Post on 29-Jan-2022
1
The association of microcephaly protein WDR62 with CPAP/IFT88 is required for cilia
formation and neocortical development.
Belal Shohayeb1, Uda Ho
1, Yvonne Y. Yeap
1,#, Robert G. Parton
2,3, Sean S. Millard
1,
Zhiheng Xu4, Michael Piper
1 and Dominic C. H. Ng
1,*
1School of Biomedical Sciences, Faculty of Medicine, The University of Queensland, St
Lucia, Australia.
2Institute for Molecular Bioscience, The University of Queensland, St Lucia, Australia
3Centre for Microscopy and Microanalysis, The University of Queensland, St Lucia,
Australia.
4State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and
Developmental Biology, Chinese Academy of Sciences, Beijing, China
#Current affiliation: Singapore Immunology Network, Agency for Science Technology and
Research, Singapore.
*Send correspondence to: Dominic C.H Ng; Tel. +61-7-3365 3077; Email: d.ng1@uq.edu.au.
Highlights
Patient-derived missense mutations on WDR62 cause neurodevelopmental defects
related to abnormalities of the primary cilium in mice.
WDR62 mutations cause differentiation and loss of radial glia in ventricular zone.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
2
WDR62 function in cilia assembly is conserved and required for neocortical
expansion.
WDR62 recruitment of CPAP/IFT88 to the basal body is required for cilia formation.
Abstract
WDR62 mutations that result in protein loss, truncation or single amino-acid substitutions are
causative for human microcephaly, indicating critical roles in cell expansion required for
brain development. WDR62 missense mutations that retain protein expression represent
partial loss-of-function mutants that may therefore provide specific insights into radial glial
cell processes critical for brain growth. Here we utilized CRISPR/Cas9 approaches to
generate three strains of WDR62 mutant mice; WDR62V66M/V66M
and WDR62R439H/R439H
mice
recapitulate conserved missense mutations found in humans with microcephaly, with the third
strain being a null allele (WDR62stop/stop
). Each of these mutations resulted in embryonic
lethality to varying degrees and gross morphological defects consistent with ciliopathies
(dwarfism, anopthalamia and microcephaly). We find that WDR62 mutant proteins (V66M
and R439H) localize to the basal body but fail to recruit CPAP. As a consequence, we
observe deficient recruitment of IFT88, a protein that is required for cilia formation. This
underpins the maintenance of radial glia as WDR62 mutations caused premature
differentiation of radial glia resulting in reduced generation of neurons and cortical thinning.
These findings highlight the important role of the primary cilium in neocortical expansion
and implicates ciliary dysfunction as underlying the pathology of MCPH2 patients.
Introduction
Primary microcephaly is a developmental condition characterized by substantially reduced
head and brain size with associated mild to moderate cognitive impairment [1]. The
identification of microcephaly genes (MCPH) has provided valuable insights into disease
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
3
aetiology and highlighted critical contributions of centrosomal/spindle pole proteins in the
finely-tuned regulation of neural stem and progenitor cell proliferation, survival and
differentiation that underpin brain growth [2]. However, centrosomes integrate complex
cytoskeletal and signal transduction events to influence multiple cellular processes that
contribute to tissue morphogenesis/homeostasis [3]. In addition, the most frequently mutated
MCPH proteins are localized to extracentrosomal compartments with pleiotropic functions
[4]. Thus, whilst defects in cell cycle progression, centriole biogenesis, checkpoint activation,
spindle alignment, asymmetric partitioning of fate determinants and primary cilium formation
have been variously reported as associated with impaired brain growth [5], the molecular
origins of primary microcephaly have remained enigmatic. Here, we characterized mouse
models recapitulating MCPH2 (WDR62) missense mutations found in humans that represent
partial loss-of-function mutants to provide new insights into the molecular and cellular
defects that cause microcephaly.
WDR62 is a large (170 kD) microtubule- and centrosome-associated protein that is highly
expressed in apical and basal neuroprogenitors within the ventricular and subventricular
zones, corresponding with peak neurogenesis in the developing mouse forebrain [6, 7]. The
depletion of WDR62 homologs in mice recapitulate reduced brain size/weight and cortical
thickness associated with precocious differentiation, reduced proliferation and/or excessive
apoptosis of neuroprogenitors, highlighting conserved functions of WDR62 that are required
for brain development [8-10]. However, the mechanisms associated with WDR62 regulation
and function underlying brain growth remain unclear, with WDR62 loss leading to wide
ranging defects in mitogenic kinase signaling, centrosome function, cytoskeletal organization
and cell cycle progression [8-11]. This likely reflects pleiotropic functions of WDR62 which
are collectively disrupted with protein depletion or null mutants [4]. Although the majority of
patient WDR62 mutations are null alleles, genetic studies have additionally revealed
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
4
pathogenic non-synonymous missense mutations that alter evolutionarily conserved residues
that are atypical in MCPH [7, 12]. As the overall tertiary structures of WD40 domain-repeat
proteins are comparatively resistant to single amino acid changes, this subset of missense
mutations may generate mutant protein with partial loss-of-function [13]. An anecdotal report
of a patient with the p.R438H mutation presenting with less severe clinical course compared
to individuals with nonsense mutations lends support to this notion [7]. Importantly, primary
cells isolated from a patient with the p.R438H mutation retained expression of full length
mutant protein, suggesting that it could retain some of the normal WDR62 functions [14]. In
this study, we characterized WDR62 mutant mice with targeted knock-in of c.196G>A in
exon 2 or c.1316G>A in exon 10, resulting in p.V66M and p.R439H single amino-acid
alterations respectively, to recapitulate two frequently reported patient-identified WDR62
missense mutations. In addition, we also generated WDR62 depleted mice through CRIPSR
disruption of exon 2 for comparison.
Here we report overall growth reduction, cortical thinning and anopthalamia as consistent
defects observed across our WDR62 mutant mice. An analysis of the neocortex revealed
precocious differentiation and depletion of radial glia and this was accompanied by ciliary
defects during early neurogenic stages. Given the requirements for intact cilia function for
normal brain development [15], we interrogated ciliary mechanisms perturbed by WDR62
point mutations and demonstrated disrupted recruitment of CPAP (also known as CENPJ) to
the basal body and axonemal loss of intraflagellar transport protein (IFT) 88 required for
ciliary protein trafficking [16]. Our studies reinforces the critical requirement for the cilia of
neuroprogenitors in expansion of the mammalian neocortex and reveal specific functions of
WDR62 protein interactions disrupted by inherited point mutations.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
5
Results
WDR62 missense mutant mice exhibit embryonic and neocortical growth deficits.
WDR62 missense mutations are causative of microcephaly and cortical malformations in
humans [7, 12] but these have not been modelled in vivo. Here, we utilized CRISPR/Cas9
gene-editing to generate WDR62 mutant mice that recapitulate frequently reported mutations
(V65M and R438H in humans) resulting in single amino acid substitutions of conserved
residues (WDR62V66M/V66M
and WDR62R439H/R439H
). In addition, we generated mutant mice
with a deletion in exon 2 that results in premature termination and severe truncation of
WDR62 (herein referred to as WDR62stop
) for comparison with the point mutants
(Supplementary Material, Fig. S1A+B). Quantitative PCR analysis confirmed mRNA levels
were maintained in WDR62V66M/V66M
and WDR62R439H/R439H
mice but substantially reduced
in WDR62stop
animals (Supplementary Material, Fig. S1C). To evaluate protein expression,
we generated a custom antibody to mouse WDR62 and validated it by immunoblot and
immunofluorescence in MEFs depleted with WDR62 siRNA (Supplementary Material, Fig.
S1D+E). An immunoblot analysis of primary isolated MEFs and embryonic brain tissue from
WDR62 mutant mice indicated WDR62 levels was maintained in WDR62R439H/R439H
mice,
reduced in WDR62V66M/V66M
and significantly depleted in WDR62stop/stop
animals
(Supplementary Material, Fig. S1F+G). Given that mRNA levels are unaltered in
WDR62V66M/V66M
mice, these findings suggests that protein stability and turnover are likely
disrupted by V66M substitution leading to partially reduced protein levels. Our observations
in WDR62R439H/R439H
mice are also consistent with a clinical report of mutant protein
expression in a MCPH patient with the R438H mutation [14] and supports the notion that this
substitution disrupts an important facet of WDR62 function in neurodevelopment. The levels
of WDR62 mRNA and protein in WDR62stop/stop
mice suggests they are likely to be null
animals. We also noted that the expression levels of a WDR62 ortholog, MAPKBP1, was
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
6
increased in brain lysates from WDR62stop/stop
mice but not with missense mutations
(Supplementary Material, Fig. S1G). This may be a compensatory effect of WDR62 loss.
Interestingly, homozygous WDR62R439H/R439H
post-natal animals were rarely observed
whereas homozygous WDR62stop/stop
and WDR62V66M/V66M
mutant mice were born at
marginally lower than expected Mendelian ratios (Fig. 1A). Heterozygous WDR62R439H/+
animals were recovered at expected ratios and were phenotypically normal (Fig. 1A). At
E12.5-17.5, WDR62R439H/R439H
embryos were found at ratios comparable to WDR62stop/stop
and WDR62V66M/V66M
genotypes (Fig. 1A) which suggests homozygous WDR62R439H/R439H
embryos perish during late gestation or at birth from undetermined causes. Embryos from all
three mutant strains were reduced in overall size (Fig. 1B) and showed incomplete penetrance
of a maldevelopment of ocular tissue with striking absence of an eye (anopthalamia) in
homozygous embryos at E15.5-E17.5 (Fig. 1B+F). WDR62 mutant embryos had reduced
brain size with enlarged ventricles and reductions in cortical thickness at E15.5, a phenotype
evident as early as E12.5 for all three genotypes when compared to wild-type littermates (Fig.
1C-E). Our findings are consistent with a requirement for WDR62 in sustaining cortical
expansion and overall embryo growth during development. In addition, the
WDR62R439H/R439H
mutation recapitulated reduced brain growth despite mutant protein
expression (Supplementary Material, Fig. S1F+G) highlighting loss of specific WDR62
functions required for neurodevelopment.
WDR62 missense mutations trigger loss and premature differentiation of radial glia.
The reduction in cortical thickness in WDR62 mutant mice led us to hypothesise that
abnormalities in neural stem and progenitor cell populations during formation of the
neocortex may culminate in the phenotypic abnormalities we had observed late in gestation.
To assess this we analysed the expression of PAX6 and the absence of TBR2 (PAX6+ve
TBR2-ve
), as indicators of apical progenitors (radial glia) that divide along the ventricular
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
7
surface, and TBR2+ve
cells as more committed intermediate progenitors that have delaminated
from ventricular surface. We stained embryonic brains for PAX6 and TBR2, and an analysis
of the medial region of the neocortex revealed that there were significantly fewer radial glia
in the ventricular zone (VZ) and the subventricular zone (SVZ) of WDR62 mutant brain at
E12.5 (Fig. 2A+B) and this persisted throughout later embryonic stages (Fig. 2B). We note
that WDR62 mutations resulted in reduced numbers of radial glia without complete
exhaustion of this stem cell pool at later developmental stages (Fig. 2B).
Previously, conflicting reports of precocious differentiation or cell cycle arrest culminating in
cell death were attributed to the reduction in radial glia numbers following WDR62 depletion
in embryonic brains [8-10, 17]. In this study, we found that the mitotic index of radial glia
(PAX6+ve
TBR2–ve
pHH3+ve
) was elevated at E12.5 and E15.5 in WDR62stop/stop
,
WDR62V66M/V66M
and WDR62R439H/R439H
embryos when compared to WDR62+/+
(Fig. 2C)
indicative of an extended duration in mitosis. The reduced numbers and prolonged mitosis of
radial glia was accompanied by a significant increase in TBR2+ve
intermediate (basal)
progenitors in the VZ/SVZ of WDR62 mutant mice at E12.5 (Fig. 2A+E). At E15.5, there
was a trend for increased TBR2+ve
progenitors in mutant embryos compared to wild-type
littermates at E15.5 that was statistically significant for WDR62stop/stop
brains (Supplementary
Material Fig. S2A, Figure 2E). Interestingly, at E17.5 we found an overall decrease in
TBR2+ve
cells in cortical regions of WDR62stop/stop
, WDR62V66M/V66M
and WDR62R439H/R439H
embryos (Fig. 2D+E). This was accompanied by significantly reduced numbers of post-
mitotic neurons (TBR1+ve
) in the cortical plate (CP) at E17.5 in WDR62 mutant embryos
(Fig. 2D+F). These findings indicate a wave of precocious differentiation of apical
progenitors that occurs during early neurogenesis (E12.5) that ultimately resulted in the
reduction of intermediate progenitors and reduced generation of new neurons during later
stages of neurodevelopment (E17.5).
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
8
The division orientation of radial glia, relative to the ventricular surface, may predict
proliferative versus self-renewing divisions, with the later generating more committed
progenitors that culminate in neurogenesis [18]. Our analysis of radial glia division
orientation in WDR62 mutant mice indicated a higher propensity for oblique (30-60o) and
horizontal (0-30o) divisions (Figure 3A+B) which are associated with asymmetric divisions
that trigger fate commitment and generation of intermediate progenitors [19]. Conversely,
symmetrical vertical divisions (60-90o) of proliferating radial glia were reduced in WDR62
mutant mice (Fig. 3A+B). An assessment of the proliferative capacity of the progenitor
compartment with single dose BrdU labeling for 24 h revealed a significant increase in cell
cycle exit (defined as the fraction of BrdU+ve
cells which did not immunostain with Ki67
versus all BrdU+ve
cells, Fig. 3C+D). These observations are consistent with the precocious
differentiation and loss of radial glia triggered by WDR62 depletion and point mutations.
Furthermore, we measured radial glial cell death and revealed a modest but statistically
significant increase in number of apoptotic cells (TUNEL+ve
) in the cortex of WDR62stop/stop
mice whilst the extent of cell death was unchanged with WDR62 point mutations (Fig.
3E+F). Thus, the compromised survival of radial glia, perhaps related to mitotic arrest,
appears to be a feature of severe WDR62 depletion but not following missense mutations.
WDR62 is also required for neuronal migration and normal lamination of the neocortex [10].
Whilst total numbers of TBR1+ve
neurons in the cortical region were reduced at E17.5 (Fig.
2F), we also observed an increase in TBR1+ve
neurons specifically in the intermediate zone
(IZ) in WDR62stop/stop
and WDR62V66M/V66M
mice but not WDR62R439H/R439H
brains
(Supplementary Material, Fig. S2B, DAPI stain demarcating IZ from CP layers and TBR1+ve
fluorescence channel from Fig. 2D shown in Supplementary Material Fig. 2C for clarity)
which suggests a defect in neuronal migration to the CP. Immunostaining for an additional
marker (Ctip2) for newly post-mitotic cortical neurons revealed similar findings of CTIP2+ve
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
9
neurons in the IZ of WDR62stop/stop
and WDR62V66M/V66M
but not WDR62R439H/R439H
mice
(Supplementary Material, Fig. S2D+E). Given the reduced protein levels in WDR62stop/stop
and WDR62V66M/V66M
embryos, our results indicate that WDR62 may also be required for the
migration of newly post-mitotic neurons to the CP. In contrast, cell movements appear
unperturbed by R439H mutation (Supplementary Material, Fig. S2B+E). Our findings reveal
migration of immature neurons that are differentially impacted by WDR62 point mutations
and gene deletion.
WDR62 regulates cilia in the developing cortex
The anopthalamic phenotype observed with WDR62 mutations was reminiscent of mice with
defects in the non-motile primary cilium [20]. Primary cilia are cellular sensory projections
that have defined roles in neurogenesis, neural patterning and cortical development [21].
While ciliary defects have been previously reported in WDR62 knock-out mice [9], how
WDR62 mechanisms were involved in cilia regulation remain unresolved. Thus, we next
investigated the organization of primary cilia in WDR62 missense mutant mice.
We stained for Arl13b, which is cilia membrane marker, at E12.5 and E15.5 to investigate
ciliary defects in neuroprogenitors within the developing cortex. We observed a decrease in
the number of ciliated cells in the SVZ of WDR62 mutant mice compared to wild-type brains
(Fig. 4A+B). Quantification of the percentage of ciliated cells revealed significant reductions
in WDR62 mutant mice compared to wild-type littermates (Fig. 4B). In addition, ciliary
lengths in cells that retained Arl13b staining were significantly reduced in WDR62 mutant
mice at both E12.5 and E15.5 (Fig. 4C+D). Similar to a previous report in WDR62 knock-out
mice [9], we observed an increased incidence of ciliary remnants (Fig. 4E, white arrowheads)
in WDR62 mutant mice at E12.5. As ciliary membrane dissociation from centrosome is a
feature of differentiated cells in late neurogenesis [22], our observation is consistent with the
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
10
premature differentiation of apical progenitors with WDR62 mutation. In evaluating the
broader requirement for WDR62 in proper cilia formation, we performed neural-specific
depletion (RNAi) of the WDR62 ortholog in Drosophila melanogaster and utilized Elav-
Gal4>GFP to visualize ciliated sensory neurons in the legs and in the antennae [23]. The loss
of dWDR62 severely disrupted cilia formation and decreased axonemal length in femoral
chordotonal sensory neurons in the leg and within chemosensory neurons that innervate the
hairs in the antennae (Supplementary Material, Fig. S3). Taken together, these results suggest
that WDR62 has a conserved role in cilia regulation that is disrupted in mice by microcephaly
mutations.
To more closely interrogate ciliary defects arising from WDR62 mutations, we isolated
mouse embryonic fibroblasts (MEFs) at E14.5 and synchronized cells through serum
deprivation to promote ciliogenesis. We found that WDR62 localized to the basal body of
ciliated wild-type MEFs but were absent in MEFs isolated from WDR62stop/stop
embryos (Fig.
5A). Interestingly, WDR62 R439H and, despite its reduced cellular levels, V66M mutant
proteins were detected on basal bodies at the base of the primary cilium (Fig. 5A) which
indicates that ciliary defects associated with WDR62 point mutations are not due to overt
mislocalization of the protein. The basal body is derived from the mother centriole and
WDR62 localization to centrosomes was previously reported to be involved in centriole
biogenesis [9]. However, we did not find significant changes in centriole numbers following
WDR62 depletion or mutation in MEFs (Supplementary Material, Fig. S4A+B).
Furthermore, the ultrastructure of centrioles in the VZ of WDR62stop/stop
brains appeared
normal (Supplementary Material, Fig. S4C). This indicates that WDR62 mutations in our
mouse models was not sufficient to trigger abnormal centriole duplication and excludes this
process as the potential cause of the neurological and ciliary defects.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
11
Similar to the ciliary deficiencies observed in vivo, we observed a reduction in the percentage
of ciliated cells (Fig. 5B), shortening in cilia length (Fig. 5C) and increased ciliary membrane
remnants (Supplementary Material, Fig. S4D+E) in WDR62 deleted and point mutant MEFs.
Reductions in cilia length were rescued with the return of WDR62-GFP to WDR62stop/stop
MEFs (Fig. 5D+E) which confirmed that WDR62 was specifically required for normal cilia
growth. We also observed a significant proportion (~10%) of WDR62 mutant MEFs were
biciliated with two closely associated Arl13b positively-stained perinuclear ciliary structures
clearly evident (Fig. 5F+G). On closer inspection bicilated cells were also present in vivo in
the SVZ of WDR62stop/stop
, WDR62V66M/V66M
and WDR62R439H/R439H
brains (Fig. 4A, white
arrowheads). Immunostaining with acetylated tubulin confirmed double microtubule
axonemal structures in biciliated MEFs (Fig. 5F). Duplicated axonemes were associated with
independent basal bodies that were positively stained with CEP170, a distal appendage and
mother centriole marker (Fig. 5H). Quantification of CEP170-stained cells indicated that
~15% of WDR62stop/stop
, WDR62V66M/V66M
and WDR62R439H/R439H
MEFs possessed two
mature centrioles in close proximity (Fig. 5I) which indicates centriole maturation is
perturbed by WDR62 loss or microcephaly-linked mutations.
WDR62 is required to recruit CPAP and IFT88 to the basal body
The similarities in ciliary deficiencies between isolated MEFs and neuroprogenitors in the
neocortex suggest that WDR62 mutant MEFs may provide valuable insights into WDR62
mechanisms underlying cilia regulation in vivo. We first considered WDR62 interactions with
CEP170 [12], a subdistal appendage protein that is required for centrosome-microtubule
anchoring [24] and thus tethering of the mother centriole to the plasma membrane for
ciliogenesis. However, the extent of CEP170 localization on mother centrioles was
unchanged in the three different WDR62 mutant MEF lines (Supplementary Material, Fig.
S5A+B). In addition, the density of microtubules in the immediate vicinity of basal body was
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
12
not markedly altered in WDR62 mutant MEFs which suggests normal microtubule anchoring
at centrosomes (Supplementary Material, Fig. S5C). EM visualization of the basal body distal
appendages of radial glia in WDR62stop/stop
brain sections appeared normal (Supplementary
Material, Fig. S4C). Moreover, depletion of CEP170 did not phenocopy decreased cilia
growth observed with WDR62 loss (Supplementary Material, Fig. S5D). This indicated
disruption of cilia in WDR62 mutant cells was not due to lost CEP170 or abnormal
microtubule attachments at the sub-distal appendages of mother centrioles.
We next considered that the ciliary defects observed with WDR62 loss or point mutations,
such as biciliation from duplicated basal bodies, were reminiscent of perturbed CPAP
localization/interaction with axonemal microtubules [25]. Given CPAP was a previously
described downstream target [26] and interacting partner of WDR62 (Supplementary
Material, Fig. S6A), we investigated whether WDR62 interactions with CPAP were involved
in cilia regulation. CPAP localization to the basal body in the progenitor compartment, as
defined by staining intensity and co-localization with -tubulin, was significantly reduced in
WDR62stop/stop
, WDR62V66M/V66M
and WDR62R439H/R439H
brains compared to wild-type
(Fig.Figure 6A-C). Similarly, the localization of CPAP to centrosomes was reduced in
WDR62 mutant MEFs (Fig. 6D+E). CPAP localization at duplicated basal bodies in
biciliated cells was also reduced (Supplementary Material, Fig. S6B). The co-
immunoprecipitation of CPAP with WDR62, indicative of partner protein interaction, was
substantially reduced in MEFs with WDR62 loss (WDR62stop/stop
and WDR62V66M/V66M
) and
in WDR62R439H/R439H
MEFs despite mutant protein expression (Fig. 6F). This indicates
WDR62 loss or mutation disrupts CPAP recruitment to centrosomes during cilia formation
and elongation. CPAP localization to centrosomes in WDR62stop/stop
MEFs was rescued with
expression of full-length WDR62-GFP (Fig. 6G+H) or a truncated WDR62 mutant lacking
C-terminal region (WDR62 N-GFP aa 1-841, Fig. 6I+J). In contrast, the centrosomal
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
13
localization of CPAP was not rescued with a truncated WDR62 mutant lacking the N-
terminal region (WDR62 C-GFP aa 842-1523, Fig. 6I+J). This corresponded with a capacity
for WDR62-N, but not WDR62-C, to interact with CPAP (Supplementary Material, Fig.
S6D). This indicates that the WD40-repeat region of WDR62 is specifically required for
interaction and recruitment of CPAP to centrosomes and consistent with CPAP defects
observed with R439H mutation.
Previous studies have demonstrated that CPAP interactions with tubulin, and potentially
intraflagellar transport (IFT) proteins, regulate polymerization and elongation of axonemal
microtubules for cilia growth [25]. We found that IFT88 co-precipitated with WDR62 and
CPAP indicating interactions with these partner proteins (Supplementary Material, Fig. S6A).
Therefore, we next investigated whether IFT88, a core component of IFT-B anterograde
transport complex, was perturbed by WDR62 missense mutations. We found that IFT-88 was
present on basal bodies and ciliary axonemes of progenitor cells in VZ/SVZ cortical layers in
wild-type mice (Fig. 7A). The localization of IFT88 to the primary cilium, indicated by
intensity of IFT88 staining and co-localization with -tubulin, was disrupted by WDR62 loss
or missense mutation (Fig. 7A-C). Similarly, IFT88 was strongly localized to the basal body
and to the axoneme in wild-type MEFs (Fig. 7D). The loss of WDR62 resulted in decreased
IFT88 levels at the basal body supporting perturbed tubulin transport required for elongation
(Fig. 7D+E). In addition, IFT88 levels at the basal body were similarly reduced in the
presence of WDR62V66M/V66M
and WDR62R439H/R439H
mutants (Fig. 7D+E). The decrease in
IFT88 localization at the basal body was reversed with WDR62-GFP expression confirming
that WDR62 was specifically required for the ciliary localization of IFT88 (Fig. 7F+G). This
highlights WDR62-CPAP interactions as required for anterograde tubulin transport and
normal cilia growth. Taken together, our studies have revealed that patient-identified
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
14
missense mutations in WDR62 disrupt its interaction with CPAP which leads to cilia defects
that may contribute to the development of microcephaly.
Discussion
WDR62 was first identified, nearly a decade ago, as a factor required for normal human
embryonic brain growth [6]. Whilst genetic models resulting in protein loss have revealed
several cellular processes requiring WDR62 expression [9, 10], the specific functions of
WDR62 impaired by pathogenic missense mutations and required for neocortical
development remain unclear. Here we report on the first mouse models recapitulating
WDR62 missense mutations that cause microcephaly in humans. Our studies confirm that the
conserved V66 and R439 residues on WDR62 are required for overall embryonic growth,
neocortical expansion and normal ocular development; the later not having been previously
reported in studies with WDR62 gene-trap animals [8, 9, 11]. Mutant protein levels, but not
mRNA levels, were reduced in WDR62V66M/V66M
mice consistent with computational
predictions that this mutation may disrupt protein stability. Thus, WDR62V66M/V66M
mice are
hypomorphic mutants with neurological defects likely arising from insufficient WDR62
protein expression. In contrast, WDR62R439H/R439H
animals retained substantial levels of
mutant protein and this is consistent with clinical studies of MCPH2 patients harbouring the
equivalent mutation (p.R438H). Moreover, we show that CRISPR disruption of WDR62
expression (WDR62stop/stop
) resulted in largely comparable abnormalities which reinforces the
observed phenotypes are due to WDR62 loss-of-function. These mouse lines represent
valuable in vivo models of human MCPH2 mutations to study WDR62 mechanisms in order
to provide insights into protein function.
Interestingly, we showed that different WDR62 mutations caused variable lethality despite
defined genetic backgrounds. A percentage of homozygous mutants were lost in mid-late
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
15
gestation and this was presumably associated with severe dwarfism and anopthalamia as
these defects were not observed in post-natal animals. Embryonic survival was compromised
by WDR62R439H/R439H
mutation, in particular, with only rare instances of homozygous
animals born compared to WDR62V66M/V66M
and WDR62stop/stop
mice which were reduced in
frequency but generally survived to post-natal stages. Our findings suggest that expression of
WDR62 R439H mutant protein may be less well tolerated compared to protein depletion in
WDR62V66M/V66M
and WDR62stop/stop
animals. This could indicate that R439H is a novel gain
of function mutation that is detrimental during late gestation. However, neomorphic
mutations are typically dominant/semi-dominant [27] and we did not observe detrimental
effects in heterozygous animals (WDR62R439H/+
) which we recovered at expected numbers
and were phenotypically normal. In contrast, recent studies suggest that the variable lethality
may be the result of cell-autonomous compensatory expression of paralogs with redundant
functions in knock-out mice [28] and triggered through a nonsense mediated decay pathway
[29]. In support of this notion, we observed reduced mRNA levels in WDR62stop/stop
mice and
this coincided with increased expression of MAPKBP1, an ortholog reported to share
functions with WDR62, for example in the regulation of stress responses [30] and spindle
microtubules [31]. Importantly, MAPKBP1 was reported to be dispensable for cilia formation
[31] and thus would not compensate for WDR62 loss in ciliogenesis.
The possibility that the increased lethality in WDR62R439H/R439H
animals may be the result of
an off-target mutation is highly unlikely. The incidence of off-target gene editing in in vivo
experiments is extremely low [32] and our mice are extensively back-crossed to segregate
off-target mutations. An exception may be gene mutations that are in close chromosomal
vicinity to R439H (genetic linkage) and thus resistant to homologous recombination.
However, this has not impaired studies in early embryonic development and our
identification of morphological and neurological abnormalities in all three mutant lines
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
16
implicates WDR62 specifically. In addition, our investigation of neuropathological
mechanisms in multiple independent mutant lines provide insights into specific WDR62
functions required for neurodevelopment. Notably, the primordial dwarfism, cortical
thinning, ocular abnormalities and infertility phenotypes in WDR62 mutant mice are
consistent with embryonic defects associated with ciliary deficiencies [33-35].
Primary cilia are important regulators of neurodevelopment and this is exemplified by
manifestations of microcephaly and cortical malformations as pathophysiological
characteristics of ciliopathies [36]. Ciliary structures in radial glia serve critical functions in
defining apical-basal polarity, morphogen sensing and hedgehog signaling control of
neuroprogenitor expansion, differentiation and migration within proliferative zones of the
neocortex [15]. Moreover, the inheritance of ciliary remnants may specify self-renewal by
enhancing ciliogenesis in daughter cells following mitosis [22]. Here we showed that
pathological WDR62 missense mutations caused reductions in the pool of proliferating radial
glia during early-mid gestation (E12.5), premature differentiation into intermediate
progenitors and immature neurons, resulting in microcephaly without overt increases in cell
death which is consistent with our previous in utero knockdown studies and following
conditional deletion of WDR62 in the brain [10, 37]. Neural defects in WDR62 deleted or
mutant mice were associated with clear ciliary abnormalities in the VZ/SVZ including
increased dissociation of ciliary membranes from centrosomes which is characteristic of
precocious differentiation of radial glia [9, 22]. Impairments in cilia assembly or timely
reabsorption in radial glia result in cell cycle exit and the onset of neuronal differentiation
[38, 39]. Therefore, in response to WDR62 mutation, the reduction of ciliated cells at the
ventricular membrane is likely the trigger for radial glia loss and their premature
differentiation to intermediate progenitors.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
17
It was recently reported that global deletion of WDR62 using CMV-Cre excision of a floxed
allele caused a delay in cilia resorption without apparent defects in ciliogenesis [40]. The
reasons underlying the phenotypic differences between this recent report and our study are
undetermined but may be related to the specific genetic background of WDR62 knock-out
mice. The floxed WDR62 allele was generated by mating C57BL/6 chimeras with
129S1/SvImJ resulting in a mosaic strain that was then subsequently crossed with CMV-Cre
mice [40]. In contrast, our WDR62 mutant mice, generated using CRISPR/Cas9 editing and
extensively backcrossed, are isogenic C57BL/6 strains. It is possible that strain-specific
expression of genetic modifiers may account for differences in severity of impaired
ciliogenesis observed between our mouse models. Importantly, our findings do not discount a
role for WDR62 in the disassembly of cilia. Moreover, we reported deficiencies in
ciliogenesis that were consistent between three independent WDR62 mouse strains
(WDR62stop/stop
, WDR62V66M/V66M
and WDR62R439H/R439H
). This indicates WDR62 expression
and the R439 residue are involved in cilia formation and required to maintain a pool of
proliferative neuroprogenitors during expansion of the mammalian neocortex.
Cilia-regulated polarization of radial glial processes are also required for oriented migration
and proper placement of cells in the neuroepithelium [41]. We observed reduced migration of
TBR1+ve
neurons to the CP in WDR62V66M/V66M
and WDR62stop/stop
, but not
WDR62R439H/R439H
brains. As WDR62 levels are reduced in WDR62V66M/V66M
and
WDR62stop/stop
brains, this suggests neuronal migration requires normal WDR62 expression.
This is aligned with previous findings of supressed migration of immature neurons and lost
apical-basal polarity of radial glia following in utero depletion of WDR62 [10]. However,
cilia contributions in this context are unclear as the R439H mutation results in comparable
severity and range of ciliary defects but neuronal migration appears unperturbed. It remains
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
18
possible that WDR62 mutations may delineate between multiple cilia functions however this
requires clarification in future work.
WDR62 loss perturbs cilia formation in Drosophila sensory neurons which suggests WDR62
regulation of cilia is evolutionarily conserved. We previously characterized WDR62 as a
spindle microtubule-associated protein but, in ciliated cells, WDR62 was localized
specifically to the basal body and not to the axoneme which suggests WDR62 may not
directly regulate axonemal microtubules. However, WDR62 interacts with CPAP [9] and the
later determines axoneme length through tubulin interactions and control of microtubule
dynamics in cilia [25]. Notably, WDR62 mutations phenocopy primordial dwarfism and
microcephaly observed in CPAP mutant mice [42] which suggests shared functions in
neurodevelopment. We find that WDR62 R439 is involved in recruiting CPAP to the basal
body and the proper function of anterograde (IFT-B) tubulin transport complexes required for
cilia elongation. While further investigation of patient-derived cells/tissue is required, our
results suggest that CPAP dysfunction and subsequent cilia malformations may underlie the
development of microcephaly and range of cortical defects in human patients with WDR62
mutations.
Further to cilia regulation, CPAP has defined roles in procentriole elongation and centriole
biogenesis [43] and centriole loss can cause microcephaly [44]. However, we did not observe
significant changes in the ultrastructure or numbers of centriole following WDR62 loss or
mutation with the exception of duplicated mature centrioles associated with biciliated cells in
a percentage of primary MEFs and neuroprogenitors in vivo. Therefore, our findings suggest
that WDR62 recruitment of CPAP to centrosomes is required for ciliogenesis but may not be
critical for centriole duplication. Biochemical alterations in CPAP-tubulin interaction has
been shown to cause ectopic formation of cilia on daughter centrioles leading to biciliation
[25] which underscores complex mechanisms underlying CPAP control of tubulin delivery
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
19
for cilia organization. It is interesting to note that a recent study that deleted CPAP in murine
radial glia resulted in microcephaly associated with long cilia [45]. It is tempting to speculate
that WDR62-CPAP complex formation may contribute to CPAP function in tubulin transport
at the basal body although this requires further investigation. Taken together, our studies
demonstrate WDR62-CPAP complexes are disrupted by microcephaly mutations and this
leads to dysfunction of the primary cilium and maintenance of proliferating progenitors
Materials and Methods
WDR62 mutant mice
WDR62stop/stop
, WDR62V66M/V66M
and WDR62R439H/R439H
mice (C57BL/6) were generated by
the Australian Phenomics Network through CRISPR/Cas9 editing of the Wdr62 gene.
Homology directed repair donor oligonucleotides 5’-
gagctgctggagcaaatatttttctgacagcccttttctttgcaggtgacacttgagaagAtgcttggcatcacagcccagaacagcag
cgggctaacctgtgaccctggcacaggccatg – 3’ and 5’ -
accagagagcttgcctgccgtccgggacttttctgacttgttcctcagacaataccatccActtctggaatttggatagcgcctctgacac
tcgatggcaaaagaacatcttcagcgatgt were utilized to generate the c.196G>A (V66M) and
c.1316G>A (R439H) mutations respectively, recapitulating pathogenic mutations identified
in MCPH patients (Suppl. Fig. 1A). Guide RNAs were microinjected into C57BL/6
blastocysts and transferred into pseudopregnant female C57BL/6 mice. In screening for
founder animals carrying point mutations, we also identified a mouse (WDR62stop/stop
) with a
1 base pair deletion in exon 2 (190delG) resulting in pre-termination codon
(p.Glu64Argfs*77). Founder animals were bred to generate N1 progeny and mutant alleles
determined by sequence analysis of amplified PCR products from genomic DNA isolated
from tail tips. We utilized 5’ CTGAAGTGACTTTCTGACCCTCC 3’ and 5’
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
20
CGCCACAGAGCATGGTGAGG 3’ primer pairs in genotyping 1316G>A and 5’
TGCAGCAGACAGGGGAATACT 3’ and 5’ TCCCCTCCATAGCCCTCACA 3’ primers
for both 196G>A and 190delG. Heterozygous animals were backcrossed for 10 generations
prior to experimentation and maintained in accordance with National Health and Medical
Research Council of Australia’s code of practice for the care and use of animals for scientific
research and approved by the University of Queensland Anatomical Biosciences Animal
Ethics committee (Ethics ID #452/18, #445/18). For the cell cycle exit experiments, pregnant
dams were intraperitoneal injected with 100uL/10g ready-to-use BrdU labelling reagent
(Thermo Fisher Scientific) 24 h prior to embryo collection.
Brain fixation and sectioning.
Embryonic (E15.5-17.5) brains were dissected and fixed in 4% (w/v) paraformaldehyde
(PFA) for a minimum of 48 hrs, washed in phosphate buffered saline (PBS, 4 hrs) and
processed with a Leica ASP300S enclosed tissue processor instrument. Embryonic brains
were embedded in paraffin wax and sectioned at the thickness of 6 μm for
immunohistochemical or histological staining. Embryos collected at E12.5 were fixed in 4%
(w/v) PFA for 48 hrs, washed in PBS and immersed in 15% sucrose and Tissue Tek O.C.T
compound for cryo-sectioning using the Thermo cyrostar NX70. E12.5 brains were kept at -
20 C° and sectioned at the thickness of 10 μm. Embryos from cell cycle exit study were
collected at E15.5 and 24 h following BrdU administration, fixed in 4% (w/v) PFA (72 h),
washed in PBS and embedded into 3% Noble agar for sectioning.
Hematoxylin and eosin staining
Tissue sections embedded in paraffin wax were dewaxed and stained with hematoxylin for 2
minutes, washed with running water and 70% ethanol. Sections were then counter-stained
with eosin for 25 seconds and washed in 90% ethanol. Brain sections were then immersed in
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
21
xylene for fixation and mounted on to glass slides using DePex mounting media. Images
were collected using Leica Aperio digital slide scanners.
Murine embryonic fibroblasts
Mouse embryonic fibroblasts (MEF) were isolated from freshly dissected E14.5 embryos by
trypsin (0.25%) digest for 30 mins. Embryonic tissues were then disrupted by passing
through a G18 needle (10-12 times) and trypsin neutralized with culture media (DMEM)
supplemented with 10% (v/v) FCS, 1% (v/v) penicillin/streptomycin, 10 mM L-glutamine, 1
x non-essential amino acids and 0.01% (v/v) -mercaptoethanol. Cells were maintained at
37°C and 5% CO2 in a humidified incubator. To induce cilia formation, MEFs were plated
(4x105 cells/well) for 24 hrs in serum-containing media, washed with PBS and then incubated
in serum-free media for 72 hours to synchronize cells at G0. In rescue experiments previously
generated pEGFP-WDR62, pEGFP-WDR62 N (aa 1-841) and pEGFP-WDR62 C (aa 842-
1523) [17] were transiently expressed in WDR62stop/stop
MEFs using Lipofectamine 2000. At
48 h post-transfection, primary cilia were induced with serum-free media and cells fixed and
analysed by immunofluorescence.
Immunofluorescence
Paraffin embedded sections were rehydrated or cryo-preserved sections washed briefly in
PBS prior to antigen retrieval (10 mM sodium tri-citrate pH 6.0, 95°C, 51 minutes). Sections
were then washed in PBS twice, blocked in a solution containing 20% (v/v) FCS, 2% (w/v)
BSA and 0.2% (w/v) Triton X-100 in PBS for 1 hour at room temperature before overnight
incubation with primary antibodies diluted in blocking buffer. Stained sections were then
washed three times in cold PBS, incubated with appropriate Alexa Fluor conjugated
secondary antibodies followed by DAPI staining and mounting in 80% glycerol for
fluorescence imaging. Images were collected using Leica TCS SP8 or Diskovery Spinning
Disk confocal microscopes. Primary antibodies included mouse anti-γtubulin (1:400, T5326
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
22
Sigma), rabbit anti-γtubulin (1:400, T5192 Sigma), rabbit anti-Arl13b (1:300, 17711-1-AP
Proteintech), mouse anti-Arl13b (1:300, 75287, Antibodies Inc.), mouse anti-αtubulin (1:300,
T5168 Sigma), rabbit anti-CPAP (1:200, 11517-1-Ap Proteintech), rabbit anti-IFT88 (1:200,
13967-1-AP Proteintech), rabbit anti-Tbr1 (1:200, ab31940 Abcam), rat anti-Tbr2 488
(1:200, 53-4875-80 eBioscience), rabbit anti-phospho-histoneH3 (1:300, ab47297 Abcam),
rat anti-Ctip2 (1:300, ab18465), rabbit anti-Satb2 (1:300, ab51502), rat anti-ki67-FITC
(1:200, eBioscience), mouse anti-BrdU (1:200, DSBH) and mouse anti-Pax6 (1:200, DSBH).
Polyclonal anti-WDR62 was generated by immunizing rabbits with a synthetic peptide
corresponding to amino acids 1150-1166 of murine WDR62 (VGQGGNQPKAGPLRAGT)
conjugated to Keyhole Limpet Hemocyanin. Custom antibody production including affinity
purification was performed by the Monash Antibody Technologies Facility (Monash
University, VIC, Australia).
Immunofluorescence analyses of MEFs were performed similarly. Following fixation in 4%
(w/v) paraformaldehyde or cold (-20°C) methanol as appropriate, MEFs were permeabilized
(0.2% [v/v] Triton X-100 in PBS, 20 min) and blocked (20% [v/v] FCS, 1% [w/v] BSA in
PBS, 60 min) prior to incubation with primary and Alexa Fluor conjugated secondary
antibodies diluted in blocking buffer. MEFs were counterstained with DAPI, mounted on
glass slides in ProLong Gold mounting media and imaged using confocal microscopes.
Protein lysates, immunoblots and immunoprecipitation
Protein lysates were prepared by homogenization and lysis of whole brain tissue or isolated
MEFs in RIPA buffer [150 mM NaCl, 100 mM Na3VO4, 50 mM Tris-HCl pH 7.3, 0.1 mM
EDTA, 1% v/v Triton X-100, 1% w/v sodium deoxycholate and 0.2% w/v NaF]
supplemented with protease inhibitors. Protein lysates were cleared by centrifugation (16,000
g, 10 min) and protein concentrations determined using Bradford assays. Proteins were
separated by SDS-PAGE, transferred onto a polyvinylidene fluoride (PVDF) membrane and
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
23
analysed by immunoblotting. For immunoprecipitation experiments, cleared cell lysates were
incubated with rabbit polyclonal primary antibodies to WDR62 (custom antibody) or CPAP
(Proteintech), followed by affinity isolation with Protein-A agarose beads for 16 h at 4°C on
an end-to-end rotator. After repeated washing with lysis buffer, bound proteins were eluted
with Laemelli buffer and separated by SDS-PAGE for immunoblotting.
Acknowledgments
DN acknowledges funding support from the National Health and Medical Research Council
(GNT1046032, GNT1162652), Australian Research Council (FT120100193) and Cancer
Council (GNT1101931). BS is a recipient of a UQ International Scholarship from the
University of Queensland. We thank Prof Carol Wicking (Institute of Molecular Biosciences,
University off Queensland) for providing anti-Arl13b and anti-IFT88. We extend our
gratitude to Dr Richard Webb (Centre for Microscopy and Microanalysis) for assistance with
electron microscopy and Dr Shaun Walters (School of Biomedical Science Imaging Facility)
for support with confocal microscopes.
Conflicts of Interest
The authors declare no competing interests.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
24
References
1. Thornton, G.K. and Woods, C.G. (2009) Primary microcephaly: do all roads lead to
Rome? Trends Genet., 25, 501-510.
2. Zaqout, S., Morris-Rosendahl, D. and Kaindl A.M. (2017) Autosomal recessive primary
microcephaly (MCPH): An update. Neuropediatrics, 48, 135-142.
3. Nigg, E.A. and Raff, J.W. (2009) Centrioles, centrosomes, and cilia in health and
disease. Cell, 139, 663-678.
4. Shohayeb, B., Lim, N.R., Ho, U., Xu, Z., Dottori, M., Quinn, L. and Ng, D.C.H. (2018)
The role of WD40-Repeat Protein 62 (MCPH2) in brain growth: Diverse molecular and
cellular mechanisms required for cortical development. Mol. Neurobiol., 55, 5409-5424.
5. Gilmore, E.C. and Walsh, C.A. (2013) Genetic causes of microcephaly and lessons for
neuronal development. Wiley Interdiscip. Rev. Dev. Biol., 2, 461-478.
6. Bilguvar, K., Ozturk, A.K., Louvi, A., Kwan, K.Y., Choi, M., Tatli, B., Yalnizoglu, D.,
Tuysuz, B., Caglayan, A.O., Gokben, S., et al. (2010) Whole-exome sequencing
identifies recessive WDR62 mutations in severe brain malformations. Nature, 467, 207-
210.
7. Nicholas, A.K., Khurshid, M., Desir, J., Carvalho, O.P., Cox, J.J., Thornton, G., Kausar,
R., Ansar, M., Ahmad, W., Verloes, A., et al. (2010) WDR62 is associated with the
spindle pole and is mutated in human microcephaly. Nat. Genet., 42, 1010-1014.
8. Chen, J.F., Zhang, Y., Wilde, J., Hansen, K.C., Lai, F. and Niswander, L. (2014)
Microcephaly disease gene Wdr62 regulates mitotic progression of embryonic neural
stem cells and brain size. Nat. Commun., 5, 3885.
9. Jayaraman, D., Kodani, A., Gonzalez, D.M., Mancias, J.D., Mochida, G.H., Vagnoni, C.,
Johnson, J., Krogan, N., Harper, J.W., Reiter, J.F., et al. (2016) Microcephaly proteins
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
25
Wdr62 and Aspm define a mother centriole complex regulating centriole biogenesis,
apical complex, and cell fate. Neuron, 92, 813-828.
10. Xu, D., Zhang, F., Wang, Y., Sun, Y. and Xu, Z. (2014) Microcephaly-associated protein
WDR62 regulates neurogenesis through JNK1 in the developing neocortex. Cell. Rep., 6,
104-116.
11. Sgourdou, P., Mishra-Gorur, K., Saotome, I., Henagariu, O., Tuysuz, B., Campos, C.,
Ishigame, K., Giannikou, K., Quon, J.L., Sestan, N., et al. (2017) Disruptions in
asymmetric centrosome inheritance and WDR62-Aurora kinase B interactions in primary
microcephaly. Sci. Rep., 7, 43708.
12. Yu, T.W., Mochida, G.H., Tischfield, D.J., Sgaier, S.K., Flores-Sarnat, L., Sergi, C.M.,
Topçu, M., McDonald, M.T., Barry, B.J., Felie, J.M., et al. (2010) Mutations in WDR62,
encoding a centrosome-associated protein, cause microcephaly with simplified gyri and
abnormal cortical architecture. Nat. Genet., 42, 1015-1020.
13. Stirnimann, C.U., Petsalaki, E., Russell, R.B. and Muller, C.W. (2010) WD40 proteins
propel cellular networks. Trends Biochem. Sci., 35, 565-574.
14. Farag, H.G., Froehler, S., Oexle, K., Ravindran, E., Schindler, D., Staab, T., Huebner,
A., Kraemer, N., Chen, W. and Kaindl, A.M. (2013) Abnormal centrosome and spindle
morphology in a patient with autosomal recessive primary microcephaly type 2 due to
compound heterozygous WDR62 gene mutation. Orphanet. J. Rare Dis., 8, 178.
15. Youn, Y.H. & Han, Y.G. (2018) Primary cilia in brain development and diseases. Am. J.
Pathol., 188, 11-22.
16. Katoh, Y., Michisaka, S., Nozaki, S., Funabashi, T., Hirano, T., Takei, R. and
Nakayama, K. (2017) Practical method for targeted disruption of cilia-related genes by
using CRISPR/Cas9-mediated, homology-independent knock-in system. Mol. Biol. Cell.,
28, 898-906.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
26
17. Bogoyevitch, M.A., Yeap, Y.Y., Qu, Z., Ngoei, K.R., Yip, Y.Y., Zhao, T.T., Heng, J.I.
and Ng, D.C.H. (2012) WD40-repeat protein 62 is a JNK-phosphorylated spindle pole
protein required for spindle maintenance and timely mitotic progression. J. Cell. Sci.,
125, 5096-5109.
18. Lesage, B., Gutierrez, I., Marti, E. and Gonzalez, C. (2010) Neural stem cells: the need
for a proper orientation. Curr. Opin. Genet. & Dev., 20, 438-442.
19. LaMonica, B.E., Lui, J.H., Hansen, D.V. and Kriegstein, A.R. (2013) Mitotic spindle
orientation predicts outer radial glial cell generation in human neocortex. Nat. Commun.,
4, 1665.
20. Jacoby, M., Cox, J.J., Gayral, S., Hampshire, D.J., Ayub, M., Blockmans, M., Pernot, E.,
Kisseleva, M.V., Compère, P., Schiffmann, S.N. et al. (2009) INPP5E mutations cause
primary cilium signaling defects, ciliary instability and ciliopathies in human and mouse.
Nat. Genet., 41, 1027-1031.
21. Guemez-Gamboa, A., Coufal, N.G. and Gleeson, J.G. (2014) Primary cilia in the
developing and mature brain. Neuron, 82, 511-521.
22. Paridaen, J.T., Wilsch-Brauninger, M. and Huttner, W.B. (2013) Asymmetric inheritance
of centrosome-associated primary cilium membrane directs ciliogenesis after cell
division. Cell, 155, 333-344.
23. Dubruille, R., Laurençon, A., Vandaele, C., Shishido, E., Coulon-Bublex, M., Swoboda,
P., Couble, P., Kernan, M. and Durand, B. (2002) Drosophila regulatory factor X is
necessary for ciliated sensory neuron differentiation. Development, 129, 5487-5498.
24. Huang, N., Xia, Y., Zhang, D., Wang, S., Bao, Y., He, R., Teng, J. and Chen, J. (2017)
Hierarchical assembly of centriole subdistal appendages via centrosome binding proteins
CCDC120 and CCDC68. Nat. Commun., 8, 15057.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
27
25. Zheng, X., Ramani, A., Soni, K., Gottardo, M., Zheng, S., Ming Gooi, L., Li, W., Feng,
S., Mariappan, A., Wason, A., et al. (2016) Molecular basis for CPAP-tubulin interaction
in controlling centriolar and ciliary length. Nat. Commun., 7, 11874.
26. Kodani, A., Yu, T.W., Johnson, J.R., Jayaraman, D., Johnson, T.L., Al-Gazali, L.,
Sztriha, L., Partlow, J.N., Kim, H., Krup, A.L., et al. (2015) Centriolar satellites
assemble centrosomal microcephaly proteins to recruit CDK2 and promote centriole
duplication. eLife, 4. doi:10.7554/eLife.07519.
27. Planutis, A., Xue, L., Trainor, C.D., Dangeti, M., Gillinder, K., Siatecka, M., Nebor, D.,
Peters, L.L., Perkins, A.C. and Bieker, J.J. (2017) Neomorphic effects of the neonatal
anemia (Nan-Eklf) mutation contribute to deficits throughout development.
Development, 144, 430-440.
28. Dickinson, M.E., Flenniken, A.M., Ji, X., Teboul, L., Wong, M.D., White, J.K., Meehan,
T.F., Weninger, W.J., Westerberg, H., Adissu, H. et al. (2016) High-throughput
discovery of novel developmental phenotypes. Nature, 537, 508-514.
29. El-Brolosy, M.A., Kontarakis, Z., Rossi, A., Kuenne, C., Günther, S., Fukuda, N., Kikhi,
K., Boezio, G.L.M., Takacs, C.M., Lai, S.L., et al. (2019) Genetic compensation
triggered by mutant mRNA degradation. Nature, 568, 193-197.
30. Cohen-Katsenelson, K., Wasserman, T., Darlyuk-Saadon, I., Rabner, A., Glaser, F. and
Aronheim, A. (2013) Identification and analysis of a novel dimerization domain shared
by various members of c-Jun N-terminal kinase (JNK) scaffold proteins. J. Biol. Chem.,
288, 7294-7304.
31. Macia, M.S., Halbritter, J., Delous, M., Bredrup, C., Gutter, A., Filhol, E., Mellgren,
A.E.C., Leh, S., Bizet, A., Braun, D.A. et al. (2017) Mutations in MAPKBP1 cause
juvenile or late-onset cilia-independent nephronophthisis. Am. J. Hum. Genet., 100, 372.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
28
32. Iyer, V., Boroviak, K., Thomas, M., Doe, B., Riva, L., Ryder, E. and Adams, D.J. (2018)
No unexpected CRISPR-Cas9 off-target activity revealed by trio sequencing of gene-
edited mice. PLoS Genet., 14, e1007503.
33. Inaba, K. and Mizuno, K. (2016) Sperm dysfunction and ciliopathy. Reprod. Med. Biol.,
15, 77-94.
34. Pazour, G.J., Baker, S.A., Deane, J.A., Cole, D.G., Dickert, B.L., Rosenbaum, J.L.,
Witman, G.B., Besharse, J.C. (2002) The intraflagellar transport protein, IFT88, is
essential for vertebrate photoreceptor assembly and maintenance. J. Cell. Biol., 157, 103-
113.
35. Shaheen, R., Faqeih, E., Shamseldin, H.E., Noche, R.R., Sunker, A., Alshammari, M.J.,
Al-Sheddi, T., Adly, N., Al-Dosari, M.S., Megason, S.G., et al. (2012) POC1A
truncation mutation causes a ciliopathy in humans characterized by primordial dwarfism.
Am. J. Hum. Genet., 91, 330-336.
36. Hildebrandt, F., Benzing, T. and Katsanis, N. (2011) Ciliopathies. New Eng. J. Med.,
364, 1533-1543.
37. Xu, D., Yao, M., Wang, Y., Yuan, L., Hoeck, J.D., Yu, J., Liu, L., Yeap, Y.Y., Zhang,
W., Zhang, F., et al. (2018) MEKK3 coordinates with FBW7 to regulate WDR62
stability and neurogenesis. PLoS Biol., 16, e2006613.
38. Gabriel, E., Wason, A., Ramani, A., Gooi, L.M., Keller, P., Pozniakovsky, A., Poser, I.,
Noack, F., Telugu, N.S., Calegari, F. et al. (2016) CPAP promotes timely cilium
disassembly to maintain neural progenitor pool. EMBO J., 35, 803-819.
39. Li, A., Saito, M., Chuang, J.Z., Tseng, Y.Y., Dedesma, C., Tomizawa, K., Kaitsuka, T.
and Sung, C.H. (2011) Ciliary transition zone activation of phosphorylated Tctex-1
controls ciliary resorption, S-phase entry and fate of neural progenitors. Nat. Cell Biol.,
13, 402-411.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
29
40. Zhang, W., Yang, S.L., Yang, M., Herrlinger, S., Shao, Q., Collar, J.L., Fierro, E., Shi,
Y., Liu, A., Lu, H. et al. (2019) Modeling microcephaly with cerebral organoids reveals a
WDR62-CEP170-KIF2A pathway promoting cilium disassembly in neural progenitors.
Nat. Commun., 10, 2612.
41. Higginbotham, H., Guo, J., Yokota, Y., Umberger, N.L., Su, C.Y., Li, J., Verma, N.,
Hirt, J., Ghukasyan, V., Caspary, T. and Anton, E.S. (2013) Arl13b-regulated cilia
activities are essential for polarized radial glial scaffold formation. Nat. Neurosci., 16,
1000-1007.
42. McIntyre, R.E., Lakshminarasimhan Chavali, P., Ismail, O., Carragher, D.M., Sanchez-
Andrade, G., Forment, J.V., Fu, B., Del Castillo Velasco-Herrera, M., Edwards, A., van
der Weyden, L., et al. (2012) Disruption of mouse Cenpj, a regulator of centriole
biogenesis, phenocopies Seckel syndrome. PLoS Genet., 8, e1003022.
43. Schmidt, T.I., Kleylein-Sohn, J., Westendorf, J., Le Clech, M., Lavoie, S.B., Stierhof,
Y.D. and Nigg, E.A. (2009) Control of centriole length by CPAP and CP110. Curr. Biol.,
19, 1005-1011.
44. Nano, M. and Basto, R. (2017) Consequences of centrosome dysfunction during brain
development. Adv. Exp. Med. Biol., 1002, 19-45.
45. Ding, W., Wu, Q., Sun, L., Pan, N.C. and Wang, X. (2019) Cenpj regulates cilia
disassembly and neurogenesis in the developing mouse cortex. J. Neurosci., 39, 1994-
2010.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
30
Figure legends
Figure 1. WDR62 deletion and missense mutations cause neural growth defects in mice.
A) Measured ratios of wild-type, heterozygous and homozygous WDR62 mutant mice at P0
and at E15.5. B) Reduced length of WDR62 mutant embryos at E15.5 compared to wild-type
littermates. C) Cortical thickness was measured in WDR62 mutant embryos and compared to
wild-type littermates at E15.5 and D) E12.5. Scale bars - 500 m. E) Ventricular area as a
ratio of brain size was measured in WDR62 mutant embryos and compared to wild-type
littermates at E15.5. F) Number of WDR62 mutant mice with anopthalmic defects observed
at E15.5 and 17.5. Mean values ± SEM are depicted. *p<0.05, **p<0.01, ***p<0.001 and
****p<0.0001 (t-test)
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
31
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
32
Figure 2. WDR62 missense mutations trigger premature differentiation and loss of self-
renewed radial glia. A) Coronal brain sections from WDR62+/+
, WDR62stop/stop
,
WDR62V66M/V66M
and WDR62R439H/R439H
E12.5 embryos were stained with PAX6 (red),
TBR2 (green) and phospho-Histone H3 (pHH3, blue). B) Quantification of PAX6+ve
, TBR2-ve
radial glia (red bars) in the VZ/SVZ of wild-type and WDR62 mutant embryos at E12.5-17.5
and E15.5. C) Measured mitotic index of radial glia (PAX6+ve
, TBR2-ve
, pHH3+ve
) in wild-
type and WDR62 mutant embryos at E12.5 and E15.5. D) Coronal sections of wild-type and
WDR62 mutant mice at E17.5 stained with PAX6 (red), TBR2 (green) and TBR1 (Magenta)
for radial glia, intermediate progenitors and immature neurons respectively. E) Quantification
of TBR2+ve
cells in the VZ/SVZ, intermediate zone (IZ) and the cortical plate (CP) at E12.5-
17.5. F) Quantification of immature neurons (TBR1+ve
) in the CP of wild-type and WDR62
mutant brains at E17.5. All scale bars - 20 m. Mean values ± SEM are depicted. *p<0.05,
**p<0.01, ***p<0.001 and ****p<0.0001 (t-test).
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
33
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
34
Figure 3. WDR62 missense mutations perturb division orientation of apical progenitors
and increase cell cycle exit. A) Mitotic radial glia (PAX6+ve
, pHH3+ve
) undergoing vertical
(60°-90°) and horizontal (0°-30°) divisions typical of symmetric and asymmetric divisions
respectively. Scale bars - 5 m. Division angles of mitotic radial glia in the VZ of WDR62
mutant embryos (E15.5) were quantified and expressed within 0°-30°, 30°-60° and 60°-90°
ranges or B) expressed in a dot plot with mean angles indicated (red line). C) Cell cycle exit
analysis of 24 h BrdU labelled coronal brain sections from wild-type and WDR62 mutant
mice (E15.5) and stained for BrdU (green) labeling and Ki67 (red) as a proliferation marker.
Scale bars - 20 m D) Cell cycle exit index in WDR62 mutant and wild-type mice
determined by counting BrdU+ve
/Ki67-ve
cells and expressed as a proportion of total BrdU+ve
cells. E) TUNEL staining of apoptotic cells in coronal brain sections of wild-type and
WDR62 mutant embryos at E15.5 F) Quantification of TUNEL+ve
cells in the neocortex.
Scale bars - 20 m. Mean values ± SEM are depicted. *p<0.05, **p<0.01, ***p<0.001,
****p>0.0001 and ns; not significant (t-test).
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
35
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
36
Figure 4. WDR62 mutations disrupt normal cilia regulation in the developing cortex.
A) Cortical sections from WDR62stop/stop
, WDR62V66M/V66M
, WDR62R439H/R439H
E15.5
embryos were stained for primary cilia (Arl13b/γ-tubulin) and representative images from the
VZ and SVZ shown. Scale bars - 20 μm. B) Percentage of ciliated cells within the SVZ at
E15.5. C) Measured length of primary cilia at E15.5 within the VZ/SVZ of developing
cortex. D) Measured length of primary cilia within the ventricular zone of the developing
cortex of WDR62stop/stop
, WDR62V66M/V66M
, WDR62R439H/R439H
embryos at E12.5 compared to
wild-type (+/+). Mean values ± SEM. **p<0.01, ***p<0.001 and ****p<0.0001 (t-test). E)
Radial glia in the VZ at E12.5 were stained with Arl13b (green) and γ-tubulin (red) to
visualize primary cilia. Arrow heads indicate ciliary remnants in WDR62 mutant mice. Scale
bars - 30 μm.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
37
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
38
Figure 5. WDR62 missense mutations cause axonemal and basal body defects A)
Primary MEFs were isolated from WDR62stop/stop
, WDR62V66M/V66M
, WDR62R439H/R439H
or
wild-type (WDR62+/+
) embryos (E14.5) and serum starved to induce cilia formation. WDR62
expression and localization (green) on primary cilia (marked by Arl13b, red) was determined
by immunostaining. B) Percentage of ciliated MEFs derived from WDR62 mutant or wild-
type embryos. C). Measured length of primary cilia in MEFs. D) Quantification of cilia
length following transient expression of WDR62-GFP in WDR62stop/stop
MEFs. E)
Representative images of primary cilia (Arl13b/tubulin) and WDR62-GFP expression in
WDR62stop/stop
MEFs. F) Representative images and G) quantification of primary MEFs
derived from WDR62 mutant mice with multiple axonemes. H) Representative images and I)
quantification of MEFs with multiple basal bodies indicated by the mother centriole marker
CEP170. All scale bars - 5 μm. Insets show individual fluorescence channels or higher
magnification images of cilia. Values are *p<0.05, **p<0.01 ***p<0.001 and ****p<0.0001.
Mean values ± SEM.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
39
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
40
Figure 6. CPAP recruitment to the basal body is perturbed by WDR62 mutations. A)
Centrosomal localization (marked by tubulin, red) of CPAP (green) in VZ/SVZ cortical
layers of WDR62stop/stop
, WDR62V66M/V66M
, WDR62R439H/R439H
or wild-type (WDR62+/+
)
embryonic brains at E12.5. B) Intensity of CPAP staining at the centrosome in WDR62
mutant embryos compared to wild-type. C) Evaluation of CPAP co-localized with tubulin at
centrosomes using Pearson’s correlation coefficient. D) CPAP localization in primary MEFs
isolated from WDR62stop/stop
, WDR62V66M/V66M
, WDR62R439H/R439H
or wild-type (WDR62+/+
)
embryos (E14.5). Inset indicates reduced CPAP (green) (scale bars - 5 μm). E) Intensity of
CPAP staining at the centrosome in WDR62 mutant MEFs compared to wild-type. F)
Immunoprecipiation of WDR62 from primary MEFs. WDR62 pulldown, co-precipitation of
CPAP and protein expression in total cell lysates (TCL) were determined by immunoblot
analysis. G) Representative images of CPAP (cyan) centrosomal localization and H)
quantification of CPAP intensity at the centrosome following WDR62-GFP expression in
WDR62-depleted MEFs. I) Representative images and J) quantification of CPAP (cyan)
localization at the centrosome following expression of WDR62 N-GFP (aa 1-841) and
WDR62 C-GFP (aa 842-1523) truncation mutants in WDR62stop/stop
MEFs. Insets show
higher magnification or individual fluorescence channels at centrosomes. All scale bars - 5
μm. Mean value ± SEM. ****p<0.0001, (t-test).
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
41
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
42
Figure 7. WDR62 mutations disrupt IFT-88 localization to primary cilia. A) IFT88
localization to primary cilia in VZ/SVZ cortical layers of WDR62stop/stop
, WDR62V66M/V66M
,
WDR62R439H/R439H
or wild-type (WDR62+/+
) embryonic brains at E12.5. B) IFT88 staining
intensity (region measured indicated within insets in A.) in WDR62 mutant and wild-type
brains. C) Evaluation of IFT88 co-localized with tubulin at centrosomes using Pearson’s
correlation coefficient. D) IFT88 co-localization with markers of axonemes (Arl13b) and
basal body (-tubulin) in WDR62 mutant and wild-type MEFs. E) IFT88 fluorescence
intensity at the basal body in WDR62 mutant MEFs was quantified and compared with wild-
type (WDR62+/+
). F) Representative images and G) quantification of IFT88 staining intensity
at the centrosome following WDR62-GFP expression in WDR62-depleted MEFs
(WDR62stop/stop
). Mean values are indicated (red line). ****p<0.0001. Insets show higher
magnification or individual fluorescence channels at centrosomes. All scale bars - 5 μm. H)
Illustrative diagram of WDR62 function in recruiting CPAP/IFT88 for cilia formation in
neuroprogenitors.
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019
43
Dow
nloaded from https://academ
ic.oup.com/hm
g/advance-article-abstract/doi/10.1093/hmg/ddz281/5670498 by U
niversity of Queensland Library user on 17 D
ecember 2019