatatatattioioioioioiooioonsnsnsnsnsnnnsnsnn , , , , , , , ananananananandddd d dd aaa aa nununununuumbmbmbmbmbmbbmbereererre oo ooofff f f gagagagagagathththt erererereee inininininnnnnnnnnnggg g ggggggspspototototttttts ss s anananannnnnndddddd ststststttttttttuddudduddddy y y y yyyy y y arararrraarararareaeeeaeaeeaeaeaeaeaeaas sssss s s s ssss fofofffffofofofofof r rrrrr tstststststststtstttuduududududududdddududdduddduduuudenenenenenennenenenenenentststststtstttstststststs... .

TTTTTTTTTTThehehehhhhehehehehhhee aaaaa aaaaaaarerererererererer nanannanananaaaaaa o oooooooffffffffffffffffffffffeererereeeeeererrererereereree s sssseseeeseeeevveraaaaaaaaaaaaaaal lllllll bbbeb neneneeeenneenneenefi fi fittssttt fffforororoo g gg gg gueeestts,s proroooovivivivvididd ng unpararararalalleleeelelell d d d sisiisiis ghghghghghghgghgghg t t tt ttt lilillllil nenes,s,s,,,, c cccccomommmmmomomommfofofofofofofoooforrtrrtrtrtrtttrtrtrr abababbababababa leleelelllseseataatatatatatataaa ininiiniiii g gg gg gggg aaananaaand d ddddd ddddd momomomooomoomoomom dededeededdedernrnrnrnrnrnrn aaaaa aamememmemmememmemeemememememm nininininininininininn titiiiitititiitiitititititiiesesesesesesessesesessessss c ononnonononoonnononsisisisisissisistststststsststts innnnininnnnnnnningg gg g gggggggg ooofoooooooooo : : twtwtwtwwtwo o o oo o DaDDaDaaaaDD ktktktkktkk rorororooronininninnnnininninininininiininnninnnicscscsccccc v v v vvidididideoeoeoeeo bbbbbbbbbbboaooaoaoaoaoaoaoao rdrdrddds,s,s a aaaaaa cccccceneneenenenenee tetetetetteterr-r-r--rr--huhuhuhuhuhuhuhhhhhhhhhhh nngngngngggnnggngnggngggg s sss coccocooooc rererererer --boaraararararararaa d,d,d,d,d,d,d,d,d d d ddddddddd ddigigigigigigigiigigiggiggggitititittititititititiitittalallalalallallaaal s s sss ssssssccccccoooccoooocccc rerrererererereer’r s taablblee, ampmpmpmppmpmpppppppleleleleleleeeleeeelee rrr rrr r rrrrrrrrrrrrreseseeeseseseeeseseeseseseeeeee trtrtrrtrtrtrtrtrtrroooooooooooooooooooomm mmm mm mmmmm mm mm fafafafafffffffffffff ciciciciiciiiiiililiillllllilillllilllllllillll tititittt eseseseesseeee , ,, , ,, aaaaaa a aaaaaaa aaaa wwwwwiwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww dede c oncocococoooooooooururuuururrurseseseseseeees wwwwhihihihhichchchchchchchchc a aaa alslsslslsslsooo o o oo oo seseeeseseserrvrvrvvvvrrrrvrrvrvrr eesesesseseeee a aaaaaa s sssss sss aaaaaawalkklkkkkkkklkllklklklkkklklkkkkkklll inininininininiinininnniii gggggggg g trtrttt ackk,kkkk, aaaaaa aa aaaaaaaaand twowowowwwww ll llararargegeg ccccc conononnonononononononoononnnnnonnononccececececeeecececeececccec ssssssssssssssssssssssssssssssioioioioioioioiiiioioiiiioooioioonnnnnnn stsssststssttstststananananaaananannaa dsdsdsdsdsdsdsdsdsdsdsdddsdds wwwwwwwww wwwwwww wwwwwititititititittititttthhh hhhhhhh hh hh h TVTVTVTVTVTVTVTVTVTVTVTVTVTVTVVVTVV ddddddddddddd d ddd dddddddddd dissisisiisisiisisiisisisiisisisisssisissisisisplpllplplplplplplppppppppplplpppppp ayayayayayayayayyayyyyyyyys sssss s s sosososoososoososo ff f ff fananananannnanana s s s sss ss s ssssss wwwwowowowowwwwwowwwwwowowwowww n’’n’nn’n’n’’n’n’n’’t tttttt t tt miiimimimmimiimimimiimmm sssssssssssssssssss aaaa aa aaaaaaa a a mmm m m mmmmm mm momomomomoomomoomomomomomenenenenennnenenee t tt tttttt ofofoffofthe acacacactitititionononon. . AAlAlAlsosoo i incnccluludeded d wiwilll bbbe e e ththhtththhhe e eee BuBBBuBuBuBBBuBulllllllldododdoodd g g g ggggggggg ScScScScSccccchohohohohohohoholalalalalalaarsrsrsrsrsshihihhhihihihihihhhhhhhhhhhh p p pp ppp ppp p HoHoHoHoHoHoH spspspspspspspppppitititititittttalalalalaalaaa ititititititity y y y yy yyyy LLLoLoLoLoLoLLLLoLLLoLoLLLLoLooL unununununununnunuununuununuunununnungegegegegeggegegeggggeggggeggegegeggeegg ttt t t tttttttttttto o oo oooooo ooo bebebebebebebbebb u uu u uu uuseseseseseeseseseeeeeeeedd dd dd dddd fofofofofofofofofof r r r r r rrr gagagagagaggagagag memememmemeemeemmmemmmmdadadadddadaday y y y y eneneenteteteertrtr aaininingngg, ,, a a saatetellitte e SpSpSpSpSpSpSppSpSppppporororrororrorororoo tststststsstssttssssstsssststsstss MMMMMMMMMMMMMM MMMMMMM MMM Meddededededededededededeedededeededeeedddedddiiiciiiciciciciiciiiciciciciciciccicinninniniiininininnininine e ee ee RoRoRoRoRoRoRoR omomomooomomoomm w w w ww wwhehehehhehehehehehherererererereee tt t tt ttttheheheheheheheeeeheh s s s sssssttututututututt dededededdddededdeentntntntntnttn -a-a-aaaaaathththththhthhthththhhleleleelelelel teteteeeteteteeteees ssssss cacacacacacacan n n nnn rererererrrrrececececeeiiiiiiiiiiiiivivivi e eeeeeeee e eee tatatatatatatatatatatatatattaaataatataatttaapipipipipipipipipiipipipipipppppipipiiiippp ngngnggngngngngngngngngngngnnnnnngnnnnngganand d trtrtreaeatmtmtmennt,t,t,t,t,t,t,t,,,,, aaaa aaa a aaannnnnnnnnnn n n n ArArArrArArArAArArArArArAAAreeeneneeenena a a BoBoBox x OfOfOffOffOfOfOffOfOOfOffififififififififi fifi fi fifi ficececcccececeeccccececceccececececcceccceccc , , , ,, , ,, ananananananaaaaaaaanaaaaaaa d d d d d ddd thththththththththhthththththtt eeeeeee e e e ee nenenenenenenenew ww w w www B B B B B B BBBBulululululullullulllldldldldldldlddldogogogogogogogogg T TTTTT TTTTeaeaeaeaeaeaaeaam mmmm mmmmm StStStSSSSSStStStSttStSStS oroororororororoooo e,e,e,e,e,eee, w wwww wwwwwwwheheheheheheheeheh rrrrrerrrerererrrr f f ffffanananaanananans s ss cacacacac n nn nnn pupupupupupupupuup rcrcrccccrccchahahaahahahahaah seseseesesesesessmememmememememmmemememercrcrcrcrcrcrcrcrrcrccrcrcr hahahahahahahahhahahahahah dnddndndndndisisisiseee e anannana d d d dd apapa ppaparerer l.lll TTheherere w wwwwwilililililiilllililiililillilillilii lll lll l lllllllll alallalalalalalalalalalalalala sososoososooossosoososososs bbbbbbbbbbbb b beeeeeeeee e aaaaaaaa a UNUNUNUNUNUNUNNUNUNUUUNUUNUUUU C C C C CCCCCCC C AsAsAsAsAsAsAsAsAAsssssssssA heheheheheheheeevivivivivvivivivvivv lllllllllllllll ee e eeeeeeeee AtAtAtAtAtAtAtAtttAAttthlhlhlhlhlhlhlhlhletetetetetetettettticicicicicicics s ssssss HaHaHaHaHaHaHaHaHHaHaHHHHH llllllllllllllll o o o o oo o oooooooooo F FF F F FFFFFamamamamamammamamaammmee eeee e e ee totototototototttoo h h hhhhhhhonononononnononononoroororoororororor t t tttttttthehehehehehehehhheheetrtrtrtrtrt adadadadadaddadadddddddititititittiiiti ioioiooonnsnsnsnnn aandndndnd B B BB Buluu lddogog SStutudentntnttttttttttttttt-A-A-AAA-A-A-A-A-A-AA-A-A---A--AAAththhhthhhththtthththththleleleeleleleleeleleleleteteteteteteteteteteteteteteeteeeeeesssssss ss ssssssssss ofofofofofoffoffoofoffofofo t t t tt ttttthehehehehehehhehhee p pppppppppppppasasasaasasaasaasa t.t.t.t.ttt.t.t.t

T TTTTTTTTTheheheheheeehehehehehehehehhhee mmmm en’s and women’ss bbasasketbt all cococoacaaaachihingngn s sstataffffff h hhavaavvee e rerelolol cacatetedd thththhheieieieirrr r ofofofofofo fi fi fifi cececees ssss totototto K K KKimimiimimmemmemem lll ArArArrA enenenenenena a a a ananananaana d wiwiwiwiwiwiwiwiwiwiw thththththththththhhhininin tthohose offi ces will be aa cccononfefereencncee rorooomomo t thahat t t cacan n alala soso s serererererrrvevevevevve a a aas s ss a a a a memememedidididia a a a rorororoomomomom f ffororororrprprprppp esessessss ss cocoonfnfnfere encec s.s TT TT T T T TTTTThehehhhh Sheh rrr ill CeCeCeCeCentnntntn er aandn K Kimimmemel l ArArenena a isisss a alslsoo fufuf lllly y cocococompmpmpmpatatatatibibibi lelelee w wwwiti h h momodededeernrnrnrnmemmemedidid aaaaa a brbrb oaoaadcd asastitingng aandnddddddddddnddd w wwww w ww wwilililili l l popopopoposssss esss s fufull wirirelelesess ss cacaccc papap bibibibbilililiiitytytyttyty a andnd eenanablblblb e ee thththt e eeeee AtAtAthlhlhlh etete iciccs sssss DeDeDeDeDepapap rtrtrtrtrtmememememeentntntntntttototottoo ccccononnnnontittinunuunue ee ititits ss hiih ghghg lylyly s sucuccecessfufufufufuufuffufufullllll llll lilililiil ve strt eae ming off f evevevenennnentststtsts.

The new Sherrill Centntntteeerr aand KKKiimi meeeeeeemeellllllllllll AAArArArArArArArArArArAAAA enenenenenenenenenennaaaaa aaaa a isiiisisisisisisisisis a aaa aaaa aa ffff f f f f f ff ffacacacacacacacacacacilililiilliilililililililitiitiiititititititittiti yyyyyy yy yy thhthhthhthhthhthththatatataatatatataata ttttt theheheheheeehehee BBBBBBBBBBB BBululllululullululuu ldlldldldldldlddogoogogogoogogogogsssssssss anannnannanananananna ddddddd d thththhtthttththeieieieieieieieieeeeirr rr r fafafafafafafaansnsnsnsnsnnn wwwww w wwwwwililililililllillilliiilillllll lllllllll l lll llbe proud to call hommmee,e, aaandnd a a f ffananntatatasts icic vvene ueeue tto oo wawawawawawawawwawaw tctctctcttttt h hhh tetteeeamamamamamamms s coocoooompmpmpmpetetetete eeeeeee aaaanaaa d dd ddd wiwiwiwiwiww n.nnnn

/// UNC ASHEVILLE BULLDOGS ///

65/// F E A R T H E D O G ///

TTTTTTTTTTTTTThhhhhhhhhhhhheeeeeeeeeeee BBBBBBBBBBBBBuuuuuuuuuullllllllllllllllddddddddddoooooooooogggggggggggssssssssss ooooooooooppppppppppeeeeeeeennnnnnnnneeeeeeeeeeeeddddddddddd ttttttttttthhhhhhhhhhhheeeeeeeeeee KKKKKKKKKKKKiiiiiiiimmmmmmmmmmmmmmmmmmmmmeeeeeeeeelllllll AAAAAAAAAAAAAArrrrrrrrreeeeeeeeennnnnnnnnnnnnaaaaaaaaa oooooooonnnnnnnnnnn NNNNNNNNNNNNNNNNNNooooooooooooooooovvvvvvvvvv........ 11111111122222222,,,,,,,,, 22222222222200000000000111111111111111111111111111,,,,,,,,, wwwwwwwwwwwiiiiiiiittttttttttthhhhhhhhhhhhhhhh tttttttttttthhhhhhhhhhhhhhhhheeeeeeeeeeeee NNNNNNNNNNNNNNNNNNooooooooooooooooooo............. 111111111111 rrrrrrrrrrrraaaaaaaaaaannnnnnnnkkkkkkkkkkkkkeeeeeeeeeeeeeddddddddddd NNNNNNNNNNNNoooooooooooooorrrrrrrtttttttttttttttthhhhhhhhhhhhhhhhhh CCCCCCCCCCCCCaaaaaaaaaaarrrrrrrooooooooooooollllllllllliiiiiinnnnnnnnnaaaaaa TTTTTTTTTTTTaaaaaaaaaaarrrrrrrrrrrrr HHHHHHHHHHHHeeeeeeeeeeeeeeeeeeeeelllllllsssssssss.......... UUUUUUUUUUNNNNNNNNNNNNNCCCCCCCCC CCCCCCCCCCCCCCCCChhhhhhhhhhhhhhhhhhhhhhhaaaaaaaaaapppppppppppeeeeeeeeeeeeelllllllll HHHHHHHHHHiiiiiiiilllllllllllllll eeeeeaaaaaaaaaaaaarrrrrrrrrrrrnnnnnnnnnnnnnnneeeeeeeeeeeeeeddddddddddddd hhhhhhhhhhaaaaaaaaaarrrrrrrrrrrdddddddddddd---------ffffffffffffoooooooooooouuuuuuuuuuuugggggggggggggghhhhhhhhhhhhhhhhhttttttttttttttttt 9999999999999999999111111111111---------77777777777777777775555555555555555555 vvvvvvvvvvvvvvvvviiiiiiiiiiiiiccccccccccttttttttooooorrrrrrryyyyyyyyyyy ooooooooooovvvvvvvvvvveeeeeeeeeeeeeerrrrrrrrrrr UUUUUUUUUUUUUUUUUUUUNNNNNNNNNNNNCCCCCCCCCC AAAAAAAAAAAAAssssshhhhhhhhhheeeeeeeeeeeeevvvvvvvvvvvvvviiiiiiiiilllllllllllllllllleeeeeeeeee iiiiiiiiiiinnnnnnnnn fffffffrrrrrrrrrrroooooooooooonnnnnnnnntttttttttttt ooooooooooooffffffffff aaaaaaaaaa ssssssssseeeeeeeeeeelllllllllllllllllllll--------oooooooooooouuuuuuuuuuuuuuttttttttttttttttttttttt ccccccccccrrrrrrrrrrrrooooooooooowwwwwwwwwwwwdddddddddddd oooooooooooffffffffff 33333333333333,,,,,,2222222222222288888888888800000000000000.........

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

66 /// F E A R T H E D O G ///

/// UNC ASHEVILLE BULLDOGS ///

67/// F E A R T H E D O G ///

ABOUT THE UNIVERSITY As the University of North Carolina at Asheville celebrates eighty years of excellence in higher education, the campus community welcomes new challenges and greater successes as one of the nation’s leading liberal arts colleges. From its beginnings as Buncombe County Junior College, where 86 students enrolled in 1927 to further their educations beyond high school, the University has valued liberal arts ideals and community engagement. Its special commitment to student learning and undergraduate education was reaffi rmed when it joined the University of North Carolina system in 1969 as the University of North Carolina at Asheville. The University maintains its liberal arts imperative, as the designated undergraduate liberal arts University of the 17-campus University of North Carolina system.

Vision

UNC Asheville students, within a diverse and inclusive community, experience liberal arts education at its best.

Mission

UNC Asheville is distinctive in the UNC system as its designated liberal arts university. Our practice of the liberal arts emphasizes the centrality of learning and discovery through exemplary teaching, innovative scholarship, creative expression, co-curricular activities, undergraduate research, engaged service, and practical experience. Primarily undergraduate, UNC Asheville offers a liberal arts education characterized by high quality faculty-student interaction. We offer this challenging educational experience to all promising students who are committed to liberal learning and personal growth.

Our liberal arts educational approach emphasizes life skills including critical thinking, clear and thoughtful expression, and honest open inquiry. Students undertake concentrated study in one area while simultaneously developing an understanding of the connections among disciplines. We encourage students to clarify, develop and live their own values while respecting the views and beliefs of others. In addition, we cultivate an understanding of the dimensions of human diversity while recognizing the common humanity of all. We believe a quality liberal arts education enables our graduates to be lifelong learners and to lead successful, fl ourishing lives as leaders and contributors to their communities.

At UNC Asheville, we respond to the conditions and concerns of the contemporary world both as individuals and as a university. We incorporate economic, social and environmental sustainability into our institutional practices and curriculum. With a range of associated centers, partnerships, and initiatives, we fulfi ll our public responsibility to address the needs of our community through a continuum of learning. We develop a commitment to continuing service characterized by an informed, responsible, and creative engagement with the Asheville area, the southern Appalachian region, the state of North Carolina, and a diverse and increasingly connected world.

Alma Mater

In 2000 the university community set about the task of writing a new Alma Mater—the offi cial anthem of UNC Asheville, sung at all ceremonial events—to replace the one from the 1960s. In Latin, alma mater means “nourishing mother,” and it also refers to the school one attended.

Hail Our Alma Mater, Hail UNCA.

Learning be your watchword,Greatness be your way.

High upon the mountains,In the Land of Sky,

Stands our Alma Mater,Lift your voices high.

Noble Alma Mater,Hear our words of praise.

May we love and honor you,Until the end of days.

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

68 /// F E A R T H E D O G ///

WWWWWiWWiWiWiWWWWiWiWiWiW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCNCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC AAA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhshs eveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn sssssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuupppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt tttttttttttheheheheheheheheheheheheheheheheheheehehhheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaaaasyssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 33333330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarra tststststststststststststststssssssss, , , , , , , ,,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscscsccieieeieieieieei ncnceeeaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillililiiiiiiiiiiibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....

HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s

AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 2020202020202020

MoMoMoststst P Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchhhhhhchc oooololoololooolooololololooolololooo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititititittererererereere atatataturururureeee,e,ee,e, EEEEEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnnonnnnnnnnnnno mmmemememeeeeeememeememeeeem ntntntntntnntntntnntnntnnnnnnntnntnn alalalalalallalalalalaallllalallallalalaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuutututututututtututututututtuuutuuuudididdidididididdidddididdididdididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,, HeHeHeHeHeealthth &&&& &&&& W W WWWWWWWWWWWWWWWWele lnnesessssPrPrromomommotottoto ioioioionn,n, aaandndndd A A A AAAAAAAAAAAAAAAAAAAAAAArtrtrttttrtrtrtrtrtrttrtrtrrrtrtrtrtrtrttrrtrtt

FuFuFuF llbllbblbblblbbbbbbblllllblbllbbl riririgghgghghghghhhhghghhgggghhgghgghhgg t t AAAAAwAwwwwwAwAAwAAAA arararardsdsdssssssssssssdssss: ::: ::: :::: 37373737373737773773773737377773737373737373737373377 s s tttutututut ddddeeeeeeeeeeeeeed ntntntntntntntntnnnn s s hhavev reeeeeececececceceieiiiiieieieiieivvvveveved ddddddd ddd ddd ththththhhhhhhhhe e prprprprprprprrprpprrrprprrp eseseseseseseseseesesesseseseeesttitititttttttttt gigigigiououououous s s s awaaawawawawawawawwawawawawawawawawawawawwawararaararrrrrarrarararaararraarara ddd

UnUnUnUnUnUUnnnnnUnnnUnddddedededddddededdergrgrgrgrggrgrgggrggrgrgrgrggrggggraraaaaaaaaaaaaddduduuududduatatatatatatataaate eeeeee e ReReReRReReReRR seseseseseeararararchchchhc :: ::::::: MoMooooreree tt thahahan hhhahahahaahahhhhalfffflfflffff oo oof f fffffff ststsstststtstsstuuududdudududdu eeeeneeneneneeneee tststsststss ccc c c ccc c cccccccccccc cccccomomomo plpplplpp eteetetetettetettetettette eeeeeeeee eeeee eeeeeeee orooororrorrrorrororororrrrrroooo igigggginininininininininininiinii aaaaaaaalalaaalalaaa r rrrrrrrrrrrrrrrreeeseeseesessssseseesseeesseeeaeeaeaeaeaeaeaeaaae rcrrcrrrcrcrcrcrcrcrcr hhhhhhhhh h hh hhhhhhhhhhhhhh iniinninininnnininininniininiinnniiinnninniinnninnnn t ttt ttttt tttttttttttttttttttttthhhhhhehehehhhehhhehheh iriririrrr fi fi fi fififififi e ee e e eeeldldlddld o oooof f f fffffff stststststttudududududududduddyyyyyyyyyythththrorougugh hh thththhhthhthhhthhheeeeeeeee e UnUnUnUnUnUnUnUnUnUUnUUnnivivivivivivivviviviiverererererererereerersisisisisss tytytyyyyyyyyyyyy’s’s’s’s nnnnnnnnn nnaaaatataatioioionananalllllly y y rrrrrerererr cooooococcoooogngngnnnngnngngngggggg izizziziiizizzizizi edededdedededededddeddedddd U U UUUUU UU UUUUU UUUUUUUUUUUUUndndndndndndndnndndndnddnndndnddndndnddndndndddddderereeereererererereeeeerereeereeeerereeerereee grgrgrgrrgrgrgggggggg dadadadadadduuauuuauauauauauuuauaaaauaaaateteteteteteeeteteteeeteeeetetetttttttttteee R R Reeeseseseseseseseseseseesesseeseeseeseseeseesseeseeseseseesseeeeeeaeaeaaeeeaeaeeeeeeeeaeeeae rrrcrcrcrcrcrcrcrccrccrcrcrrrrccrcrccchhhh hh hhhhhhhhhhhhh hhhhhh hhhhhhhhhhhhh PrPrPrPrrrrrrPrPrPPPPrrrP ogooogogogogogogogogogogooogoooggogoogoogogggoogogogogooggoo rararaaararararrararaaarrararrararaaraarraraaarararaaaar mm.mmm.m.mm.m.mmmmmmmmmm.mmmmmm.mmmmmmmmm UUUU NCNCCCC AAAA A AAAAshshshshhhhhevevevvvililillilillleleleleleleleeffofoooooooof unundeeeeeeeeed d ttththhthhhheeee e NaNaNaNaNaNNNaNaNaNaaaaaNaaaatitititititit onononononnonoono lalllalalllla CC CCCCCCCCCCCCCCCononononnonononooo fefefefeferrerer ncnce e e onoo UUUUUUUUndndndndnndndndndnnnn errrrererrrrggrgrgggg aadadaadadadddadaa uauauuuauauaaaauauuaauaaaauaaauaauatttttteteteteettttetttttt R RRR RRRRR RRRRReseseeeesesesesesessssesesseseseseeseeeeee eaeaeaeaeaeeaeaeaeaeaeaeaeaeaeaeaeaeaeearcrcrccccrcrcrrcrcr hhhhhhhhhhhhh h h hhhhh mmomore tthahan n 25222222225255552522522222522525255555222 yy yyyeaeeeaeaeaeeaeaeeaeeaeeeeeaeeeeeeaearsrrrsrsrsrsrssrsrssrsrsrssrrrrsrsrssrrrsrssrssssss aaaaaaaa aaaaaaaaaaaaaa gogggggggogogogogoggogogggogogogoggogogggggggggggg .

StStStStSStStStStS udddududududddduuduudududyy yyyyyy yy yyyyyy yyy AbAbAAA roorooooooooooaaaaaadddda a aaaaaaaaaaaaaaaaaaaaandndndndddndddddddndndndndndndndnndnnndnnddndn S SS SSSSSS SSSSSSSSSSSttutuututututututututttt dddydydyddyddydddydyyddydyy A AA A AAAAwawwaww y:y: 1 17 77 pepepeeeeeercrrr eeeeeenenneenee t t tt oofofffooooooo s sssssssssstutututuuuuuuuudddddddddededdddedddddddddddddddd ntnnnnnnntntnnnnnnnnnnnnnntn sssss ssssssss tatatatatataaaatataataaaaaaaaaaakekekekkekekekekekekekekekekeke a aaa aaaa aaadddddddvdvdvvvvvdddvvdvvvvvanananannanannnnnnanananananannanaa tatatatatatatatatataaaaaaaaaagegegegegegegegegegegegegegegegegeegegegeee o oooo oo o o o o oo oooooff ff ff f ff f fff f ff leleleleleeelelellelelellleeeleeeleeleeeleleeararararararararaararaaa ninininininininnininnininnnnniniiin ngngngnnngngngngngngnnnngngnngngngnnngnnnngnnnngnnnnnnnnggnnggggngg ooooooo oooooooooooopppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppororooooooooooooooo tututututtttutuutuuutttutttttutututuutuutuuuuutuututuunininininininn titititttt esessssss i i innnnnnnototoototottototoototo heheheheheeheheeheeh r r rrrrr ststststststtststtstatatatatatttatatatttteseseseeseseeseseeeee aaaanndndddddddddndddddddddddd ccccc cccccccccccccccccccoououoooooo ntntnnntntnttntntntntnttrrriririrrrrirrriirirriir esesess w whihihilele e enrnrnrololollllllllelelelellleeeleell ddd ddddddddddddd atatataatatattat UUUU UUUUU UU UUNCNCNNCNCNCNCCCCNCNCNCNNCNCNCNCC A A AAAAAA AAAAAAAA AAAAAAAAAAA Ashshshshhshshhhhshhshshshhhshshhhhhshhsshs evevevevevevevevevvevevevvvevevvveveveeveve ililililillllliillililiiililleleleleleleleleeleleleelee... .

StStS ududenenenenenenttt ttttt AAAtAtAAtAtAthlhlhlhlhlhlhlh eteeetteettte e eee GGGrGrrGGGrrG adadadadadadaaduauuauauauauauaaaaaatititititititiititittitit ononononoono RRRRR R RR Ratatattttttattattatatattttattteeeeee::ee:eeeee:ee:ee UUUUU U UNCNNCNNCNNCNCNCNCNC AAAAA AA Ashshsshshshshevevevevevevvililililili lellellelele s sssss stututudeddentnnnntnnntnnnnnnnnnnnnn -a-aaththtththhthththhhthhthhthhlleleleleeeelelelelleeleletetetetetetetetetetetetettteteeeeteteetetetetessssssssssssssssss s sss hahahahahahahhahahahahahahhahaahahahahhahahhhhahahaahhh vevevevevevevvevvevveveveveveveevev o oo ooooonenennn o of f hththe e hihighghg esest t grgrrgrgrgrgrgrrgrrradadadadadaadaaaada uauauuatitittiononononrararrarrraatetetetetet ss s sss iiniiininininnin tt t t ttthhhehehehehe NNNNN NN NCACACACACACACACAA.A.A.A.A.A.A.AAA O O OOOOurururururururu ssssss sstutututututudedededededentntntntntntnn aa-a-a-athththtttthleleleteteetes s sss ononononon a a a aaththleleetitiitititicc c scscscscscscscchohohoohohoohohooooooholalalalllallalalalalaarrsrsrsrsrsrsrshihhihihhhhihihhhihih pspsps wwhoho p plalay yy alalalaa ll fofofooofourururrurururrururrurrurur yyyyy yyy yyyeaeaeearsrs aaattt UNUNCCCAsAsAsAsAshehehhevivivilllllle e hahahahavevevve a aaa 9 9 9 99 9 9 pepepepepeep rcrcrcrcrcrcenenenene tt ttt grgrgradadadadaaduauauauauatiitititioonon rrratatate.e..

FaFaFaFaFaFaFaFaFFFFFFFaFacuccucucuucuc ltltltltlltl y:y:y:y:yyyyyyy 222222 2 210101001000010101010 fffff ffulululluluullll-l-l-l--l-l-ll titititititit memememememememeeeeee ff fffffffffacacacacacacaaaacululllulullululultytytytytytytytyyyyyy mm m m m mmmmmmmemememememememmememeeee bebbebebebbebbebeersrsrsrrsrsrssrsr , , , ,, 84848484484848484848484%%%%%%%% % % wiwiwiwithththtththhht ttt tttttereeerererererrrmimimimimimmimimiminananaal l l dedededededeedegrgrggrgrgggrgrggg eeeeeeeeeeeeees s

COCOPLAC: UNUNC C AsAshehevivilllle isiis t thhehe hh heaeadqddquauauartrtereers s s fofor the e CCoununcicil l of PPububblilicc c Liberal l Artsts C Coolleges, aa2727-mmemembeber r orgagaaninizazazattition of state-supppporteed libebeberalll arts collegegeges that rrrececogogninizeze tt theee immpmportancncncee e ofoff liberal l arartsts a andnd s sccicieneenceccess ededucucatiion for succesee s ss innn aa comom lplexex g gloloobabab l sosocicietetety.

CCCCaCaCaCaCaCCCCCaCCCCaCaCampmpmpmpmpmpmpmpmpmpmpmpmpppppus LifeRRReReReReReReReResisisisisisiiisiidededededededeedeeencncncccccncccnccncncncnnce e eeeeeeeeee Haalllls:s: AAboboutut oonene-t-thihirdrd o of f ststududenentsts l livive e onon c camampupus,s, w whiiiileleleeeeeeeeeleleleeleelelee a a a a aaa a aa aaaa aaaaaaannonononnnononononnooonoononnoonnnononnnonnn thththththththththththththththththththththhthhhththhherererererererererererererererererererereeerrerrrr t t t tt tt t t t tt t ttt t ttttttt ttt tthihihhihihihihihihihihihihihihihihihhhhhhhihhihiih rdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrdrdrdrdrdrdrdrddr ll l ll l ll ll l lll l ll l lliviviviviiiivivivivivivivivivivive withthini aa one-milerarararaaadididididddiddd usususususus o o o ooffff ff ff cacacacacacaaaaaaccaaacccc mpmpmmmmmmmmmm usus.

AtAtAtAAAAAAthlhlhlhlhlhlletetetee icicicics:s:s:ss:s:: 1 115 5 5 5 NCNNNCNCNCNCNCNCNCCCCCCCCCCCCCNCAAAAAAAAAA D Divviision 1 1 tetetetetetetetetetetetetetetttttteteteteamamamamamamammamamamamamamamaaaaaaaaaaaa s s s

StStStStStStSttStStStStududududdududududududeneneneneeneneneneenenene ttttttttttt t GrGrGrGGrGrGGrGrGrGrGrouououououououououououpspspspspsppps:: :: MoMoMoMoMooMoMoMoMoMoooM rrererrererereeererereererrerererrerrererererr t t t t t tttthahahahahahahahahahaaahahahahahaahaaan n n nnnnnnnn 60606060606060600000 c ccccccccccccccccccccclulululuululululululuulululuuuuulululullubsbsbsbsbsssbsbssssbssbsbsbsbsbsbsbssbsbsbsb a a aa a a a aa aa a aaaaaaaanddndndndndndndndndndnddddddndndddnd ooo oooooo oo o oo oooooo ooooooorgrgrgrgrgrgrgrgrgrgrgrrgrgrgrrgrgrgrgggananizzata ioionss, raaaaaaaangngngngngngngngngngnggngngnngngnngnggngngngininininininininininininninininininiiininiiniinnggg g ggg ggg g g gggggggg ggg g ggggggggggg g frfrfrfrfrfrfrfrrfrfrfrfrfrfrrfrfrffrfrrfrffrfrrrrromomomoomomomomomomomomomomomoomomommommomoooomoommomomomomo hh hhh h hh hhononononononoroorororororo s s s s ssococococococieieieieietititititiesesesess ttttttttttto o o oo oo iniinininnninintrtrtttrtrtrrtrrrrrttrrrtrrrrrrrrrramamamamamamamamaaaamamaaamaaaaa urururururuuururururruruurururururururrrruralalalalalaaallalalalalalalalalalaaaaspspspspspspspsporororororroortstststst

Innnnnntttteteeercrculululuuullultutututuutututturararaaaararal CeCeCeCeCeCCeCeCeCeCentntnttntttttttttterererererererererererererererere & & &&&&&&&&&&&&&&&&& O OO OOOOO O OOOOOOOOffiffiffiffififfiffiffiffiffiffifffifffiffi cccccc cc e e eee ofooofofofofoooo M MMMMMMululululuullultititittitititicucuucucucucuucultltltltlttlttttururururururururururalalalalalaalalal S SS S SS S SSS S SStutututututututututtuudededededededededededeeeedentntntntntntntntntntnnntntntt P PPPPPPPPPP P Prororororoororoororoororogrgrgrgrgrgrggrgrgrggrgrggrrgrrrg amamamamamamamamaamams:ss Thee Inttttererererererererccucucucuuuucucuultltltltll uuururrurrrrrurrralalalalalalalalalalaal C C CC C C C enenenenteteteteteteteteteterr r r rrrrrrr hhohohohohohohohohohoh uuusususususususususususususussussuusuuseseesesesesesesesesesesesesseesseseseessssssesssseessssesesssscocococooococoococococooccococc fmfmfmfmfmfmfmfmfffmfmfmfmfm ororrrororororororororororortttatatatataattaablblbbblblbblblbb e eee spspspspsppaaaaaacccca esesesesesesesessesessesesses ff f f fff f f f f f ffffff ororororororororororororororororor mm mmmmmmmmmmmmm m mmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeetitititititititititititit ngngngngngngngggggngggngngngngn s,s,s,s,s,s,s,s,s,ss,s,ss,s s s s s ssssooco ial evevevenenenene tstststt a aa aaaannddndndnddnd p p p p ppp ppp pppror grgrrgrgrrrramamamamamsss sss ininininvovovovovooooovoovovvov lvlvlvll ininnininingggggg g susususususususususususususuuuuchchchchchchchchchchchcchchcc d ddd d dd d dd ddivivivvivvvvvi ererererereeerrsssssesessssssee groupppppsss sss asasasasasasasasasasas A AA AA A AA AAAA Alllllllliaiaaaaai nnnncncncnccccccncncncncncnncncncnncnncnccccccnnnce,e,e,e,e,ee,e,e,e,e,e,e,e,e,ee,,e,ee,eee,eee,eeeeeeee,,ee,,, BBBBlllBBBBBlB aacacacacacaacaaaa k k k k StSStttttSttttttudududududuududeneneneneennenennentstststststssssss A A AA A AAAAAAAsssssssssssssssococococococococococococococococociaiaiaiaiaiaaiaiaiaiaiaiaiaiaiaiatitittititittititititititititittitiononononononononononononononon, ,, ,,,, ,, , , , InInInInInInInInInIInInnnInntetetetetetetetetetetttetteteternrnrnrnrnnrnnrrrrnrr aatataaaaaaaaaaa ioionanaaaaal l l ll SSStStStStStStSStStSS ududududududduddduudeneneenennenennenne ttt t tt t tttt AAAsAsAsAsAsAsAAAAsAsA sososossosososssssociiciciciciiciiiiatatatatataatattatatattatiioioioiooioioooioiooiioionn,n,nnn,, A A AAAAAAsisisisssisisisis anannanananananananannnnaa SSS SS S Stut deddddedeeeeeeeeeeeenntntnttnttttttntntntttnn ssss s ininnnnnnn A AAAAAAshss eveveveevevevevevevevevevilille, , HHeHeHeHeHHeHHHHeHeHHHHH rmrmrrmanananananan@s@@@s@s@s@s@s@s@s@s@s@s@@s@s@s@@s@s@s@s@s@s@s@s@s@s@s@s@s@s@s@@s@s@@@s@@@s@ss@ss@@@s@@OOrOrOOOrOrOOrOOrOOOrgugugugugugulllllll ooooooosososos@@@@@ssss@@@@@ eeeeeen n n n nn LaLaLaLaLaLas s s ssssssssssss s AmAmAmAmAmAmAmAmAAmAmAmAmAmAAmAmAmererererererererererererereereerrericicicicicccicicicicicicicicicicasasasasasasasasasasasasasas (( ( (( (( ( ((( ( ( ( ( ((HOHOHOHOHOHOHOHOHOHOHOHOOHOHOHOHOHOH LALALLLALAALALALAL ))))))) anannanananananananand d ddddd d d dd d d HiHiHiHHiHiHiiHiHiHiHiHHiHiHH llllllllllllllllllllllllll elelellleeeleee . .

TTTTTThThThThThThThThThTThTTTTTTThThThThe eee eeeee SShShShShShShShShShShSShShShererererererererererrririiiriririririirilllllllllllll C CCC CCCCCCenenenenenenenene teteteteeeteteeteteeer:r:r:r:r:r:r:r:r:rr:rr WiWiWiWiWiWWWiWiWiWiWiWiWiWiWiWillllmlmlmlmlmmlmlmlmlmlma a aaaaaaa aaaa a MM.M.MMM.MMMMM.MMMMM S SSSSSSSSSSShehheheeeehheheheeehheheheherrrrrrrrrrrrrrrrrrrrrrrrrrililiiliilililiilili lllll CCCeCeC ntntntntereree i iis ththhththt eeeeeeee e unuuuunununununuuuununnniviviviviviiiviiivviviverrerererererrererer isisisiisisisisiisisisisisisisisisisityttytytytytytytytyytytyttytytyttytytytytyttytyy’s’s’s’s’’s’s’s’s’s’s’s’s’s’sssssss n nn n n nn nnnn nnn nnnnnnneweweweweweweweweweweweewewwweweeewwwesesesesesesesseseseseseeeseesessessttt tt tttt ttt aaaanaaannannd d d lalaargrgrgrgesesessssssssessssst tt t t tttt fffafafafaaaaaafaaaf cccccciiciccccccccccccciliiiitytytyty, , , oofffffffffffffffffffefefffffeeeeeffeffffefefferiirrr ngnngngngngnngngngngnggngngngngngngngngnggnggnggnggggga a rarangngnggge e e ofoff a a acacacadededeeemimiimimimimic c c c c c ananananannnndd d d d d dd ouououoououtrtrtrtrtrtreaeaeaeaeaeaeachchcchchchchchhhh p p prrorogrgramams s fofocucusesed d ononononnn hhh hh h h hh heaeaeeeaaaeaeaaaaltltltltltttthyhyhyhyhyhyhyhhyhhhyhyyy lllll l l ll liviviviiviviviivvivvinininininiiinngg g gg g ggg ananananananananananananand ddddd dddd d dd weweweweweweeeweewwweww lllllllllllllllllllneneneneneneneneneneneneneessssssssssssssssssssssssssssssss pppp p p ppppp pp pppp p prororrrororororoororrrororororroroooomomomomommmmmmm titititionnnnnnnnnnnnnnnnnnnnnoo .. . ... ThThhhhhhhhhhhhhhhhhhhhhhheeeeeeeeeeeeeeeeeeeeeeeecececececeececccccc nntntntn ererere i i iiis s s hohohomemmmemee tt ttooooo o thththhhththeeeeee e acaacacaacaca adadadadaddada ememememmemiciciciciciccic DDDDDDDepeepppararara tmttmeeeneent t fof HHHHHHH HHeaeaeaeaaltltttthh hhhh ananana d d WeWeWeWWWWWWeWWWWWeWWWW llllllllllllllllll nenenn sss, withhhhhhhhhth cclalalassssroroomomommms,ss, dddd dddededededeeedediciccciccciiicatatatttttedededddededededed ssssss s ss spapapapapapapapapapapapacececececececececececcecececceccececcececeeeeceffofoff r r unundedergrgr rar duate researchh, a hiiighghghghghg -tech tttet acachingngngnngng/ddeemmmonoonstststtrararar titiononnn kkitittttchchchchchchhchhchhhchchc eneeeenennnnnenennnnnn, , ,, , , , , ,, ,,,, ananand ddd rereeeseseseseseeeeararararararararaaaarraraaaarararraararaa chchchchhhhhhhhcch aaaaa aa aaaaandndndndndnndn lleaearnnininnngggggglalalalallal bsb .Theee S SSherrrrrriliiiiii l CeCeCeeeeeenter includededededeeeeeeeeeeeeeeessss sssssss ss sss ananna ee expxpxpxxx ananansisisiveve fifififi fifi t ttnenenessssss c ccenenenennneeennnttttetetetetetetetteteeerrrrr,rrrrrrr,rrr,rrrr aaa a a a b b bbioioioioiooiooioiooooioioffefefeffefefefefffffefefeeeededededededededdededeededdde bababababababababbababababbabaaaackckcckckckckkcckckkckcckkckkckckcckckcck ll l l ll l ababbababababaabababbbb a a a a a aa nnndndd mmmmmmmmmmmmmmedededdedddededdddddddddedddditiititttitittiitttitttatatatatata ioioiooion nn rrrrrrrororrrrrrorrrrror omoomomomommomomomoomommomoooooomooooooo , , , anaananaa d tththththththhtththht eee eeeee WWWWWeWeWeWWWWWW lllllll neneneeeeessssssssssssss CCCCCCCCCCCCCCCCCCCCCCCafafafafaaafé.éééééé

KiKiKKiKK mmmmmmmmmmmmmmelelelelelelelel A A AA A AAA A AAAArererereerrrenananananana: : : : : ThThThThThThe e e ee neneneneneew w w w w KiKiKKKK mmmmmmmmmmmmmmmmmmmmmeleleeleleleleleelee A A AAA A AAAAAAArerereenanana, , wwwhich isssi p pararara tttt t ofofofofofofofofofofooff t t t ttttt tthehehhehehhheh SSS hheherrrrrrr iiililll CeCeCeCeCeeCeeCentntntntnttntntntntnterererereeererr, ,, , , caccccacacacacaccccann n nnn n seseseseseesess atataatatatatataaaatat uu uuu u u upp p p ppp tottotooooooooo 3 3 33,8,8,8,8,8888,8,88888, 00000000000000000000000peopoppppppopopppleeeleelellellelle f f f ff f ffffforororororororoor cccccc conononononncececececertrtrtrtrtr s,s,ss,s, ccc cccomomomomomommmememmmmencncncncncncnccncnccemeeememememememeemememenenenenennenennennentstststs, , , cocooc nnvvocatttioioiooonsnnn , , , leleleectctctctctttttctttctururururururururu eeseseses,, ,, , ,, iinininiiii teteetercrcrcr oloolleeelelegigiggiiig ataatatatatatatataaaattaa e e e eeee e ee e mememememmememeememenn’n’n’n’nnnnnn s ss s sss ananananananannndd dd d ddd wowowowowwowwww mememmememeeen’n’n’n’nnn’nn s s ss ss babababbabababababababbbaabaassss-----s-sss-ssketbbbbbbbbbbalalalalaalalallaa l lll l l l ll gagagagagagagagagagggagamememmememeemmmes,s,s,s,sss h h hh h heaeaeaeaeaealtltltltltlth h h h h h fafafafafaf iriririririrs,s,sss,s a aa andndddddddd c c c c c c cc cc cccccomomomoomomomomomomomomo mmmmumumumummmmm nininityyytty eeeeventtts..s.AsAAshehehevvvvviviiiilllllllllle e eee ee e e e cocooocoooocococooommmmmmmmmmmmmm unu ity.

/// UNC ASHEVILLE BULLDOGS ///

69/// F E A R T H E D O G ///

KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKKuKuKuKuKuKKKuKuKKuKKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAAAsAsAsAAAsAAsAAssssheheheheheheheheehehehheeeeeheheheeeeeevivivvvivivivivivivivivvivivviv lllllllllllllllllle ee eee e eeee ofofofofofofofooooffffo fefefefefefefefeffeeeeeeeeeeeeeeeefersrsrrrrrsrsrssrsrssrrrrsrssrssrssrsr a a a a aaaaaaaaaaaaaa ““““““““““ ““ttotototototttotottooooot p-p-p-p-p-p-p-p-pppp nononononononnonoononononooonotctctctttctctttttccttcctt hhh h hhhhhhhh hh acacacacaccacacacacacaacaaaa adadadadaddadadadaddadadaddadddda ememememememememeememememeemeememememmmmicicicicicicccicicccccicici e e e ee ee xpxpxpxpxpxpxpxpxpxxxppxxpxxpxppxppeerereeeereerereereeeerrre ieieieieieeeeiei ncncnnccccccncncnccnn eee,e,e,e,eeeeeee,,,, ”” ””” ””””” anananananananananananananana d,ddd,d,d,dddddd,ddddd,d,d,d,d,d,d,dddddd b bbb b b bbbb bbbasaasasasasasaaaa edededededededededededeeeeddeeedee o oooooo oo ooon nnnnnn n nnn nnnnn sstststststststststsststsssssttudududududududududdududuuuuuuuddenenenenenenenneneeneneeennnnennennnnnntttt t t ttttt tttttt t ttt ssususususussssss rvrvrr eyeyyyeyyyyyyyyyyyyyy r rrrrrrrrrrrrreseseeseseeseeeee popopopopopoppppppp nsnsnssn esesesesesesssesssssss, , , , , ,,,,,,AsAsAsAsAAsAsAsAsAAsAsAsAsAsAAsAsAssssAshehehehheheheheeeehehheehehehehevivivivivivivivvivivivivvvivvvvillllllllllllllllllllleeeee eee eeeeeee e isisisisiisisisississss rr r r rrrrrrr rananannanananannanaaananaanaanaaaankekekekekekekekekekekekekeekekekekeekeeedddddddd dddd dddd d d d 111111111111111111111111111111thtthththththththtththththththhththttttttttt i ii ii iiii nnnnnnnnnnnnn nnn n ththththththththththththhththhthththt eeeeeee ee nanaaaatitititttiititittitiitititt onn o on n ththee “c“colollelegege c citty y gegetss hhigighh mamarkrks” lisst. - TThehe PPrir ncncetetonon R Re-e-viviviviv ewewewewewwewwwwwwwwwwwwwwww’s’ss’ssssss’sssssss ““““““ “ “ ThThThThThThThTThee ee ee e e e BeBeBBeBeBeeeeBeBeBeBBeeeBBBeB ststststststttsststststststtstststttstssts 3 33 3 3 3 333 333333337777777777777777777777777777777777777777 C C C CC C C C CC CC CCColololololooolollooololoooololollelelelegegegegegggggggggggg ss s - 2022020201313131333 E EE E dididititititittiononononn”” (A(A(A(AA(((((((((((( ugugugguguggggggggggggusususussu ttt tt tt 20202020202201212121222)))))))))))))

UNUNUNUNUNUNNNUNUNUNUUNUNU C CC CCCCCCC AsAsAsAsAsAsAAsAsAsAsAsAsAsAAssshehehehhheehehheeeheheeheviviviviviviivivivvvvvv lllllllllllllllleee e e eeee rarararararararrrarrrarar knknknknknknknkkknknknkknknkkknnkkkkedededededededddeee 2 2 222222 2 222221st in the nnnaataa ion n as aaa “BeBB sts Buy C C Colololololleeeegegegegeg ,” based on n quququalalitty y ofofo teaeaching, carareeeerr prprprprprprrrprprrpppppp osososososospepepepepepeeeeepp ctctcttttctcccccccccccccc ss,s,s,s,s,ssss,ss, g g ggg ggggg grararrararaaaaaararaarrar duddududududududududududududududduuuuataatatattattaatataaaaaaa iiiioioioiooiiioioi n n n nn nnn rrrraaaararaaaaatett s,s and sstututudedededed ntn debebe t leveel..Off theeehe e e igigiggghththhththhh u niiveerssititieies s inin N NNoororthth C CCararolo inina a a aa a aa ththhththththththththththtththatataatttataatattatatattt mmamamamamamamamamamaammamaamm dededeedeededeedededdd ttttttttttttt ttthehhhehheeeeeheheheehehehhheeheehehhee ll llllll llllisissssssssississsissssisssst,t,t,t,t,t,t,ttt,tt,t,tt,t,tt,ttt oo o o o ooooooonlnnnlnlnlnlnnlnlnlnlnlnlnlllllln yyyy yyy y y yyyyy y yyy y yy yyy UNUNUNUNUNUNNUNNUUNUNUNUNNUNNCCCCCCCC-C-CCCCC-ChChChapapappelll H Hilll,l, aat 13313133tht , , raraaaaanknknknknkeded higigheher r thhthhananaa U UUNCNCNNN AAshheveve ilillele. . RaRaRanknkininngsgsgs p prerereeeepapapapapapapapapapaaap rerererererreerererererrrred d d dddd d ddd dd dddd bybybybybybybybybybybybbyybybybybyy thththththththhthhttt eeee e eee CeCeCeCeCeCeCeCeCeCeCeeeeeCeeeeeeentnntntntntntnnnnnnnnnnn erererrrrrerrrrr fff fffffff fffff oroorooorororrrrororroroorororoooo CCCCCCCCC CCCCCCCCCCCCoooolololololooloooo leeeeeleleeleegegegeggegeegege AAAAAAAAAffffffffffffffffffffffffororororororororororororrorrrdadadadadadadadadadadadaddadadadaabibibibibibibiiibiiilililililillllllllll tytytytyttytytytytytytytytytyttyy a a a a a a a aaaaaandndndddndndndndndnddnndndndn PPP PP PPPPP PPPPPPPPPPrororororororororororoorooooorodudududududududdududududududududduuuuctctctctctctctccctcttcttttcc iviviviviviviviviivivivivivvvi itittttttty.y.y.y.y.y.y.y.y.y.yyyy.yyyyy. - --- - - F FF Forororororoororororororroorroro bebebebebebebebebebebebebebebbbeb s ss s ssss s s ss MaMaMaMaMaMaMaMaaMaMMaMaMaaMaMaMaaM gagaagagagagagagagagagagagagaggagaggaaazizizizziineneneneneneneneenenenee ( ( ( ((( ( (( (((AuAuAAuAuAuAuAAuAuAuuuuAAuuAA guguguguguguguguuguguguuguguustststsstststssss 2 2 2 2 222 22222010101000100000000 2)2)2222222222222

“U“U“U““U“U“U“U“U“U“U“U“U““U“U““U“UU“U“U“U“U“UUUUNNNCNNCCNCNNNCNNNNCNCNNCCCNNCNCNNN A AA AAAAAAA A AAAAAshshshshshshsshsshshshsshshs evevevevevvvvvvveveeevvvvvviiilililililililililiiiillllii leleleleleeeeeeeleleeee aa a aaaaaaaaaaa aaaaandndndndndndndndndndndndndnndndndndnnndn ttttt tttttttthehhheheheheeeeehhehhheehee c cccccccititititittitity yyyyyyy ofofofofofffofoofoffoff A AAA AAAAAAAAAA Ashshshhshshhhhhhhshshhheveveveeeeveevevevevee ililililillililllillelelelelelelleeele aaaaa a arererererreererere sssss s steteeteteeeeteeteteeeepepepepeepepepepepepeppeppe ededddededededeededdedd iiiii i innnnn n nn whwhw ititewewwatata ererer c ccululultututurerer m mororore ee ththanan a anynyyywhwhwhwhwhwhwhwhwhwhwhwwhwhwhwhwhw eerererererereereee e e e eeeeeeeeeee elelelelelelleleleleleele sesesese ininininininnnnninnninninnnn tt t t ttttttheheheheheheheheheheheheheheehhheeeeheh www ww w worororororororo ldlldldlddddddlldldldlldldlddddddldddlddd.................. . AsAAsAsAsAsAsAsAAsAAAsAAAsAAss didididdidididididdididdddididdiddiddiii e eeeeeee fffrfrffrfrfffffrfrfrffffrffffff ooooooomomomomomoooo t theeheirir l llonononoong g g g lilil ststttt oof f fi rsrst t dedeeeescscs enentsts a andddndnd r racace ee iiiwiwiwiw nsnsnsss, , UNUNUNUNUNUUNNCCCCCC C AAsAsAsAAAsAAsAAshehehehhhehehehevivivvvvvvvv lll e e alalalalalallalalalalaalalla umummummumummumummu s ss s ssssss ss sss anananananananannndddddd d dddprprpppprprprppp ofoffesesee sosorsrs a aaaaaaaaaaaaaaaaaalslslslslsslslsooooo o ooooooooo gigiiigivevvevvvvevevevvvv b baaaaaccacacaccccccaaack kk k toto ttttheheh p padadddldldldlininii g ggg cocommmmmmmm ununititty.yyy.”-”---”- “““ ““HHHoH nnonon r r RoRollll: : ThThhe e BeBeeB stst O Oututu dododooror SSchchoooooooooooolslslslslslslsllsslsl i ii ii i i ii i i iiiiinnnnnnnn n n n n nnnn ththththththththththhhththhe ee ee e e eeeeeeeeeBlBlueueueueueeue RRididgege,”,”””””””””””””” B B B B Blllluullllllll e e RiRidgdgggggee eeeeeeeeeeee e OuOuOuOuOOOOOOuOOuOOOOOO tdtdtdttdttdttdooooooooooorsrsr ( ( (((((((AuAuA gugugugggggggggggg stst 2 2 222010100112)2)

UNUNUUUU C C AsA hehevvvvivviviviviiivvvivvvivvvvvv lllllllllllllleeeeee eeeeeeeeeeeee isisisisisissisisiisisisssissiissssssss “““““““““““““ ononononnonoooononooonnnnnnnnonoonoo eeeeeee ee e ofofofofofofofofofofofooffoofofoofoooo tttttttttttt t ttthehehehehehhehehehehhehehhehheeheehhe bbbb b bbbbbbbb eseeseseseseseesesessseseseesssessssttt t t t ttt t tt t edededededeeedeeee ucucucucatatioiooonanan ll babargrgaiainsns i inn ththe e cocoununtrtry.y.” ” FoForr nininene c cononononoooononononononoonooononnnnnno seseessesesesecucucucucucuccuutiiitiiiititititititiiit veveveveveveveee y yyyy y yyeaeaeaaaeearsrssssrsrsrsrs,, ,UNUNC C AsAshehevivillllllllllllllllllllllleeeee’e’e’’e’eee’eeee’eeeeeeee s s sssss ss ss EnEnEnEnEEnnEnnvivivivivivviviviv roroorororooonmnmmnmnmnnmn enenenennentatataatatallll StStSStStttStStudududuuduuuduuuu ieieieieeees s s s ss ss s PPrPrPrPrPrPPPrrP ogogogogogogoggrarararararararaaam mm mmmmmmmm hhhahhhahhhhahahhhhhahahaas s s ssssss bebebeebebebebebebebeeebebebeebebebeeeenenenneeneneneneeenene nnnnnnnnnnn nnnn nnnnnnnamamammamamamamamaamamammmmmamamamammeddedededededeedededeeededededded ttttttttt tt tttt ttooo ooo oo o ooo o oo ththththththththththththththththhthheeeee eeee eeeeeeeeeeeee lililililliistststststststststttttttttt ooo oo o o oo of ff ff prprppppp e-e-prprofofofoffoffffffofffffffffffffo eeseseseseseseseesseeeeeee sisisisisisisiononononoononnno alalaalaalaall ppp p ppprorororrororrororo--grgramams s wiwithth u unuuuunususususssusususususususuususuuualalallaaalalaalallalalalalaala ssssss ssstrrtrtrtrtrtrtrttrtrtrtrtrtrtrtrtrrrrreneenenennnenenenennnnnenenenne gtgtgtgtgggtgtgtggttgtgthhhhhhhhhhhhhhhhh h ininninininiiinininininninnnnnn p ppp p pppppp p p p prerererererererereeereeeeeepapapapapapapapapapapapapapapapapap ririririririririririririrrririrrringngngngngngngnggngngngngnnggngngngnnnggn sssssssssss s ssss sstutututututtututtuutututuutututuututudedededeededeeedededededeeeeedeentntntntntnnttntntnttntntnnntnn sssssssssss s ss fofofofofoffofofoofofff r r rrr rr cacacacacaaccaccaarererererererereererererereerrs.s.sss. - -- - T TTTT TTThehehehehhehehh F F FFFFFFFFFFisisisisisisisssskekekekekkekkkekeke G GGGGuiuuiuuu dedddedeededeee t t tttt ttt to o oooo CCoCoCCCCCoCoCoCCoolllllllllllllllll egegegegegegeggegeegegeggesesesesssesesessesseses, 20202020202020020202001313333 EdEditioi n n (J(Jululy y 20012122)))

UNNC C AsAshevillee is listed amamong AmA erica’s “green” ccollllegeges aandnd uuniniversrsittiees.s - TThehe PPririncncettonon RRevevieiew’w’ss ““G“Guide to 3222 Grreeenn Colllegegese for 2012” (April 2020112))

UUNC Asheevivillllee is among jjusu t 75 iinsn titutions nationwiw dee nnoteded aas s a a “B“Beest VaV lue”e” p pubublic coollegge. - TThee PPrinceton Reevieww’s’s “20011 BBest Value CoC lleges” (Februuarry y 22012)

UUNC Asheevville e isis o onene o of f ththe e nanatitionon’s’s 5 0 bebest values inn ppppppp bubububbblililic cccc coollllegggggess, , iwithth t thehe fi fif fththhhh l lowowowowowesestt tototatall cost of f faattendinnnnnnnngg gg g g gggg pepepepepepepepp rrr rrr yeyeyeyeyyeyy arararararara , , ,,,,, annananananddddd d thththththe ee eeee eieieighghghgg ththth l l lowowowesesest t t t avavavavererereragagagagaggggee e e e dededededd btbttbttbt a aa a amomomomooomomomomonnngngnngngnggg g gg ggrrarar duduatatatatateses. . -- Kiplppppp inininnii gegeer’’s ss s PePP rsrsrssr onalalalal F Financee MMagazinene ( ( (((((((JaJaJJaJaanunuuuunun arararararra yyyy y y yyy 2022020202022202020121222212122212))))))

UNUNUNUNUNUUNUNNC C C CCCCCCCC AsAsAsAsAsAsAsAsAsAsAshehehehehehheeheh viviviviviv lllllllllllee e e ee rarararaaaarararraanknknknknknkkkknkkkssssss s s eeeiiiieeieighghhghghhhhhhghghgg tththththththhhthth i i in nnn ththttthtththeeeee e ee nanananananananann titititititititittt ononoooonnooono a aaaa aaa aamomomomomomomoomm ngngngngng PPPPubububbblililil ccc c c LiLiLiLLLiLiLiLLL beebeebeeeeebbbb raalll l AAArrrrtstststststststs C CCCCCCCCCC ooooololoololo lleeeeeleleegegegegegeeegeg s,s,s,s,s,s,s,s, aa nnndnnnndndnd i i issss ss ss tththhhhhhhe eeeeeee oononono lyyyyy N N NN NNorrth CaCaCaCaCaCaCaCaCaCaCaarororrororororororororor lililiililiililinananannanaaaanana ii iiiiinsnsnsnsnssnsnsn tititttitiitttitittit tutututuuuuuutt titititittititionononnnnnononnnnnoonon lllll lll ll isisisiiisiisi tetetettteetttt ddd d ddd d ddd aaamamamamamaaamononononnnonnnnongg g gggg NaNaNaNNNNaNNNaNaN ttitititttiiiononononooo alalalla L L L LLibibibibbbibibbererererererererereraalalalaaaa AAAA AArtrtrtrttsss ssss CoCoCoCoCoCoCoCCoColllll egegegegeseeseseseeses whooooooooooseseseseesesesse ssssssstutututuuuututut denntttttttsss s s ggrrrrrgrrrrgg aaaaadddaddddduauauauauauauau tteteete wwwwwwittttti h hhh h ththththththttht e eeeeeeleleeeleleeeeeasasaaaaasaaasasasasastt ttt t t t ttt t tttt amamamamamamammmaaamamaamououououououountntnttntntnn ooooooof fff ff dedededededededdd btbtbbtbtbtbbtbtt. .. - - - U.U.U.UUUUUU S.S.S.S.SSSS. N NN NNNNewewewwws ss & &&&&&&&& & WoWWoWoWoWoWorlrlrlrrlrr d d dddddddd ReReReReReReReReReR popopopopopooorrrtrtrtrtrtttrtrr ’ssss’s’’s’’s’s’ “““AmAAmAmAmAmmmmAmmeeeeere ica’s Best Colleges” ((SeSeptpteemmmmmbebebebebebeb rrrr 2000000011111111111))))))))

UNUNUNUNUNNNNNNNNC C C C C AsAsAsAsAsAsAsAsAssAsAsAsssAsA hehehhehehehheheheheehehheeeevivivivivvvivvivvivivivillllllllllllllllllle ee eee iiiiiiisisisisis o oo o onenenneneenenneeeee ooooo oo ooooffffff fff ff f AAAAAmAmAmAmAmAmAmAmAmAmAmerererererrerreriiiiiiciccic ’’’’’’’a’’a’aaa sss ss “1“1“1“1““1“1“1“1“1110000 000 0000 0000 BBBBeBeBeBeBeBeBeBeBeBeBe tststststststtstststss CCC C CCCCCCCCCCCCCC lllolololoololololoolololo lllleleleeeeleelelelleegegegegeggegegegegegegeegegges ss s s fofoof r r hthhhthe e e MoMMoMooMMoMooMoonnneneeeeenen y.y.y.yyyyy.yyyyy”””” ” ---- - BaBaBaBaBaaaBaBaBaBaBBBaBaBaaBanknknknknkknknnnknknknnknknnkrarararararararr teteeeeteteteteeteee.cccccc.cc.ccc.c.c.comomomommmmommmmomm, a aaaaa lelelll adadadadadaddadadddddinininnnininggg gggg g g g gg g g gggg gg ooononononononoonnlilililililineeneneneenene sosososoosoososourururuururuuururururururrrrururrurrcecececcececececcecceccececececececececeececececcecee o oo oo o o o oo o offffff f f fff ff f fifififi fi fifi fifi fi fifififi fi fi fifififififinananananananananananannannanananannnanaaaancncncncnncncncncncncncnnncnnn iaiaiaiaaiaiaaiaiaaaaaaial ll ll ll llllllll ininninnnfofofooofooooooooooormrrmrmrmrmrmmmmrmrrmmmrmmmmmrr atatatattatataataaaatatattattataaa iooioioooiooooioioioooioiooooi nnnn nn nnn nnnnnnn (J(J((J(J(J((J(J(J(((J(J(J(J(Junununnnnunnuunununnnunnununneeee e eee e eeeee eeee 20202020202020202202020202002220222201111111111111111111111))))))))))))))))

AdAdAdAdAdAdAdAdAdAdAdAdmimimimimimimimmmmimmimimmimmiisssssssssssssssssssssssssss ioioioioioioioioioiiioioioiooioioooonsnsnsnsnnnsnnssnnsnnnssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshsssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 111100900090909009090900900909099990-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 1211122212222221111221212121221221121250500505050500050500505000505050550050505555555050000 ( (((((( ( ((((( ((( (((FFFFaFaaFFaFFFaFaFaFaaFaFaFaaFaFaaaaallllllllllllllllllllllllllllllllllllllllll 2222222222 2 2 22222 2 222222 010100101101010101010100110100010101010100101011010110110 1)1)1)111)1)))1)111))1))))111)1))1)1

AnAAAAAAAnAAnAAAnAnAnAnAnAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TuTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $5$5$5$55$ ,3,33,3,333333,333333333333393933939393939939939939999939999 (((((( ( ((((((( (((((202020202020202020202020202222222 11111111111111111111111--1111-1-1-1-1-1-1-1-- 2)2)2)2)22))))22)2)2))

AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 9999999999,9999999999,9,00020202022002002020020200020202020200020022000002222202202000020255555555555 5555 5 555555555 (((2(2(2(2(2(2(2(2(2001010111111-1-1-1-11-11-11 122212122222222222))))))))))))) ))) )

AvAAAAAvererererererraaggggagagagagaaaagagagggee e eeee e AAnAnAnAnnununununnnnnn alalalalallllllllll HHHHHHHHH ououuusisisisiingngngng a aaaaaa anndnddddddndddddddnddndndnddd MMM MMMMMMMMMMMMMMM MM MMMMM Meaeaaaeaeaeaaeaaaeaeaeaaaeaeaeallllllll l llll PlPlPlPlPlPlPPPPPP ananan FFFFFFFFFFFFeeeeeeeeeeeeeeeeeeeees:s:s:s: $$$$ $$$$$$$$$$ $$ $$$$7,7,7,7,30330303 222 2 2 2 (2(2(222(22(222(2222(22222(( 0000001011010000 1-11111 1212121221222) )

FiFiFFFFFFFiFFiFiFFFiFiFiFinananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvviviivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennnttttststststttststts’ ’’ fi fi finannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

70 /// F E A R T H E D O G ///

Dr. Anne Ponder became the sixth Chancellor of the University of North Carolina at Asheville in October 2005. She began her tenure by leading a campuswide collaboration to create a dynamic and viable fi ve- to seven-year strategic plan and revised mission statement.

With this focus, UNC Asheville has made major strides as a national leader in the liberal arts and has become a one of the top choices for students seeking a rigorous and multi-faceted educational experience.

During her tenure, the university was chosen as the fi rst national headquarters for the Council of Public Liberal Arts Col-leges and several majors in Religious Studies and Anthropology have been added to the curriculum. Dr. Ponder has encouraged innovative collaboration that resulted in a UNC-Chapel Hill satellite pharmacy education program. Building new partnerships with local governments, scientifi c agencies and non-profi t organizations have resulted in agreements with Mission Hospital Sys-tems, the City of Asheville, the Renaissance Computing Institute and others for enhanced learning and research opportunities for students and faculty. This emphasis on collaboration, one of Chancellor Ponder’s hallmark traits, also led to the cultivation, with other campus and community leaders, of some of the largest multi-million donations in the university’s history.

Chancellor Ponder oversaw the largest building projects in UNC Asheville’s history, including New Hall classroom building; Sam Millar Facilities Management Complex; Zeis Science and Multimedia Building; and the Wilma M. Sherrill Center, which houses the North Carolina Center for Health & Wellness and the Kimmel Arena. In each of these projects, environmental sustainability has been a key feature, as dictated by the university’s strategic plan. These green efforts – combined with countless others across campus – have earned the university a host of awards, including repeated recognition as one of the lowest energy consuming agencies in the state.

A strong advocate for community service, Dr. Ponder is a member of the Mission Hospitals Audit Committee, the Asheville Community and Economic Development Alliance, the Children’s Welfare League and the WNC Community Foundation’s Women for Women. She also is a board member for the non-profi t Kendal Corporation.

Before becoming Chancellor at UNC Asheville, Dr. Ponder served for 10 years as president of Colby-Sawyer College, a private liberal arts col-lege in New Hampshire. Prior to that appointment, she held teaching and administrative posts at Elon College (now Elon University), Guilford Col-lege and Kenyon College.

Chancellor Ponder, who holds a doctorate in English from UNC-Cha-pel Hill, is a nationally known expert on institutional effectiveness, stra-tegic planning, and fundraising and resource development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education and wrote the chapter on strategic planning in the American Council on Education’s book “Leading America’s Branch Campuses.”

A native of Asheville, Chancellor Ponder is the daughter of the late Eleanor and Herschel Ponder, both of whom trace their Asheville family roots to the 1780s. She is married to award-winning writer and publisher Christopher Brookhouse.

DR. ANNE PONDERCHANCELLOR - UNC ASHEVILLE

/// UNC ASHEVILLE BULLDOGS ///

71/// F E A R T H E D O G ///

Janet R. Cone is in her ninth year as Director of Athletics at UNC Asheville. She also serves the school as Senior Administrator for University Enterprises. This past year was highlighted by the men’s basketball team’s winning the Big South Conference championship for the second year in a row. The Bulldogs set a school record for conference and overall wins. Asheville advanced to the NCAA Tournament where it nearly pulled off one of the greatest upsets in NCAA history when the 16th-seeded Bulldogs lost a close game to top-seeded Syracuse. In addition, the school successfully hosted the Big South Conference men’s basketball tournament with a national television audience and sellout crowd watching the championship game in the school’s brand-new Kimmel Arena. Cone oversaw the successful opening of the Wilma Sherrill Center which houses the Kimmel Arena. She worked to bring the top-ranked UNC Chapel Hill men’s basketball team to open Kimmel against the Bulldogs in a game that was nationally televised. That game was also sold out. The Sherrill Center had more than 100,000 visitors the past year as its hosted various events

from concerts to graduation.

Other successes included the men’s tennis team’s fi nishing in second place in the Big South Conference, its highest league fi nish ever, the volleyball team’s advancing to the semifi nals of the Big South Tournament for the eighth time in the last nine years, and the women’s tennis, men’s tennis and women’s track and fi eld teams being honored for their work in the classroom.

Cone guided the athletic department through a successful certifi cation process by the NCAA. In addition, she brought back women’s swimming as a varsity sport for the fi rst time in more than 35 years.

In the 2010-11 year, Cone saw the UNC Asheville men’s basketball team win the Big South Conference championship and advance to the second round of the NCAA Tournament. In addition, the Bulldog women’s indoor track and fi eld squad fi nished in third place, the highest fi nish in school history. Senior sprinter Natalie Pearson made her second appearance in the NCAA National Outdoor Track and Field meet.

Three years ago, Chancellor Anne Ponder appointed Cone to the position of Senior Administrator for University Enterprises. In this position, Cone oversees the Sherrill Center, manages specifi c community relationships and serves as a member of UNC Asheville’s major gifts team. She is a member of the Chancellor’s Senior Staff.

In 2009, Cone helped to create the Asheville Buncombe Regional Sports Commission to bring athletic events to the Asheville area. Her leadership helped secure the return of the Southern Conference men’s and women’s basketball tournament to Asheville in March 2012.

Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club which recognizes student-athletes who make a 3.0 or better grade point average each semester. More than 900 student-athletes have made the club during Cone’s nine years, and in 2009-10, a record number of student-athletes earned that distinction.

During that same time period, more than 800 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes earned this impressive academic distinction.

Cone has overseen construction projects that have dramatically improved the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The Wilma Sherrill Center/Kimmel Arena was completed in the spring of 2011. Funded partly through a $35 million state appropriation, Cone helped raise more than $ 7 million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation, attract major speakers and performances, and have a new home for the men’s and women’s basketball teams. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that were completed in the fall of 2009. The facility has been the home of Bulldog men’s and women’s tennis for the past three seasons, and this past spring hosted the Big South Conference men’s and women’s tennis championships for the fi rst time in school history.

JANET R. CONEDIRECTOR OF ATHLETICS • SENIOR ADMINISTRATOR FOR UNIVERSITY ENTERPRISES

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

72 /// F E A R T H E D O G ///

Highlights of the 2007-08 year included the men’s basketball team being co-regular season champions of the Big South Conference and earning a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends. In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi t from each and every day.”

In 2006-07, three different UNC Asheville teams won Big South Conference championships and advanced to the NCAA Tournament. In May 2006, the baseball team completed an amazing run with its fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against topseed UNC Chapel Hill in the College Cup. In March 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship. Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.

The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics website, and the implementation of internet broadcasts and video-streaming for six different sports.

Cone has been tapped by the NCAA and the Big South Conference to serve on several key committees. In the Big South, she is on the committees for Budget, Compliance, Ad Hoc Committee on Publicity and Promotions, Baseball, Men’s and Women’s Basketball and Men’s Soccer and Tennis. In the spring of 2006, Cone was named to the NCAA Women’s Basketball Issues Committee. In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver. In September 2008, she began a four-year term on the NCAA Division I Leadership Council.

Other highlights of Cone’s tenure include the development of a new Athletics Logo and a partnership with the Asheville City and Buncombe County Parks and Recreation Departments.

In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service.

Cone is extremely active in the community, and in the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. In addition, Cone was recognized as one of 10 Women to Know in Western North Carolina.

Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach beginning in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003.

Prior to Samford, Cone served as the fi rst full-time Assistant Athletics Director, and the head women’s basketball and volleyball coach at Saint Leo University in Florida. She also directed basketball programs at Western Carolina University and Mars Hill College. Cone began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.

Cone was born and raised in Summerville, S.C. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone was inducted into that school’s Hall of Fame in 2007. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Master’s from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.

A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.

/// UNC ASHEVILLE BULLDOGS ///

73/// F E A R T H E D O G ///

TERRI BRNEASSOCIATE DIRECTOR OF ATHLETICS OF INTERNAL AFFAIRS SENIOR WOMEN’S ADMINISTRATOR

Terri Brne is in her seventh year of service to the UNC Asheville Athletics Department. She serves as Associate Director of Athletics for Internal Affairs and as Director of Compliance and Sport Oversight. She joined the UNC Asheville Athletic Department in the fall of 2006. In the summer of 2011, Terri became the school’s Senior Woman Administrator. Brne is responsible for the interpretation of rules by the NCAA and Big South Conference and is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. Brne serves as the Game Administrator for men’s and women’s basketball. Terri also oversees men’s and women’s soccer plus baseball and assists with men’s and women’s basketball. In addition, she works with the Big South Conference whenever UNC Asheville hosts a league tournament. This past year saw Brne help the athletic department pass its NCAA certifi cation and host both the men’s basketball and men’s and women’s tennis Big South tournaments. The Illinois native was an assistant basketball coach at both South Dakota and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance for all sports. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her masters’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.

MIKE GOREASSOCIATE DIRECTOR OF ATHLETICS FOR EXTERNAL AFFAIRS

Mike Gore is in his 27th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 13 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.

UNC ASHEVILLE SUPPORT STAFF

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

74 /// F E A R T H E D O G ///

Judith BohanBusiness Manager

James WestfallAssistant

Athletic Trainer, ATC

Harmon TurnerTicket Manager

Tim WhiteHead

Athletic Trainer, ATC

Lydee BenoitAssistant Volleyball

Coach

Mary CaseyAssistant Women’s

Soccer Coach

Dr. Herman HoltFaculty AthleticsRepresentative

Rebecca Nelms-KeilDirector of Student

Athlete Affairs

Erin Punter-SpenceDirector of Marketing

and Promotions

Matt PellegrinDirector of Athletics

Media Communications

ASHEVILLE SUPPORT STAFF

Eric LinnellAssistant

Athletic Trainer, ATC

Brett CareyAssistant Men’s

Basketball Coach

Aaron SandersDirector of Sherrill

Center

Joe Burnette Assistant Men’sSoccer Coach

Tom HandAssistant

Tennis Coach

Janell CraytonAssistant Women’s Basketball Coach

Russ GardinerAssistant Women’sBasketball Coach

Nick McDevittAssistant Men’s

Basketball Coach

Joel WilliamsAssistant Track & Field

Coach

Adam PuettAssistant Cross Country Coach

Honey BrownAssistant Women’sBasketball Coach

Donna PeekAdministrative

Assistant

Brady BurreshDirector of Facilities

Jim WallaceAssistant

Athletic Trainer, ATC

Omar AhmadHead Strength &

Conditioning Coach

/// UNC ASHEVILLE BULLDOGS ///

75/// F E A R T H E D O G ///

Brenda Mock KirkpatrickWomen’s Basketball

1st year as head coach

Michele DemkoWomen’s Soccer

3rd year as head coach

Matt KernMen’s Soccer

3rd year as head coach

Tom SmithBaseball

4th year as head coach

Jesse NormanCross Country/Track

6th year as head coach

Elizabeth LykinsWomen’s Swimming

1st year as head coach

Lise GregoryTennis

6th year as head coach

Eddie BiedenbachMen’s Basketball

17th Year as head coach

Frederico SantosVolleyball

2nd year as head coach

UNC ASHEVILLE HEAD COACHES

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

76 /// F E A R T H E D O G ///

Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.

In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.

The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.

In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.

In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.

UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.

1990-2003

2004-Present

ROCKY

/// UNC ASHEVILLE BULLDOGS ///

77/// F E A R T H E D O G ///

Important NCAA Terms

A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):

(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Revised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the summer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)

Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. How-ever, an institutional staff member or athletics representative who is approached by a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.

Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.

Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi ca-tions or athletics ability of a prospective student-athlete, including any visit to a prospective student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.

Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the prospective student-athlete during an evaluation period.

Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruiting contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.

Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to per-mit offi cial or unoffi cial visits by prospective student-athletes to the institution’s campus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a prospective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in at-tendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educational institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.

Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Executive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and competition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.

Frequently Asked Questions

What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In exchange, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is November 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.

What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institution’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.

Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three com-plimentary admissions to any home athletic contest, excluding Big South Confer-ence Post Season Tournaments.

What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.

This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.

THE NCAA

/

// U

NC A

SHEV

ILLE

BUL

LDOG

S /

//

78 /// F E A R T H E D O G ///

For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:

Champions in Athletics, Leaders in Life.

For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics

Justice Center, CPO #2600One University Heights

Asheville, NC 28804Phone: (828) 251-6459

Fax: (828) 251-6386www.uncabulldogs.com

“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”

--Rich Davis ’93, Jan Davis Tire Store

“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”

--Pat Britz ’90; former men’s soccer player

BULLDOG ATHLETICS ASSOCIATION

FRON

TCOU

RTBA

CKCO

URT

11/10 WESTERN CAROLINA 4:30 pm 11/15 WOFFORD 7 pm 11/17 at Eastern Kentucky 2 pm 11/20 MONTREAT COLLEGE 7 pm 11/25 at UNC Chapel Hill 6 pm 11/28 SOUTH FLORIDA 7 pm 12/1 CAMPBELL* 2 pm 12/3 at USC Upstate 7 pm 12/8 COLUMBIA COLLEGE 2 pm 12/13 KENNESAW STATE 7 pm 12/18 vs. Bethune-Cookman^ 3 pm 12/19 at Stetson^ 1 pm 12/29 HIGH POINT* 2 pm 1/3 at Radford 7 pm 1/5 at Liberty* 4 pm 1/10 WINTHROP* 7 pm 1/17 PRESBYTERIAN COLLEGE* 7 pm 1/19 GARDNER-WEBB* 2 pm 1/24 at Charleston Southern* 7 pm 1/26 at Coastal Carolina* 4 pm 1/31 at Gardner-Webb* 7 pm 2/2 at Presbyterian College* 2 pm 2/7 CHARLESTON SOUTHERN* 7 pm 2/9 COASTAL CAROLINA* 2 pm 2/14 at High Point* 7 pm 2/16 at Campbell* 1 pm 2/21 LIBERTY* 7 pm 2/23 LONGWOOD* 2 pm 3/2 at Winthrop* 1 pm 3/5-10 at Big South Championship TBA

ALL CAPS - Home Game * - Big South Conference Game ^ - Stetson Hatter Classic All Times Eastern

2012-13 UNC ASHEVILLE SCHEDULE2012-13 UNC ASHEVILLE SCHEDULE