Post on 31-Jan-2022
Turnover and Localization of the Actin-Binding Protein Drebrin in Neurons
D i s s e r t a t i o n
zur Erlangung des akademischen Grades
d o c t o r r e r u m n a t u r a l i u m
(Dr. rer. nat.)
im Fach Biologie
eingereicht an der
Lebenswissenschaftlichen Fakultät
der Humboldt-Universität zu Berlin
von
Master of Science Eugenia Rojas Puente
Präsident der Humboldt-Universität zu Berlin
Prof. Dr. Sabine Kunst
Dekan der Lebenswissenschaftliche Fakultät
Prof. Dr. Richard Lucius
Gutachter/innen: 1. Prof. Hanspeter Herzel
2. Prof. Britta Eickholt
3. Prof. Matthew Larkum
Tag der mündlichen Prüfung: 24.08.2016
For my parents and Erik
Table of Contents
Summary ..................................................................................................................... I
Zusammenfassung ..................................................................................................... II
Motivation .................................................................................................................. III
Abbreviations .............................................................................................................. 1
Keywords .................................................................................................................... 2
Neurons, drebrin, actin, cytoskeleton ......................................................................... 2
Neuronen, drebrin, actin, cytoskelett .......................................................................... 2
1 Introduction .......................................................................................................... 3
1.1 Dendritic spines ............................................................................................. 3
1.2 Actin cytoskeleton in dendritic spines ............................................................ 5
1.3 Actin-binding proteins .................................................................................... 6
1.4 Drebrin ........................................................................................................... 7
1.5 Drebrin regulation .......................................................................................... 8
1.6 DBN in ageing and disease ......................................................................... 10
1.7 Protein Turnover in neurons ........................................................................ 12
1.8 Hypotheses ................................................................................................. 14
1.9 Phases and milestones of the project .......................................................... 14
1.10 Organization of the experiments and methodology applied ...................... 16
2 Results ............................................................................................................... 19
2.1 Analyzing regulatory inputs of DBN abundance in cell lines and neurons ... 19
2.2 Regulation of DBN turnover ......................................................................... 32
2.3 Visualization of DBN mRNA in neurons and abundance upon neuronal stimulation ............................................................................................................. 56
3 Discussion .......................................................................................................... 60
3.1 Effect of oxidative stress on DBN abundance and its link to neurodegeneration ................................................................................................ 60
3.2 DBN turnover and stability in dependence of S647 phosphorylation ........... 61
3.3 DBN stabilization upon inhibition of the ubiquitin proteasome system ......... 62
3.4 Regulation of DBN translation by the PI3K-mTOR pathway ........................ 63
3.5 DBN localized translation in dendrites ......................................................... 64
3.6 Dendritic localization of DBN mRNA ............................................................ 65
4 Conclusions and Outlook ................................................................................... 67
5 Materials and Methods ....................................................................................... 69
1.1 Molecular biology ......................................................................................... 69
1.1.1 Plasmids ............................................................................................... 69
1.2 Consumables............................................................................................... 69
1.3 Solutions and buffers ................................................................................... 71
1.4 Culture medium ........................................................................................... 73
1.5 Chemicals and kits ...................................................................................... 74
1.6 Experimental cell models ............................................................................. 76
1.6.1 Cell models ........................................................................................... 76
1.6.2 Primary neuronal cultures ..................................................................... 76
1.7 Treatments and cell transfection.................................................................. 79
1.7.1 Transfection in multiple cell lines .......................................................... 79
1.7.2 Oxidative stress induction ..................................................................... 79
1.7.3 Neuronal stimulation and network silencing .......................................... 79
1.8 Assays ......................................................................................................... 80
1.8.1 SDS-PAGE and Western blotting (WB) ................................................ 80
1.8.2 Lentiviral infection of DBN-KO neurons ................................................ 80
1.8.3 Immunocytochemistry ........................................................................... 81
1.8.4 Pulse-chase experiments in 293T cells ................................................. 82
1.8.5 Click-chemistry protein lysates .............................................................. 82
1.8.6 FUNCAT-PLA ....................................................................................... 83
1.8.7 High-resolution fluorescence in situ hybridization (Panomics probes) .. 83
1.8.8 Puromycilation (Puro) ........................................................................... 84
1.8.9 Proximity ligation assay (PLA) .............................................................. 84
1.9 Image-acquisition ........................................................................................ 86
1.10 Analyses and statistical tests ................................................................... 86
1.10.1 Data normalization and calculations .................................................. 86
1.10.2 Image analyses.................................................................................. 87
1.10.3 Dendrites and soma PLA/Panomics analyses ................................... 87
6 References ......................................................................................................... 88
7 Supplemental information .................................................................................. 94
7.1 Supplementary data .................................................................................... 94
7.1.1 PLA analysis script ................................................................................ 94
7.1.2 PLA dendrites ..................................................................................... 107
7.1.3 PLA Soma script ................................................................................. 108
8 Collaborations and technical support ............................................................... 111
9 Acknowledgments ............................................................................................ 112
10 Selbständigkeitserklärung ............................................................................. 114
Summary
Summary
This thesis deals with the regulatory inputs modulating the abundance of the protein
Drebrin (Developmentally Regulated Brain Protein) in neurons, which is an actin-
binding protein capable of bundling actin filaments. Most excitatory synapses in the
mammalian brain are formed on tiny protrusions, called dendritic spines that spread
from the neuronal dendrite. It has been suggested that changes in dendritic spine
morphology affect synaptic activity and plasticity, which are processes underlying
memory formation, brain ageing, and some disorders, such as mental retardation. It is
thought that Drebrin plays an important role in regulating dendritic spine morphology.
Drebrin levels are known to recede with age and could be associated with cognitive
decline. Moreover, some neurodegenerative conditions have been shown to be linked
with a decrease in Drebrin abundance. A weakening in the expression of this protein
in dendritic spines is associated with the loss of synaptic connections, a common
feature of ageing and various neurological disorders such as Alzheimer's disease. This
evidence was the underlying motivation for studying the localization and turnover of
Drebrin.
During the project reported in this thesis, I studied the effect of the site-specific S647
phosphorylation of Drebrin and found that such post-translational modification
regulates protein stability and turnover. For the project, it was necessary to establish
several novel techniques in our laboratory, including state-of-the-art methods such as
FUNCAT-PLA and Puro-PLA for the visualization of de novo synthesized proteins in
situ. Furthermore, my results show that Drebrin translation occurs not only in somata
but also locally in the dendrites and dendritic spines of neurons. The same observation
is true for Drebrin transcripts, which are present both in the soma and dendrites of
neurons. I obtained this result using high-resolution fluorescence in situ hybridization.
These observations suggest that Drebrin could play an important role during synaptic
plasticity. My results allow the future investigation of the potential role of site-specific
phosphorylation of Drebrin in spine morphology, in order to better understand the role
of the protein in spines, as well as how its synthesis is controlled. Preliminary results
in this direction are presented in this thesis. This PhD thesis represents a contribution
to better understanding the regulation of Drebrin abundance. It also provides an
experimental platform for additional investigation about the role of Drebrin in spine
morphology, regarding its stability and its correlation with synaptic maintenance and
function.
Zusammenfassung
II
Zusammenfassung
Die vorliegende Arbeit erforscht die regulatorische Inputs, die die Expression von
Drebrin (Developmentally Regulated Brain Protein) in Neuronen modulieren. Drebrin
ist ein Protein das an Actin bindet und Actin-Filamente bündeln kann. Die meisten
erregende Synapsen in Gehirnen von Säugetieren werden in kleinen
Dendritenfortsätzen gebildet, die sogenannten Dendritendornen. Es ist postuliert
worden, dass Änderungen in der Morphologie der Dendritendornen die synaptische
Aktivität und Plastizität verändern können. Diese Prozesse spielen eine Rolle bei der
Gedächtnisbildung und Alterung des Gehirns, sowie geistigen Störungen bzw.
Behinderungen. Es wird angnommen, dass Drebrin eine wichtige Rolle bei der
Regulierung der Morphologie der Dendritendornen spielt.
Es ist bekannt, dass die Drebrin-Präsenz im Alter zurückgeht – dies könnte kognitive
Defizite erklären. Außerdem wurde gezeigt, dass einige neurodegenerative
Krankheiten mit einer Reduzierung von Drebrin einhergehen. Eine Schwächung der
Expression dieses Proteins in Dendritendornen ist mit einem Verlust an synaptischen
Verbindungen gekoppelt, ein gemeinsames Merkmal von Alterung und neurologische
Störungen, wie bei der Alzheimer Krankheit. Diese Befunde bildeten die Motivation
und Grundlage für meine Erforschung der Produktion und Lokalisierung von Drebrin.
Während meines Projektes, habe ich den Effekt der sequenzspezifische S647-
Phosphorylierung von Drebrin untersucht. Diese Arbeit zeigt, dass diese post-
translatorische Änderung die Stabilität und Produktion des Proteins reguliert. Es war
für das Projekt notwendig neuartige experimentelle Verfahren in unserem Labor zu
etablieren, wie z.B. FUNCAT-PLA und Puro-PLA, Methoden die den neusten Stand
der Technik auf diese, Gebiet darstellen, letzteres für die Visualisierung von de novo
synthetisierten Proteinen in situ. Außerdem zeigen meine Resultate, dass Drebrin-
Translation nicht nur im Zellkörper sondern auch lokal in den Dendritendornen
stattfindet. Dasselbe gilt für Drebrin mRNA Transkripte, die sowohl im Zellkörper als
auch in den Dendriten vorhanden sind. Diese Ergebnisse wurde durch den Einsatz
von hochauflösender fluorizierender Hybridisierung in situ erreicht. Meine Resultate
ermöglichen die zukünftige Erforschung der potentiellen Rolle der sequenz-spezifische
Phosphorylierung von Drebrin für die Morphologie der Dendritendornen. Damit kann
die Aktivität des Proteins in den Dendriten und die lokale Steuerung der Synthese dort
Zusammenfassung
II
besser verstanden werden. Vorläufige Ergebnisse in diese Richtung werden in dieser
Arbeit vorgestellt.
Diese Dissertation bietet eine Grundlage für das Verständnis der Regulierung der
Drebrin-Konzentration in Zellen. Die Arbeit liefert eine experimentelle Plattform für
zusätzliche Studien der Rolle von Drebrin bei der Bestimmung der
Dornenmorphologie, sowohl in Bezug auf Stabilität als auch hinsichtlich der Korrelation
mit der synaptischen Funktion und Erhaltung.
Motivation
III
Motivation
This thesis addresses the role of the protein Drebrin (DBN) in neurons, and more
specifically, the specific regulatory inputs that influence the expression and stability of
DBN in dendritic spines. The effect of synaptic activity, oxidative stress, and post-
translational modification is studied through the adaptation to our needs of state of the
art laboratory techniques, which let us image the spatio-temporal patterns of
expression of DBN within neurons. This thesis represents a contribution towards the
elucidation of the role of DBN both during the development and ageing of the human
brain.
DBN (developmentally-regulated brain protein) is an actin-binding protein present in
cells of humans and other species. DBN was first identified in the chicken brain in 1985
applying two-dimensional electrophoresis -- it was later characterized in mammals
(Shirao and Obata, 1985). Its role as an interaction partner of the phosphatase and
tensin homolog protein (PTEN) has been and is being studied in the Eickholt Lab
(Charite Universitätsmedizin Berlin). Both DBN and PTEN are present in brain tissue.
PTEN is a protein that can act as tumor suppressor. It can function as a protein and a
lipid phosphatase. As a lipid phosphatase, PTEN directly antagonizes the PI3K
pathway, responsible for fundamental processes in the cell, such as cell growth, cell-
cycle progression, metabolism, cell migration and protein synthesis.
PTEN mutations have been identified in cancer patients, and in neurological disorders
such as Cowden syndrome, Bannayan-Riley-Ruvalcaba, and in autism spectrum
disorders (Pilarski et al., 2011).
DBN was first identified as a developmentally regulated protein (hence the name) and
is known to be important for neuronal development (Shirao and Obata, 1985). Using
immunoelectron microscopy, it was shown shortly after its discovery that DBN is
expressed in the dendrites of neurons from the cerebellar cortex of the chicken (Shirao
et al., 1987). In 1989, DBN isoforms were first identified in rat brains by the Shirao
group, and were first cloned and isolated from a human brain in 1993 (Toda M. et.al.,
1993).
It was originally proposed that DBN affects neuronal morphogenesis because of its
developmentally regulated expression and because of its actin-binding properties
(Ishikawa et al., 1994). It has been shown to interact with other actin-binding proteins
Motivation
III
and to modulate the morphology of dendritic spines in neurons – for example, it can
induce the formation of filopodia-like structures in cells (Hayashi and Shirao, 1999; Jin
et al., 2002; Mammoto et al., 1998; Sasaki et al., 1996). Furthermore, DBN-A, which is
a brain-specific isoform, has been shown to alter synaptic activities of glutamatergic
and GABAergic neurons in overexpression experiments (Ivanov et al., 2009a). DBN
has also been linked to disease: for example, DBN levels are low in the brains of
patients with Alzheimer’s disease (AD) and Down syndrome (Shim and Lubec, 2002).
However, the specific mechanisms behind the potential role of DBN in degenerative
brain conditions remains unknown.
DBN is a phosphoprotein of which more than 13 phosphorylation sites have been
identified. Post-translation modifications have been shown to regulate protein turnover
in some cases. During the characterization of the PTEN-DBN protein-protein
interaction (Kreis et al., 2013), it became clear that PTEN down regulation correlates
with an increase in pDBN-S647 levels. Moreover, the interaction between DBN and
PTEN was shown to partially occur in dendrites and to be synaptic activity dependent.
However, the role of the S647 phosphorylation site remained unclear. Therefore, two
main hypothesis were formulated regarding DBN function and control after those
findings:
• First, that the site-specific phosphorylation of DBN is important for the control of
DBN turnover.
• Second, that the spatial-temporal patterns of DBN could be relevant in the
formation and maintenance of filopodia and dendritic spines.
Motivation
III
In order to better understand how DBN is regulated and work towards proving or
disproving these hypotheses, I pursued the following objectives during the realization
of this thesis:
1. Find regulatory inputs for DBN stability in the context of oxidative stress
2. Study the effect of site-specific phosphorylation (S647/S601) on DBN stability
and turnover.
3. Study the spatial-temporal patterns of DBN expression in situ.
4. Find regulatory inputs for DBN translation in the context of signaling cascades.
The results of this research agenda are detailed in this thesis which is organized as
follows:
Chapter 1 is an introduction explaining the motivation for this project. It makes explicit
the main hypothesis and objectives of this thesis. Moreover, it briefly describes what
where the methodologies applied to produce the results. Chapter 2 walks the reader
through the results of the thesis – it is organized in three sections: Section 2.1 deals
with the identification of regulatory inputs relevant to the abundance of DBN, and with
the study of different cellular models for studying DBN turnover. Several important
control experiments are discussed. They constitute the basis for further trials explained
in the following sections, which include testing different DBN antibodies in western blot
and in immunostaining. In order to explore the stability of DBN and the potential
molecular mechanisms contributing to cognitive decline during aging and disease, I
applied compounds known to induce oxidative stress, such as the herbicide paraquat
and Amyloid beta peptide (Aβ). The results of the experiment are described in this
section.
Section 2.2 provides data showing the effect that site-specific phosphorylation has on
DBN protein stability and turnover in overexpression models and in primary culture
neurons. It describes state-of-the-art techniques for the visualization of de novo
synthesis of DBN proteins in neurons, which I applied to study DBN turnover in primary
neuronal cultures. Moreover, pulse-chase experiments in overexpression systems
indicate that DBN degradation is inhibited when the proteasome itself is inhibited,
suggesting a mechanism for degradation via the proteasome ubiquitin system (UPS).
Together, these experiments indicate that C-terminal phosphorylation of DBN is an
important regulatory input for the regulation of protein stability, and that DBN
degradation might be at least partially controlled by the UPS.
Motivation
III
Section 2.3 focuses on the regulation of DBN translation and the localization in neurons
of DBN transcripts. Visualization in situ of both DBN transcripts and newly synthesized
DBN, applying high-resolution fluorescence in situ hybridization and puromycilation-
PLA, respectively, confirm the presence of DBN transcripts and its translation both in
soma and in dendrites. This observation, suggests and important role of the protein for
synaptic plasticity, as discussed in this chapter. Finally and based on the previous
finding that PTEN indirectly controls DBN abundance, I explore the potential regulation
of the PI3K-mTOR pathway during DBN synthesis. I found that acute inhibition of
mTOR reduces DBN translation.
Chapter 3 discusses the main findings of this thesis. Chapter 4 ends with the
conclusions and a discussion of future work. Finally, Chapter 5 contains a full
description of the materials and methods that were used for obtaining the experimental
data.
As is evident from the description above, this thesis provides new insights about the
molecular mechanisms and cellular processes controlling DBN turnover, and is a
contribution towards understanding DBN’s potential role in the regulation of spine
morphology.
Abbreviations
1
Abbreviations
AD Alzheimer’s Disease
AHA azidohomoalanine
Akt Protein kinase B
Aniso Anisomycin
APS Ammonium persulfate
CaMKII α-subunit of Ca2+/calmodulin- dependent protein kinase II
CNS Central nervous system
CO2 Carbon dioxide
COS-7 CV-1 (simian) in Origin, and carrying the SV40 genetic material
DS Down Syndrome
DBN Drebrin
DIV Days in vitro
DMEM Dulbecco´s modified eagles medium
DMSO Dimethylsulfoxide
DNA Deoxyribonucleic acid
Drebrin Developmentally regulated brain protein
E. Embryonic day
EDTA Ethylene diamine tetraacetic acid
ERK1/2 Extracellular signal regulated kinase ½
F-actin Filamentous actin
FCS Fetal calf serum
Fig. Figure
FUNCAT Fluorescence Non-Canonical Amino acid Tagging
GAPDH Glycerin aldehyde-3-phosphate dehydrogenase
G-actin Globular actin
h. Hours
HBSS Hank's balanced salt solution
HEK Human embryonic kidney cells
HEK293T Human Embryonic kidney cells expressing SV40 Large T-antigen
HRP Horseradish peroxidase
kDa Kilo Dalton
KO Knock-out
LTD Long-term depression
2
LTP Long-term potentiation
MAP2 Microtubule-associated protein 2
Met Methionine
min Minutes
mL Milliliter
mRNA messenger Ribonucleic acid
mTOR Mammalian target of rapamycin
P Day postnatal
PBS Phosphate buffered saline
PFA Paraformaldehyde
PI3K Phosphoinositide-3-kinase
PLA Proximity Ligation Assay
PTEN Phosphatase and tensin homologue deleted on chromosome ten
P/S Penicillin/Streptavidin
RT Room temperature
s Seconds
SDS Sodium dodecyl sulfate
SDS-PAGE SDS- polyacrylamide gel electrophoresis
SILAC Stable isotope labeling with amino acids in cell culture
TBS-T Tris buffered saline with Tween20
WB Western blot
w/o without
μg Microgram
μl Microliter
Keywords
Neurons, drebrin, actin, cytoskeleton
Neuronen, drebrin, actin, cytoskelett
Introduction
3
1 Introduction 1.1 Dendritic spines
Neurons develop two types of functionally and morphologically different cytoplasmic
processes: axons and dendrites. Axons are usually long and produce terminal
branches. Their growth cones transform into presynaptic terminals which then form
synapses with the dendrites of other neurons. Dendrites are not as long as axons but
branch extensively, giving rise to dendritic trees with thousands of synapses (see
Figure 1. for a schematic representation of morphological changes in neurons) (Luo L,
2002). Most excitatory synapses extend directly from the dendrites. These are tiny
postsynaptic protrusions called dendritic spines (Bourne and Harris, 2008). They are
highly dynamic structures containing filamentous actin. This protein endows spines
with dynamic properties -- it has been shown to be important for the morphogenesis
and maintenance of dendritic spines.
Figure 1| Schematic representation of morphological changes during neuronal development.
Different stages in the life of a neuron (A-E) are visible. In E, the magnified inset represents
dendritic spines, postsynaptic structures on dendrites. The long process growing on the bottom
of the cell represents the axon, in this figure it is colored in red. Figure based on Luo L, 2002.
Introduction
4
Different membrane morphologies can be observed during the development of spines.
These include dendritic filopodia, which lack the postsynaptic compartment where
scaffold proteins and synaptic receptors are found, and synaptic function. Dendritic
filopodia have been proposed to function as precursor for dendritic spines. In addition
to this, three further types of dendritic spines have been classified: the thin, stubby and
mushroom shaped spines (see Figure 2 for a diagram) (Harris KM, 1992; Ziv NE &
Smith SJ, 1996; Sekino Y et al., 2007). Thin spines have been strongly associated with
plasticity -- it is believed that they play a role during the process of learning new
information, whereas mushroom spines are thought to contribute to the formation of
long-term memories and mediate strong synaptic currents (Morrison JH & Baxter MG,
2012). Moreover, mushroom spines are commonly recognized as mature, being
characterized by the presence of neurotransmitter receptors, scaffold proteins
anchoring the receptors, intracellular signaling molecules and different actin-binding
proteins. Mushroom spines play a crucial role in synaptic activity (Harris KM, 1992;
Shim KS & Lubec G, 2002; Toni N et al., 2007; Sekino Y et al., 2007). The role of
stubby spines remains unclear (Morrison JH & Baxter MG, 2012). The main players
involved in shaping the structure of dendritic spines are the actin-binding proteins,
which are able to polymerize or de-polymerize filamentous (F) actin in response to
internal and external signals. In Section 2.3, further down, a detailed description on the
actin-binding proteins in dendritic spines is provided.
Figure 2| Schematic representation of the morphology of dendritic spines. Spine development
starts with dendritic filopodia and continues with the formation of a head on top of them. It
undergoes elongation, giving rise to different morphologies of dendritic spines, which correlate
with synaptic activity and spine maturation. Mature spines are characterized by a widening of
their head, containing postsynaptic machinery (PSD and receptors) and a branched actin
cytoskeleton (mushroom shaped dendritic spines: see the text for details).
Introduction
5
1.2 Actin cytoskeleton in dendritic spines
Actin is an evolutionary conserved protein. Three main actin isoforms are known in
vertebrates, including the α-isoform expressed in different muscle cells, as well as the
β- and γ- isoforms found together in almost all non-muscle cells (Dominguez R &
Holmes KC, 2011). Actin in the cell is found as a monomer (globular or G-actin) and
as a polymerized filament (filamentous or F-actin) (Sekino et al., 2007). G-actin
contains a binding site for ATP and, when bound to ATP, it self-assembles
spontaneously through weak non-covalent interactions into F-actin. F-actin contains
two ends: a “minus” or pointed end, which is rather stable, and a “plus” or barbed end,
where polymerization occurs. F-actin turnover is controlled by several actin-binding
proteins responsible for the stabilization or destabilization of actin filaments. They do
this by promoting actin nucleation, elongation, capping, severing or depolymerization.
This process is essential for the reorganization of the actin cytoskeleton in cells
(Campellone KG & Welch MD, 2010). Actin is one of the major components of the
cytoskeleton, playing and important role in cell motility and shape dynamics, as well as
contributing to other cellular functions such as cell division and intracellular protein
trafficking.
In the central nervous system (CNS), the actin cytoskeleton is essential for the
establishment of neuron morphogenesis and maturation, as well as for a number of
dynamic changes in morphology. Changes in the morphology of spines as well as
changes in spine density along dendrites are processes that require actin cytoskeleton
rearrangements. These changes have been linked to synaptic plasticity (Cingolani and
Goda, 2008; Engert and Bonhoeffer, 1999) Actin filaments are the major cytoskeletal
component in dendritic spines, but actin in spines is found both in its monomeric
structure and in its filamentous conformation (Landis DM & Reese TS, 1983). It is well
known that the actin cytoskeleton contributes to regulate dendritic spines
morphogenesis, maintenance and motility, as well as to support postsynaptic receptor
anchoring (Cingolani LA & Goda Y, 2008; Hotulainen P & Hoogenraad CC, 2010).
Actin filaments in the spine head are very dynamic and show a high turnover by
continuous treadmilling (Star EN, et al., 2002; Cingolani LA & Goda Y, 2008).
Polymerization of G-actin and disassembly of F-actin induce rapid changes in the
cytoskeleton, enabling morphology and functional modifications of dendritic spines
(Cingolani LA & Goda Y, 2008).
Introduction
6
In cells, actin filaments are commonly assembled into extended structures such as
branched networks and bundles. A study by Koroba & Svitkina 2010, characterized the
molecular architecture of the synaptic actin cytoskeleton. In this study, using platinum
replica electron microscopy, spine heads were observed to contain branched dense
networks of cross-linked actin filaments, while spine necks were found to have loosely
arranged actin filaments. The spine base presented long actin filaments (see Figure 3
for a model) (Koroba F & Svitkina T, 2010). This finding illustrates an essential role of
the treadmilling of F-actin in regulating the morphology of dendritic spines as well as
defining their different structures.
Figure 3| Model for F-actin organization in dendritic spines. Actin filaments (blue) are
organized forming different networks: linear and branched anchored to microtubules (red) or
actin filaments in the dendritic shaft (Figure from Koroba F & Svitkina T, 2010)
1.3 Actin-binding proteins
Actin-binding proteins have been identified as important modulators of spine
morphogenesis and maintenance. They promote actin polymerization and
depolymerization. Actin-binding proteins can be organized in three main groups with
severing, stabilizing and modulating activity, respectively (Cingolani LA & Goda Y,
2008; Lin W & Webb DJ, 2009). Examples of severing proteins are cofilin
(Andrianantoandro E, et al., 2006) and gelsolin (Coué M & Korn ED, 1985). They are
molecules capable of binding F-actin and breaking it down into smaller pieces thus
playing an important role in the maintenance of the G-actin pool required for new
assembly (Star E et al., 2002). In contrast, the second group of stabilizing actin-binding
proteins prevent F-actin to lose or add G-actin to already existing actin filaments, thus
Introduction
7
stabilizing the actin cytoskeleton. This is the case, for example, for Eps8 (Menna E et
al., 2009), that also functions as an actin-capping. Profilin is an example for proteins
promoting actin polymerization (Ackermann and Matus, 2003). Finally, proteins such
as α-actinin (Grazi E et al., 1992), CaMKII (Lin YC & Redmond L, 2008) and the
developmentally regulated brain protein DBN modulate actin organization, affecting
spine structure and function, by bundling or cross-linking actin filaments (Takahashi H
et al., 2003; Lin W & Webb DJ, 2009). Numerous findings indicate that the actin
signaling pathways in spines are regulated by many synaptic receptors including, for
example, NMDA and AMPA receptors. They have been suggested to regulate the
formation of the actin cytoskeleton mainly by mediating the influx of Ca2+ ions into
postsynaptic neurons and by binding directly to actin-binding proteins (Hotulainen P &
Hoogenraad CC, 2010). In addition to synaptic receptors, other actin-regulating
proteins, such as receptor tyrosine kinases and synaptic adhesion molecules, have
been described as important regulators of synapse function, but it is through multiple
signaling pathways and tightly controlled regulation that actin-binding proteins
modulate actin cytoskeleton dynamics in spines. GTPases of the Rho family and
serine/threonine kinases regulate actin polymerization by targeting actin-binding
proteins such as ProfilinII, CaMKII and ADF/Cofilin. Many of these proteins, which are
modulating actin meshwork in dendritic spines, are regulated by phosphorylation (Da
Silva JS & Dotti CG, 2002), a common post-translational modification.
1.4 Drebrin
Three DBN isoforms were first discovered in the chicken embryo brain by two-
dimensional gel electrophoresis (Shirao T & Obata K, 1985). Later, two different DBN
isoforms were described in mammals: an embryonic form or DBN-E (~115kDa) and an
adult form or DBN-A (~125kDa) (Shirao et al., 1987). In the DBN proteins five domains
have been identified: an N-terminal ADF homology domain, a coiled coil helical domain
where an actin binding domain (Grintsevich E. Elena, 2010) is located, a proline-rich
region suggested to regulate an interaction with profiling (Mammoto et al., 1998) and
C-terminal Homer-binding domains (Shiraishi-Yamaguchi et al., 2009) (Figure 4).
Moreover, the DBN gene is regulated in a developmental manner: Drebrin E is
replaced by Drebrin A in the adult brain (Kojima et al., 1993).
Introduction
8
Figure 4| Diagram of Drebrin alternative splicing isoforms and domains. A) DBN is found in
two isoforms produced by alternative splicing. DBN-A mRNA differs from DBN-E mRNA only
by the presence of a 138-nucleotide sequence insert codifying for 46 amino acids depicted in
the diagram. The protein domains of the two Drebrins are represented in this figure. By the N-
terminus an ADF/cofilin domain (blue), a coiled coil region (green) where the actin binding
domain (yellow) is located, a prolin rich region (orange) and two homer binding domains by the
C-terminus region. B) 13 of the 17 phosphorylation sites that have been identified in the
Drebrin protein are listed here.
1.5 Drebrin regulation
Post-translational modifications have been described to provide regulatory
mechanisms for protein function. One common type of post-translational modification
is phosphorylation involving the addition of a phosphoryl group. Phosphorylation of
proteins can control different processes such as providing on and off switches of
enzymatic activity, protein complex formation, protein localization, protein stability and
turnover. DBN is a highly phosphorylated protein – to date 17 phosphorylation sites
have been identified. These sites have been found by analysis of brain samples and
cell lines using mass spectrometry (Ballif et al., 2004; Beausoleil et al., 2008; Chew et
al., 2005; Molina et al., 2007; Olsen et al., 2006; Rush et al., 2005; Vosseller et al.,
2005; Wollscheid et al., 2005; Zheng et al., 2005)
It has been shown that DBN is an actin-binding protein that modulates actin bundling
and inhibits the interaction between F-actin and other actin-binding proteins such as α-
actinin, fascin (Sasaki Y et al., 1996), tropomyosin and myosin (Ishikawa R et al., 2007;
Hayashi K et al., 1996; Ivanov A et al., 2009). In adult neurons, DBN accumulates in
spine heads enriched in actin that have formed long filamentous structures. It has been
suggested that DBN modulates synaptic plasticity by affecting the morphology of
dendritic spines and by regulating neuronal transmission (Hayashi K et al., 1996;
Introduction
9
Hayashi K & Shirao T, 1999; Ivanov A et al., 2009; Aoki C et al., 2009). Additionally, it
has been reported that DBN induces the synaptic clustering of the post-synaptic
density scaffold protein (PSD-95), supporting its role in synaptic plasticity (Takahashi
H et al., 2003). Interestingly, it has been shown that increasing the expression levels
of DBN in neurons promotes spine elongation, whereas down-regulation of DBN
reduces spine density (Mizui T et al., 2005; Takahashi H, et al., 2006).
Drebrin A (DBN-A) was described to be neuronal specific, therefore, in order to
investigate the role of DBN-A in neuronal function, an overexpression model was
generated by the Shirao group in Japan (Gunma University, Graduate School of
Medicine). Morphological analysis of hippocampal neuronal cultures upon DBN-A
overexpression, resulted in elongation of dendritic spines while the overexpression of
a DBN-A mutant lacking the actin binding domain did not have this effect (Ivanov et
al., 2009b). This study showed that the actin-binding domain was responsible for the
morphological phenotype of DBN-A in spines. Moreover, in the same study it was
reported that the overexpression of DBN-A in neurons did not interrupt spontaneous
synaptic activities in synapses. However, measurements of cumulative probability plots
for amplitude and frequency showed a shift in the neurons overexpressing DBN-A
having significantly higher values than in control neurons (Ivanov et al., 2009).
In contrast to the overexpression effect of DBN on the morphology and function of
neurons, downregulation of DBN-A with antisense oligonucleotides was reported to
decrease the filopodia-spine density in comparison to the control but no changes in the
elongation of the spines were detected (Takahashi et al., 2006). To further understand
the functional role of DBN-A at the spines in neurons, a DBN-A knockout (KO) mouse
model was generated. These animals presented deficits in homeostatic synaptic
plasticity (Aoki et al., 2009). Further analysis of this mouse model showed that
depletion of DBN-A impairs context-dependent fear learning (Kojima et al., 2010,
2016). While the KO model is specific for DBN-A, the other isoform DBN-E is still
present in the KO, that could lead to misinterpretation of the data where the lack of
DBN-A together with the potential substitution of DBN-E could be responsible for the
changes that are reported in these studies. However, more recently, the group of Prof.
Dr. Gert Lubec reported for the first time morphological and functional analyses of a
full DBN knockout mice. These animals lack both DBN isoforms and morphological
analyses of this animal model show a reduction in spine number on dendritic segments
Introduction
10
of CA1 apical pyramidal cells and CA1 hippocampal neurons and electrophysiological
analyses confirmed that memory related synaptic plasticity was affected in these mice
(Jung et al., 2015).
Overall, the functional data for the role of DBN in neurons is still limited and further
studies are required to clarify the function and regulation of DBN in the brain.
1.6 DBN in ageing and disease
The mammalian brain contains millions of specialized synapses -- interconnections
between neurons generating neuronal networks. The first step in the formation of
neuronal networks is the outgrowth of neuronal processes (i.e. presynaptic axonal
terminals and postsynaptic dendritic regions, see Figure 1 for a schematic
representation) which eventually enable the brain to perform complex tasks such as
the formation of thoughts, memories, dreams, and learning (Shirao, 1995, Hotulainen
P. & Casper C., 2010).
Electron microscopy and electrophysiological studies have shown that cognitive
decline during ageing is accompanied by a loss of thin spines, while no loss of
mushroom or stubby spines has been observed. Thin spines have been strongly
associated with plasticity. It is believed that they play a key role in the task of learning
new information, whereas mushroom spines are thought to contribute to long-term
memories and mediate strong synaptic currents. The role of stubby spines remains
unclear (Morrison JH & Baxter MG, 2012).
Proteins regulating spine morphology and maintenance are associated with cognitive
impairment in ageing. This association was shown in a recent study where cognitively
impaired by age or aged rats presented alterations in the expression of hippocampal
proteins, which are normally responsible for synaptic-activity, signaling and structure.
The proteins included MAP2, DBN, PSD-95 and CaMKIIα. Up-regulation of DBN
significantly correlated with declining cognitive performance in aged impaired rats,
indicating that a balance in the expression of the proteins, such as DBN, is essential
for the maintenance of normal synaptic function during ageing (VanGuilder HD et al.,
2011).
Neuronal dysfunction has been identified as hallmark in cognitive impairment and in
neurodegenerative diseases, such as Alzheimer’s disease (AD) (Calon F et al., 2004).
Introduction
11
Interestingly, an alteration in the expression levels of DBN has been observed in
human hippocampal synapses in AD (Harigaya and Shoji, 1996). Other studies have
shown that DBN levels decrease in brains of patients with AD and Down syndrome,
thus supporting the hypothesis that DBN plays an important role in regulating synaptic
activity in ageing and disease (Shim K S & Lubec G, 2002).
Since ageing and neurodegenerative conditions have been shown to correlate with an
imbalance in the expression of DBN, this result may suggest that a decline of DBN in
dendritic spines may weaken synaptic connections, a common feature observed in
ageing and various neurodegenerative disorders (Harigaya and Shoji, 1996; Shim KS
& Lubec, 2002; Kojima et al., 2010). Supporting this hypothesis, Kobayashi and
colleagues found that a reduction of DBN induced by antisense knockdown in the brain
of rats causes cognitive deficits (Kobayashi H et al., 2004). However, the molecular
mechanisms involved still remain unclear.
Figure 5| Spine morphology maintenance under DBN turnover. A) Schematic representation
of a neuron. Magnification represents a fragment of a dendrite where dendritic spines grow. B)
Model for spine morphology after overexpression, normal or downregulation of DBN. Different
phenotypes for dendritic spines have been described where DBN abundance plays important
roles. The same phenotypes correlate with ageing and disease when DBN is downregulated.
Introduction
12
1.7 Protein Turnover in neurons
Protein turnover is the result of protein synthesis and protein degradation to maintain
a steady-state protein abundance. This process is a key element for cell diversity and
is regulated at different levels including: transcriptomics, metabolomics and proteomics
(Doherty and Beynon, 2006).
Different protein pools and the abundance in which they are found in specific
compartments control synaptogenesis and dendritic spine morphology. Protein
composition and concentration provide individuality to synaptic boutons (axons) or
spines (Schuman, 1999). The protein diversity pools found at the synapse are
maintained by two mechanisms taking place in neurons: localized transport and
localized translation of mRNAs in the spines and axons. Localized translation, is often
observed in polarized cells such as neurons. However, the most classic and better
characterized example for transcript localization is the drosophila oocyte where the
spatial distribution of mRNAs directs the early patterning of the anterior-posterior poles
(reviewed by Schuman, 1999). Electron microscopy images of synapses allowed the
identification of polyribosomes –mRNA and ribosome complexes- in dendritic shafts
and at the base of spines (Ostroff et al., 2002), supporting the paradigm of mRNA
localization and local translation in neurons. Moreover, deep sequencing of the
Neuropil and high resolution in situ hybridization of neuronal transcripts (see Figure 6)
in neurons clearly show the presence of more than 2000 transcripts in dendrites
(Cajigas et al., 2012). To date it is clear that mRNA translation in the soma of neurons
is undoubtedly important, however increased evidence has been provided that support
the functional significance of local protein synthesis. Local protein synthesis has been
described to play a role in fundamental processes in neurons such as memory
formation, dendrite and arbor branching, synapse formation, axon steering, cell
survival and proteostasis (Tom Dieck et al., 2014).
Introduction
13
Figure 6I High-resolution fluorescent microscopy for detection of different mRNAs in primary
neuronal cultures. This figure taken from Cajigas et.al, 2012 is an example for some of the
evidence of localized transcripts in neurons. The red puncta represent the transcripts for the
indicated genes found in dendrites and the panels are presented according to transcript
abundance in dendritic shafts (top to bottom).
On the other hand, protein degradation has been shown to play an important role in
neurons. The ubiquitin proteasome system (UPS) is the main mechanism for protein
degradation in the cell and is highly conserved among species from yeast to human
cells (Yi and Ehlers, 2005). Moreover, protein ubiquitination and subsequent
degradation is a very specific process acting in a spatial-temporal manner (Yi and
Ehlers, 2005). In the synapse, the UPS plays an important role in synaptogenesis and
spine morphogenesis during activity-dependent spine outgrowth (Hamilton et al., 2012)
and changes in spine morphology are known to underlie learning and memory (Engert
and Bonhoeffer, 1999). These data provides evidence for the role of the proteasome
regulating locally the growth of new dendritic spines.
We know from previous work from the Eickholt lab that PTEN a protein and lipid
phosphatase antagonizing the PI3K pathway interacts with DBN and that this
interaction affects pS647-DBN levels. PTEN knock down in primary neuronal cultures
increased pS647-DBN levels suggesting DBN regulation to be indirectly controlled by
PTEN (Kreis et al., 2013). This observation was the first hint to hypothesize that
perhaps DBN stability could be mediated by phosphorylation. DBN abundance is
particularly interesting in the context of spine maintenance and synaptic function and
Introduction
14
currently very little is known about how is DBN regulated. Moreover, downregulation
of DBN has been observed in disease. Therefore, DBN turnover and stability in
neurons became the focus of our research for which the following hypotheses were
formulated.
1.8 Hypotheses
The main hypotheses this thesis addresses are:
• Phosphorylation of DBN at S647 is important for the control of DBN turnover --
it is regulated by the phosphatase activity of PTEN.
• DBN synthesis could be controlled by the PI3K-mTOR pathway and DBN
degradation by the protein phosphatase activity of PTEN.
• DBN turnover is likely to be controlled locally in dendrites and spines of neurons.
• Spatial-temporal patterns of pS647-DBN could be relevant in the formation and
maintenance of filopodia and dendritic spines.
1.9 Phases and milestones of the project
During the first year of my PhD project, I generated and tested several expression
plasmids (DBN full-length and different phosphorylation mutants) that allowed me to
examine DBN protein turnover in well-defined experimental settings. I mastered the
techniques for introducing the constructs into different cell lines, in order to analyze
morphometric changes and also for performing evaluations by western blotting. This
was an essential step for fully understanding the specificity of a set of commercially
available and in-house generated DBN antibodies. I also tested different protocols for
inducing oxidative stress in mature primary neuronal cultures under clear experimental
conditions, this to simulate neurodegenerative conditions in an in vitro model. Through
these experiments I determined that an Abeta peptide preparation and paraquat can
be applied in studies that unambiguously reduce DBN abundance in neurons and likely
in cell lines too.
In the second year of the project, I validated pulse-chase labeling protocols using
metabolic labeling with the AHA, a methionine analog in order to study the stability of
DBN depending on its post-translational modification. By the end of the year, the
Introduction
15
relevant experiments were completed. They proved that one specific phosphorylation
event at the DBN C-terminus (S647) is critical for controlling protein stability. Based on
these findings, I continued my experiments in the laboratory of Prof. Erin Schuman of
the Max-Planck Institute for Brain Research in Frankfurt. There, I acquired the
expertise needed for applying a method that facilitates pulse-chase labeling of
endogenous proteins and also the visualization of specific de novo synthesized
proteins in cells. Initial characterization of the techniques validated them as a feasible
approach for studying the spatial and temporal control of DBN turnover in neuronal
primary cultures.
In January of 2014, I started setting up the FUNCAT-PLA experiments in Berlin and
modified the conditions for mouse neurons. I also initiated a collaboration with Viktor
Dinkel, a bioinformatics student, with whom I developed a software plugin for semi-
automated analyses of PLA data. This plugin makes possible the systematic analysis
of hundreds of confocal microscopy images. It was essential for obtaining the final
quantifications and results for the different assays that I prepared applying PLA. The
establishment of the technique, named FUNCAT-PLA, in the Eickholt Lab was
accomplished at the end of the second and beginning of the third project years.
During the course of the third year of the project, I made and completed the FUNCAT-
PLA experiments for studying DBN turnover in neurons. This assay provided
information about the localization of the newly synthesized DBN proteins, showing that
they could be translated locally in dendrites and spines. Therefore, in March of 2015, I
went back to the Max-Planck Institute for Brain Research in Frankfurt and performed
further experiments in neurons. By visualizing DBN transcripts in dendritic spines, I
could confirm the presence of DBN mRNA in dendrites, providing additional support to
the hypothesis that DBN is locally translated. While in Frankfurt, I also received training
for applying Puro-PLA, an experimental technique that allows the visualization of
specific proteins directly after translation with metabolic labeling using puromycin.
During the course of my last project year, I established this technique in our lab and
applied it to N1E neuroblastoma cells and primary neurons. The data obtained from
the neurons confirms that DBN is not only translated in the soma of the neurons but
also in dendrites, and possibly even in spines. I also applied this assay to study DBN
translation after inhibition of the mTOR-PI3K pathway. I was able to show that mTOR
inhibition reduces DBN translation in comparison to respective controls in
Introduction
16
neuroblastoma cells under serum deprived conditions. Chapter 3 of this thesis provides
the necessary experimental data and a discussion of these results.
1.10 Organization of the experiments and methodology applied
The main goal of this thesis project has been understanding the turnover and
localization of the actin-binding protein DBN in neurons, and also determining the
regulatory inputs for its stability. With these objectives in mind, some key experiments
and the technology to be used were defined. The results of the thesis (in the next
chapter) have been organized in three main sections that also present the
methodology used in each experiment.
Section 1: Regulatory inputs of DBN abundance in cell lines and neurons
I started by investigating the expression levels for endogenous DBN in four different
cell lines, as described in the first section of results. This was done with SDS-PAGE
and western blot (WB) analyses. In the next step, I tested multiple antibodies against
DBN, for their specificity in WB. Then, in order to test different plasmids for DBN, I
performed transfection in cell lines and analyzed the expression levels using SDS-
PAGE and western blotting (sections 2.1.1 and 2.2.2).
In order to test the specificity of our DBN antibodies in immunocytochemistry, I cultured
hippocampal neurons from DBN-KO embryos. I transduced these neurons with either
YFP-DBN or only with YFP. This enabled me to determine the specificity of multiple
DBN antibodies and to compare with the labelling in wild-type neurons (section 2.1.3).
I applied the proximity ligation assay in order to obtain a direct visualization of the DBN-
PTEN interaction in neurons. This assay is an antibody based technology (first
described in Söderberg, 2006) that allows the direct visualization of interacting proteins
as close as 30-40 nm in fixed cells (section 2.1.4).
In order to elucidate whether the phosphorylation site S647 of DBN plays a role in the
formation of filopodia-like structures, I overexpressed YFP-DBNwild-type or the phospho-
mutants: YFP-DBNS647A or YFP-DBNS647D in multiple cell lines. These experiments are
discussed in section 2.1.5.
Introduction
17
I also explored possible mechanisms that control the abundance of DBN in neurons by
analyzing DBN expression levels using western blotting, after the induction of oxidative
stress with different compounds (section 2.2.2). With the same objective, I stimulated
neurons with the antagonist for GABA A receptors and followed the expression of DBN
over time using SDS-PAGE and western blotting (section 2.2.4)
Section 2: DBN turnover
Additionally, this thesis examines the characterization of the phosphorylation site S647
and its potential role in the control of DBN turnover. In order to address this question,
I developed pulse-chase experiments using metabolic labeling in cells overexpressing
either Flag-DBNwild-type, Flag-DBNS647A (phospho-dead), or FlagDBNS647D (phospho-
mimetic). This allowed me to mark de novo synthesized proteins using pulse-labeling
with AHA; a methionine analog. Their decay could be followed by chasing in complete
medium. Click-chemistry allowed me to post-label with biotin the metabolically labeled
proteins and their detection was then possible using streptavidin-HRP on a blot
(section 2.2.1).
The next project goal was to investigate the turnover of DBN in neurons and the
resulting spatial-temporal patterns. To do so, I performed pulse-chase experiments
with FUNCAT-PLA (Fluorescence Non-Canonical Amino acid Tagging and Proximity
Ligation Assay) as described in Tom Dieck et al., 2015. This assay, allows the direct
visualization of specific proteins after metabolic labeling in cells and it can be combined
with chase in complete medium. These experiments are discussed in sections 2.2.2
and 2.2.5. The FUNCAT-PLA provides microscopy images for quantitative analyses.
Quantification required, the development of a semi-automated FIJI plugin with its
description provided in section 2.2.4
I also employed metabolic labeling with puromycin in order to address the question:
how is DBN translation controlled? To answer this, I studied the regulation of DBN
translation upon inhibition of the PI3K-mTOR pathway in combination with
puromycilation and Proximity Ligation Assay or Puro-PLA as described in (Tom Dieck
et al., 2015). These results are discussed in section 2.2.6 and 2.2.7.
Introduction
18
Section 3: Visualization of DBN mRNA in neurons and abundance after neuronal
stimulation
The last section in the results chapter deals with the following questions: Where is DBN
mRNA localized in neurons? Can its abundance and localization change when
synaptic activity is blocked or enhanced? Finally, I investigated the localization of DBN
transcripts in neurons by in situ fluorescence hybridization (FISH) at basal conditions
and upon stimulation with bicuculline (for enhancing synaptic activity), or TTX + APV
(silencing synaptic networks). These results are discussed in section 2.3.
Results
19
2 Results
2.1 Analyzing regulatory inputs of DBN abundance in cell lines and neurons
This section describes the different treatments applied in experiments performed for
establishing endogenous DBN presence in various cell lines and neurons. The
overexpression of various DBN constructs was also tested. The main goal of these
experiments was establishing models for studying DBN turnover, but also discovering
regulatory inputs controlling the stability of DBN. Optimizing the parameters of this set
of experiments turned out to be essential for the development of the more complex
assays explained in the later sections.
2.1.1 Analyses of endogenous and exogenous DBN expression by western blotting
In order to investigate the endogenous expression of DBN, I prepared cell lysates from
the following four cell lines that were continuously kept in culture:
• HEK293T: human embryonic kidney cells expressing the SV40 Large T-antigen,
• COS-7: fibroblast-like cell line derived from monkey kidney tissue,
• N1E-115 (N1E): mouse neuroblastoma cell line, and
• SH-SY5Y: human neuroblastoma cell line.
The samples were analyzed using western blotting and were probed for DBN with two
different antibodies (mouse monoclonal and guinea pig serum), with pS647-DBN and
with GAPDH as loading control. I identified endogenous DBN expression in all four cell
lines (Figure 7) to approximately similar levels. I also used our custom antibody for
detecting pS647-DBN levels, and in fact in all four cell lines different levels were
identified. Out of the four cell lines, HEK293T cells show the highest levels of pS647,
while the SH-SY5Y cells have the lowest levels.
The GAPDH bands have different sizes among four different cell lines shown in Figure
7, which might be due to the differences in the species of different cells lines
Results
20
Following overexpression experiments were pursued in HEK293T, chosen for being
cells easy to transfect. N1E-115 cells were used for imaging experiments as good
neuroblastoma model and for immunocytochemistry purposes.
Figure 7| Endogenous DBN expression in cell lines. Cell lysates from HEK 293T, COS-7, N1E
and SH-SY5Y were collected and analyzed using western blotting. DBN was identified in all of
the analyzed cell lines at similar levels, using two different pan-DBN antibodies (M2F6 mouse
monoclonal and polyclonal guinea pig). In contrast, levels of pS647-DBN varied between the
different cell lines. GAPDH was used as loading control.
In the DBN literature little is known concerning the differences between the two DBN
isoforms found in mammals. DBN-A and DBN-E are two different splicing isoforms of
DBN. Whilst the overall amino acid sequence is almost identical, DBN-A (when
compared to DBN-E) contains an extra sequence of 46 amino acids as shown in Figure
4. At the protein expression level, it has been reported that DBN-E is replaced by DBN-
A in the brain tissue during development (Hayashi et al., 1998). Yet, no functional
differences have been described to date. In order to gain some insights into the
potential functional differences between DBN-A and DBN-E isoforms, I transfected
HEK293T cells with tagged DBN constructs, and explored morphological changes by
Results
21
microscopy and imaging analysis. First of all, I confirmed their expression at the protein
level using western blotting after transfections (Figure 8). Secondly, I searched for
differences in the phenotypes induced after DBN overexpression (Figure 14).
Transfection of DBN-E and DBN-A, Myc-DBN-E, YFP-DBN-E, YFP-DBN-A, YFP, Flag-
DBN-E or Flag was performed and the expression was analyzed by western blotting
using DBN and tag specific antibodies, as shown in Figure 8. all the different constructs
were successfully transfected and were identified at the expected molecular weights.
No band was found in non-transfected cells. The corresponding bands for those
transfected with only YFP or Flag were not detected in these blots due to their small
molecular weights. However, no band for DBN-tagged was found in the lysates from
those cells transfected only with YFP and flag. Providing good controls for these
experiments. Although we know that DBN is indeed express in HEK293T cells (see
Figure 7), endogenous DBN was not always detected in the conditions where cells
were not transfected with any construct or transfected with YFP, Flag. The reason for
this is rather technical, the exposure time for detection of bands should be increased
in order to visualize DBN endogenous levels.
Results
22
Figure 8| DBN overexpression with different plasmids. Cell lysates were analyzed by western
blotting and blots were probed with DBN, GFP, MYC and FLAG specific antibodies,
respectively, to identify exogenous DBN expression. Anti-GAPDH antibody was used as
internal loading control. A) Transfected HEK293T cells with tagged DBN-E and DBN-A
constructs as indicated. B) Transfected HEK293T cells with Myc-DBN-E or untransfected
control cells. C) Transfected HEK293T cells with YFP-DBN-E, YFP-DBN-A or YFP. D)
Transfected HEK293T cells with Flag-DBN-E or Flag.
2.1.2 Determining the Specificity of DBN Antibodies in Immunocytochemistry
Published DBN antibodies are commercially available, but specificity in
immunofluorescence assays was nonetheless tested. This is especially important
whenever the effect of the application of those antibodies is the main read-out of a
particular assay. This is the case for example in techniques like immunocytochemistry
(IC) and the proximity ligation assay (PLA). In the next section a detailed description
of the PLA is provided.
During my thesis project, I performed many antibody-based assays. Therefore, it was
important to control for the specificity of the two pan-DBN antibodies that were applied
for IC and PLA in this project. Those antibodies were the M2F6 DBN antibody (mouse
monoclonal) and our custom made DBN antibody (rabbit polyclonal Eickholt lab). The
DBN (Eickholt lab) is an antibody that is collected after serum purification of our pS647-
DBN antibody, and has been established to recognize total DBN. I tested the specificity
Results
23
of these two DBN antibodies by performing immunocytochemistry in DBN-Knockout
(DBN-KO) hippocampal neurons, using the DBN antibodies mentioned above.
In our lab, Dr. Till Mack has generated a DBN-KO mouse model missing the exons 1-
6 of DBN, as described in the material and methods section. Cultured neurons from
these animals should not produce any positive labeling for DBN when performing
immunocytochemistry (IC) unless the DBN antibody being unspecific.
To confirm the specificity of these antibodies I performed IC in cultured DBN-KO
hippocampal neurons transduced with either YFP-DBN (Figure 9 A and B) or YFP
lentiviruses (Figure 9 C and D). After 22 DIV the neurons were fixed and
immunocytochemistry for the detection of DBN and MAP2; a somato dendritic marker
was performed. Transduced neurons were identified by the expression of YFP. For
those neurons transduced with YFP-DBN a co-localization between YFP and DBN
staining was observed (Figure 9 A and B). In contrast, neurons missing DBN and
transduced only with the YFP lentivirus control have no expression and staining of
DBN, proving the specificity of the antibodies (Figure 9 C and D).
Results
24
Figure 9| Control immunostaining for DBN antibodies in DBN-KO neurons. Cultured
hippocampal neurons from DBN-KO mice were infected with YFP-DBN (A and B) or YFP (C
and D) lentiviruses as indicated after 14 DIV and fixed at 22 DIV. Immunocytochemistry was
performed using DBN (M2F6), or our homemade DBN rabbit antibody DBN (Eickholt lab) for
DBN staining and MAP2 as a neuronal marker. The images are maximal projections;
brightness and contrast has been manually modified for visualization purposes. Scale bar: 20
µm.
Moreover, DBN localization is known to be enriched in dendritic spines and to co-
localize with F-actin. Therefore, it can be used as a postsynaptic spine marker. F-actin
forms the actin cytoskeleton in neurons and it is usually complex and enriched in
dendritic spines. In order to visualize the localization of DBN, using both of the
antibodies tested above, I performed IC for DBN and MAP2 in wild-type neurons
(Figure 10 A and B). In these pictures it is evident that DBN decorates the dendrites
as synapses would do. In order to confirm this localization, I performed IC for DBN and
F-actin wild-type neurons, using both DBN antibodies (Figure 10 C and E). DBN has
been shown to be enriched in dendritic spines and to accumulate in areas where F-
actin is highly abundant. As shown in Figure 10 C and E, DBN is indeed found in
dendritic spines and it highly co-localizes with F-actin in these neuronal compartments.
Results
25
This is evident by the presence of the yellow color; consequence of the merge between
green (F-actin) and red (DBN).
Figure 10| Localization of DBN in neurons from wild-type mice. Cultured hippocampal neurons
from wild-type mice were fixed after 22 DIV and stained with DBN (M2F6) (A and C) or DBN
(Eickholt Lab) (B and E) antibodies (red). An antibody against MAP2 was used as a neuronal
marker to distinguish neurons from non-neuronal cells (blue) in A and B and phalloidin was
used to label F-actin in C, D and E. The images are maximal projections; brightness and
contrast has been manually modified for visualization purposes. Scale bar: 20 µm.
2.1.3 Visualization of DBN and PTEN interaction in neurons
Kreis et.al. (2013) identified DBN as an interaction partner of PTEN. The interaction
was detected in the rat brain by mass spectrometry analysis and it was confirmed by
co-immunoprecipitation. The interaction was further characterized in overexpression
systems in PC12 cells using multiphoton fluorescence-lifetime imaging microscopy.
Moreover, experiments with hippocampal rat neurons cultured for 18 DIV and stained
with anti-pS647-DBN and PTEN antibodies, showed that PTEN is mainly found in
dendrites and only occasionally in spines, while pS647-DBN is highly concentrated in
spines. In this paper, anti-DBN antibody labelling, as well as labelling using the anti-
pS647-DBN antibody, demonstrated some co-labelling with anti-PTEN antibody in
cultured neurons. One of the main observations was that whenever PTEN was
Results
26
detected in spines, pS647-DBN was missing. These results suggested that PTEN and
pS647-DBN segregate into complimentary compartments, supporting the idea that
PTEN can negatively regulate pS647-DBN in neurons (Kreis et al., 2013).
In order to further explore the localization of the PTEN-DBN interaction in neurons, as
well as to establish a new platform in which we can test if the interaction is of direct
nature, I performed a proximity ligation assay in cultured hippocampal neurons as
shown in Figure 12 A for PTEN and DBN.
Several methods for visualizing protein interactions in situ have been developed during
the last decades. In order to visualize direct protein-protein interaction in cells, most
approaches rely on the overexpression of genetic constructs, and they have been
successfully used in assays of living cell maintained in tissue culture as well as in fixed
cells (Hu et al., 2002; Jares-Erijman and Jovin, 2003). However, most of these assays
involve the introduction of exogenous proteins.
I wanted to investigate the interaction between DBN and PTEN at endogenous levels
in normal conditions. To do so, I applied the proximity ligation assay or PLA; an assay
that offers the possibility for the direct visualization of specific protein-protein
interactions that are in the proximity of 30 nm (Söderberg et al., 2006). The PLA is an
antibody based assay, combining proximity ligation with rolling circular amplification
(RCA). The PLA probes consist of species-specific antibodies coupled to linear
oligonucleotide sequences that in the proximity and the presence of a ligase will
catalyzed the ligation between the two ends in proximity. RCA is directed by a
polymerase and the addition of fluorescence labeled oligonucleotides complementary
to the PLA probes. A schematic representation of this assay in depicted in Figure 11.
Results
27
Figure 11| Schematic representation of the PLA for DBN and PTEN. A) The PLA assay is an
antibody based assay. In order to visualize the interaction between DBN and PTEN antibodies
specific to these proteins as well PLA– -mouse and PLA+-rabbit probes were applied. B) In this
diagram 1-5 provides a guide to the general procedure conducted for the detection of the DBN-
PLA complex in neurons using PLA.
In order to detect and visualize the endogenous interaction between DBN and PTEN,
the PLA in 18-21 DIV cultured hippocampal neurons using anti-DBN and anti-PTEN
antibodies was performed, according to the manufacturer’s manual. Following the
amplification reaction, cells were then stained with an anti-MAP2 antibody to establish
the general outline of the soma and dendrites, and to exclusively label neurons (Figure
12). These experiments resulted in puncta from the PLA reaction that were found in
close proximity to MAP2 positive dendrites. In order to control for the specificity of this
approach, I undertook three sets of control experiments. In the first, both primary
antibodies were omitted, whilst in the second and third, neuronal cultures were labeled
with the PTEN antibody only or the DBN antibody only. In all experiments, the
secondary antibodies were used. The PLA in these experiments resulted in no puncta,
Results
28
indicating the specificity of the approach in detecting PTEN-DBN interaction. This is
the first time that PTEN-DBN interactions have been visualized at endogenous levels
in neurons.
Figure 12| PTEN-DBN interaction in neurons. PLA for DBN and PTEN was performed in fixed
18-21 DIV mouse neurons. A) PLA controls for the visualization of the PTEN-DBN interaction
in neurons applying PLA. The first row of images shows the interaction between PTEN-DBN
(red) in neurons. The second, third and fourth rows, show that in the absence of one or both
of the antibodies in the PLA assay, the interaction is not detected, proving the specificity of the
signal in the assay. The neuronal marker MAP2 is shown in green, the PTEN-DBN interaction
in red and Hoechst in blue. Scale bar: 20 µm
Results
29
In order to unequivocally localize the obtained PLA signals to dendritic spines, I also
performed the assay and co-labelled with F-actin. As demonstrated in Figure 13, some
puncta co-localize to F-actin rich dendritic spines. However, only a minority of spines
show evidences of PTEN-DBN PLA signals, suggesting this complex to be a rare
incidence.
Figure 13| Visualization of PTEN-DBN interaction in neurons with PLA. A) PLA for DBN and
PTEN (yellow) in co-localization with F-actin (red) in neurons. B) Visualization of the presence
of the PTEN-DBN complex in spines (PLA). F-actin is stained in green, MAP2 in magenta,
Hoechst in blue, and the PTEN-PLA complex in yellow. This staining shows the presence of
the PTEN-DBN complex in dendrites and base/neck of spines. Scale bar: 20 µm
2.1.4 DBN biological role in the formation of filopodia-like structures when
overexpressed in cell lines.
As an F-actin binding protein, DBN overexpression has been reported to induce
filopodia-like structures in a number of different cell types and cultured neurons
(Hayashi and Shirao, 1999; Mizui et al., 2005). In order gain first insights into the
potential effect of the phosphorylation site of DBN in cells, I exploited a cell line based
assay to monitor filopodia formation using YFP-tagged wild-type isoforms DBN A and
E as well as of amino acid substitutions mimicking a dephosphorylated state (DBN
S647A for the adult form and in the site S601A for the embryonic form). COS-7 cells
(Figure 14-A) or SH-SY5Y (Figure 14-B) cells were transfected with the individual
constructs and were then fixed after 24 h, before stained for microtubules with anti-
Results
30
tubulin and nuclei with Hoechst. Representative confocal microscope images are
shown in Figure 14.
In cells overexpressing DBN-A, there was a clear induction of a prominent filopodia
phenotype, similar to the results reported by Hayashi and Shirao (1999) in CHO cells.
Here, overexpression of DBN-E, as well as the mutant DBN S647A/S601A constructs
induced filopodia to the same extend as DBN-A. Therefore, S647/601 is not likely to
influence DBN activity toward influencing actin dynamics during filopodia induction, at
least not in this assay.
Figure 14| Overexpression of DBN induces the formation of filopodia-like structures. A) COS-
7 and B) SH-SY5Y cells were transfected with either YFP-DBN-E, YFP-DBN-E-S601A, YFP-
DBN-A, YFP-DBN-A-S647A or an YFP control, as indicated and labeled in green for 24 h. As
an extra control non-transfected cells are included. After transfection, cells were fixed and
stained for tubulin in red and Hoechst in blue. The images were captured using a confocal
microscope.
Results
31
2.1.5 Induction of oxidative stress by paraquat reduces DBN expression levels in
cortical neurons
The production of reactive oxygen species (ROS) is consequence of the metabolism
of the cell, however when the ROS present un-pair electrons they are known as free
radicals. Free radicals are highly reactive molecules that can affect important
processes in the cell leading to cell dead (Ramalingam and Kim, 2011). An increase in
the production of ROS has been described to contribute in the pathogenesis of some
diseases including AD (Ramalingam and Kim, 2011). In connection to this, multiple
studies have reported a decrease on DBN protein levels in the brains from AD patients
suggesting a possible correlation between DBN levels and cognitive impairment
(Counts et al., 2012; Harigaya and Shoji, 1996; Shim and Lubec, 2002). However, clear
evidence about how DBN influences AD disease remains to be elucidated.
I hypothesized that DBN may be modified by oxidative stress. Therefore, I investigated
whether DBN levels decrease during oxidative stress by challenging matured cortical
neurons testing three compounds commonly used for the induction of oxidative stress
in cells: H2O2 and the herbicide paraquat (Wang et al., 2009; Doré et al., 1999;
Ramalingam and Kim, 2011). In addition to those compounds, Aβ the Alzheimer’s
disease related protein was also tested.
In order to assess DBN stability during conditions that may resemble aged or disease-
like insults and to find the right experimental conditions, H2O2, paraquat and Aβ were
applied at different concentrations. I observed that H2O2 at the tested concentrations
(1-10 µM) had no effect on DBN protein levels in 14 DIV cortical neurons. Treatments
with Aβ applied (0.25µM-2µM) were rather difficult since occasionally the effect was
very toxic leading to neuronal death. However, the herbicide paraquat significantly
reduced DBN protein levels in a 20 µM concentration with no cytotoxic effects (Figure
15), providing a good platform for future experiments targeting the regulation of DBN
abundance during oxidative stress. These data demonstrate that levels of DBN are
vulnerable to increased oxidative stress providing a good experimental setup for future
investigations.
Results
32
Figure 15| Induction of oxidative stress by paraquat reduces DBN levels in 14 DIV cortical
neurons. Mouse embryonic day 16.5 (E16.5) cortical neurons were cultured for 14 days in vitro
and were treated with different concentrations of paraquat. Twenty-four hours after treatment,
the cells were lysed and analyzed for DBN levels (A). Equal amounts of lysates were loaded
on 8% poly-acylamide gels and were probed for DBN and GAPDH. B) The relative levels of
DBN were quantified and normalized to vehicle control levels. These values are plotted for
three independent experiments, where the error bars represent +/- SEM and *p=0.010
2.2 Regulation of DBN turnover
This section describes the experiments I performed in order to study the potential role
of DBN phosphorylation at (S601) in the stability of the protein. I designed and
established pulse-chase experiments using metabolic labeling with AHA. These
experiments allowed me to study the degradation and turnover profiles of Flag-DBNwild-
type and two Ser-substituted mutant forms, mimicking either a dephosphorylated (Flag-
DBNS601A) or a phosphorylated state (Flag-DBNS601D) of the protein.
Results
33
2.2.1 Pulse-chase experiments using L-Azidohomoalanine in a cell culture system
show that pS647 regulates DBN stability
Cell homeostasis is a process highly dependent on the proteome. The proteome is
very dynamic and it is regulated by protein synthesis and protein degradation. This
regulation is implicated in several biological processes such as cell proliferation, cell
growth, cell differentiation, cell metabolism, memory and learning (Dieterich et al.,
2006). Therefore, understanding the means for proteostasis can provide insights into
the regulation of such processes. DBN is a protein which has been described to play
a role in synaptic plasticity (Jung et al., 2015) and which protein levels seem to be
important in the regulation of filopodia formation and spine maintenance (Hayashi and
Shirao, 1999; Kreis et al., 2013).
DBN is a highly phosphorylated protein and site-specific phosphorylation is speculated
to regulate localization and stability of DBN. Therefore, I explored DBN turnover in
dependence of S647/S601 phosphorylation, a phosho-site shown by Eickholt and
colleagues to be regulated by PTEN levels (Kreis et al., 2013). To do so, I applied
bioortogonal noncanonical amino acid tagging (BONCAT) (Dieterich et al., 2006).
BONCAT was developed by Schuman and colleagues (2006) for the identification of
newly synthesized proteins in mammalian cells using metabolic labeling with AHA.
Application of assays such as isotope labeling amino acid, 2D gel electrophoresis,
radioactive isotope labeling amino acid and others had been applied before for this
purpose (Dieterich et al., 2006). However, BONCAT opened the possibility of enriching
labeled de novo synthesized proteins. This is possible with AHA and ‘click-chemistry’
for the alkyne-biotin cycloaddition.
Results
34
Figure 16| Overview of the experimental setup for pulse-chase experiments using metabolic
labeling. A) Chemical structure of the methionine analog L-azidohomoalanine. B) Chemical
structure of the aminoacid methionine. C) Flow chart of the protocol for pulse-chase
experiments. 293T cells were transfected and later pulse-labeled with AHA. Cells were lysed
and click-chemistry was performed. Detection of AHA-labeled proteins was performed with
streptavidin-HRP in western blot.
AHA is an unnatural amino acid that is incorporated into newly synthesized proteins
instead of Methionine (Met) during pulse-labeling. This principle was used to label
expressed protein over defined periods of time, chasing them with complete medium
for studying the labelled protein’s stability. As shown in Figure 16, HEK293T cells were
transfected and, after 24 h, Met starved for 1 h and pulse-labeled with 1 mM AHA for
1 h. Then, cells were lysed and click-chemistry was performed. Samples were
analyzed by WB, whereby the detection of the AHA-labeled proteins was performed
with streptavidin-HRP.
Results
35
Figure 17| DBN protein stability is pS647 dependent. HEK293T cells were transfected 24 h
after platting with DBNWT-Flag, DBNS647A-Flag, DBNS647D-Flag or Flag. 24 h after transfection
cells were methionine starved for 1 h followed by pulse-labeling with L-azidohomoalanine
(AHA) for 1 h and chased in complete medium for 0, 24, 48 or 72 hrs. Cell lysates were
collected and used for click-chemistry (alkyne-biotin cycloaddition). Pellets were resuspended
in sample buffer and analyzed by western blotting using streptavidin for the detection of AHA
labeled proteins or the indicated antibodies. A) Pulse-chase experiments comparing DBNWT-
Flag and DBNS647A-Flag protein stability or B) DBNWT-Flag and DBNS647D-Flag protein stability
by western blotting. C-D) Western blots were quantified and relative protein abundance after
normalizing to loading control (tubulin) and to time point 0 h is plotted. Pointed lines indicate
the respective exponential decay curves and error bars show the SEMs.*P-value= 0.070
These experiments show that DBNS601A is degraded faster than the DBNwild-type isoform
(Figure 17). This observation suggests that the stability of DBN is S601
phosphorylation dependent. In contrast, DBN mutant isoform mimicking a
phosphorylated state (S601D) is as stable as the wild-type DBN-E isoform after 72 h
chase (Figure 17). In addition, I estimated protein half-lives for all the DBN proteins:
wild-type and mutants (Figure 18). The protein half-lives indicate that DBN is a long-
lived protein and that ablating DBN S601 phosphorylation increase its turnover (half-
live=39 +/-3 hours). Moreover, the half live of DBNwild-type does not differ significantly
from the half live of DBNES601D (75 ± 8 hours and 97± 16 hours, respectively), indicating
Results
36
that DBN is highly phosphorylated under normal conditions. These results suggest that
DBN stability is dependent on S647 phosphorylation.
Figure 18| DBN protein stability is pS647 dependent. A) HEK293T cells were transfected 24
h after platting with DBNWT-Flag, DBNS647A-Flag or DBNS647D-Flag. 24 h after transfection
cells were methionine starved for 1 h followed by pulse-labeling with L-azidohomoalanine
(AHA) for 1 h. Cells where then chased in complete medium for 0 and 72 h. Cell lysates were
collected and used for click-chemistry (alkyne-biotin cycloaddition). Pellets were resuspended
in sample buffer and analyzed by western blotting using streptavidin-HRP for the detection of
AHA labeled proteins or Flag-specific antibody to detect total exogenous gene product. A)
Representative western blot showing time points 0 and 72 h chase. DBN AHA-labeled proteins
are detected with streptavidin-HRP. Less AHA-labelled DBNS647A-Flag is present after 72 h
chase compared to DBNWT-Flag and DBNS647D-Flag. B) and C) Protein half-lives were
calculated from quantification of three independent experiments and are plotted in this bar plot
C) The half-lives indicate that DBN is a long-lived protein and that ablating DBN S647
phosphorylation increases its turnover. Error bars indicate SEMs and * indicates P-value <
0.01.
Results
37
2.2.2 Proteasome inhibition in pulse-chase experiments reveals that DBN is degraded
via the Ubiquitin Proteasome System
Cellular control of protein degradation involves a number of different mechanisms. For
example, membrane proteins are proteolytically cleaved in the lysosome compartment
whilst most cytosolic proteins are degraded by the proteasome. Since I was studying
the degradation profiles of DBN and the regulation of its stability, the connected
question arose: how is DBN degraded in the cell?
At the time of this investigation there was no data in the literature providing any
evidence about the mechanisms for DBN degradation. Therefore, a viable first
approach was to apply a proteasome inhibitor, MG132, in the already developed pulse-
chase system and follow DBN degradation in the presence or absence of such
inhibitor. Later, Chimura et.al. (2015) published that DBN degradation is calpain
mediated during cytotoxicity with NMDA.
Pulse-chase experiments in which MG132 was applied during the chase resulted in a
change in the turnover of DBN. As shown in Figure 19, DBN was stabilized when the
proteasome was inhibited during the 24 and 48 h chases. Quantification of 2
independent experiments was performed and relative protein abundances for DBN-
wild-type and DBNS647A are plotted in the bar plot of Figure 19. These analysis show
that both isoforms are stabilized when the proteasome is inhibited, suggesting a
degradation via UPS.
In order to further investigate the degradation of DBN, ubiquitin assays for DBN were
performed in collaboration with Dr. Patricia Kreis (Postdoc in the Eickholt lab). The
results support the idea that DBN is degraded, at least partially, via UPS (these
experiments are not reported in this thesis).
Results
38
Figure 19| DBN degradation is proteasome dependent. A) HEK293T cells were transfected
24 h after platting with DBNWT-Flag, DBNS601A-Flag or Flag. 24 h after transfection, cells
were methionine starved for a period of 1 h followed by a pulse-labeling with AHA for 1 h and
chase in complete medium for 24 or 72 h in the absence (control) or presence of 1 µM MG132.
B) Cell lysates were collected and used for click-chemistry (alkyne-biotin). Samples were
analyzed by western blotting using streptavidin-HRP and the specified antibodies. C) Western
blot quantification representing two independent experiments of streptavidin normalized first
to loading control (α-tubulin) and 24 h chase DBN-WT control, which equals maximum
labelling. D) Western blot quantification representing two independent experiments of
streptavidin normalized first to loading control (α-tubulin) and 24 h chase DBN-S601 control,
which equals maximum labelling. Data from two independent experiments is shown.
2.2.3 Studying DBN turnover in neurons.
We asked how DBN abundance is regulated. To answer this question, we studied DBN
turnover in pulse-chase experiments. These experiments suggest that DBN is a long
lived protein with an estimated half-live of 3 days. Moreover, we were able to show that
the stability of DBN is controlled by the phosphorylation of S647 (S601), located at the
C-terminus of the protein. To further confirm these results we searched for an
experimental approach that could allow us studying DBN turnover at the endogenous
level in neurons. We collaborated with Prof. Dr. Erin Schuman (Max Planck Institute
for Brain Research, Frankfurt am Main) to perform FUNCAT-PLA (Fluorescence Non-
Canonical Amino acid Tagging- Proximity Ligation Assay) in neurons in order to get
more insight into DBN stability in neurons. In this section the results for these analyses
are presented.
Results
39
2.2.3.1 Visualization of de novo synthesized proteins in vitro with FUNCAT-PLA
in neurons
FUNCAT-PLA (Tom Dieck et al., 2015) combines two different techniques – FUNCAT:
Fluorescence non-canonical amino acid tagging (Dieterich et al., 2010) and PLA:
proximity ligation assay (Söderberg et al., 2006). Combined they help to visualize the
synthesis of specific proteins at the single molecule level in fixed cells. FUNCAT is a
method that allows the visualization of newly synthesized proteins after metabolic
labeling with AHA. This assay was introduced by Schuman and collaborators (Dieterich
et al., 2010).
Using FUNCAT-PLA, the abundance and localization of newly synthesized individual
proteins can be quantified. In addition, it can be combined with variable chase periods,
making it possible to study the turnover of specific proteins. Our focus is on DBN;
therefore I applied FUNCAT-PLA to study the spatial-temporal localization of newly
synthesized DBN in neurons (Figure 22). As exemplified in Figure 20, Click-chemistry
is performed on fixed cells, covalently linking the newly synthesized AHA bearing
proteins to biotin. The nascent proteins can later be detected using a fluorophore–
coupled antibody against biotin. PLA, which traditionally has been used for the
visualization of individual protein-protein interactions by proximity ligation at various
subcellular structures, can be used to label specific proteins that have incorporated
AHA during a pulse of 2 h. This is achieved, using the anti-biotin antibody in
combination with an antibody against the protein of interest (e.g. anti-DBN).
The diagram in Figure 20 shows the seven general steps of the protocol:
1. Pulse-labeling with AHA.
2. Click-chemistry (alkyne-biotin).
3. Incubation with primary antibodies (E.g. DBN and Biotin).
4. Incubation with PLA probes (anti-mouse- and anti-rabbit+).
5. Ligation.
6. Rolling circular replication.
7. Microscopy imaging for detection of red fluorescent signal.
Results
40
Figure 20| FUNCAT-PLA Scheme. This scheme shows the principle behind the technique that
was applied for the direct visualization of DBN in neurons. Using metabolic labeling, cells were
pulse-labeled with the non-canonical amino acid AHA (1). AHA intercalates into newly
synthesized proteins instead of methionine labeling nascent proteins. Click-chemistry for
alkyne-biotin cycloaddition is then performed on the fixed cells, covalently linking the newly
synthesized AHA bearing proteins to biotin (2). Anti-DBN (mouse) and anti-biotin (rabbit)
antibodies are applied (3), followed by the incubation with the anti-mouse MINUS and the anti-
rabbit PLUS PLA probes (4) Secondary antibodies coupled to a short and unique
oligonucleotide sequence. Upon close proximity (<40nm) the PLA probes will come together
in a ligation step (5). This interaction between the two DNA strands can then be amplified by
performing a rolling circular replication in the presence of a polymerase and fluorescent-
coupled deoxyribonucleotides (6). In the end the signal is observed as red puncta representing
the novo protein synthesis (7).
2.2.3.2 Development of automatic FUNCAT-PLA analysis
For quantitative evaluations of PLA signal systematic analyses of multiple confocal
microscope images became apparent. Therefore, we developed a JAVA program for
the quantitative analysis of the PLA signal in confocal images, in a semi-automated
way. This program was developed under my supervision with Viktor Dinkel, which
formed essential part of his BSc project (thesis advisor: Prof. Raul Rojas, Department
of Mathematics and Computer Science, Freie Universität Berlin).
Results
41
The original sequence for the analysis of the PLA distribution in cells was created by
Lisa Kochen (Department of Synaptic Plasticity, Max Planck Institute for Brain
Research). Using her sequence, we further optimized the analysis in order to increase
its rigor. We developed a systematic approach for quantifying our results. The program
is optimized to process multiple images from a given folder with an approximate
processing time of 10-20 seconds per image. At the end of the analysis, the program
provides a summary report for individual images that includes the following data:
a. Raw image file.
b. Images for individual channels.
c. Mask for cell volume marker (e.g.MAP2, tyr-tub or GFP).
d. Values for the thresholds used. Thresholds can be chosen automatically or can
be set manually.
e. Values for total area occupied by the cell volume marker (e.g. MAP2 in neurons).
f. Number of PLA puncta for each image and total area occupied.
g. Fluorescent intensity for PLA signal.
The image is further filtered to exclude puncta that are either non-overlapping with the
cell volume marker, or are in close proximity (< 1 µm) to cover the area of the dendritic
spines that are not label by MAP2. Finally, the ratio of the specific PLA signal area over
the cell volume marker area are calculated and presented as a percentage of total cell
area. This pipeline of image processing and data acquisition is repeated for individual
images. The analysis is performed on maximal projections for one group of images
with the same experimental condition and contains a summary table with the values
for the thresholds used, the total number of images analyzed, the mean values for PLA
and MAP2 areas, as well as the PLA/MAP2 mean ratio (as a percentage) for the group
of images analyzed. In addition, the summary report allows us to return to the previous
step during the evaluation process, for each image. All images, including masks, are
individually stored for manual control in the analyses folder, if needed. An example of
a summary report is presented in Figure 21.
Results
42
Figure 21| Report for PLA analysis of confocal images. The report for a folder containing
multiple images includes the complete analysis of the group, and also provides individual
results for each image, as shown in this figure. The top panel is the report for the entire group,
which in this case contains 5 images. The next panel is an example for one image, where the
original image, the image for the MAP2 mask (cell volume marker) and the splitting of the
channels is included. The report also contains the quantification for the total area occupied by
MAP2 and by the number of puncta that have been counted. It gives the ratio PLA area over
MAP2 area as a percentage, and shows the total number of puncta, both filtered and total. The
blue letters are a link to an Excel file containing the quantification for all the images, where the
complete data is organized in a table facilitating data analyses.
Results
43
2.2.3.3 Visualization of de novo synthesized DBN in situ with FUNCAT-PLA in
neurons
DBN overexpression studies in HEK293T cells revealed that DBN stability is
phosphorylation (S601) dependent. However, I wanted to know whether this also holds
true for endogenous DBN in neurons. To study the turnover of DBN in neurons, I
performed pulse-chase experiments with FUNCAT-PLA for DBN.
To do so, rat hippocampal dissociated neurons (18-20 DIV) were pulsed-label with
AHA for 2 h and chased for 15 min before fixation, as indicated in the schematic
representation (Figure 22). PLA for biotin and DBN was followed on the fixed cells after
click-chemistry. To evaluate the specificity of the labeling, two negative controls were
prepared: a methionine control (met), whereby the complete medium contains
methionine but no AHA, and an anisomycin control (aniso) where protein synthesis
was blocked. Finally, staining of MAP2, a neuronal somato-dendritic marker was
applied.
These experiments indicated that the DBN pool, labeled for 2 h with AHA, is present
both in soma and dendrite and that this signal is specific (Figure 22). The specificity
was confirmed by quantitative analyses of the two control conditions: Met or AHA-aniso
and compared to AHA. The signal in Met and AHA-aniso is 80 fold lower therefore
considered as a background signal. These experiments were the bases for performing
pulse-chase experiments applying FUNCAT-PLA for studying DBN turnover in
neurons.
Results
44
Figure 22| FUNCAT-PLA for visualization of DBN synthesis in situ. A) 18-20 DIV primary
neurons were pulse-labelled for 2 h with AHA and were fixed after a 15 min chase in complete
conditioned medium. B) To follow DBN synthesis in situ click-chemistry (alkyne-biotin
cycloadition) and PLA using antibodies against DBN and Biotin was performed on the fixed
neurons. This was performed for the three FUNCAT-PLA control conditions: AHA-control, Met-
control and AHA-anisomycin. MAP2 is shown in magenta, PLA in yellow and DAPI in blue. C)
Quantification of the PLA signal after MAP2 normalization as percentage of AHA-control (error
bars indicate SEM from three independent experiments. Images were modified for visualization
purposes. Scale bar: 20µm
Results
45
2.2.3.4 DBN turnover and pS647-DBN kinetics in rat hippocampal neurons
I performed pulse-chase and FUNCAT-PLA experiments in rat hippocampal neurons
with the objective of studying DBN turnover in neurons. The degradation of DBN was
followed for 24 h and 68 h after pulse-labeling as shown in the schematic
representation in Figure 23. Representative images of the experiments for 0 h, 24 h
and 68 h chase are displayed on Figure 23. Quantification of these images from three
independent pulse-chase experiments shown in Figure 23-C indicate that
approximately 50% of the DBN protein is degraded after ~70 h, while no degradation
occurs during the first 24 h. This is in line with my previous experiments performed in
the lab using biochemical assays, which determined the half-life of DBN to be 75 ± 8 h
in pulse-chase experiments.
Results
46
Figure 23| Pulse-chase experiments with FUNCAT-PLA to follow the spatio-temporal pattern
of de novo synthesized DBN A) 18-20 DIV primary neurons were pulse-labelled with AHA for
2 h and fixed after 0, 24 or 68 h chase in complete conditioned medium. B) To follow the spatio-
temporal patterns for newly synthesized DBN click-chemistry (alkyne-biotin) and PLA using
antibodies against DBN and Biotin was performed on the fixed neurons. These was performed
for the three FUNCAT-PLA control conditions: AHA-control, Met-control or AHA-anisomycin.
(MAP2 is shown in green, PLA in red and DAPI in blue. C) Quantification of the PLA signal
after MAP2 normalization as percentage of AHA-control (error bars indicate SEM of three
independent experiments). Images were modified for visualization purposes. Protein half-live
was calculated assuming an exponential decay degradation. Scale bar: 20 µm.
Results
47
2.2.4 Deciphering DBN translation control and localization in situ in neurons
It has become clear that several synaptic proteins are locally translated in dendrites
and synapses (Tom Dieck et al., 2014). Moreover, polyribosomes have been identified
in the dendritic shafts and spines, which suggests a role of local protein synthesis in
the regulation of synapses (Ostroff et al., 2002). Furthermore, it has been proposed
that synaptic plasticity requires synthesis of proteins and that this occurs locally for the
long-term synaptic plasticity underlying memory formation (Tom Dieck et al., 2014 and
Santini et al., 2014). These results together with others reported in the literature lead
us to the next question. How is DBN translation controlled in neurons and where are
DBN transcripts localized? Therefore, it became relevant to study whether DBN is
synthesized locally or if it is transported to the dendrites. To address these questions,
I made use of two technologies. Firstly, I applied metabolic labeling with puromycin in
combination with PLA (Puro-PLA) for the investigation of DBN translation control.
These experiments are described in section 2.2.4.1. And secondly, I performed high-
resolution fluorescence in situ hybridization (FISH) for the visualization of DBN mRNA
transcripts as shown in section 3.
2.2.4.1 Visualization of in situ DBN translation in neurons applying metabolic
labeling with puromycin in combination of the proximity ligation assay.
Puromycin is an antibiotic that acts as a protein synthesis inhibitor by truncating the
nascent chain of a peptide. It is also structurally an aminoacyl tRNAs analog (see
Figure 24) and can be used for metabolic labeling of translated proteins. It has been
used successfully as a nonradioactive method to measure protein synthesis rates
(Schmidt et al., 2009), as well as to visualize de novo proteins in situ in combination of
PLA as reported in and named Puro-PLA (Tom Dieck et al., 2015).
Results
48
Figure 24| Metabolic labeling with puromycin. A) Chemical structures of the amino acid
tyrosine, the tRNA Tyrosyl and the protein synthesis inhibitor puromycin. Puromycin is a tRNA
analog and can covalently bind into nascent peptide chains. B) Schematic representation of
the process of protein synthesis in the presence of puromycin which inhibits the process of
synthesis inducing the release of the synthesized peptide when binding to the nascent chain.
(Figure adapted from Goodman and Hornberger (2015).
In addition to studying the turnover of DBN in neurons, I also explored the localization
of newly synthesized DBN. To do so, I visualized newly synthesized DBN combining
puromycilation applying Puro-PLA in neurons.
For this, cells are briefly treated with puromycin to label proteins in the process of
translation, then PLA for DBN and puromycin is performed. Finally, microscopy
imaging is used to capture multiple images for the analyses of PLA (see Figure 25 for
diagram). The resulting signal provides a quantitative read-out for DBN synthesis rates
as well a quantitative result for the localization of the protein synthesis in the cell.
Results
49
Figure 25| Puro-PLA. N1E cells or primary mouse neurons are treated with different inhibitors
for 1 h followed by a 3 min incubation with 1 µM puromycin with or without the respective
inhibitors. Cells are fixed and PLA with antibodies against puromycin and DBN is performed.
These experiments demonstrate than a pool of DBN is translated in dendrites and
spines, implying that DBN is locally translated in dendritic shafts. This can be observed
in the upper panel of Figure 26. The arrow indicates de novo synthesized DBN puncta
found in dendrites. This observation is in line with the previously shown distribution of
DBN detected in neurons when applying FUNCAT-PLA (see Figure 22). In contrast to
FUNCAT-PLA where pulse-labeling with AHA was performed for 2 h, allowing enough
time for protein transport, in Puro-PLA the pulses with Puro were performed for only 3
min, excluding long-range protein transport. However, short-range protein diffusion
cannot be completely excluded during the delay between labelling and fixation.
Nevertheless, to further confirm this observation I explored the localization of DBN
transcripts in neurons as shown in the last section of results.
To evaluate the specificity of the labeling, two negative controls for the Puro-PLA assay
were included: anisomycin to block protein synthesis with a pre-treatment of 30 min
and a condition without puromycin. As shown in Figure 26 , no signal comparable to
the control can be detected, proving the specificity of the antibodies in this assay and
the specificity of the puromycin labeling.
Results
50
Figure 26| DBN is locally synthesized. Cultured hippocampal neurons from E16.5 mice were
grown for 14 DIV and incubated for 3 min with 1 µM puromycin, washed and fixed. PLA with
antibodies against puromycin and DBN was then performed on the fixed cells. Puromycin
(puro) shows DBN synthesis in situ and anisomycin (aniso + puro) or No puromycin (no puro)
are negative controls. Arrows in top right image indicate PLA signal found in distal dendrites.
Scale bar: 20 µm.
Results
51
2.2.4.2 DBN protein synthesis is affected by the PI3K-mTOR pathway
One of the main objectives of this thesis was to find regulatory inputs for the turnover
of DBN. Therefore, I wanted to explore whether the Phosphatidylinositol 3-kinase –
mammalian target of rapamycin (PI3K-mTOR) pathway (see Figure 27 for schematic
representation) plays a role in the regulation of DBN translation. The PI3K-mTOR
pathway is known to control the translation of some proteins, therefore we explored
whether DBN was one of those.
The PI3K pathway controls essential processes of the cell such as cell proliferation
and cell growth. PTEN antagonizes this pathway while PI3K activates it. In neurons,
the kinase activity of mTOR is involved in translation regulation and long-lasting
synaptic plasticity. The PI3K pathway starts with the activation of PI3 kinase which
occurs after growth factor stimulation. Phosphoinositol-3-Kinase (PI3K) catalyzes the
conversion of phosphatidylinositol 4-5 diphosphate (PIP2) into phosphatidylinositol
3,4,5 triphosphate (PIP3). This reaction is antagonized by phosphatase and tensin
homolog (PTEN). PIP3 activates Protein kinase B (AKT) which subsequently can
activate the mammalian target of rapamycin (mTOR). mTOR activates ribosomal
protein S6 kinase beta-1 (S6K1), this activation has an effect in protein synthesis.
4EBP, in contrast, if activated has a translation repression activity. A schematic
representation of a simplified version of this pathway as well as the target proteins for
some inhibitors of the pathway are shown in Figure 27.
Results
52
Figure 27| Simplified schematic representation of the PI3K-mTOR pathway. Phosphoinositol-
3-Kinase (PI3K), Protein kinase B (AKT), phosphatase and tensin homolog (PTEN)
mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase beta-1 (S6K1). Inhibitors
for PI3K, PTEN and mTOR are indicated in the pathway.
In order to gain insights into the regulation of DBN translation in dependence of the
PI3K-mTOR pathway, I first tested the mTOR inhibitor rapamycin, the PI3K inhibitor
GDC0941 and the PTEN inhibitor bpV(hopic) in cells and analyzed their activity by
western blotting (Figure 28). Inhibition of mTOR with rapamycin resulted in the
reduction of downstream pS6 levels, inhibition of PI3K decreased the levels of
pS473AKT and inhibition of PTEN with increased pS6 levels. These results proved that
all inhibitors were working and acting as anticipated in this cellular model.
Results
53
Figure 28| Different inhibitors induce inhibition or over-activation of the PI3K-mTOR pathway.
N1E cells were treated for 1 h with 100 nM rapamycin, 0.25 µM GDC0941, 100 nM or 1 µM
bpV (hopic) in duplicates or DMSO as a control. Cell lysates were collected and analyzed by
western blotting to evaluate the inhibitors activity using AKT-pS473, pS6 and α-actin as a
loading control.
The next step was to control for the efficiency of puromycin in western blot and to
confirm that the presence of puromycin does not affect the activity of the tested
inhibitors. To do so, puromycilation for 5 min was analyzed by western blotting. A
schematic representation of the experimental design is depicted in Figure 29.
Figure 29| Puromycilation protocol. A) N1E cells are treated with different inhibitors for 1 h
followed by a 5 min incubation with 4 µM puromycin with or without the respective inhibitors.
Cells are lysed and lysates are analyzed by western blotting. To detect puromycilation a
puromycin antibody is applied in Western blots.
Results on Figure 30-A show a reduction on pS6 upon treatments with rapamycin, an
increase in pS6 after PTEN inhibition and a reduction of pS473 after PI3K inhibition.
Results
54
These results prove that co-treatment with puromycin does not interfere with the
activity of the applied inhibitors. In parallel, in Figure 30-B, it can be observed that
puromycin efficiently labeled newly synthesized proteins and that this labeling can be
completely abolished with a pre-treatment with anisomycin (aniso) to block protein
synthesis. Additionally, absence of puromycin (no-puro) does not provide any signal,
confirming the specificity and efficiency of the labeling of de novo synthesized proteins
in N1E cells without detectable background.
Figure 30| Controls for PI3K-mTOR pathway inhibitors in combination of puromycin. A) In
order to confirm that our different inhibitors are active in combination of puromycin, N1E cells
were grown in DMEM 1 % FCS for 24 h and then treated for 1 h with 40 µM anisomycin, 100
nM rapamycin, 0.25 µM GDC0941,100 nM or 1 µM bpV (hopic), or DMSO as a control and
directly incubated for 5 min with 4 µM Puromycin +/- inhibitors. Cells were washed with PBS
and cell lysates were collected and analysed by western blotting to evaluate the activity of the
inhibitors in the presence of puromycin; a tRNA analog that causes protein truncation, probing
for AKT-pS473, pS6 and α-actin as a loading control. In line with what is reported in the
literature, pS6 levels are massively reduced when rapamycin is applied and in contrast
increased when PTEN is inhibited with bpV, pS473AKT levels are downregulated when PI3K
inhibitor GDC0941 is applied and anisomycin blocks protein synthesis. B) Samples were
analyzed using a Puromycin antibody to detect the total newly synthesized proteins or the
puromycilated fraction and α-actin as a loading control. Importantly, the respective inhibitors
do not seem to affect global protein synthesis while we observe that some of them affect DBN
protein synthesis specifically in our Puro-PLA experiments.
Results
55
To further investigate the potential role of the PI3K-mTOR pathway in the regulation of
DBN translation, I performed PURO-PLA experiments in combination with acute
inhibitions of PTEN, PI3K or mTOR. Quantification of the PLA signal for all the different
conditions proves that the inhibition of PTEN and PI3K do not affect the translation rate
of DBN in comparison to the control. However, inhibition of mTOR significantly reduces
DBN synthesis in N1E cells. These results are shown in Figure 31.
Figure 31| Treatment with rapamycin reduces DBN translation. A) N1E cells were grown in
DMEM 1% FCS for 24 h and then treated for 1 h with 100 nM rapamycin, 0.25 µM
GDC0941,100 nM or 1 µM bpV (hopic), 4 µM anisomycin, or DMSO as a control and directly
incubated for 3 min with 1 µM Puromycin +/- inhibitors or without puromycin. Cells were
washed and directly fixed. PLA with antibodies against puromycin and DBN was then
performed on the fixed cells. B) DBN Puro-PLA quantification. (Error bars indicate SEM of
three independent experiments and * pValue< 0.01). Scale bar: 10 µm.
Results
56
2.3 Visualization of DBN mRNA in neurons and abundance upon neuronal stimulation
2.3.1 DBN mRNA transcripts are present in dendrites.
Experiment performed in neurons applying FUNCAT-PLA and Puro-PLA show that de
novo synthesized DBN is present in dendrites and spines. This observation suggested
that DBN could be a protein which local translation is needed during synaptic plasticity.
To further characterize the localization of DBN translation I performed high-resolution
FISH experiments for the visualization of DBN transcripts in neurons. Confocal
microscopy images of these experiments show the presence of DBN mRNA in
dendrites supporting the idea that DBN translation is localized (Figure 32). A negative
control where no probe was added was included in the experiment and as shown in
Figure 32 no signal can be detected.
Results
57
Figure 32| DBN transcripts are localized in dendrites. A) Schematic representation for the in
situ hybridization amplification system for the fluorescence detection of mRNA (Panomics). B)
RNA fluorescence in situ hybridization for DBN mRNA using Panomics probes. MAP2 staining
was applied as a neuronal marker and DAPI as nuclear stain. Images were modified for
visualization purposes. Scale bar: 20 µm
2.3.2 Visualization of DBN mRNA abundance in neurons with high-resolution FISH
Cajigas et al. 2012 reported over 2000 mRNAs to be present in the neuropil, including
DBN. In addition, high-resolution FISH in cultured hippocampal neurons clearly
showed the presence of diverse mRNA transcripts in dendrites and also different soma
to dendrite ratios for the abundance of these (Cajigas et al., 2012). Therefore, I
performed high-resolution FISH for DBN, beta-actin and CamKII. By observing
representative images it is possible to compare their abundances in cultured neurons.
CamKII is reported to be highly abundant in neurons, this can also be observed in my
Results
58
experiments. When comparing these levels those of Beta-actin and DBN mRNA
puncta it looks like they are in the lower range (Figure 33). However, more experiments
should be performed for a clear conclusion on this matter.
Figure 33| DBN, CamKII and Beta-actin mRNA abundance in neurons. RNA fluorescence in
situ hybridization for detection of DBN mRNA (A), CamKII mRNA (B) and Beta-actin mRNA
(C) was performed in primary hippocampal neurons using Panomics probes. MAP2 staining
was applied as a neuronal marker and Dapi as a nuclear staining. Representative images show
different transcript abundance for DBN and Beta-actin in comparison to CamKII known to be
highly abundant in neurons.
2.3.3 Neuronal network silencing during homeostatic plasticity results in more DBN
localized transcripts.
In order to investigate whether DBN is regulated at the transcriptional level upon
synaptic activity stimulation or during homeostatic plasticity, I performed high-
resolution FISH in cultured hippocampal neurons after treating 24-28 DIV neurons for
2 h with either bicuculline, TTX + APV or vehicle control. Using the PLA plugin for FIJI
I quantified the total signal (Figure 34 -B), the signal in the soma (Figure 34-C) and
calculated the signal in the periphery (Figure 34-D) for the different conditions. The
results are shown in Figure 34. No significant differences are observed after enhancing
synaptic activity with biccuculline in comparison with the control. However, silencing of
the network and spontaneous activities with TTX + APV changes the total mRNA
abundance of DBN. No changes are observed in the soma whereas an increase in the
abundance in dendrites is evident.
Results
59
Figure 34|Neuronal network silencing results in more DBN transcripts. A) RNA fluorescence
in situ hybridization for DBN mRNA using Panomics probes was performed in primary
hippocampal neurons treated for 2 h with Bicuculline (30 µM), TTX (1µM) + APV (20 µM) or
vehicle control. MAP2 staining was applied as a neuronal marker and DAPI as a nuclear stain.
Images were modified for visualization purposes. B) Global mRNA signal was quantified after
MAP2 normalization as percentage of Vehicle-control C) Signal in somata and D) Signal in
dendrites.
Discussion
60
3 Discussion Experimental evidence in neurons for DBN overexpression (Kreis et al., 2013; Mizui et
al., 2005), DBN downregulation (Takahashi et al., 2006) and complete depletion of
DBN in a DBN-KO model (Jung et al., 2015) have shown that DBN levels - too high or
too low - can affect spine morphology as well as synaptic function. These results
suggested that DBN abundance is essential for the modulation and stability of spine
morphology. Moreover loss of DBN in the brain is linked to cognitive impairment as
well as Alzheimer’s disease and Down’s syndrome. Therefore, studying the inputs that
control the turnover and stability of DBN is of great interest not only to understand how
DBN is regulated but also to understand how DBN affects synaptic plasticity and how
it contributes to aging.
Protein damage and oxidative stress are thought to contribute to age-related
pathology. Thus, in the first section of my discussion I analyze the decrease of DBN
abundance during oxidative stress conditions using oxidizing agents in neurons. The
second part of the discussion is dedicated to understanding how DBN stability is
regulated and how DBN is degraded.
In the last two sections I will discuss the regulation of DBN translation and the presence
of DBN transcripts in dendrites.
3.1 Effect of oxidative stress on DBN abundance and its link to neurodegeneration
During aging, the entire proteome is affected by oxidative stress, however the
consequences may differ from one protein to another. Considering the decrease of
DBN during aging, I hypothesized that DBN may be modified by oxidative stress. To
assess DBN stability during oxidative stress, I challenged matured cortical neurons
with H2O2 and Paraquat, compounds that are commonly used to induce oxidative
stress (Wang et al., 2009; Doré et al., 1999; Ramalingam and Kim, 2011) as well as
Aβ the Alzheimer’s disease related protein. In order to find the right experimental
conditions, H2O2, Paraquat and Aβ were tested at different concentrations and applied
in cultured cortical neurons. I observed that H2O2 at the tested concentrations has no
effect on DBN protein levels at 14 DIV cortical neurons. Treatments with Aβ were
difficult to reproduce since occasionally the effect was very toxic leading to neuronal
Discussion
61
death. However, the herbicide paraquat reduced DBN protein levels in a 15 µM
concentration with no cytotoxic effects, providing a good platform for future
experiments targeting the regulation of DBN abundance during oxidative stress
Towards finding new therapeutics for the treatment of neurodegenerative diseases
where neuronal loss occurs, studying the effect of reactive oxygen species during
synaptic plasticity is a very common approach (Guo et al., 2015; Santini et al., 2015).
Moreover, oxidative stress has been described as one characteristic in
neurodegeneration (Klein and Ackerman, 2003). Therefore, having an experimental
system where DBN protein levels decrease is an important readout in the context of
neurodegeneration. Future studies, could clarify the molecular mechanisms behind
DBN and its described downregulation in AD (Counts et al., 2012; Harigaya and Shoji,
1996) and Down syndrome (Shim and Lubec, 2002).
Overall, these results provide insights into the potential regulation of DBN abundance
during oxidative stress. However, to clarify the mechanisms modulating the effects on
DBN decreasing levels, further investigation is necessary.
3.2 DBN turnover and stability in dependence of S647 phosphorylation
We have previously shown that DBN interacts with the phosphatase and tensin
homolog (PTEN) protein. We found that DBN is highly phosphorylated at Serine 647
residue and that this phosphorylation is negatively regulated by the phosphatase PTEN
(Kreis et al., 2013). A reduction in PTEN protein levels coincided with an increased in
pS647-DBN levels (Kreis et al., 2013). Moreover, the PTEN-DBN interaction is
destabilized upon neuronal activity. Therefore, we were interested in the understanding
of the dynamics of DBN phosphorylation and dephosphorylation and its role in DBN
stability during synaptic plasticity.
My PhD thesis had as one key objective to answer how DBN abundance is regulated.
To address this question, I studied DBN turnover in pulse-chase experiments in
HEK293T cells. These experiments suggest that DBN is a long lived protein with an
estimated half-live of 3 days. Moreover I was able to show that the stability of DBN is
controlled by the phosphorylation of the S647, located at the C-terminus of the protein
and that the turnover of DBN is slower when inhibiting the UPS. To further confirm
these results, I searched for an experimental approach that could allow me studying
Discussion
62
DBN turnover at the endogenous level in neurons. I applied FUNCAT-PLA in cultured
hippocampal neurons and followed the degradation profile of endogenous DBN for 24
and 68 h after pulse labeling with AHA. Analyses of these experiments confirmed that
DBN is a long lived protein in neurons with a calculated half-life of ~ 70 h. This is in
line with my previous experiments using biochemical pulse chase assays, which
indicated the half-life of DBN to be ~ 75 h. Moreover, Cohen and colleagues have
estimated the protein half-life of 150.48 h for DBN and suggested that the average
turnover of synaptic proteins is of 99.6 h (Cohen et al., 2013). In contrast to my
experimental approach for DBN turnover analysis, Cohen et.al, (2013) calculated
protein half-lives mass spectrometry analyses. The analyzed data was generated by
applying isotope labeling with amino acids in cell culture (SILAC) in 14 DIV rat cortical
neurons, while our data was obtained from the analyses of HEK293T cells and 18-21
DIV rat hippocampal neurons labeled with AHA. Different cell systems as well as
different techniques for labeling proteins could be the reason for finding a big difference
between the calculated half-life for DBN by Cohen et.al. (2013) (~150 h) and the half-
lives I calculated in both my assays (~ 75 h). Nevertheless, in both cases DBN results
to be a long-lived protein.
Overall, my data provides new information on the turnover of DBN and confirms that
DBN is a very stable protein which stability is controlled by phosphorylation.
3.3 DBN stabilization upon inhibition of the ubiquitin proteasome system
In order to study the possibility of DBN stabilization when inhibiting the most common
path of degradation in the cell I applied MG132, an UPS inhibitor in my pulse-chase
experiments. There was no data available in the literature concerning the mechanisms
for DBN degradation. Our first hypothesis was that DBN could be ubiquitinated and
degraded via the UPS. To address this, I performed pulse-chase experiments in
HEK293T cells as shown in the result section (Figure 19) in the presence or absence
of MG132, an UPS inhibitor. The addition of MG132 during the chase resulted in the
stabilization of DBN, suggesting that DBN degradation could be directed by
ubiquitination. To study this further, ubiquitination experiments (not shown in this
thesis) were performed by Dr. Patricia Kreis. The results support the observation of
DBN degradation by UPS. However, in 2015, Yoshida and colleagues reported DBN
Discussion
63
degradation by calpain. In this work, they induced excitotoxicity in cultured
hippocampal neurons by prolonged stimulation of NMDA-receptors (NMDA-R)
(Chimura et al., 2015). Excitotoxicity is the pathological term for neuronal degeneration
by long exposures to neurotransmitters or excessive depolarization of the cells. Such
stimulation induced the degradation of DBN after only a few hours when treated acutely
with NMDA. The NMDR-R overstimulation induced degradation of DBN was rescued
when applying a chelating agent or a calpain inhibitor suggesting DBN degradation by
calpain (Chimura et al., 2015).
Two ways of degradation for DBN are presented here. DBN degradation by calpain is
suggested to occur by NMDA induced excitotoxicity in neurons while inhibition of the
UPS with MG132 stabilizes DBN in pulse-chase experiments. Further investigation
would be needed to clarify how exactly DBN degradation is targeted and whether
different conditions activate different pathways for the degradation of the protein.
Specific degradation of proteins can be context dependent regulated. This is the case
for exampled for PTEN. PTEN has been described to be ubiquitinated and degraded
by the UPS (Lee et al., 2015) in cancer cell lines. However it has also been suggested
that PTEN degradation is mediated by calpain-2 after neuronal stimulation with BDNF
(Briz et al., 2013). This example, supports the idea that DBN degradation can be
controlled by different mechanisms during different responses.
3.4 Regulation of DBN translation by the PI3K-mTOR pathway
Protein turnover is the result of protein synthesis and protein degradation. In order to
get insights into the regulation of DBN turnover I first addressed DBN degradation in
dependence of phosphorylation as discussed in previous sections. However, it was
important to explore potential regulators of DBN translation. Therefore, as a first
approach I targeted several candidates of the PI3K-mTOR pathway, a pathway known
to regulate protein synthesis. The mammalian target of rapamycin (mTOR) is an
evolutionary conserved kinase known to play a role in controlling protein synthesis
during synaptic plasticity and memory (Blenis, 2009; Santini et al., 2014). There are
multiple stimuli controlling mTOR activity in neurons. Neurotransmitters and metabolic
changes can activate mTOR through upstream activation of AMPA-receptors, NMDA-
receptors, dopamine receptors, mGluRs and BDNF receptors. It has been suggested
that mTOR signaling contributes to short-term (minutes) and long term (hours)
Discussion
64
activation of translation. De novo protein synthesis that occurs after neuronal
stimulation has been observed to happen locally in the active synapses providing
evidence to the idea that localized translation is associated and needed for memory
formation during synaptic plasticity (Costa-Mattioli et al., 2009; Santini et al., 2014).
In order to elucidate signaling mechanisms responsible for DBN regulation as well as
what events during synaptic plasticity induce or block DBN synthesis or degradation, I
studied DBN synthesis in the presence of PI3K, mTOR and PTEN inhibitors applying
PURO-PLA in N1E cells. The results show that DBN translation is controlled by mTOR
since inhibition of mTOR with rapamycin decreased DBN translation rates.
It is well known that the mTOR signaling pathway is essential for synaptic plasticity and
memory consolidation. The evidence indicates that late long-term potentiation (L-LTP
induces the phosphorylation of mTOR downstream proteins. Moreover, application of
rapamycin inhibits long-lasting synaptic changes and memory formation in mammals
during certain behavioral tasks (reviewed in Costa-Mattioli et al., 2009).
My results together with the literature lead to the hypothesis that DBN translation during
L-LTP, which underlies synaptic plasticity and mimics memory, may be regulated by
mTOR downstream targets. In order to study whether DBN translation is controlled by
mTOR during synaptic plasticity, examination of DBN translation upon short treatments
with rapamycin during L-LTP in neurons would clarify this point. This could be
performed applying PURO-PLA in neurons combining BDNF and Rapamycin
treatments.
3.5 DBN localized translation in dendrites
Applying FUNCAT-PLA in neurons I have been able to visualize the pool of DBN
protein that is synthesized within two hours in neurons. Newly synthesized DBN is
enriched in the dendritic shaft and localizes at the base of the spines. Whether DBN
was locally translated or transported after synthesis remained an open question after
performance of the pulse-chase experiments with AHA where the pulse lasted 2 h,
enough time for protein transport to occur. However, application of PURO-PLA
demonstrates that a pool of DBN is translated in dendrites supporting the idea that
DBN is locally translated in neurons. This observation may emphasize the role of DBN
in synapse maintenance. It has become clear that in neurons several synaptic proteins
Discussion
65
are locally translated in dendrites and synapses (Tom Dieck et al., 2014).
Polyribosomes have been identified in the dendritic shafts and spines, which
suggested a role of local protein synthesis in the regulation of synapses (Ostroff et al.,
2002) Furthermore, it has been proposed that synaptic plasticity requires synthesis of
proteins and that this occurs locally during long-lasting synaptic plasticity; underlying
memory formation (Costa-Mattioli et al., 2009; Kang et al., 1996; Santini et al., 2014;
Tom Dieck et al., 2014). In order to further characterize the regulation of localized DBN
translation in dendritic shaft other experiments need to be performed. For example
induction of neuronal stimulation by applying BNDF together with rapamycin, shown to
control DBN translation in my experiments with N1E cells, could provide interesting
data. Nevertheless, the general consensus indicates that late phase of LTP depends
on transcription since it has been shown to be blocked when applying inhibitors for
transcription and for translation (Costa-Mattioli et al., 2009).
3.6 Dendritic localization of DBN mRNA
My data generated with FUNCAT-PLA and PURO-PLA suggests that DBN is locally
translated in neurons. However, to further support this observation I examined the
localization of DBN transcripts in neurons. Interestingly, I found DBN transcripts in the
dendrites of cultured hippocampal neurons. This observation was performed by
applying high-resolution in situ hybridization. DBN is not the first transcript to be found
in dendrites, in fact several mRNAs have been shown to be transported into dendrites
in cultured hippocampal neurons (reviewed by Martin and Zukin, 2006). Some of the
first mRNAs that were identified to be localized in dendrites include the microtubule
associated protein MAP2 (Garner et al., 1988), the activity-regulated cytoskeleton-
associated proteins Arc (Lyford et al., 1995) and the brain-derived neurotrophic factor
BDNF (Tongiorgi et al., 1997). However, more recently applying deep sequencing
analyses and high-resolution in situ hybridization, Schuman and colleagues generated
a library with more than 2000 transcripts identified in the neuropil of the hippocampus
(Cajigas et al., 2012). In this study DBN was identified as one of the localized mRNAs
in dendrites. However, I am the first to show the visualization of localized DBN mRNAs
in the dendrites of cultured hippocampal neurons.
Localized transcripts are transported into dendrites in large granules where they
remain latent until activation by specific stimuli. The granules contain mRNAs, RNA
Discussion
66
binding proteins, ribosomes and translational factors. The mRNA trafficking is a quick
process with an average speed of 0.1 µm/s, is bidirectional and it is directed by
microtubules (reviewed by Martin and Zukin, 2006).
Dendritic mRNA localization has been described to play a role in neuronal development
and synaptic plasticity. Moreover, several studies have reported examples for dendritic
mRNAs pools which turnover or show trafficking changes upon neuronal stimulation.
Tongiorgi et.al. (1997) demonstrated that the dendritic localization of mRNAs coding
for BDNF and its receptor TrkB increases after neuronal stimulation with high
potassium (Tongiorgi et al., 1997).
Towards finding potential inputs regulating DBN mRNA trafficking into dendrites, I
applied biccuculline to enhance synaptic activity and Tetrodoxin (TTX) together with
APV to silence the neuronal network onto cultured neurons. Use of both TTX and APV
results in complete blockage of synaptic activity. TTX blocks neurotransmitter release
by action potentials and APV, an NMDA antagonist, inhibits miniature excitatory
synaptic events. Application of bicuculline had no effect on DBN mRNA abundance or
localization. However, after simultaneous application of TTX and APV in cultured
hippocampal neurons I observe an increase in the total abundance of DBN transcripts
and this increase is observed to be significantly different in the dendrites but not in the
soma in comparison to the vehicle-control, after the inhibition of active and
spontaneous synaptic events. One possible explanation for this, is that this kind of
stimulation induces both transcription and trafficking of DBN transcripts into dendrites.
However, to fully understand what the reason for this change in the dendritic DBN
mRNA pool is, other experiments need to be performed. In general, changes in the
abundance and localization of DBN transcripts could be due to an increase in mRNA
synthesis (1), changes in the turnover of DBN mRNA (2) or due to unmasking of mRNA
granules (3) permitting the targeting of the transcripts and their visualization.
Conclusions and Outlook
67
4 Conclusions and Outlook Changes in dendritic spine morphology alter synaptic activity and plasticity, a
phenomena important in memory formation, ageing and disorders such as mental
retardation. One key protein in these processes is DBN, which is fundamentally
important in regulating dendritic spine morphology. During my PhD, I studied the effect
of site-specific phosphorylation of DBN and found that this post-translational
modification regulates protein stability and turnover. In this context, my work identifies
that DBN is locally translated in the dendritic spines in cultured hippocampal neurons.
The overall aim of my PhD project was to understand regulatory inputs relevant to the
protein abundance of DBN. DBN abundance declines with age and this is correlated
with cognitive decline during ageing. I have identified a phosphorylation site (S647)
controlling DBN stability and found that oxidative stress induced by treatments with the
herbicide paraquat reduce DBN protein levels in neurons in a concentration dependent
manner.
During my PhD work, I also investigated the control of DBN synthesis. This was
assessed with the PURO-PLA assay by application of different PI3K and mTOR
inhibitors in neurons and N1E-115 cells. I could demonstrate that DBN translation is
regulated by mTOR pathway. These results are very interesting since rapamycin is
known to block long term synaptic plasticity and L-LTP is known to involve the
transcription and synthesis of new proteins in dendrites and synapses. Performing
experiments in neurons during L-LTP and simultaneously adding rapamycin could
provide new information clarifying the mechanisms behind DBN turnover in neurons
and its role in the modulation of spine maintenance.
Furthermore, my experiments for the visualization of DBN mRNA in neurons
demonstrate their dendritic localization. Treatments in neurons for the blockage of
synaptic activity with TTX and APV resulted in an increase in the dendritic localization
and abundance of DBN mRNA. These results indicate that local translation of DBN
might be indirectly regulated by spontaneous activity.
Overall my work provides new insights into the regulation of DBN turnover and stability.
In addition, I show that DBN translation is controlled by mTOR and my data also
Conclusions and Outlook
68
suggests that DBN degradation occurs via the UPS. This thesis also delivers data
demonstrating the dendritic localization of both DBN transcripts and DBN translation.
A working model summarizes all these findings and postulates that DBN turnover in
neurons is locally controlled. Several inputs mentioned previously contribute towards
the regulation of DBN turnover and are shown in Figure 35. However, further work
needs to be performed to better correlate DBN protein abundance with synaptic
function, spine maintenance and synaptic plasticity.
Figure 35| Working model for the control and regulation of DBN turnover in dendritic spines.
This thesis show that DBN translation is controlled by mTOR pathway. Data in this thesis
suggest that DBN mRNA trafficking and transcription are indirectly regulated by spontaneous
synaptic activity. On the other hand, DBN stability dependent of phosphorylation of S647, and
as shown before in the Eickholt Lab PTEN depletion increases pS647-DBN levels therefore
indirectly regulating DBN turnover in a PI3K-independent manner. Last, this thesis shows that
DBN translation occurs locally in dendrites and in proximity of the spines. We propose that
DBN turnover is controlled locally in spines and that this regulation contributes to synaptic
function, spine maintenance and synaptic plasticity.
Materials and Methods
69
5 Materials and Methods This chapter explains how the experimental work was conducted. It should enable the
reader to fully understand the results reported in Chapter 3. It provides all the
necessary details for successful replication. All experimental techniques used, as well
as the preparation of the experimental samples, are covered.
This chapter is organized as follows: Sections 5.1 to 5.10 contain the lists of laboratory
consumables, protocols and detailed information used in the realization of the
experimental work presented in this thesis. The topics include: experimental models,
treatments and manipulations, assays, imaging-acquisition, molecular biology,
solutions and buffers, culture medium and chemicals and kits.
1.1 Molecular biology
Transfections in this work were performed using lipofectamine and the following
plasmids were available in the Eickholt Lab. All these constructs have the CMV
promoter. All YFP- and Flag-DBN constructs were generated in the Eickholt lab and
are based on the human cDNA sequence. DBN constructs with serine to
alanine/aspartic acid substitutions were generated by site directed mutagenesis, and
then validated by sequencing. The Myc-DBN E construct originated from the lab of T.
Shirao (Gunma University, Japan).
1.1.1 Plasmids
YFP-DBNA, YFP-DBNE, YFP-DBNAS647A, YFP-DBNAS647D, YFP-DBNES601A,
YFP-DBNES601D, YFP-empty, Flag-DBNE, Flag-DBNES601A, Flag-DBNES601D,
Flag-empty and Myc-DBNE.
1.2 Consumables
All consumables are enlisted in five tables presented in this section.
Table 1: Primary antibodies
Table 2: Secondary antibodies and HRP-reagents
Table 3: Buffers
Table 4: Culture medium
Table 5: Chemicals and kits
Materials and Methods
70
Table 1 lists the primary antibodies, the assays in which they were applied, and their
dilutions. Company and catalog number are indicated to facilitate their acquisition
when commercially available.
Table 1- Primary antibodies
Antibody name Antibody specie
Assay Dilution Company Catalog.No
Debrin M2F6 mouse FUNCAT-PLA WB
1:300 GenTex GTX12350
DBN (Eickholt Lab)
rabbit Puro-PLA Immuno.
1: 1000 In house made
Collected after pS647-DBN
purification by Dr. Till Mack)
DBN Guinea pig WB 1:1000 Progen GP823 pDBN (S647) rabbit WB
Immuno. 1:1000 1:500
In house made
Biotin rabbit PLA 1:5000 Cell signaling 5597 Biotin mouse PLA Sigma-
Aldrich B7653
PTEN (138G6) rabbit WB PLA
1:100 Cell signaling 9559
pS6 (Ser235/236) rabbit WB 1:1000 Cell signaling 2211 P44/42 MAPK
(Erk1/2) rabbit WB 1:1000 Cell signaling 4370
Probe Anti-Rabbit PLUS
rabbit
PLA 1:10 Duolink Sigma-Aldrich
DUO92002
Probe Anti-Mouse MINUS
mouse PLA 1:10 Sigma-Aldrich
DUO92004
Puromycin [3RH11]
mouse Puro-PLA WB
1: 4000 1:1000
Kerafast EQ0001
MAP2 guinea pig Immuno. 1:1000 Synaptic Systems
188004
Alpha-Tubulin mouse WB 1:3000 SRM T6199-200UL Flag mouse WB
or WB AHA labeling
(pulse-chase)
1:1000 or 1:100000
Sigma F3165
GAPDH [6C5] mouse 1:5000 Calbiochem CB1001 Tubulin [YL1/2] rat immuno 1:500 Abcam ab6160 anti-Ubiquitin rabbit 1:1000 DAKO 00051128)
pAKT(Ser 473) rabbit WB 1:2000 Cell signaling 4060L
AKT (pan) rabbit WB 1:2000 Cell signaling 4691 Cyclin B1 mouse WB 1:1000 Santa Cruz sc70898
Materials and Methods
71
Table 2 lists the secondary antibodies, assays in which they were applied, and the
corresponding dilutions. Company name and catalog number are indicated to facilitate
their acquisition when commercially available.
Table 2- Secondary antibodies and HRP-reagents
Antibody name Assay Dilution Company Catalog.No Streptavidin-HRP WB 1:500 Cell signaling Anti-mouse WB 1:3000 VECTOR PI-2000 Anti-rabbit WB VECTOR PI-1000 Anti-mouse alexa 568
Immuno 1:500 Invitrogen A-11004
Anti-mouse alexa 488
Immuno 1:500 Jackson Immuno Reseach
715-545-150
Anti-rabbit alexa 568
Immuno 1:500 Invitrogen A-11011
Anti-rabbit alexa 488
Immuno 1:500 Jackson Immuno Reseach
711-545-152
Anti-rat alexa 568 Immuno 1:500 Invitrogen A-11077 Anti-guinea pig Cy5
Immuno 1:500 Jackson Immuno Reseach
706-175-148
donkey anti-guinea pig IgG Cy2
Jackson Immuno Reseach
706-225-148
Alexa Fluor 488 phalloidin
Immuno 1:50 Life Technologies
A12379
Phalloidin 647 Alexa Flour
Immuno 1:25 Life Technologies
A22287
1.3 Solutions and buffers Table 3 lists the name and recipes of buffers and solutions prepared and used for
conducting all experiments.
Materials and Methods
72
Table 3- Buffers
Buffer name Concentration Assay Chemicals Company Catalog.No. Buffer A Buffer B
Ready made PLA In situ Wash Buffers, fluorescence
Sigma-Aldrich
DUO82049
Stacking buffer
0.5 M Tris-HCl 0.4% SDS pH 6.8
WB Tris-HCl SDS
homemade
Trypsin
10 mg/ml in HBSS
Primary culture Trypsin HBSS
SRM
14170146
10x TBS-T
50 mM Tris-HCl 150 mM NaCl 0.05% Tween 20 detergent
WB Tris-HCl NaCl Tween 20 detergent
Roth Roth Calbiochem
9090.3 9265.1 655205
10x Transfer-buffer
Rothiphorese SDS-Page
WB Roth 3060.2
Roti-Load sample buffer
Ready made WB Roth K929.2
APS 10% 100 µg/ml Ammoniumperoxodisulfat
WB Ammoniumperoxodisulfat
Roth 9592.3
Stripping buffer I
Ready made WB AppliChem A7140, 0125
Temed ≥99 % WB Roth 2367.1 RIPA buffer
50 mM Tris-HCL pH 7.4 150 mM NaCl 0.5% sodium deoxycholate 1% NP40 0.1% SDS
WB Tris-HCL NaCl sodium deoxycholate NP40 SDS
homemade
PBS 1x Tablets for preparation of 500 ml PBS in water
All assays phosphate buffered saline
AppliChem A9191.0012
Blocking and antibodies solution for western blot
5% Milk in TBS-T WB Low fat powder milk
Roth T145.2
Mowiol 4-88
5 g Mowiol 20 ml PBS 10 ml glycerine
Immuno Calbiochem
PBS-MC 1 x PBS PH 7.4 1mM MgCl2
(Stock: 1M in H2O) 0,1mM CaCl2
(Stock: 0.1M in H2O)
FUNCAT-PLA MgCl2
CaCl2
4% PFA, 4% Sucrose in PBS-MC pH= 7.4
20 g PFA 400 mL PBS-MC 5 µl MgCl2- Stock (1M in H2O) 5 µl CaCl2- Stock (0,1M in H2O) 20 g Sucrose
Immuno. FUNCAT-PLA Puro-PLA
Poly-DL-Ornithine
1.5-mg/mL (100X) Sigma Aldrich
P8638
Materials and Methods
73
1.4 Culture medium
Table 4 lists the different medium cultures used for growing the cell lines and primary
neurons.
Table 4- Culture medium
Medium Cell type Company
DMEM + GlutaMax Cell lines Gibco – 31966021
MEM Glial cells (rat) Gibco – 31095029
Neurobasal-A Primary cultures Gibco- 10888022
DMEM Met-Free
(custom made)
293T cells for metabolic labeling
Gibco
Neurobasal-A Met- free
(custom made)
Neurons for metabolic labeling
Gibco
Materials and Methods
74
1.5 Chemicals and kits
Table 5 shows the list of chemicals and kits used during this project.
Table 5- Chemicals and kits
Chemical Assay Company Catalog.No.
Azidohomoalanine BONCAT, FUNCAT-PLA Anaspec AS-63669
Puromycin
(50mg/ml)
Puro-PLA
Puro-WB
Sigma-Aldrich P8833
Anisomycin FUNCAT-PLA, Puro-PLA Tocris 1290
Biotin-Alkyne
(Acetylene-PEG4-Biotin)
FUNCAT-PLA Jena Biosciene GmbH
CLK-TA105
ECL western blotting substrate
WB Promega REF W1001
CuSO4-5H2O FUNCAT-PLA Sigma-Aldrich 678937
TCEP-HCl FUNCAT-PLA Pierce 20490
Triazole ligand
(TBTA)
FUNCAT-PLA Sigma-Aldrich 678937
Duolink In situ detection reagent –Red
PLA Duolink
Sigma-Aldrich
DUO92008
Click-iT® Protein Reaction Buffer Kit
Click-chemistry (cell lysates) Invitrogen C10276
Hoechst IC Sigma-Aldrich 14530
Biotin-alkyne
(4 mM stock)
Click-chemistry (cell lysates) Invitrogen B10185
protease inhibitor cocktail
WB Calbiochem 539134
Lipofectamine 2000
Transfections Life Technolog/SRM
11668019
1x phosphatase inhibitor cocktails 2 and 3
WB Sigma-Aldrich P5726 and P0044
Rapamycin mTor inhibitor, puromycilation
Cell signaling 9904S
Materials and Methods
75
GDC0941 PI3K inhibitor, puromycilation Selleckchem S1065
bpV (hopic) PTEN inhibitor, puromycilation
Calbiochem 203701
MG-132 Proteasome inhibitor, Pulse-chase 293T
SRM/Caymann 10012628
Papain dissociation System
Primary culture Worthington LK003150
Bicuculline Competitive antagonist of GABAA receptors (enhances neuronal synaptic activity)
Tocris 0130
Tetrodoxin citrate (TTX)
Reversible, selective blocker of Na+ channels, silencing of network activity
Tocris 1069
GlutaMax Primary culture Thermo Scientific 35050061
FCS Primary culture Biochrom S 0615
B27 supplement Primary culture Life Technologies 17504-044
Penicillin/streptomycin Primary culture Life Technologies 15140122
D-AP5 (APV) Neuronal stimulation Tocris 0106
Materials and Methods
76
1.6 Experimental cell models
Different cell models were used in order to establish the most valuable systems to
address the scientific questions reported in this thesis. To do so, cell lines and primary
neuronal mix cultures were used. In this section, I characterize the conditions needed
to maintain and grow cell lines and neurons isolated from mouse and rat in culture.
1.6.1 Cell models
COS-7, HEK293T and N1E-115 cells were grown and maintained for several passages
in the incubator at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM)
supplemented with 10 % fetal calf serum (FCS) and 1% penicillin/streptomycin (P/S).
1.6.2 Primary neuronal cultures
In order to study neuronal systems, I used cortex or hippocampal neurons obtained by
microdissection from BL6 wild-type E16.5 mice, the DBN-KO E16.5 mice generated in
the Eickholt lab, or P0-P1 Wistar rats. I established the long-term cultures (18-24 DIV)
in the Eickholt lab from both mouse embryos and rat pups. In the following section, I
describe the specific protocols needed to prepare and maintain neurons in culture.
1.6.2.1 Mouse primary neuronal cultures
Cortices or hippocampi were dissected from E16.5 C57BL/6 mice embryos. The
dissected tissue was then dissociated in 0.5 mg/ml trypsin in HBSS for 15 minutes at
37°C, washed twice in HBSS buffer, washed once in Neurobasal (NB) medium
supplemented with 1% GlutaMAX, 2% B27, 1% P/S, and 102.29 µM (1:100, and then
1:50 000 from stock solution) β-mercaptoethanol. Tissue was washed once in NB
supplemented with 10% Horse Serum, and gently triturated in culture medium using a
fire polished Pasteur pipette. Single cell suspension cells were plated on glass
coverslips (Assistent) previously coated with Poly-Ornithine 1:50 (stock concentration
1.5 µg/µl). Cultures were maintained in NB supplemented with 1% GlutaMAX, 2% B27
and 1% P/S at 37°C and 5% CO2. After 3 days, astrocyte conditioned medium (ACM)
was diluted in growing medium to a final concentration of 2x. Half the medium was
Materials and Methods
77
replaced every medium change, once a week. Neurons were plated at a density of 50
000 cells/well in 24 well plates (TTP), 150 000 cells/well in 12-well plates, or 300 000
cells/well in 6-well plates (TTP).
1.6.2.2 Rat models
Cortices or hippocampi were dissected from Winstar rats postnatal stages (P0-P1),
dissociated in papain (Worthington) according to the papain dissociation system kit
protocol. 20 000 hippocampal cells were plated on 35 mm glass-bottom (MatTek
Corporation) previously coated with 1:50 Poly-Ornithine (stock concentration 1.5
µg/µl). Two to four hours after plating the cells, 3 ml of the rat conditioned medium
were pipetted in every dish.
1.6.2.2.1 Growing medium
Neurobasal medium supplemented with 1% GlutaMAX, 2% B27 and 1% P/S, and
102.29 µM (1:100 and then 1:50000 from stock solution) β-mercaptoethanol.
1.6.2.2.2 Generation of conditioned medium
Conditioned medium was required for all the types of neurons in order to maintain them
in long term culture. For primary mouse neuronal cultures Astrocytes conditioned
medium was produced as described in the following section. To culture primary rat
neurons from postnatal rat animals, conditioned medium was used. To generate this
medium cortical and glial conditioned mediums were produced as described in the next
sections.
1.6.2.2.3 Astrocytes conditioned medium (ACM) for mouse primary cultures
Cortices were dissected from E16.5 C57BL/mice embryos, dissociated in 0.5 mg/ml
trypsin diluted in HBSS for 15 min at 37°C, washed twice in HBSS, washed once in
growing medium: Neurobasal medium supplemented with 1% GlutaMAX, 2% B27 and
1% P/S, and 102.29 µM (1:100 and then 1:50000 from stock solution) β-
mercaptoethanol. Single cell suspension cells were plated on glass coverslips
(Assistent) previously coated with 0.5% collage and grown in DMEM supplemented
with 10% FCS and 1 % P/S until confluent. Then, astrocytes were washed once in 1x
PBS and medium was replaced by Neurobasal (NB) medium supplemented with 1%
Materials and Methods
78
GlutaMAX, 2% B27 and 1% P/S, and 102.29 µM (1:100 and then 1:50000 from stock
solution) β-mercaptoethanol. Medium replacement and collection were performed
every 3 days.
1.6.2.2.4 Rat conditioned medium
This medium was prepared as follows: 80 % growing medium, 15% glial medium and
5% cortical medium.
1.6.2.2.5 Cortical conditioned medium for rat conditioned medium
In order to prepare cortical conditioned medium necessary for culturing P0-P1 rat
neurons, cortices were dissected from Wistar rats postnatal stages (P0-P1) dissociated
in papain (Worthington) according to the Papain dissociation system kit protocol.
Single cell suspension cells were plated in T75 flasks previously coated with 1:50 poly-
Ornithine (stock concentration 1.5 µg/µl) and grown in Neurobasal medium
supplemented with 1% GlutaMAX, 2% B27 and 1% P/S, and 102.29 µM (1:100 and
then 1:50000 from stock solution) β-mercaptoethanol. Medium was changed after two
days and a week later, before collection, which was done every 3 days.
1.6.2.2.6 Glial conditioned medium
Cortices were dissected from Wistar rats postnatal stages (P0-P1) dissociated in
papain according to the papain dissociation system kit protocol. Single cell suspension
cells were platted in T75 flasks previously coated with 0.5% collagen and growth in
Minimum Essential Medium (MEM) supplemented with 10% horse serum and 20%
glucose and 1% P/S until confluent. Then, medium is replaced with NB medium
supplemented with 1% GlutaMAX, 2% B27 and 1% P/S, and 102.29 µM (1:100 and
then 1:50000 from stock solution) β-mercaptoethanol. Medium collection was
performed every 3 days.
Materials and Methods
79
1.7 Treatments and cell transfection
In order to find regulatory inputs for DBN stability, cells were subjected to several treatments as described in the following section.
1.7.1 Transfection in multiple cell lines
SH-SY5Y, COS-7, N1E-115 or HEK293T cells were transfected 24 h after plating in
24 well (1.9cm2) on cover slips, 12 well plates (3.8cm2), or 6 well plates (9.5cm2) using
lipofectamine 2000 (Invitrogen), Opti-MEM as transfection reagent, and 1 µg, 1.5 µg,
or 3 µg of plasmid, respectively. The transfection mix was prepared as suggested in
the commercial Lipofectamine 2000 reagent protocol. Four hours after transfection the
medium was replaced with fresh medium, and cells were incubated overnight at 37°C
and 5% CO2 before cell fixation, cell lyses, or pulse labeling in pulse-chase
experiments.
1.7.2 Oxidative stress induction
Stock concentrations of H2O2, paraquat or β-Amyloid Peptide (1-42) (Calbiochem)
were prepared as follows. paraquat was dissolved in ddH2O to a stock concentration
of 500 µM. H2O2 was freshly dissolved in ddH2O to a stock concentration of 97 µM. Aβ
was dissolved in Hexafluoroisopropanol to a stock concentration of 60µM. 14 DIV
cortical neurons were treated with different concentrations of H2O2, paraquat or Aβ for
24 h, and were then lysed for Western blot (6-well/12-well plates), or were fixed for
immunocytochemistry (24-well plates).
1.7.3 Neuronal stimulation and network silencing
Neurons were treated with either 30 µM bicuculline to stimulate synaptic activity or TTX (1 µM) + APV (20 µM) to silence the network activity for the indicated time points.
Materials and Methods
80
1.8 Assays
Different classic assays such as SDS-page and western blot, as well as new assays,
such as FUNCAT-PLA, were applied in this work. A detailed explanation of how these
were performed is presented in this section.
1.8.1 SDS-PAGE and Western blotting (WB)
Neurons or cells were washed once with PBS and lysed in RIPA buffer supplemented
with protease inhibitor and phosphatase inhibitors as specified in the consumables
section. Equal amounts of protein were loaded in 8% acrylamide gels, transferred onto
nitrocellulose membranes and blocked for 1 h in TBS supplemented with 1% Tween
and 5% milk. Membranes were incubated 1 h in primary antibodies and washed three
times for 5 min with TBS-Tween. They were then incubated for 1 h in secondary
antibodies and washed three times for 5 min with TBS-Tween. Primary and secondary
antibodies were prepared in TBS-Tween 5% milk.
1.8.1.1 Membrane development and imaging
ECL western blotting substrate for membrane development was applied for 1 minute
and membranes were immediately developed with the system Fusion SL VILBER
LOURMAT and digital images were captured for further analyses. Quantification of
bands density was performed using ImageJ. The area of the band and the mean gray
value were measured to obtain a relative density. For relative quantifications,
measurements were normalized to loading control.
1.8.2 Lentiviral infection of DBN-KO neurons
Primary culture preparation was performed and 60 000 DBN-KO hippocampal neurons
were grown on covers lips previously coated with 1:50 poly-O (stock concentration 1.5
µg/µl). Neurons were infected with 50 µl of YFP-DBN or YFP lentiviruses after 2 DIV
and later fixed after 22 DIV. Description of the DBN-KO model generation and specifics
about the virus are described in the following section.
Materials and Methods
81
5.1.1.1 DBN knockout mice
The DBN knockout (DBN-KO) mice line was developed in the Eickholt lab. The DBN
knockout (DBN-KO) mice line was developed in the Eickholt lab. The Dbn1 mouse
strain was used for the development of this mouse model from the embyonic stem cell
clone. This clone, was obtained from KOMP Repository (www.komp.org) and the
mouse model was generated at the Welcome Trust Sanger Institut (Skarnes, Rosen
et.al.2011). The initial heterozygous mice holding a promoter-driven knockout allele
(Dbn1tm1a(KOMP)Wtsi) were acquired from the KOMP Repository. Gene-trap
cassette holding a constitutive null mutation was deleted after crossing with a FLP
strain. Pre-conditional allele was validated by PCR and sequencing by Dr. Till Mack in
the Eickholt Lab. This was followed by breading homozygote pre-conditional mice with
a Cre strain (B6.C-Tg(CMV-cre)1Cgn/J, Jackson Laboratories) for the generation of
homozygote null alleles and heterozygote null alleles. Genotyping with PCR was
performed using the following primers:
Genotyping Primers (5’-3’):
F4: CGCCGGAACCGAAGTTCCTATT (forward primer for KO-PCR upstream of β-
gal+ neo cassette)
F3: GAGGAGGTTAAAGGAGCAGTCTATCTTT (forward primer for WT-PCR end of
exon 6)
RS1: AGGAATACTCAAGTTCCTGTCGGACC (reverse primer between exon 6 and
exon 7)
5.1.1.2 YFP-virus
DBN-A wild-type-YFP and YFP lentiviruses with a synapsin promoter were generated
by Dr. Till Mack (Eickholt Lab) and are based on pLenti6.3 backbone (Thermo
Scientific).
1.8.3 Immunocytochemistry
Neurons or cells were fixed with 4% PFA, 4% sucrose or 4% paraformaldehyde (PFA),
respectively for 20 min, washed three times with PBS, permeabilized for 15 min in 0.5%
Materials and Methods
82
triton in PBS-MC (PH7,4) and blocked for 1 h or overnight in 4% goat serum.
Coverslips were incubated with primary antibodies for 1 h at room temperature,
washed three times for 5 min with PBS, incubated with secondary antibodies for 1 h at
room temperature and washed three times with PBS. Coverslips were incubated with
Hoechst (1:50000 dilution) for 10 min and mounted using Mowiol. Primary and
secondary antibodies were diluted in blocking solution. Antibodies were prepared in
4% goat serum as follows: Drebrin (mouse monoclonal [M2F6], GenTex) 1:200, α-
tubulin (mouse monoclonal antibody, Sigma Aldrich) 1: 400, α–tubulin (rat monoclonal
[YL1/2] Abcam) 1:50. Secondary antibodies anti-mouse alexa 568, anti-mouse alexa
488 and anti-rat alexa 568 (Invitrogen) were prepared in a dilution of 1:1000 in PBS
2% BSA, 1% goat serum and 1% Sodium azide.
1.8.4 Pulse-chase experiments in 293T cells
150 000 cells (HEK293-T) were plated on poly-ornithine coated 12-well plates and
growth in DMEM medium supplemented with 10% FCS and 1% P/S for 24 h at 37°C
and 5% CO2. After 24 h the cells were transfected with Lipofectamine using 1.5 µg of
plasmid DNA. Twenty four hours after transfection, cells were washed in pre-warmed
methionine free DMEM medium supplemented with 10% FCS and 1% P/S. Cells were
incubated for 1 h. Later, the medium was replaced by labeling medium: 1 mM
azidohomoalanine (AHA) in methionine free DMEM medium supplemented with 10%
FCS and 1% P/S. Cells were pulse-labeled for 1 h, washed once in complete medium
and twice in PBS, and followed by cell lyses (no chase) or chase for: 24 h, 48 h and
72 h in complete medium before cell lyses. Cells were lysed in 150 µl of RIPA buffer
supplemented with 1x protease inhibitor cocktail and 1x phosphatase inhibitors. Click-
chemistry in the protein lysates was then performed.
1.8.5 Click-chemistry protein lysates
100 µl of cell lyses were collected and click-chemistry was performed using the Click-
it Protein reaction buffer kit as suggested in the protocol provided. Cycloaddition was
used with biotin-alkyne and precipitated protein was re-suspended in 1x Roti-Load
sample buffer for western blot analyses. Labeled proteins were detected with
Streptavidin-HRP (1:1500) and later stripped for 30 min at 45°C to further blot with anti-
Flag 1:100,000. As loading control anti-α-Tubulin was used.
Materials and Methods
83
1.8.6 FUNCAT-PLA
Between 30 000-50 000 hippocampal rat neurons were plated on poly-ornithine coated
35 mm glass-bottom (MatTek Corporation) and growth in rat conditioned medium (see
section 2.3.2.4). 18-21 DIV neurons were incubated for 2 h with Neurobasal A-Met free
+ 1% glutaMax, 2% B27 and 4 mM AHA, 40 µM Anisomycin (Aniso) or Methionine
(Met). Conditioned medium for each plate was kept in the incubator during pulse-
labeling to be re-used during the chase. After pulse-labeling with AHA or Met-control,
cells were washed twice with PBS-MC (pH 7.4) and fixed with 4% PFA 4% Sucrose in
PBS-MC (PH 7.4) (no chase) or chase in own medium for: 24 h or 68 h. Time points
were coordinated to end at the same time. Fixed cells were permeabilized for 15 min
with 0.5% triton in PBS-MC (pH 7.4), blocked for 1 h in 4% goat serum in PBS (pH 7.4)
and washed twice with PBS pH 7.8 before click-chemistry.
Click-chemistry reaction for FUNCAT-PLA (1 reaction)
1 ml PBS, pH 7.8
1 µl of triazole ligand stock (Stock 200mM)
1 µl of freshly prepared TCEP (500mM)
0.5 µl biotin-alkyne (Stock 50mM)
1 µl CuSO4 solution (200mM)
Cells were incubated in the click-chemistry reaction at room temperature overnight and
then a second permeabilization step was performed in 15 min with 0.5% triton in PBS-
MC (pH 7.4). Cells were washed twice with PBS-MC (pH 7.4) and blocked for 1h in 4
% goat serum in PBS (pH 7.4). Incubation with primary antibodies was followed and
performed for 1.5 h at room temperature. Antibodies were prepared in blocking buffer
at indicated dilutions (See table 1). DBN (mouse monoclonal [M2F6]) antibody was
always used in these experiments.
1.8.7 High-resolution fluorescence in situ hybridization (Panomics probes)
These experiments were fully performed in the Schuman Lab. To do so, high-resolution
fluorescence in situ hybridization probes were designed to detect DBN mRNA in rat
neurons. Hippocampal rat neurons (21-24 DIV) were fixed with PFA-sucrose and
Materials and Methods
84
permeabilized before target hybridization. The FISH protocol was followed exactly as
suggested in the Afimetrix kit manual (QuantiGene ViewRNA Cell Assay User Manual;
P/N 1880).
The procedure consisted of three main steps:
• Fixing cells and hybridization (in this step the transcript-specific probe is
applied).
• Amplification (in this step the signal is amplified).
• Antibody staining (MAP2 and phalloidin in this work).
1.8.8 Puromycilation (Puro)
For puromycilation, neurons or N1E-115 cells were incubated with 1 µM (for PLA) or 4
µM (for WB) puromycin or without puromycin as a control for 3 or 5 min (as indicated),
in medium at 37 °C in an incubator with 5% CO2. After incubation, two fast washes
with pre-warmed PBS-MC were performed and cells were either fixed for 20 min in
PFA-sucrose or lysed in RIPA buffer for WB analyses. In neurons, the medium in
which they were grown was always used for any drug treatments. As a protein
synthesis inhibitor 40 µM anisomycin was applied 30 min to 1 h before puromycilation
and in the presence of puromycin.
After fixation, cells were washed with PBS, permeabilized for 15 min with 0.5% triton
in PBS-MC (pH 7.4), blocked for 1 h in 4% goat serum in PBS (pH 7.4) and followed
by the proximity ligation assay as described in section 2.3.6 using the puromycin and
rabbit polyclonal DBN (homemade; Eickholt Lab) antibodies for 1.5h at room
temperature (see table 1 for antibody dilutions).
After cell lyses, samples were centrifuged, prepared as described in section 2.3.1, and
analyzed with the puromycin antibody.
1.8.9 Proximity ligation assay (PLA)
This assay was applied for FUNCAT-PLA, Puro-PLA and PLA experiments modifying
the antibodies as needed. This protocol was optimized following the directions of the
Duolink In Situ manual and as described in the following section.
Materials and Methods
85
After primary antibody incubation, cells were washed three times for 5 min with PBS
(pH 7.4) and incubated for 1 h at 37°C with freshly prepared PLA-probes (1:10) in a
semi-wet chamber.
PLA probes (1 reaction = 80 µl)
8 µl PLA + (Probe Anti-Rabbit PLUS)
8 µl PLA – (Probe Anti-Mouse MINUS)
64 µl blocking buffer
After incubation with the PLA probes, cells were washed three times for 5 min with
washing buffer A. Ligation was performed for 30 min at 37°C in a semi-wet chamber.
Ligation (1 reaction = 80 µl)
16 µl ligation-stock (PLA kit)
5 µl ligase
62 µl H2O
After ligation, two washing steps with washing buffer A were performed, the
amplification reaction was prepared and cells were incubated for 100 min at 37°C in
this solution.
Amplification (1 reaction = 80 µl)
16 µl amplification-stock (PLA kit)
1 µl polymerase
63 µl H2O
After amplification, two immediate washing steps with washing buffer B were
performed followed by two of 10 min each, one with 0.01x washing buffer B and one
with PBS. Finally, cells were incubated for 10 min with 4% PFA 4% sucrose in PBS for
a second fixation step. The last step in this protocol is the staining of neurons with the
MAP2 neuronal marker. For this purpose, cells were incubated in blocking solution
overnight at 4°C and incubated with the MAP2 antibody for 1.5 h at room temperature.
After three washing steps with PBS, cells were incubated with anti-guinea pig antibody
Materials and Methods
86
for 1h and further washed three times with PBS. Finally, nuclear staining was
performed with Hoechst for 5 min and washed with PBS. Cells were maintained in PBS
at 4°C until imaging.
1.9 Image-acquisition
In the Eickholt Lab, the images of cells were captured using a Confocal Laser Scanning
Microscope Leica TCS SP8 using a 63x oil objective. Images were acquired with a
resolution of 1024 x 1024 pixels through the entire sample as z-stacks size 0.5 µm.
Laser intensities and gain were defined for every experiment and maintained without
changes within an experiment.
In the Schuman Lab, the images were captured using a LSM780 confocal microscope
(Zeiss) using a 40x oil objective. Images were acquired with a resolution of 1024 x
1024 pixels through the entire sample as z-stacks size 0.5 µm. Laser intensities and
gain were defined for every experiment and maintained without changes within an
experiment.
1.10 Analyses and statistical tests
1.10.1 Data normalization and calculations
To plot the data obtained from the pulse-chase experiments, we reasoned that at the
time point 0 h chase, maximum protein labeling has been achieved. Therefore, we
normalized the data considering AHA 0 h as 100%. In pulse chase experiments with
293T cells protein half-lives were calculated individually for every experiment using the
exponential decay equation from the curves (0 h and 72 h chase) from multiple
experiments (n ≥ 3) and later mean values between half-lives were obtained. However,
in pulse chase experiments in neurons the protein half-live for DBN was calculated
using the exponential equation from the curve from three independent experiments.
Data was always normalized as percentage of control.
T-tests were applied in all cases and P-values were indicated on every figure. The
standard error of the means (SEMs) were calculated and are represented in the error
bars of the bar plots presented in the results section.
Materials and Methods
87
1.10.2 Image analyses
Five to ten images per condition were captured and processed for analysis in FIJI
(Schindelin et al., 2012). Maximal projections were used for all quantitative analyses.
All the images obtained from the FUNCAT-PLA, Puro-PLA and Panomics experiments
were analyzed using our customize Plugin for PLA. The details for this plugin are
explained in the results section X since this was part of the thesis work and the detailed
script in the supplemental information section. Overall, PLA puncta and the area these
occupied were quantified on a mask for a cell volume marker. In neurons: MAP2 and
in N1E-115 cells: actin-stain. All the puncta not overlapping or in the close proximity
with the respective cell volume marker were excluded from the analyses. Finally, PLA
to cell volume marker ratios were calculated and experimental conditions were always
normalized as percentage of control. The signal from a whole image was considered
as the total or global signal in the case of further analyses to compare soma and
dendrites.
1.10.3 Dendrites and soma PLA/Panomics analyses
A plugin to manually select the Soma in neurons was also developed for the analyses
of this work (see supplemental figures for script). After selection of soma on a specific
image, a subfolder was automatically created where the storage of soma pictures were
kept. PLA analyses were later run on the specific folder and results were further
analyzed in Excel. The following calculations were performed to quantify the signal
along dendrites:
PLAglobal – PLAsoma/ MAP2global – MAP2soma = Dendrites signal
References
88
6 References Ackermann, M., and Matus, A. (2003). Activity-induced targeting of profilin and stabilization of dendritic spine morphology. Nat. Neurosci. 6, 1194–1200.
Aoki, C., Kojima, N., Saballauskas, N., and Al., E. (2009). Drebrin A Knockout Eliminates the Rapid Form of Homeostatic Synaptic Plasticity Excitatory synapses of Intac Adult Cerebral Cortex. J Comp Neurol. 517, 105–121.
Ballif, B.A., Villén, J., Beausoleil, S.A., Schwartz, D., and Gygi, S.P. (2004). Phosphoproteomic analysis of the developing mouse brain. Mol. Cell. Proteomics MCP 3, 1093–1101.
Beausoleil, S.A., Bakalarski, C.E., Elledge, S.J., Dephoure, N., Zhou, C., Ville, J., and Gygi, S.P. (2008). A quantitative atlas of mitotic phosphorylation ´. PNAS 105.
Blenis, X.M. and J. (2009). Molecular mechanisms of mTOR-mediated translational control. Nat.Rev.Mol.Cell Biol. 10, 307–318.
Briz, V., Hsu, Y.-T., Li, Y., Lee, E., Bi, X., and Baudry, M. (2013). Calpain-2-Mediated PTEN Degradation Contributes to BDNF-Induced Stimulation of Dendritic Protein Synthesis. J. Neurosci. 33, 4317–4328.
Cajigas, I.J., Tushev, G., Will, T.J., Tom Dieck, S., Fuerst, N., and Schuman, E.M. (2012). The Local Transcriptome in the Synaptic Neuropil Revealed by Deep Sequencing and High-Resolution Imaging. Neuron 74, 453–466.
Chew, C.S., Okamoto, C.T., Chen, X., and Thomas, R. (2005). Drebrin E2 is differentially expressed and phosphorylated in parietal cells in the gastric mucosa. Am. J. Physiol. Gastrointest. Liver Physiol. 289, G320–G331.
Chimura, T., Launey, T., and Yoshida, N. (2015). Calpain-Mediated Degradation of Drebrin by Excitotoxicity In vitro and In vivo. PLoS One 10, e0125119.
Cingolani, L.A., and Goda, Y. (2008). Actin in action: the interplay between the actin cytoskeleton and synaptic efficacy. Neuroscience 9.
Cohen, L.D., Zuchman, R., Sorokina, O., Müller, A., Dieterich, D.C., Armstrong, J.D., Ziv, T., and Ziv, N.E. (2013). Metabolic Turnover of Synaptic Proteins: Kinetics, Interdependencies and Implications for Synaptic Maintenance. PLoS One 8, e63191.
Costa-Mattioli, M., Sossin, W.S., Klann, E., and Sonenberg, N. (2009). Translational control of long-lasting synaptic plasticity and memory. Neuron 61, 10–26.
Counts, S.E., He, B., Nadeem, M., Wuu, J., Scheff, S.W., and Mufson, E.J. (2012). Hippocampal drebrin loss in mild cognitive impairment. Neurodegener. Dis. 10, 216–219.
Dieterich, D.C., Link, A.J., Graumann, J., Tirrell, D.A., and Schuman, E.M. (2006). Selective identification of newly synthesized proteins in mammalian cells using
References
89
bioorthogonal noncanonical amino acid tagging (BONCAT). Proc. Natl. Acad. Sci. U. S. A. 103, 9482–9487.
Dieterich, D.C., Hodas, J.J.L., Gouzer, G., Shadrin, I.Y., Ngo, J.T., Triller, A., Tirrell, D. a, and Schuman, E.M. (2010). In situ visualization and dynamics of newly synthesized proteins in rat hippocampal neurons. Nat. Neurosci. 13, 897–905.
Doherty, M.K., and Beynon, R.J. (2006). Protein turnover on the scale of the proteome. Expert Rev. Proteomics 3, 97–110.
Doré, S., Takahashi, M., Ferris, C.D., Zakhary, R., Hester, L.D., Guastella, D., and Snyder, S.H. (1999). Bilirubin, formed by activation of heme oxygenase-2, protects neurons against oxidative stress injury. Proc. Natl. Acad. Sci. U. S. A. 96, 2445–2450.
Engert, F., and Bonhoeffer, T. (1999). Dendritic spine changes associated with hippocampal long-term synaptic plasticity. Nature 399, 66–70.
Garner, C.C., Tucker, R.P., and Matus, a (1988). Selective localization of messenger RNA for cytoskeletal protein MAP2 in dendrites. Nature 336, 674–677.
Grintsevich E. Elena, et. al. (2010). Mapping of Drebrin Binding Site on F-Actin. J Mol Biol 398, 542–554.
Guo, C., Zhang, Y.X., Wang, T., Zhong, M.L., Yang, Z.H., Hao, L.J., Chai, R., and Zhang, S. (2015). Intranasal deferoxamine attenuates synapse loss via up-regulating the P38/HIF-1?? pathway on the brain of APP/PS1 transgenic mice. Front. Aging Neurosci. 7, 1–12.
Hamilton, A.M., Oh, W.C., Vega-ramirez, H., Stein, I.S., Hell, J.W., Patrick, G.N., and Zito, K. (2012). Activity-Dependent Growth of New Dendritic Spines Is Regulated by the Proteasome. Neuron 74, 1023–1030.
Harigaya, Y., and Shoji, M. (1996). Disappearance of actin-binding protein, drebrin, from hippocampal synapses in alzheimer’s disease. J. Neurosci. … 92.
Hayashi, K., and Shirao, T. (1999). Change in the shape of dendritic spines caused by overexpression of drebrin in cultured cortical neurons. J. Neurosci. 19, 3918–3925.
Hayashi, K., Suzuki, K., and Shirao, T. (1998). Rapid conversion of drebrin isoforms during synapse formation in primary culture of cortical neurons. Brain Res. Dev. Brain Res. 111, 137–141.
Hu, C.D., Chinenov, Y., and Kerppola, T.K. (2002). Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Mol. Cell 9, 789–798.
Ishikawa, R., Hayashin, K., Shiraon, T., Takagill, T., and Kohamas, K. (1994). Drebrin, a Development-associated Brain Protein from Rat embryo Causes the dissociation of Tropomysin from Actin Filaments. J. Biol. Chem. 269, 29928–29933.
References
90
Ivanov, A., Esclapez, M., and Ferhat, L. (2009a). Role of drebrin A in dendritic spine plasticity and synaptic function. Am. J. Hum. Genet. 2, 268–270.
Ivanov, A., Escalpez, M., Pellegrino, C., and Et.al (2009b). Drebrin A regulates dendritic spine plasticity and synaptic function in mature cultured hippocampal neurons. J. Cell Sci. 122, 524–534.
Jares-Erijman, E. a, and Jovin, T.M. (2003). FRET imaging. Nat Biotechnol 21, 1387–1395.
Jin, M., Tanaka, S., Sekino, Y., Ren, Y., Yamazaki, H., Kawai-Hirai, R., Kojima, N., and Shirao, T. (2002). A novel, brain-specific mouse drebrin: cDNA cloning, chromosomal mapping, genomic structure, expression, and functional characterization. Genomics 79, 686–692.
Jung, G., Kim, E.J., Cicvaric, A., Sase, S., Gröger, M., Höger, H., Sialana, F.J., Berger, J., Monje, F.J., and Lubec, G. (2015). Drebrin depletion alters neurotransmitter receptor levels in protein complexes, dendritic spine morphogenesis and memory-related synaptic plasticity in the mouse hippocampus. J. Neurochem. 134, 327–339.
Kang, H., Jia, L.Z., Suh, K.Y., Tang, L., and Schuman, E.M. (1996). Determinants of BDNF-induced hippocampal synaptic plasticity: role of the Trk B receptor and the kinetics of neurotrophin delivery. Learn. Mem. 3, 188–196.
Klein, J.A., and Ackerman, S.L. (2003). Oxidative stress , cell cycle , and neurodegeneration. 111, 785–793.
Kojima, N., Shirao, T., and Obata, K. (1993). Molecular cloning of a developmentally regulated brain protein, chicken drebrin A and its expression by alternative splicing of the drebrin gene. Mol. Brain Res. 19, 101–114.
Kojima, N., Hanamura, K., Yamazaki, H., Ikeda, T., Itohara, S., and Shirao, T. (2010). Genetic disruption of the alternative splicing of drebrin gene impairs context-dependent fear learning in adulthood. Neuroscience 165, 138–150.
Kojima, N., Yasuda, H., Hanamura, K., Ishizuka, Y., Sekino, Y., and Shirao, T. (2016). Drebrin A regulates hippocampal LTP and hippocampus-dependent fear learning in adult mice. Neuroscience 324, 218–226.
Kreis, P., Hendricusdottir, R., Kay, L., Papageorgiou, I.E., van Diepen, M., Mack, T., Ryves, J., Harwood, A., Leslie, N.R., Kann, O., et al. (2013). Phosphorylation of the Actin Binding Protein Drebrin at S647 Is Regulated by Neuronal Activity and PTEN. PLoS One 8, e71957.
Lee, M.-S., Jeong, M.-H., Lee, H.-W., Han, H.-J., Ko, A., Hewitt, S.M., Kim, J.-H., Chun, K.-H., Chung, J.-Y., Lee, C., et al. (2015). PI3K/AKT activation induces PTEN ubiquitination and destabilization accelerating tumourigenesis. Nat. Commun. 6, 7769.
References
91
Lyford, G.L., Yamagata, K., Kaufmann, W.E., Barnes, C. a., Sanders, L.K., Copeland, N.G., Gilbert, D.J., Jenkins, N. a., Lanahan, A. a., and Worley, P.F. (1995). Arc, a growth factor and activity-regulated gene, encodes a novel cytoskeleton-associated protein that is enriched in neuronal dendrites. Neuron 14, 433–445.
Mammoto, A., Sasaki, T., Asakura, T., Hotta, I., Imamura, H., Takahashi, K., Matsuura, Y., Shirao, T., and Takai, Y. (1998). Interactions of Drebrin and Gephyrin with Profilin 1. 89, 86–89.
Martin, K.C., and Zukin, R.S. (2006). RNA trafficking and local protein synthesis in dendrites: an overview. J. Neurosci. 26, 7131–7134.
Mizui, T., Takahashi, H., Sekino, Y., and Shirao, T. (2005). Overexpression of drebrin A in immature neurons induces the accumulation of F-actin and PSD-95 into dendritic filopodia, and the formation of large abnormal protrusions. Mol. Cell. Neurosci. 30, 630–638.
Molina, H., Horn, D.M., Tang, N., Mathivanan, S., and Pandey, A. (2007). Global proteomic profiling of phosphopeptides using electron transfer dissociation tandem mass spectrometry. Database 104, 2199–2204.
Olsen, J. V, Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P., and Mann, M. (2006). Global, In Vivo, and Site-Specific Phosphorylation Dynamics in Signaling Networks. Cell 127, 635–648.
Ostroff, L.E., Fiala, J.C., Allwardt, B., and Harris, K.M. (2002). Polyribosomes redistribute from dendritic shafts into spines with enlarged synapses during LTP in developing rat hippocampal slices. Neuron 35, 535–545.
Pilarski, R., Stephens, J. a., Noss, R., Fisher, J.L., and Prior, T.W. (2011). Predicting PTEN mutations: an evaluation of Cowden syndrome and Bannayan-Riley-Ruvalcaba syndrome clinical features. J. Med. Genet. 48, 505–512.
Ramalingam, M., and Kim, S. (2011). Reactive oxygen/nitrogen species and their functional correlations in neurodegenerative diseases. J. Neural Transm.
Rush, J., Moritz, A., Lee, K.A., Guo, A., Goss, V.L., Spek, E.J., Zhang, H., Zha, X.M., Polakiewicz, R.D., and Comb, M.J. (2005). Immunoaffinity profiling of tyrosine phosphorylation in cancer cells. Nat. Biotechnol. 23, 94–101.
Santini, E., Huynh, T.N., and Klann, E. (2014). Mechanisms of translation control underlying long-lasting synaptic plasticity and the consolidation of long-term memory (Elsevier Inc.).
Santini, E., Turner, K.L., Ramaraj, A.B., Murphy, M.P., Klann, E., and Kaphzan, H. (2015). Mitochondrial Superoxide Contributes to Hippocampal Synaptic Dysfunction and Memory Deficits in Angelman Syndrome Model Mice. J. Neurosci. 35, 16213–16220.
References
92
Sasaki, Y., Hayashi, K., Shirao, T., Ishikawa, R., and Kohama, K. (1996). Inhibition by Drebrin of the Actin-Bundling Activity of Brain Fascin, a Protein Localized in Filopodia of Growth Cones. 980–988.
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682.
Schuman, E.M. (1999). mRNA trafficking and local protein synthesis at the synapse. Neuron 23, 645–648.
Sekino, Y., Kojima, N., and Shirao, T. (2007). Role of actin cytoskeleton in dendritic spine morphogenesis. Neurochem. Int. 51, 92–104.
Shim, K., and Lubec, G. (2002). Drebrin, a dendritic spine protein, is manifold decreased in brains of patients with Alzheimer’s disease and Down syndrome. Neurosci. Lett. 324, 209–212.
Shiraishi-Yamaguchi, Y., Sato, Y., Sakai, R., Mizutani, A., Knöpfel, T., Mori, N., Mikoshiba, K., and Furuichi, T. (2009). Interaction of Cupidin/Homer2 with two actin cytoskeletal regulators, Cdc42 small GTPase and Drebrin, in dendritic spines. BMC Neurosci. 10.
Shirao, T., and Obata, K. (1985). Two acidic proteins associated with brain development in chick embryo. J. Neurochem. 44, 1210–1216.
Shirao, T., Inoue, H.K., Kano, Y., and Obata, K. (1987). Localization of a developmentally regulated neuron-specific protein S54 in dendrites as revealed by immunoelectron microscopy. Brain Res. 413, 374–378.
Söderberg, O., Mats, G., Jarvius, M., and Karin, R. (2006). Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat. Methods 3, 995–1000.
Takahashi, H., Mizui, T., and Shirao, T. (2006). Down-regulation of drebrin A expression suppresses synaptic targeting of NMDA receptors in developing hippocampal neurones. J. Neurochem. 97, 110–115.
Toda M. et.al. (1993). Molecular cloning of cDNA Encoding Human Drebrin E and Chromosomal Mapping of its Gene. 468–472.
Tom Dieck, S., Hanus, C., and Schuman, E.M. (2014). SnapShot: Local Protein Translation in Dendrites. Neuron 81, 958–958.e1.
Tom Dieck, S., Kochen, L., Hanus, C., Heumüller, M., Bartnik, I., Nassim-Assir, B., Merk, K., Mosler, T., Garg, S., Bunse, S., et al. (2015). Direct visualization of newly synthesized target proteins in situ. Nat. Methods 1–7.
Tongiorgi, E., Righi, M., and Cattaneo, a (1997). Activity-dependent dendritic targeting of BDNF and TrkB mRNAs in hippocampal neurons. J. Neurosci. 17, 9492–9505.
References
93
Vosseller, K., Hansen, K.C., Chalkley, R.J., Trinidad, J.C., Wells, L., Hart, G.W., and Burlingame, A.L. (2005). Quantitative analysis of both protein expression and serine/threonine post-translational modifications through stable isotope labeling with dithiothreitol. Proteomics 388–398.
Wang, X., Zaidi, A., Pal, R., Garrett, A.S., Braceras, R., Chen, X., Michaelis, M.L., and Michaelis, E.K. (2009). BMC Neuroscience. BMC Neurosci. 20, 1–20.
Wollscheid, B., Eng, J.K., Li, X., Bodenmiller, B., Watts, J.D., Hood, L., and Aebersold, R. (2005). Quantitative phosphoproteome analysis using a dendrimer conjugation chemistry and tandem mass spectrometry. Nat. Methods 2, 591–598.
Yi, J.J., and Ehlers, M.D. (2005). Ubiquitin and protein turnover in synapse function. Neuron 47, 629–632.
Zheng, H., Hu, P., Quinn, D.F., and Wang, Y.K. (2005). Phosphotyrosine proteomic study of interferon alpha signaling pathway using a combination of immunoprecipitation and immobilized metal affinity chromatography. Mol. Cell. Proteomics MCP 4, 721–730.
Supplemental information
94
7 Supplemental information 7.1 Supplementary data
In this section I include the codes generated by Viktor Dinkel for the FIJI Plugin Script that I applied for the PLA data analyses. Three codes are shown: PLA analysis, PLA dendrites and PLA soma.
7.1.1 PLA analysis script
import ij.plugin.PlugIn; import ij.IJ; import ij.ImagePlus; import ij.gui.GenericDialog; import ij.process.ImageProcessor; import ij.plugin.Duplicator; import ij.plugin.filter.Analyzer; import ij.measure.ResultsTable; import java.io.File; import ij.io.Opener; import java.util.List; import java.util.ArrayList; import java.io.PrintWriter; import java.io.FileWriter; public class PLA_Analysis extends ImagePlus implements PlugIn { // STRING FOR OS public static String os_system = ""; public static String os_slash = ""; /////////// ---------- CONFIGURATION public static Double areaMaxValue = 9999999.0; // AREA UPPER BOUND FOR MAX PLA-SIZE public static Boolean fixedThreshold = true; // SET TO 0 IF YOU WANT TO DEFINE IT AUTOMATICALLY, OTHERWISE YOUR FIXED VALUE WILL BE USED public static Integer autoThreshold = 0; public static String map2ThresholdMethod; /////////// -------------------------------------------- public static String version = "0.86"; public static String path = ""; public static String pathChannels; public static String pathAnalysis; public static ArrayList<String> imageFiles; public static ArrayList<String> plaResults; // Format of singleResults:
Supplemental information
95
public static Integer headerElements; public static ArrayList<String> csvHeader; public static String singleResults; public static String allResults; public static Integer plaThreshold; public static Double map2Area; public static Double plaArea; public static Double totalIntDen; public static Double maxIntDen; public static Double minIntDen; public static Double sumMAP2Area; public static Double sumPLAArea; public static Double sumIntDen; public static Integer countedAreas; public static Integer numAreas; public void run(String arg) { // Initialization imageFiles = new ArrayList<String>(); plaResults = new ArrayList<String>(); headerElements = 7; csvHeader = new ArrayList<String>(); singleResults = ""; allResults = ""; plaThreshold = 70; map2Area = 0.0; plaArea = 0.0; sumMAP2Area = 0.0; sumPLAArea = 0.0; countedAreas = 0; numAreas = 0; totalIntDen = 0.0; maxIntDen = 0.0; minIntDen = 99999999.99; sumIntDen = 0.0; os_system = System.getProperty("os.name"); if (os_system.contains("Mac")) os_slash = "/"; else os_slash = "\\"; IJ.log("-----------------[ Start PLA_Analysis V"+version+" ]-----------------"); IJ.log("System information: "+os_system+" separator: "+os_slash); path = IJ.getDirectory("Choose Directory of Image File(s)"); IJ.log("- Directory: "+path); // Ask for automatic/fixed MAP2-threshold GenericDialog gd_map = new GenericDialog("MAP2-Threshold");
Supplemental information
96
gd_map.addMessage("Do you want to define a fixed MAP2-threshold for all files? \n\n\nSet the value to 0 if the threshold has to be defined automatically for each image. "); gd_map.addNumericField("Threshold: ", autoThreshold, 0); gd_map.showDialog(); if (gd_map.wasCanceled()) return; autoThreshold = Math.max(0,Math.min((int)gd_map.getNextNumber(),254)); if (autoThreshold == 0) {fixedThreshold = false; map2ThresholdMethod = "Auto";} else {fixedThreshold = true; map2ThresholdMethod = autoThreshold.toString();} // Ask for automatic/fixed MAP2-threshold GenericDialog gd_pla = new GenericDialog("PLA-Threshold"); gd_pla.addMessage("Change the Number if you want a different PLA-threshold for all files. Otherwise click OK."); gd_pla.addNumericField("Threshold: ", plaThreshold, 0); gd_pla.showDialog(); if (gd_pla.wasCanceled()) return; plaThreshold = Math.max(0, Math.min((int)gd_pla.getNextNumber(),254)); final File folder = new File(path); imageFiles = listFilesForFolder(folder); createPaths(path); // Create the subfolders String imageName; IJ.log("---------------------- Start processing images"); String HTMLString = ""; for (int i=0; i<imageFiles.size(); i++){ plaArea = 0.0; map2Area = 0.0; totalIntDen = 0.0; maxIntDen = 0.0; minIntDen = 99999999.99; imageName = imageFiles.get(i); if (csvHeader.size() < headerElements) csvHeader.add("imagename"); singleResults += imageName+";"; IJ.log("Image: "+imageName); processImage( imageName ); measureImage( imageName ); resetAll(); if (i<imageFiles.size()-1) IJ.log("------------------------------"); sumMAP2Area += map2Area; sumPLAArea += plaArea; sumIntDen += (totalIntDen/countedAreas); HTMLString = makeHTML(i, imageName, false, HTMLString);
Supplemental information
97
allResults = allResults + singleResults+"\n"; singleResults=""; } makeHTML(0, "", true, HTMLString); writeCSS(); writeCSV(); System.gc(); IJ.log("-----------------[ End PLA-Plugin ]-----------------"); return; } public String convertToPNG(String imageName){ String pathHTML = path+"pla"+os_slash+"HTML"+os_slash; //IJ.log(pathHTML); Boolean success = (new File(pathHTML)).mkdirs(); if (!imageName.substring(imageName.length()-4).toLowerCase().equals(".png")) { //ImagePlus imp = IJ.openImage(path+"\\"+imageName); ImagePlus imp = IJ.openImage(path+"/"+imageName); imageName = imageName.substring(0, imageName.length()-4)+".png"; IJ.saveAs(imp, "png", pathHTML+imageName); IJ.log("... converted to .png "); } return imageName; } public ArrayList<String> listFilesForFolder(final File folder) { ArrayList<String> dirFiles = new ArrayList<String>(); ArrayList<String> fileFormats = new ArrayList<String>() {{ add(".jpg"); add(".tif"); add(".png"); add(".gif"); add(".bmp"); }}; Integer k = 0; for (final File fileEntry : folder.listFiles()) { if (fileEntry.isDirectory()) { //this is for recursive search of the directory //listFilesForFolder(fileEntry); //IJ.log("Skipped directory: "+fileEntry.getName()); } else { String fileName = fileEntry.getName(); for (int i=0; i<fileFormats.size(); i++){ if (fileName.contains(fileFormats.get(i))){ // replace spaces if (fileName.contains(" ")){ File newFile = new File(path+fileName.replace(" ", "_")); fileEntry.renameTo(newFile);
Supplemental information
98
fileName = fileName.replace(" ", "_"); } // convert the image into png-format IJ.log("start converting file: "+fileName); convertToPNG(fileName); //if the image is not added for processing if (!dirFiles.contains(fileName)) { IJ.log("_"+k.toString()+". Image-File: "+fileName); dirFiles.add(fileName); } k++; break; } } } } return dirFiles; } public void createPaths(String thispath){ pathChannels = thispath + "pla"+os_slash+"temp"+os_slash+"channels"; pathAnalysis = thispath + "pla"+os_slash+"analysis"; Boolean success = (new File(pathChannels)).mkdirs(); Boolean success2 = (new File(pathAnalysis)).mkdirs(); } public void processImage( String imageName ){ splitChannels( imageName ); maskMAP2(imageName); maskPLA(); return; } public void measureImage( String imageName ){ plaArea = measurePLA( imageName ); map2Area = measureMAP2( imageName ); return; } public void splitChannels( String imageName ){ ImagePlus imp = IJ.openImage(path+imageName); IJ.run(imp, "Split Channels", ""); IJ.log("SAVING CHANNELS AT: "+pathChannels); IJ.selectWindow(imageName+" (green)"); IJ.saveAs("TIF", pathChannels+os_slash+"green.tif"); IJ.selectWindow(imageName+" (blue)"); IJ.saveAs("TIF", pathChannels+os_slash+"blue.tif");
Supplemental information
99
IJ.selectWindow(imageName+" (red)"); IJ.saveAs("TIF", pathChannels+os_slash+"red.tif"); IJ.run("Close All", ""); return; } public void maskMAP2( String imageName ){ IJ.log("MASKING MAP 2 :" +imageName); ImagePlus imp = IJ.openImage(pathChannels+os_slash+"green.tif"); imp.show(); ImageProcessor ip = imp.getProcessor(); Integer thisThreshold; if (!fixedThreshold){ thisThreshold = ip.getAutoThreshold();} else{ thisThreshold = autoThreshold;} if (csvHeader.size() < headerElements) csvHeader.add("map2-thr;pla-thr"); singleResults += String.valueOf(thisThreshold)+";"; singleResults += String.valueOf(plaThreshold)+";"; IJ.log("- MAP2-Threshold (Mask): "+thisThreshold.toString()); IJ.setThreshold(imp, 0, thisThreshold); IJ.run("Threshold", "thresholded remaining black slice"); IJ.run(imp, "Convert to Mask", ""); IJ.run(imp, "Dilate", ""); ImagePlus imp2 = new Duplicator().run(imp); IJ.saveAs("png", pathAnalysis+os_slash+"DIL_MASK_"+imageName.replace(".tif","")+".png"); imp.close(); imp2.show(); return; } public void maskPLA(){ ImagePlus imp = IJ.openImage(pathChannels+os_slash+"red.tif"); imp.show(); IJ.setThreshold(imp, 0, plaThreshold); IJ.run("Threshold", "thresholded remaining black slice"); IJ.run(imp, "Convert to Mask", ""); IJ.run(imp, "Create Mask", ""); imp.close(); return;
Supplemental information
100
} public Double measurePLA(String imageName){ //ImagePlus dilGreen = IJ.openImage(pathAnalysis+"\\DIL_MASK_"+imageName+".jpg"); //dilGreen.show(); //String origTitle = dilGreen.getTitle(); IJ.selectWindow("mask"); IJ.run("Set Measurements...", "area mean integrated gray redirect=DUP_green.tif decimal=3"); IJ.run("Analyze Particles...", "size=0-Infinity circularity=0.00-100.00 show display clear add in_situ"); IJ.selectWindow("Results"); ResultsTable rt = ResultsTable.getResultsTable(); Integer numResults = rt.getCounter(); Integer numColumns = rt.getLastColumn(); IJ.log("- Amount of columns: "+numColumns.toString()); Double area, mean, intDen, rawIntDen, totalArea; area=0.0; mean=0.0; intDen =0.0; rawIntDen=0.0; totalArea=0.0; countedAreas = 0; numAreas = numResults; for (int i = 0; i<numResults; i++){ area = rt.getValueAsDouble(0,i); mean = rt.getValueAsDouble(1,i); intDen = rt.getValueAsDouble(20,i); rawIntDen = rt.getValueAsDouble(25,i); //IJ.log("- IntDen "+intDen.toString()); String addExcluded = ""; if (area > areaMaxValue) addExcluded = " - TOO LARGE!!!"; //IJ.log("A: "+String.valueOf(area)+addExcluded); //IJ.log("M: "+String.valueOf(mean)); //IJ.log("---Area: "+String.valueOf(area)+" Mean: "+String.valueOf(mean)); if (mean>0.0 && area <= areaMaxValue){ totalArea += area; countedAreas++; totalIntDen += intDen; if (intDen > maxIntDen) maxIntDen = intDen; if (intDen < minIntDen) minIntDen = intDen; } } IJ.log("- PLA Area: "+String.valueOf(totalArea)+" (counted: "+countedAreas.toString()+"/"+numResults.toString()+") intden: "+intDen.toString()+" rawint: "+rawIntDen.toString()); IJ.saveAs("Results", pathAnalysis+os_slash+imageName+"_Results.csv"); // XLS OR CSV
Supplemental information
101
// just _Results.xls contains PLA area IJ.run("Close"); IJ.selectWindow("mask"); IJ.saveAs("tif", path+os_slash+"pla"+os_slash+"temp"+os_slash+"red_mask.tif"); Double ret; ret = totalArea; if (csvHeader.size() < headerElements) csvHeader.add("pla"); singleResults += String.valueOf(ret).replace(".", ",")+";"; if (csvHeader.size() < headerElements) csvHeader.add("min-pla-int;max-pla-int;mean-pla-int;int/map2-ratio"); double thisMeanIntDen = (totalIntDen/countedAreas); singleResults += String.valueOf(minIntDen).replace(".", ",")+";"+String.valueOf(maxIntDen).replace(".", ",")+";"+String.valueOf(thisMeanIntDen).replace(".", ",")+";"; // String.format("%.2f",maxIntDen) return ret; } public Double measureMAP2(String imageName){ ImagePlus imp = IJ.openImage(pathChannels+os_slash+"green.tif"); imp.show(); ImageProcessor ip = imp.getProcessor(); Integer thisThreshold; if (!fixedThreshold) { thisThreshold = ip.getAutoThreshold(); autoThreshold = thisThreshold; } else{ thisThreshold = autoThreshold;} IJ.setThreshold(imp, 0, thisThreshold); IJ.log("- MAP2-Threshold (Measure): "+thisThreshold.toString()); IJ.run("Threshold", "thresholded remaining black slice"); IJ.run(imp, "Convert to Mask", ""); IJ.run(imp, "Create Selection", ""); IJ.run("Set Measurements...", "area mean gray redirect=None decimal=3"); IJ.run(imp, "Measure", ""); IJ.run(imp, "Select None", ""); imp.close(); IJ.selectWindow("Results"); ResultsTable rt = ResultsTable.getResultsTable(); Double thisMap2Area = rt.getValueAsDouble(0,0);
Supplemental information
102
//IJ.log("- MAP2 Area: "+String.valueOf(thisMap2Area)+" micron? = "+(String.valueOf(thisMap2Area)).contains(".")); IJ.saveAs("Results", pathAnalysis+os_slash+imageName+"_NeuronArea__Results.csv"); // XLS OR CSV //_NeuronArea_Results.xls contains MAP2 Area IJ.run("Close"); IJ.log("-- PLA/MAP2 - RATIO: "+String.valueOf(plaArea/thisMap2Area)+" * 100 = "+String.valueOf((plaArea/thisMap2Area)*100)); if (csvHeader.size() < headerElements) csvHeader.add("map2"); singleResults += String.valueOf((totalIntDen/countedAreas)/thisMap2Area).replace(".", ",")+";"+String.valueOf(thisMap2Area).replace(".", ",")+";"; if (csvHeader.size() < headerElements) csvHeader.add("pla/map2-ratio"); singleResults += String.valueOf(plaArea/thisMap2Area).replace(".", ",")+";"; Double ret = thisMap2Area; return ret; } public String makeHTML(Integer i, String imageName, Boolean writeFileNow, String HTMLString){ String pathHTML = path+os_slash+"pla"+os_slash+"HTML"+os_slash+i.toString()+os_slash; Boolean success = (new File(pathHTML)).mkdirs(); imageName = imageName.replace(".tif",""); if (writeFileNow){ // make new results file IJ.log("------------- SUMMARY -------------"); Double meanPLA = sumPLAArea/imageFiles.size(); Double meanMAP2 = sumMAP2Area/imageFiles.size(); Double meanIntDen = sumIntDen/imageFiles.size(); Double meanRatio = ((meanPLA/imageFiles.size()) / (meanMAP2/imageFiles.size()))*100; IJ.log("SUM of Areas [PLA] "+String.valueOf(sumPLAArea)+" / [MAP2] "+String.valueOf(sumMAP2Area)+" = "+String.valueOf(sumPLAArea/sumMAP2Area)); IJ.log("MEAN Value [PLA] "+String.valueOf(meanPLA)+" / [MAP2] "+String.valueOf(meanMAP2)+" = "+String.valueOf(meanRatio)); String HTMLHeader = "<html><head><title>PLA-Analysis</title><link href=\"../HTML/style.css\" rel=\"stylesheet\" type=\"text/css\"></head><body><div id=\"main_container\"><h1>Analysis of PLA</h1><div class=\"content_left\"><p>MAP2-Threshold</p><p>PLA-Threshold</p><p>Analyzed images</p><p>Mean-PLA</p><p>Mean-
Supplemental information
103
MAP2</p><p>Mean-Ratio</p><p>Mean-Intensity</p></div><div class=\"content_right\"><p>"+map2ThresholdMethod+"</p><p>"+plaThreshold+"</p><p>"+imageFiles.size()+"</p><p>"+String.format("%.2f", meanPLA)+"</p><p>"+String.format("%.2f", meanMAP2)+"</p><p>"+String.format("%.2f", meanRatio)+"%</p><p>"+String.format("%.2f", meanIntDen)+"</p><p><a href=\"ALL_RESULTS.csv\" target=\"blank\"> >> ALL_RESULTS.csv</a></p></div><div class=\"clear_float\"></div>"; String fullHTML = HTMLHeader+HTMLString; try { PrintWriter writer = new PrintWriter(pathAnalysis+os_slash+"results_summary.html", "UTF-8"); writer.println(fullHTML); writer.close(); }catch (Exception ex){ } return HTMLString; } else { ImagePlus green = IJ.openImage(pathChannels+os_slash+"green.tif"); green.show(); ImagePlus red = IJ.openImage(pathChannels+os_slash+"red.tif"); red.show(); ImagePlus blue = IJ.openImage(pathChannels+os_slash+"blue.tif"); blue.show(); IJ.run(green, "Merge Channels...", "c1=red.tif c2=green.tif c3=blue.tif create"); IJ.selectWindow("Composite"); IJ.run("Split Channels", ""); IJ.selectWindow("C1-Composite"); IJ.saveAs("png", pathHTML+"red_orig.png"); IJ.run("Close"); IJ.selectWindow("C2-Composite"); IJ.saveAs("png", pathHTML+"green_orig.png"); IJ.run("Close"); IJ.selectWindow("C3-Composite"); IJ.saveAs("png", pathHTML+"blue_orig.png"); IJ.run("Close"); ImagePlus red_mask = IJ.openImage(path+os_slash+"pla"+os_slash+"temp"+os_slash+"red_mask.tif"); red_mask.show(); IJ.run(red_mask, "Invert", ""); IJ.run(red_mask, "RGB Color", ""); ImagePlus green_dil = IJ.openImage(pathAnalysis+os_slash+"DIL_MASK_"+imageName+".png"); green_dil.show();
Supplemental information
104
ImagePlus blue_orig = IJ.openImage(pathHTML+"blue_orig.png"); blue_orig.show(); //IJ.log("HERE MERGE CHANNELS!"); //IJ.selectWindow("red_mask.tif"); //IJ.run("8-bit", ""); Integer red_bitDepth = red_mask.getBitDepth(); Integer green_bitDepth = green_dil.getBitDepth(); Integer blue_bitDepth = blue_orig.getBitDepth(); IJ.log("Bit-depths: "+red_bitDepth+" "+green_bitDepth+" "+blue_bitDepth); if (( red_bitDepth != green_bitDepth ) || (red_bitDepth != green_bitDepth ) || ( green_bitDepth != blue_bitDepth )){ IJ.run(red_mask, "RGB Color", ""); IJ.run(green_dil, "RGB Color", ""); IJ.run(blue_orig, "RGB Color", ""); } IJ.run(green_dil, "Merge Channels...", "c1=red_mask.tif c2=DIL_MASK_"+imageName+".png c3=blue_orig.png create"); IJ.selectWindow("Composite"); IJ.saveAs("png", pathHTML+"red_green_composite.png"); IJ.run("Close"); ImagePlus green2 = IJ.openImage(pathChannels+os_slash+"green.tif"); green2.show(); IJ.run(green2, "Invert", ""); IJ.saveAs("png", pathHTML+"green_inverted.png"); IJ.run("Close"); ImagePlus red2 = IJ.openImage(pathChannels+os_slash+"red.tif"); red2.show(); IJ.run(red2, "Invert", ""); IJ.saveAs("png", pathHTML+"red_inverted.png"); IJ.run("Close"); ImagePlus blue2 = IJ.openImage(pathChannels+os_slash+"blue.tif"); blue2.show(); IJ.run(blue2, "Invert", ""); IJ.saveAs("png", pathHTML+"blue_inverted.png"); IJ.run("Close"); // SAVE PLA MASK ImagePlus imp = IJ.openImage(pathChannels+os_slash+"red.tif"); imp.show(); IJ.setThreshold(imp, 0, plaThreshold); IJ.run("Threshold", "thresholded remaining black slice"); IJ.run(imp, "Convert to Mask", ""); IJ.run(imp, "Create Mask", "");
Supplemental information
105
IJ.saveAs("png", pathAnalysis+os_slash+"PLA_MASK_"+imageName+".png"); imp.close(); IJ.run("Close"); // append HTML-data to HTML-File HTMLString += "<div class=\"results\"><h2>"+imageName+"</h2><div class=\"upper_content_box\"><h3>Results</h3><div class=\"content_left\"><p>MAP2 Area</p><p>MAP2-THR</p><p>PLA Area</p><p>Ratio</p><p>Counted</p><p>Int/MAP2-Ratio</p></div><div class=\"content_right\"><p>"+String.format("%.2f", map2Area)+"</p><p>"+String.valueOf(autoThreshold)+"</p><p>"+String.format("%.2f", plaArea)+"</p><p>"+String.format("%.2f", (plaArea/map2Area)*100)+"%</p><p>"+countedAreas.toString()+"/"+numAreas.toString()+"</p><p>"+String.format("%.4f", (totalIntDen/countedAreas)/map2Area)+"</p></div></div><div class=\"upper_content_box\"><h3>Original Image</h3><a href=\"../HTML/"+imageName+".png\" target=\"blank\"><img src=\"../HTML/"+imageName+".png\" /></a></div><div class=\"upper_content_box\"><h3>Dilated mask</h3><a href=\"DIL_MASK_"+imageName+".png\" target=\"blank\"><img src=\"DIL_MASK_"+imageName+".png\" /></a></div><div class=\"clear_float\"></div><h4>Channels</h4><div class=\"lower_content_box\"> <a href=\"../HTML/"+i.toString()+"/red_orig.png\" target=\"blank\"><img src=\"../HTML/"+i.toString()+"/red_orig.png\" /></a> <a href=\"../HTML/"+i.toString()+"/red_inverted.png\" target=\"blank\"><img src=\"../HTML/"+i.toString()+"/red_inverted.png\" /></a></div> <div class=\"lower_content_box\"><a href=\"PLA_MASK_"+imageName+".png\" target=\"blank\"><img src=\"PLA_MASK_"+imageName+".png\" /></a> <b>PLA Mask</b><br /><br /> <b>Intensity</b><br /> min: "+String.format("%.2f",minIntDen)+"<br /> max: "+String.format("%.2f",maxIntDen)+"<br /> ∅: "+String.format("%.2f", (totalIntDen/countedAreas))+"</div> <div class=\"lower_content_box\"> <a href=\"../HTML/"+i.toString()+"/green_orig.png\" target=\"blank\"><img src=\"../HTML/"+i.toString()+"/green_orig.png\" /></a> <a href=\"../HTML/"+i.toString()+"/green_inverted.png\" target=\"blank\"><img src=\"../HTML/"+i.toString()+"/green_inverted.png\" /></a></div></div><div class=\"clear_float\"></div>"; //countedAreas.toString()+"/"+numAreas.toString() if (csvHeader.size() < headerElements) csvHeader.add("counted_areas;total_areas"); singleResults += String.valueOf(countedAreas.toString())+";"; singleResults += String.valueOf(numAreas.toString())+";"; if (i == imageFiles.size()-1){ HTMLString+="</div></body></html>"; } }
Supplemental information
106
return HTMLString; } public void writeCSS(){ String pathCSS = path+os_slash+"pla"+os_slash+"HTML"+os_slash; String cssString = "@font-face {font-family: 'Dosis';font-style: normal;font-weight: 400;src: local('Dosis Regular'), local('Dosis-Regular'), url(http://themes.googleusercontent.com/static/fonts/dosis/v2/xIAtSaglM8LZOYdGmG1JqQ.woff) format('woff');} body, div, h1, h2, h3, h4, h5, h6, p, ul, ol, li, dl, dt, dd, img, form, fieldset, input, textarea, blockquote {margin: 0; padding: 0; border: 0;} body {font: 15px 'Dosis', sans-serif; text-transform: uppercase; } #main_container {position:relative;margin:0px auto;width: 820px;} .results{position:relative;background-color: white;margin-top:40px;margin-left:20px;padding-left:10px;width: 800px;border:0px;border-top: 1px solid grey;} .upper_content_box{position:relative;float:left;background-color:white;margin-right:10px;margin-top:0px;height:260px;width:250px;} .results .upper_content_box img{width:248px;height:248px;border: 1px solid grey;} .lower_content_box{position:relative;background-color:white;float:left;margin-right:10px;margin-bottom:10px;height:122px;width:250px;} .results h4{color:red;} .results .lower_content_box img{position:relative;float:left;margin-left:2px;width:120px;height:120px;border: 1px solid grey;} .clear_float{clear:both;} .content_left{float:left;background-color:white;padding-top:20px;} .content_right{float:left;margin-left:10px;background-color:white;padding-top:20px;} h2{color:grey;} .content_left p{margin-bottom:10px;text-align:right;font-size:20px;} .content_right p{margin-bottom:10px;text-align:left;font-size:20px;} .results .upper_content_box img:hover {border-color:blue;} .results .lower_content_box img:hover {border-color:blue;} a:link { text-decoration:none; } a:visited { text-decoration:none; } a:hover { text-decoration:none; } a:active { text-decoration:none; } a:focus { text-decoration:none; }"; try { PrintWriter writer = new PrintWriter(pathCSS+"style.css", "UTF-8"); writer.println(cssString); writer.close(); }catch (Exception ex){ } } public void writeCSV(){ String pathCSV = path+os_slash+"pla"+os_slash+"analysis"+os_slash; try { PrintWriter writer = new PrintWriter(pathCSV+"ALL_RESULTS.csv", "UTF-8"); String headerString = "";
Supplemental information
107
for (int k = 0; k<csvHeader.size(); k++){ headerString = headerString + csvHeader.get(k)+";"; } writer.println(headerString); writer.println(allResults); writer.close(); }catch (Exception ex){ } } public void resetAll(){ IJ.run("Close All", ""); IJ.selectWindow("ROI Manager"); IJ.run("Close"); return; } }
7.1.2 PLA dendrites
import ij.plugin.PlugIn; import ij.IJ; import ij.ImagePlus; import ij.gui.GenericDialog; import ij.gui.WaitForUserDialog; import ij.io.OpenDialog; import ij.WindowManager; import java.io.File; import ij.measure.Calibration; public class PLA_Dendrites extends ImagePlus implements PlugIn { // STRING FOR OS public static String os_system = ""; public static String os_slash = ""; public static String version = "0.85"; public void run(String arg) { IJ.log("-----------------[ Start PLA_Dendrites V"+version+" ]-----------------"); os_system = System.getProperty("os.name"); if (os_system.contains("Mac")) os_slash = "/"; else os_slash = "\\"; OpenDialog od = new OpenDialog("Select imagefile"); ImagePlus imp = IJ.openImage(od.getPath()); String path = od.getPath().substring(0,od.getPath().length()-imp.getTitle().length());
Supplemental information
108
String imageName = imp.getTitle(); IJ.log("img: "+imageName+" path: "+path); // GET MEASUREMENTS (PIXLE/MICRONS) Calibration cal = imp.getCalibration(); double x = cal.pixelWidth; double y = cal.pixelHeight; IJ.run(imp, "Select All", ""); Integer oldWidth = (int)imp.getRoi().getFloatWidth(); Integer oldHeight = (int)imp.getRoi().getFloatHeight(); double distance = oldHeight/(oldHeight*x); IJ.run(imp, "Select None", ""); IJ.log("Measurements: "+x+" x "+y+" | "+oldWidth+" x "+oldHeight+" = "+(oldHeight*x)+" => distance: "+oldHeight/(oldHeight*x)); IJ.setTool("polyline"); imp.show(); new WaitForUserDialog("Selection required", "1. Track the dendrite with left clicks.\n\n2. Place your last selection with right click. \n\n3. Press the OK button to continue").show(); IJ.run("Straighten...", "title=straightened_"+imp.getTitle()+" line=20"); imp.close(); ImagePlus imp2 = WindowManager.getCurrentImage(); IJ.log("img2: "+imp2.getTitle()); String fullpath = createPaths(path); IJ.run(imp2, "Set Scale...", "distance="+distance+" known=1 pixel=1 unit=micron"); IJ.saveAs(imp2, "Tiff", fullpath+os_slash+imp2.getTitle()); imp2.close(); //IJ.run("Close All", ""); System.gc(); return; } public String createPaths(String path){ String fullpath = path+os_slash+"Straightened"+os_slash; Boolean success = (new File(fullpath)).mkdirs(); return fullpath; } }
7.1.3 PLA Soma script
import ij.plugin.PlugIn; import ij.IJ;
Supplemental information
109
import ij.ImagePlus; import ij.gui.GenericDialog; import ij.gui.WaitForUserDialog; import ij.io.OpenDialog; import ij.WindowManager; import ij.measure.Calibration; import java.io.File; public class PLA_Soma extends ImagePlus implements PlugIn { // STRING FOR OS public static String os_system = ""; public static String os_slash = ""; public static String version = "0.85"; public void run(String arg) { IJ.log("-----------------[ Start PLA_Soma V"+version+" ]-----------------"); os_system = System.getProperty("os.name"); if (os_system.contains("Mac")) os_slash = "/"; else os_slash = "\\"; OpenDialog od = new OpenDialog("Select imagefile"); ImagePlus imp = IJ.openImage(od.getPath()); String path = od.getPath().substring(0,od.getPath().length()-imp.getTitle().length()); String imageName = imp.getTitle(); IJ.log("img: "+imageName+" path: "+path); // GET MEASUREMENTS (PIXLE/MICRONS) Calibration cal = imp.getCalibration(); double x = cal.pixelWidth; double y = cal.pixelHeight; IJ.run(imp, "Select All", ""); Integer oldWidth = (int)imp.getRoi().getFloatWidth(); Integer oldHeight = (int)imp.getRoi().getFloatHeight(); double distance = oldHeight/(oldHeight*x); IJ.run(imp, "Select None", ""); IJ.log("Measurements: "+x+" x "+y+" | "+oldWidth+" x "+oldHeight+" = "+(oldHeight*x)+" => distance: "+oldHeight/(oldHeight*x)); // IJ.run(imp, "Set Scale...", "distance=5.5494 known=1 pixel=1 unit=micron"); IJ.setTool("brush"); imp.show(); new WaitForUserDialog("Selection required", "1. Hold the left mouse button down and drag the brush over the soma.\n\n2. Areas
Supplemental information
110
can be erased by clicking with the brush tool outside the marked area and drag it on the zone which shall be removed. \n\n3. Press the OK button to continue").show(); IJ.run("Copy", ""); Integer newWidth = (int)imp.getRoi().getFloatWidth(); Integer newHeight = (int)imp.getRoi().getFloatHeight(); // Add 1/3 of height and width to the borders to make sure that the cell mass is less than the background newHeight += 2*(int)(newHeight/3); newWidth += 2*(int)(newWidth/3); Integer bitDepth = imp.getBitDepth(); IJ.log("NewFile: "+newWidth+" x "+newHeight+" bitD: "+bitDepth); imp.close(); ImagePlus imp2 = IJ.createImage("brushed_"+imageName, bitDepth+"-bit black", newWidth, newHeight, 1); IJ.run(imp2, "Paste", ""); IJ.run(imp2, "Select None", ""); imp2.show(); String fullpath = createPaths(path); IJ.run(imp2, "Set Scale...", "distance="+distance+" known=1 pixel=1 unit=micron"); IJ.saveAs(imp2, "Tiff", fullpath+os_slash+imp2.getTitle()); //IJ.run("Close All", ""); System.gc(); return; } public String createPaths(String path){ String fullpath = path+os_slash+"Brushed"+os_slash; Boolean success = (new File(fullpath)).mkdirs(); return fullpath; } }
Collaborations and technical support
111
8 Collaborations and technical support For this thesis work the contribution of different people was necessary. Viktor Dinkel
developed the plugin for PLA analyses, Dr. Till Mack generated the flag-tagged DBN-
E constructs and performed the mutagenesis for DBNS601A-flag and DBNS601D-flag.
Moreover, he produced the virus constructs, virus particles and coordinated the
generation of the DBN-KO mouse model. In the Schuman Lab (Max Planck Institute
for Brain Research, Frankfurt am Main) Dr. Susanne Tom Dieck helped me with the
planning of the first FUNCAT-PLA experiments. In parallel with me, Ina Bartnik
performed the first FUNCAT-PLA experiments for DBN. Lisa Kochen designed the
image analyses sequence (Image J) for the analyses of PLA and shared it with me.
Susanne Tom Dieck, Ina Bartnik and Lisa Kochen occasionally helped with the
microscopy imaging of FUNCAT-PLA and panomics experiments and Susanne Tom
Dieck performed one of the three panomics experiments. Kristin Lehman and Kerstin
Schlawe did most of the preparation for the primary cultures. Beate Diemar performed
some of my western blots.
Acknowledgments
112
9 Acknowledgments My PhD has been an adventure and what an adventure. There have been ups and
downs but overall a lot of learning. Permanent and non-stop learning. Perhaps that is
the part that I find most exciting about doing scientific research. There is so much to
know and so much to explore. During this adventure of learning many people
contributed in the process and I would like to acknowledge some of them.
I start by thanking Prof. Britta Eickholt. There are many reasons I am grateful to her.
First of all, I thank Britta for inviting me to work in her lab and to provide me with a very
interesting, challenging and fun project. Second of all, I thank her for her dedicated
supervision during my PhD. I feel particularly grateful to her for fully supporting me
when I wanted to go to conferences and specially that one time when I met Prof. Erin
Schuman. I still remember the first time during my PhD that I went to a scientific
meeting and how much I had to fight to pursue Britta to let me go. Several times she
came back to me saying: -Eugenia it is too soon!-. But finally, on that day I suggested
I could go to this PhD meeting in the MPI in Göttingen she said: -Yes, I’ll support that
one!-. So there I went and it was absolutely fruitful. After that meeting, our collaboration
with the Schuman Lab started. I thank Britta, for the support and the freedom I received
from her, concerning my trips to Frankfurt. Last, I thank her for the orientation in the
writing of this thesis.
All the work I did during my PhD would have not been possible without the support,
orientation and scientific discussions with George, Till, Paloma, Kai, Patricia, Steffi,
Mayur, Julia, Sandra, Annika and Willem. I also thank them for making of our group a
very pleasant place to be, especially during those times of cake eating, summers of
gin and tonics and long nights of beer drinking. That was fun!
I thank our technicians Beate, Kerstin and Kristin, their work was really important in the
development of my work in the lab. From teaching German to learning together how to
perform new protocols and so on.
I am very thankful to Prof. Erin Schuman. I thank her for opening me the doors to her
lab. I thank her for listening, reading, supporting and caring. Having met her makes me
very happy and keeps me going in this adventure. She is an inspiration and a
motivation to go on.
Acknowledgments
113
I thank Susu, Ina and Lisa for all the support when it came to making experiments with
them and the Mexican, French and other parties they organized when I was there in
Frankfurt. That was not only a very productive time but also a very fun one. I thank in
general all the Schuman Lab and the team in the MPI for supporting me and always
make me feel welcome. I thank Anne-Sophie for hosting me when I visited Frankfurt
the last times and for discussing science with me. It is not always easy to have deep
and interesting discussions but with Anne-Sophie, this is possible.
I thank Viktor Dinkel for developing the plugin with me and for teaching me how to
teach.
I am grateful to Prof. Rojas for proof-reading and guiding me in the writing of this thesis.
I also thank him for all the support he gave me for starting my collaboration with Viktor.
He is a motivation to keep on studying and trying hard to stay in academia: learning,
teaching and sharing. Gracias Rojas!
I thank my friends for listening to all my complaints and providing advice and
support…always!
I thank my entirely family for all the support. For the support every day of my life and
every day during my PhD. My father’s support… I have no words to thank for that one.
The rest of my family, when I started this adventure they helped me to make it happen.
I don’t forget.
Finally, I am deeply thankful to my partner, my best friend, my favorite person, the
father of our future daughter and my husband. Erik’s help has been perhaps the most
important one during this adventure. I am really lucky to have such a life partner. He
has listed to my science stories probably every day since the last four years and our
scientific discussions, although sometimes ending in fights the outcome was always
positive. Thank you B.
Selbständigkeitserklärung
114
10 Selbständigkeitserklärung
Ich, Eugenia Rojas Puente, erkläre, dass ich die vorgelegte Dissertation mit dem
Thema „Turnover and localization of the actin binding protein Drebrin in Neurons“
selbst verfasst und keine anderen als die angegebenen Quellen und Hilfsmittel
benutzt, ohne die unzulässige Hilfe Dritter verfasst und auch in Teilen keine Kopien
anderer Arbeiten dargestellt habe.“
Datum Unterschrift