Post on 03-Jan-2017
1
Sialic acid transport contributes to pneumococcal colonization
Carolyn Marion1, 2, Amanda M. Burnaugh1, 2, Shireen A. Woodiga1, Samantha J. King*1, 2
1Center for Microbial Pathogenesis, The Research Institute at Nationwide Children’s Hospital,
and 2Department of Pediatrics, The Ohio State University College of Medicine, Columbus, OH.
Running title: Sialic acid transport in pneumococcus
Corresponding author: Samantha J. King, Ph.D.
Department of Pediatrics, The Ohio State University College of Medicine, and The Research
Institute at Nationwide Children’s Hospital, Center for Microbial Pathogenesis
Room W511
700 Children’s Drive
Columbus, OH 43205-2696 USA
Phone: (614) 722-2912
Fax: (614) 722-2818
e-mail: samantha.king@nationwidechildrens.org
Key-words: Streptococcus pneumoniae, sialic acid, bacterial colonization, ABC transport
Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.00832-10 IAI Accepts, published online ahead of print on 28 December 2010
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
2
Abstract 1
Streptococcus pneumoniae is a major cause of pneumonia and meningitis. Airway 2
colonization is a necessary precursor to disease, but little is known about how the bacteria 3
establish and maintain colonization. Carbohydrates are required as a carbon source for 4
pneumococcal growth and, therefore, for colonization. Free carbohydrates are not readily 5
available in the naso-oropharynx; however, N- and O-linked glycans are common in the 6
airway. Sialic acid is the most common terminal modification on N- and O-linked glycans, and 7
is likely encountered frequently by S. pneumoniae in the airway. Here we demonstrate that 8
sialic acid supports pneumococcal growth when provided as a sole carbon source. Growth on 9
sialic acid requires import into the bacterium. Three genetic regions have been proposed to 10
encode pneumococcal sialic acid transporters: one sodium solute symporter, and two ATP 11
binding cassette (ABC) transporters. Data demonstrate that one of these, satABC, is required 12
for transport of sialic acid. A satABC mutant displayed significantly reduced growth on both 13
sialic acid and the human glycoprotein, alpha-1. The importance of satABC for growth on 14
human glycoprotein suggests that sialic acid transport may be important in vivo. Indeed, the 15
satABC mutant was significantly reduced in colonization of the murine upper respiratory tract. 16
This work demonstrates that S. pneumoniae is able to use sialic acid as a sole carbon source 17
and that utilization of sialic acid is likely important during pneumococcal colonization. 18
19
Introduction 20
Streptococcus pneumoniae (pneumococcus) is responsible for over one million deaths per 21
year worldwide (42). Although asymptomatic, colonization of the naso-oropharynx is required 22
for the bacteria to cause disease (38). Relatively little is known about pneumococcal growth 23
and colonization of the airway. Carbohydrates provide a carbon source to the bacteria and are 24
therefore necessary for growth. Free carbohydrates are not readily available in the airway 25
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
3
where initial colonization occurs (24). Instead, carbohydrates are found in the form of glycan 26
modifications on human lipids and proteins. 27
28
S. pneumoniae express at least nine surface-associated glycosidases that modify host glycans 29
(for review, see (12)). The ability to deglycosylate host glycans could contribute to bacterial 30
survival by multiple mechanisms including but not limited to: providing a carbon source for 31
growth, modifying function of host clearance molecules, competing with other bacteria for a 32
niche, aiding in movement through the mucin layer and promoting adherence to epithelial cells 33
(3, 8, 14, 29, 33, 43). It was previously demonstrated that pneumococci sequentially 34
deglycosylate both N- and O-linked glycan structures (14, 18). We have demonstrated that S. 35
pneumoniae can grow on a human protein decorated with N-linked glycans and that this 36
growth is dependent on the ability of the bacteria to sequentially deglycosylate this structure 37
(3). The most common terminal carbohydrate present on N- and O-linked glycans is sialic acid, 38
which is cleaved by pneumococcal neuraminidase NanA. As sialic acid is the initial sugar 39
released during sequential deglycosylation, we hypothesize it will contribute to pneumococcal 40
growth in vivo. 41
42
Further supporting our hypothesis that sialic acid can be utilized for growth, S. pneumoniae is 43
predicted to encode required proteins for the catabolism of sialic acid (2). While the catabolic 44
enzymes appear to be conserved amongst many bacterial species, four distinct mechanisms 45
of sialic acid transport have been identified: the major facilitator superfamily, sodium solute 46
symporters, tripartite ATP-independent transporters, and ATP-binding cassette (ABC) 47
transporters (1, 2, 25-27, 30, 36). Through a bioinformatics approach, a putative sodium 48
solute symporter encoded by open reading frame SP1328 in strain TIGR4 was initially 49
predicted to be the primary pneumococcal sialic acid transporter (32, 35). Based on similarity 50
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
4
to known sialic acid transporter components, it was later suggested that putative permease 51
components of the ABC transporters SP1681-3 and SP1688-90 may also be involved in sialic 52
acid uptake (2). 53
54
Here, we show that S. pneumoniae can utilize sialic acid as a carbon source for growth. 55
Furthermore, using mutants in the three predicted transporters we identify the ABC transporter 56
encoded by SP1681-3 as the primary sialic acid transporter. This sialic acid transporter 57
contributes to growth on a human glycoprotein and colonization in vivo. Together, these data 58
suggest that sialic acid transport may be important for pneumococcal pathogenesis. 59
60
Materials and Methods 61
Bacterial strains, culture media, and chemicals. Parental and genetically modified strains of 62
S. pneumoniae utilized in this study are described in Table 1. Broth cultures were routinely 63
grown at 37°C in Todd-Hewitt broth (Becton, Dickinson, and Company) supplemented with 64
0.2% w/v yeast extract (Becton, Dickinson, and Company) (THY). C media with 5% yeast 65
extract (C+Y) pH 8.0 was used for transformations. Chemically defined medium (CDM) was 66
used for growth analyses and was supplemented with no sugar, 12 mM glucose, 12 mM sialic 67
acid, or 5 mg ml-1 alpha-1 glycoprotein (AGP), as indicated (15). S. pneumoniae was also 68
grown at 37°C and 5% CO2 overnight on tryptic soy agar plates (Becton, Dickinson, and 69
Company) spread with 5000 U of catalase (Worthington Biochemical Corporation) prior to 70
plating bacteria as well as on trypic soy agar plates supplemented with 5% sheep blood 71
(Becton, Dickinson, and Company). Bacteria were selected on tryptic soy agar plates that 72
contained streptomycin (200 µg ml-1), kanamycin (500 µg ml-1), chloramphenicol (2.5 µg ml-1) 73
or neomycin (20 µg ml-1), as appropriate. 74
75
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
5
Unless otherwise specified, all chemicals, substrates, and enzymes were purchased from 76
Sigma Chemicals. 77
78
Construction of mutants. Unmarked, in-frame deletions of the putative sialic acid 79
transporters were generated using the Janus cassette selection system (31). This method 80
requires two rounds of transformations. The first round introduces an engineered cassette 81
conferring kanamycin resistance and streptomycin sensitivity (rpsL+) into a streptomycin 82
resistant (Smr) parental strain. Regions flanking the gene(s) of interest were amplified with 83
primers 1 and 2, and 4 and 6, then sequentially joined to the Janus cassette using modified 84
splicing by overlap extension (SOE) (3, 10). A high fidelity proofreading polymerase, Pfx-50, 85
(Invitrogen) was used throughout to minimize PCR-generated errors and all genomic DNA was 86
prepared essentially as described previously (41). All Janus constructs were transformed into 87
pneumococci and transformants were selected on kanamycin and confirmed by PCR with 88
primers 7 and 8, which flank the mutant construct. All primer sequences can be found in Table 89
2. 90
91
The second round of transformation replaced the Janus cassette with a DNA construct 92
consisting of the fragments flanking the region to be deleted; these fragments were generated 93
with primers 1 and 3, and 5 and 6 and joined by SOE PCR. Introduction of this construct 94
restores kanamycin sensitivity and streptomycin resistance. Transformants were confirmed by 95
PCR with primers 7 and 8 and genetic sequencing of this same region confirmed that no 96
spurious mutations had been introduced during generation of the mutants. As opacity can also 97
affect pneumococcal colonization and glycosidase expression all mutants were confirmed as 98
being of the same opacity as that of their parental strains (13, 40). 99
100
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
6
All mutants have been genetically reconstituted by reintroducing the deleted region into the 101
same genetic location in the same orientation through two additional rounds of genetic 102
transformation: one to reintroduce the cassette and the second to restore the original parental 103
region. Growth of all strains was tested in rich medium to ensure that the mutation did not 104
introduce generalized growth defects. 105
106
The glycosidase NanA is predicted to be encoded in a single gene transcript (32). Therefore, 107
an insertion-deletion mutation was constructed as previously described (13, 14). 108
109
RNA extraction and reverse transcriptase PCR. The Janus system of mutant generation is 110
designed to generate unmarked mutants; however, as the genes encoding the predicted ABC 111
transporters are predicted to be in operons, we demonstrated the mutants had no effect on 112
transcription of the distal genes by reverse transcriptase PCR. RNA extraction was conducted 113
using a modified RNeasy extraction protocol (Qiagen). Bacteria were grown in THY to OD600 = 114
0.3 ± 0.01. Each 5 ml culture was centrifuged and resuspended in 500 µl of 10 mM Tris, 50 115
mM EDTA (pH 8) and cells were lysed by addition of 30 µl of sodium N-lauroyl sarcosinate 116
(20% w/v) with incubation for 10 min at 37°C. Concentrated samples were combined with 2 ml 117
of Tri-Reagent (MRC Inc.) and allowed to stand at room temperature for 5 min. A 400 µl 118
aliquot of chloroform was added to each sample followed by gentle shaking for 15 s and then 119
allowed to stand at room temperature for an additional 3 min. After centrifugation at 4000 x g 120
at 4°C for 15 min, the aqueous layer was removed and 1 volume of 75% ethanol was added 121
and mixed by pipetting. Samples were then processed on RNeasy mini columns (Qiagen), 122
eluted into 30 µl of RNAse-free water and quantified on a Nanodrop spectrophotometer. 123
124
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
7
After DNAse I treatment (Invitrogen), 1 µg of RNA was used for cDNA synthesis with 125
SuperScript II reverse transcriptase (Invitrogen) according to the manufacturer’s specifications. 126
Parallel samples lacking reverse transcriptase were processed and served as a negative 127
control for each sample to ensure purity of RNA isolation. cDNA and no reverse transcriptase 128
negative control samples were tested by PCR; primers 9 and 10 were designed in the 129
immediate downstream gene to the relevant mutations, and primers RT.F and RT.R are within 130
a control housekeeping gene, aroE (Table 2). Products were visualized by agarose gel 131
electrophoresis and ethidium bromide staining. 132
133
Dialysis of human alpha-1 glycoprotein (AGP). Dialysis was conducted in order to remove 134
any free sugar from AGP as previously described (3). The Slide-A-Lyzer dialysis cassette 135
(10,000 molecular weight cutoff) was used according to the instructions of the manufacturer 136
(Pierce). Human AGP was reconstituted at 10 mg ml-1 in distilled water (dH2O) and dialyzed 137
against 2 L of dH2O at 4°C for 2 h and then overnight in fresh, prechilled dH2O (2 L). Samples 138
were concentrated using Slide-A-Lyzer concentrating solution (Pierce) according to the 139
instructions provided, and the protein was then extracted, diluted to the original volume, filter 140
sterilized, and stored at 4°C. 141
142
Growth Assays. Growth assays were conducted essentially as described previously by our 143
laboratory (3). S. pneumoniae strains were grown in THY medium to an OD600 of 0.6 ± 0.005, 144
representative of exponential growth, and 1 ml was washed and resuspended in 130 µl of 1:1 145
phosphate buffered saline (PBS):catalase (3x104 U ml-1). 20 µl of bacterial suspension or 146
PBS/catalase (no bacteria control) was added to 180 µl of CDM supplemented with the 147
appropriate carbon source (12 mM glucose, 12 mM sialic acid, or 5 mg ml-1 AGP). Medium 148
supplemented with glucose (12 mM) was used as a positive control in all experiments to 149
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
8
confirm the viability of strains. Medium supplemented with no sugar served as a negative 150
control in all experiments. Plates were incubated at 37oC in a BIO-TEK Synergy HT plate 151
reader for at least 60 h and OD600 was measured every 20 min. 152
153
Data were corrected for path-length and the averages from triplicate no-sugar medium controls 154
were subtracted from values for experimental wells. Results for triplicate wells were then 155
averaged, and this value was considered as one datum point for further analysis. Data from at 156
least three independent experiments were averaged, and the 95% confidence interval was 157
calculated for each time point. 158
159
To determine if the growth of bacterial inoculums on rich media contributed to the delay 160
observed in growth on sialic acid, as compared to glucose, we prepared inoculums from 161
bacteria grown on sialic acid. Bacteria were prepared and grown on sialic acid in a 96-well 162
plate as described above. When strains reached a path-length corrected OD600 of 0.3, 163
bacteria were harvested from the wells, pooled, washed in PBS and resuspended in 1:1 164
PBS:catalase. To ensure a fair comparison of growth between conditioned and non-165
conditioned bacteria it is important to use essentially identical bacterial inoculums. To achieve 166
this goal a range of dilutions of the conditioned bacteria recovered from the plate was used to 167
inoculate fresh sialic acid media. Enumeration of inoculums allowed selection of wells 168
containing inoculums closest to but not exceeding the original inoculums. 169
170
Neuraminidase activity assay. Neuraminidase activity was measured using a fluorimetric 171
assay (16). The fluorogenic substrate 2’-(4-methyl-umbelliferyl)-a-D-N acetylneuraminic acid 172
(MUAN) was resuspended in 0.25 M sodium acetate buffer (pH 7) at 0.35% (wt/vol) and stored 173
in aliquots at -20°C. After cultures were grown to an OD600 of 0.2 ± 0.01 in CDM 174
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
9
supplemented with 5 mg ml-1 AGP, bacteria were toluene lysed. 10 µl of MUAN was mixed 175
with 10 µl of bacterial lysate and incubated at 37°C for 5 min. The reaction was stopped by the 176
addition of 1.5 ml of 50 mM sodium carbonate buffer pH 9.6. The fluorescence was detected 177
using a BIO-TEK Synergy HT plate reader at an excitation wavelength of 366 nm and an 178
emission wavelength of 446 nm. The average fluorescence of controls with media alone was 179
subtracted from the sample readings. Experiments were conducted three times in triplicate; 180
significance was determined by a two-tailed Student’s t-test, and a P-value below 0.05 was 181
considered significant. 182
183
Southern blot. Distribution of SP1328 was assessed via Southern blot analysis. Each 2 µg 184
sample of genomic DNA was digested with the restriction enzyme EcoRV (Fisher Scientific) for 185
2 h at 37°C. Samples were resolved on a 1% agarose gel and visualized by ethidium bromide 186
staining to ensure that DNA was digested and present in each lane. The Turboblotter rapid 187
alkaline transfer system (Whatman) was used according to the manufacturer’s instructions to 188
transfer digested DNA to a polyvinylidine fluoride membrane. DNA was crosslinked to the 189
membrane via UV radiation. The DNA probe was generated via PCR using primers C.9 and 190
C.10 (Table 2) and labeled using the ECL Direct Nucleic Acid Labeling and Detection System 191
(GE Life Sciences). Hybridization was conducted as per the manufacturer’s instructions and 192
followed by autoradiography to detect DNA binding. 193
194
Sialic acid transport assay. Cultures of parental and mutant S. pneumoniae strains were 195
grown in THY broth to an OD600 of 0.6 ± 0.01. Each sample was pelleted, washed in PBS and 196
concentrated in CDM without sugar to an OD600 = 2.0. CDM containing sialic acid was 197
prepared such that [3H]-sialic acid (American Radiolabeled Chemicals Inc.) accounted for 1% 198
total sialic acid. Triplicate 90 µl aliquots were first incubated for 3 min at 37°C to acclimate. 199
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
10
CDM medium containing sialic acid was then added to the culture to achieve a final 200
concentration of 2.5 µM. After incubation at 37°C for the designated time, reactions were 201
terminated by filtration through 0.22 µm filters (Millipore). Filters were washed 3 times with 2 202
ml CDM without sugar. After air-drying the filters, 10 ml of 30% ScintiSafe LCS Cocktail 203
(Fisher Scientific) was added to each sample. Incorporated sialic acid was measured in a 204
Packard Tri-Carb Liquid Scintillation Analyzer. Average measurements conducted with heat-205
killed bacteria were subtracted from each value. Data were normalized to label incorporated 206
per 107 cells. Time course experiments were conducted twice in triplicate. All other transport 207
experiments were conducted three times in triplicate. Where applicable, significance was 208
determined by a two-tailed Student’s t-test and a P-value below 0.05 was considered 209
significant. 210
211
Murine colonization. Nasopharyngeal colonization was performed as described previously 212
(19). Groups of 10, 6 to 8 week-old female C57BL/6 mice (Jackson Laboratory) were 213
inoculated intranasally with 1 x 108 mid-log-phase organisms of 1121 Smr, 1121 ∆satABC, 214
1121 ∆SP1688-90, 1121 ∆satABC ∆SP1688-90, or 1121 ∆nanA. After 5 days, the density of 215
colonization was assessed by upper respiratory tract lavage and quantitative culture of 216
recovered organisms on tryptic soy agar supplemented with neomycin. The animal data are 217
presented as the mean colony forming units ml-1 ± SEM (standard error of the mean). 218
Significance was assessed by a two-tailed Student’s t-test; a P-value below 0.05 was 219
considered significant. 220
221
Results 222
S. pneumoniae can utilize sialic acid as a sole carbon source. We have previously 223
demonstrated the ability of S. pneumoniae to remove sialic acid from both N- and O-linked 224
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
11
glycans via neuraminidase cleavage (3, 14, 18). As sialic acid is found terminally positioned 225
on glycoconjugates, S. pneumoniae likely encounters sialic acid frequently in the airway (7). 226
Release of sialic acid may thus provide S. pneumoniae with a source of carbohydrates 227
necessary for growth. To first test whether sialic acid could be used as a sole carbon source, 228
bacteria were grown in CDM supplemented with sialic acid. Sialic acid was able to support 229
significant pneumococcal growth (OD600=0.4), although, this growth was delayed and to a 230
lower final optical density than growth in glucose at the same molar concentration (Fig. 1). 231
Conditioning bacteria in sialic acid media resulted in a reduction, but not elimination, of the 232
time taken to achieve the maximal optical density (data not shown). These data suggest that 233
the delay in growth on sialic acid is in part due to the prior growth of the bacteria in rich media. 234
235
To determine whether sialic acid can support the growth of diverse pneumococcal strains, 236
recent clinical isolates of different serotypes and genetic backgrounds (Table 1) were tested for 237
their ability to utilize sialic acid as a sole carbon source (data not shown). While growth rate 238
and maximal OD600 achieved varied, each strain tested grew on sialic acid, suggesting that the 239
ability to utilize sialic acid is conserved. In order for S. pneumoniae to utilize sialic acid as a 240
nutrient source, the bacteria must have a mechanism for import of the carbohydrate; however, 241
no pneumococcal sialic acid transporter has yet been identified. 242
243
Proposed pneumococcal sialic acid transporters. Based on annotation of the TIGR4 244
genome, three distinct genetic regions have been suggested to encode sialic acid transporters: 245
a predicted sodium solute symporter SP1328, and two predicted ABC transporters SP1681-3, 246
and SP1688-90 (Fig. 2) (2, 27, 32, 35). Of these, the predicted sodium solute symporter 247
(SP1328) was previously proposed to be the primary transporter (35). However, the open 248
reading frame SP1328 is absent in at least half of pneumococcal strains (23, 35). By Southern 249
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
12
blot analysis, strain 1121, and 4 of 5 recent clinical isolates tested were shown to lack 250
homologs to SP1328, and yet were all able to maintain growth upon sialic acid (Fig. 1, data not 251
shown). These data suggest that SP1328 is not the primary sialic acid transporter; therefore, 252
initial efforts focused on determining the role of the two putative ABC transporters. 253
254
The open reading frames SP1681-3 and SP1688-90 are predicted to encode components of 255
ABC transporters (Fig. 2) (32). Unlike the predicted symporter, both loci are considered to be 256
part of the pneumococcal core genome (20). Presence of open reading frames SP1681-3 and 257
SP1688-90 was confirmed in strain 1121 and five recent clinical isolates by PCR amplification 258
(Table 1, data not shown). These genes exist in proximity to the genes encoding the two 259
characterized neuraminidases, NanA and NanB, as well as a predicted sugar kinase 260
(SP1675), a predicted N-acetylneuraminate lyase (SP1676), and a predicted N-261
acetylmannosamine-6-phosphate 2-epimerase (SP1685) (32). Together, this evidence 262
suggests that one or both of these predicted ABC transporters are involved in sialic acid 263
utilization. 264
265
SP1681-3 (satABC) is required for growth on sialic acid. In order to test whether SP1681-266
3 or SP1688-90 contribute to growth on sialic acid, unmarked deletions were constructed, 267
resulting in strains 1121 ∆1681-3, 1121 ∆1688-90, and 1121 ∆1681-3 ∆1688-90. Mutations 268
were confirmed by both PCR and sequencing and determined to lack polar effects by reverse-269
transcriptase PCR (data not shown). Data suggest that only one of these regions, SP1681-3, 270
contributed to growth on sialic acid (Fig. 3). As such, 1121 ∆1681-3, but not 1121 ∆SP1688-271
90, showed a significant reduction in growth (maximum OD600 < 0.1) compared to the parental 272
strain 1121 Smr. The double mutant showed no additional reduction in growth, suggesting that 273
no additive effect of the two transporters existed (data not shown). All mutant strains were 274
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
13
genetically reconstituted, and each reconstituted strain grew as efficiently as the parent on 275
sialic acid (data not shown). These data suggest that SP1681-3 encodes the primary sialic 276
acid transporter in S. pneumoniae, and henceforth is referred to as the sialic acid transporter, 277
satABC. In this locus, satA (SP1683) is predicted to encode a substrate binding protein, while 278
satB (SP1682) and satC (SP1681) are predicted to encode permease components. 279
280
satABC is required for transport of sialic acid. To directly test whether satABC encodes a 281
sialic acid transporter, uptake assays utilizing radiolabeled sialic acid were conducted. A time 282
course experiment with the parental strain was conducted first to demonstrate temporal 283
increase in uptake of [3H] sialic acid (Fig. 4A). From this experiment, a ten-minute incubation 284
time was selected for subsequent experiments. When compared to the parent strain, 1121 285
∆satABC was significantly reduced in uptake of [3H] sialic acid (Fig 4B). While SP1688-90 286
showed no growth defect on sialic acid, it remained possible that this predicted transporter was 287
still responsible for some uptake of sialic acid. However, the SP1688-90 mutant strain showed 288
no statistically significant reduction in transport of sialic acid under these conditions and the 289
double mutant showed no significant reduction in transport compared to the satABC single 290
mutant (Fig. 4B). These data demonstrate that satABC encodes the primary transporter for 291
sialic acid under these conditions. 292
293
The SP1328 predicted symporter does not contribute to sialic acid transport. Although 294
1121 lacks the predicted sodium solute symporter, it remained possible that SP1328 295
contributes to transport of sialic acid when present. To test this, we measured the uptake of 296
[3H] sialic acid in the TIGR4 strain which contains all three candidate transporters. TIGR4 297
∆satABC showed a significant reduction in sialic acid transport which could be restored in the 298
genetically reconstituted strain, TIGR4 ∆satABC /satABC+ (Fig. 4C). A TIGR4 ∆satABC 299
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
14
∆SP1688-90 ∆SP1328 triple mutant had no greater reduction compared to the satABC mutant, 300
which suggests that neither SP1688-90 nor SP1328 contribute to sialic acid import under these 301
assay conditions. Overall transport in the TIGR4 background was lower than for 1121; this is 302
consistent with the delayed growth and lower maximal OD achieved when TIGR4 is grown on 303
sialic acid as a sole carbon source (data not shown). Together, these data suggest that 304
satABC encodes the primary sialic acid transporter in multiple strain backgrounds. 305
306
satABC contributes to growth on human glycoprotein. While the data presented 307
demonstrate that SatABC transports sialic acid, we wanted to test whether this transport 308
contributed to growth on human glycoprotein. We have previously shown that S. pneumoniae 309
can grow on a model human glycoprotein, AGP (3). AGP is decorated with complex N-linked 310
glycans containing terminal sialic acid, galactose, and N-acetylglucosamine. These three 311
carbohydrates can be sequentially cleaved by pneumococcal exoglycosidases (neuraminidase 312
NanA, beta-galactosidase BgaA, and N-acetylglucosaminidase StrH) and used for growth. 313
Mutation of any of these exoglycosidases results in a reduction in growth (3). Thus, sialic acid 314
released by neuraminidase and transported by SatABC likely contributes to growth of S. 315
pneumoniae. We therefore hypothesized that the inability to transport sialic acid would result 316
in a reduction, but not elimination of growth on AGP. 317
318
When 1121 Smr and the satABC mutant were grown on AGP, a significant reduction in growth 319
on AGP was seen for 1121 ∆satABC (Fig. 5); growth was restored in the 1121 320
∆satABC/satABC+ reconstituted strain (data not shown). As was the case with growth on free 321
sialic acid, 1121 ∆1688-90 was not significantly reduced in growth on AGP and the double 322
mutant showed no further reduction compared to 1121 ∆satABC (Fig. 5 and data not shown), 323
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
15
suggesting that SP1688-90 does not contribute to growth on AGP under these experimental 324
conditions. 325
326
As the transport of a substrate into the cell often upregulates utilization pathways, it was 327
possible that 1121 ∆satABC may express lower neuraminidase levels than 1121 Smr (6, 11). 328
A reduction in neuraminidase expression would reduce cleavage of sialic acid, which would 329
restrict other pneumococcal glycosidases from releasing underlying carbohydrates for growth. 330
To determine if less efficient cleavage of carbohydrates from AGP significantly contributed to 331
the reduced growth of 1121 ∆satABC, the neuraminidase activity of bacteria growing on AGP 332
(OD600 = 0.3) was determined. No significant difference in neuraminidase activity between the 333
mutant and parental strain was observed (data not shown). This supports the original 334
hypothesis that the inability to utilize sialic acid results in a reduction in growth on AGP. As 335
glycoconjugates are likely used as a carbon source during colonization, these data suggest 336
that sialic acid utilization contributes to growth in the airway. 337
338
satABC contributes to airway colonization. Although no reduction in colonization was 339
observed in a ∆nanA mutant compared to the parental strain, it remained possible that 340
transport of sialic acid may still contribute to colonization (data not shown). Indeed, 341
significantly fewer bacteria were recovered from the upper respiratory tract of mice inoculated 342
with 1121 ∆satABC when compared to those inoculated with 1121 Smr, suggesting that sialic 343
acid transport contributes to colonization (Fig. 6). In contrast, 1121 ∆1688-90 showed no 344
significant attenuation in vivo and there was no statistically significant difference in colonization 345
between 1121 ∆satABC and 1121 ∆satABC ∆1688-90. Although we cannot rule out that 346
SP1688-90 is important at other times during infection or that its role is human-specific, these 347
data suggest that SP1688-90 does not contribute to airway colonization. Collectively, these 348
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
16
data demonstrate that satABC, and presumably transport of sialic acid, is important for 349
colonization of the naso-oropharynx. 350
351
Discussion 352
Data here demonstrate that sialic acid can be used as a sole carbon source for growth. 353
Several bacteria that are able to colonize the human airway or gut mucosa have been shown 354
to utilize sialic acid as a carbon source, including H. influenzae, and multiple streptococcal and 355
bifidobacteria strains (4, 5, 28, 34, 37). Growth of S. pneumoniae on free sialic acid appeared 356
less efficient than growth on the same molar concentration of glucose under our experimental 357
conditions. While the reason for this remains unknown, it may relate to the differences in the 358
carbohydrate structures, or mechanisms of transport. Even though growth on sialic acid may 359
be less efficient than other carbohydrates, because it is often the first carbohydrate 360
encountered on glycoconjugates it is likely used as a carbon source in the airway. 361
362
Growth on sialic acid is dependent upon satABC which encodes an ABC transporter. The 363
absence of satABC resulted in reduced bacterial growth on a human glycoprotein and reduced 364
colonization in a mouse model, suggesting that this genetic locus and therefore transport of 365
sialic acid are important for human airway colonization. Previous studies have suggested co-366
regulation of the operon containing satABC and nanA; as nanA encodes the neuraminidase 367
that cleaves terminal sialic acid from host glycoconjugates, these data suggest the cleavage 368
and utilization of sialic acid is a coordinated process (13). 369
370
Despite this, a nanA mutant showed no reduction in colonization in the same model, although 371
a role for NanA in murine colonization has previously been demonstrated (17, 21). The reason 372
for this discrepancy is unclear, but data here are consistent with our previous colonization 373
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
17
modeling with nanA mutants in other strain backgrounds (13, 14). These results may indicate 374
that SatABC has additional unidentified substrates or that sialic acid is being made available to 375
pneumococcus by some other mechanism. It is possible that host protein turnover or 376
neuraminidases from other sources, including the host, other bacterial cohabitants of the 377
niche, or pneumococcus itself (NanB), may each contribute to sialic acid availability that is 378
independent of NanA. 379
380
The SatABC transporter is a member of the ABC transport superfamily. Although other ABC 381
transporters are predicted to import sialic acid, the only other characterized ABC transporter 382
responsible for sialic acid import is SatABCD in Haemophilus ducreyi (25). ABC importers 383
require two nuclear binding domains (ATPases), two transmembrane domains (permeases) 384
and a substrate-binding domain that confers specificity (9, 22). The genetic organization of 385
satABC in pneumococcus notably lacks predicted ATPases. While transport components are 386
typically organized within a single operon, there are other examples of streptococcal species 387
lacking ATPases in operon organization (39). Our data show that the SatABC transporter is 388
functional for uptake and utilization of sialic acid, and thus require that the ATPases be 389
encoded elsewhere. 390
391
The functions of the other two predicted sialic acid transporters remain unknown. Despite 392
SP1688-90 and SP1328 being located within the same operons as nanB and nanC, 393
respectively, we could demonstrate no role for either in sialic acid transport under our assay 394
conditions. These data suggest that the additional predicted transporters are either specific for 395
other substrates or contribute to sialic acid transport under other conditions. SP1688-90 is 396
considered part of the core pneumococcal genome and as such is likely essential for some 397
aspect of pathogenesis. In contrast, the gene encoding the predicted symporter (SP1328) is 398
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
18
not part of the core genome (20). SP1328 is encoded within a 20 kb region that correlates with 399
invasive disease; although, how each gene product within this region contributes to this is 400
unknown (20). The absence of this region in some strains demonstrates that SP1328 cannot 401
be essential for human colonization (23). Furthermore, our data demonstrate that this locus is 402
not essential for invasive disease as neither of our clinical isolates recovered from blood 403
possess this genomic region (Table 1). 404
405
The human glycoprotein AGP contains N-linked glycans with sialic acid, galactose, and N-406
acetylglucosamine that can be sequentially cleaved by pneumococcal glycosidases (14). Here 407
we show that sialic acid released from AGP is imported via SatABC and utilized as a carbon 408
source for growth. For these experiments, a limiting concentration of AGP was used; given the 409
solubility of AGP, higher concentrations of AGP could not be tested. This leaves open the 410
possibility that sialic acid is not utilized for growth in vivo where pneumococcus presumably 411
encounters an excess of glycoconjugates. However, the significant reduction of the satABC 412
mutant in murine colonization supports the hypothesis that sialic acid is used as a carbon 413
source in vivo. 414
415
In summary, we have demonstrated that S. pneumoniae is able to utilize sialic acid as a sole 416
carbon source and have identified satABC as encoding an ABC transporter specific for sialic 417
acid. Furthermore, we have shown that import of sialic acid by SatABC contributes to 418
colonization in the airway. 419
420
Acknowledgements 421
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
19
This work was supported by the American Heart Association Predoctoral Fellowship 422
10PRE3490014 (CM) and the National Institute of Allergy and Infectious Diseases grant 423
1R01AI076341 (SJK). 424
425
We thank Dr. Robert Munson Jr. for his assistance with design of the transport assays.426
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
20
427
References 428
1. Allen, S., A. Zaleski, J. W. Johnston, B. W. Gibson, and M. A. Apicella. 2005. Novel 429
sialic acid transporter of Haemophilus influenzae. Infect Immun 73:5291-5300. 430
2. Almagro-Moreno, S., and E. F. Boyd. 2009. Insights into the evolution of sialic acid 431
catabolism among bacteria. BMC Evol Biol 9:118. 432
3. Burnaugh, A. M., L. J. Frantz, and S. J. King. 2008. Growth of Streptococcus 433
pneumoniae on human glycoconjugates is dependent upon the sequential activity of 434
bacterial exoglycosidases. J Bacteriol 190:221-230. 435
4. Byers, H. L., K. A. Homer, and D. Beighton. 1996. Utilization of sialic acid by Viridans 436
streptococci. J Dent Res 75:1564-1571. 437
5. Byers, H. L., K. A. Homer, E. Tarelli, and D. Beighton. 1999. N-acetylneuraminic acid 438
transport by Streptococcus oralis strain AR3. J Med Microbiol 48:375-381. 439
6. Chan, P. F., K. M. O'Dwyer, L. M. Palmer, J. D. Ambrad, K. A. Ingraham, C. So, M. 440
A. Lonetto, S. Biswas, M. Rosenberg, D. J. Holmes, and M. Zalacain. 2003. 441
Characterization of a novel fucose-regulated promoter (PfcsK) suitable for gene 442
essentiality and antibacterial mode-of-action studies in Streptococcus pneumoniae. J 443
Bacteriol 185:2051-2058. 444
7. Chen, X., and A. Varki. 2010. Advances in the biology and chemistry of sialic acids. 445
ACS Chem Biol 5:163-176. 446
8. Dalia, A. B., A. J. Standish, and J. N. Weiser. 2010. Three surface exoglycosidases 447
from Streptococcus pneumoniae, NanA, BgaA, and StrH, promote resistance to 448
opsonophagocytic killing by human neutrophils. Infect Immun 78:2108-2116. 449
9. Holland, I. B., and M. A. Blight. 1999. ABC-ATPases, adaptable energy generators 450
fuelling transmembrane movement of a variety of molecules in organisms from bacteria 451
to humans. J Mol Biol 293:381-399. 452
10. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering 453
hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. 454
Gene 77:61-68. 455
11. Iyer, R., N. S. Baliga, and A. Camilli. 2005. Catabolite control protein A (CcpA) 456
contributes to virulence and regulation of sugar metabolism in Streptococcus 457
pneumoniae. J Bacteriol 187:8340-9. 458
12. King, S. J. 2010. Pneumococcal modification of host sugars: a major contributor to 459
colonization of the human airway? Mol Oral Microbiol 25:15-24. 460
13. King, S. J., K. R. Hippe, J. M. Gould, D. Bae, S. Peterson, R. T. Cline, C. Fasching, 461
E. N. Janoff, and J. N. Weiser. 2004. Phase variable desialylation of host proteins that 462
bind to Streptococcus pneumoniae in vivo and protect the airway. Mol Microbiol 54:159-463
171. 464
14. King, S. J., K. R. Hippe, and J. N. Weiser. 2006. Deglycosylation of human 465
glycoconjugates by the sequential activities of exoglycosidases expressed by 466
Streptococcus pneumoniae. Mol Microbiol 59:961-974. 467
15. Kloosterman, T. G., J. J. Bijlsma, J. Kok, and O. P. Kuipers. 2006. To have 468
neighbour's fare: extending the molecular toolbox for Streptococcus pneumoniae. 469
Microbiology 152:351-359. 470
16. Lock, R. A., J. C. Paton, and D. Hansman. 1988. Purification and immunological 471
characterization of neuraminidase produced by Streptococcus pneumoniae. Microb 472
Pathog 4:33-43. 473
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
21
17. Manco, S., F. Hernon, H. Yesilkaya, J. C. Paton, P. W. Andrew, and A. Kadioglu. 474
2006. Pneumococcal neuraminidases A and B both have essential roles during infection 475
of the respiratory tract and sepsis. Infect Immun 74:4014-4020. 476
18. Marion, C., D. H. Limoli, G. S. Bobulsky, J. L. Abraham, A. M. Burnaugh, and S. J. 477
King. 2009. Identification of a pneumococcal glycosidase that modifies O-linked 478
glycans. Infect Immun 77:1389-1396. 479
19. McCool, T. L., and J. N. Weiser. 2004. Limited role of antibody in clearance of 480
Streptococcus pneumoniae in a murine model of colonization. Infect Immun 72:5807-481
5813. 482
20. Obert, C., J. Sublett, D. Kaushal, E. Hinojosa, T. Barton, E. I. Tuomanen, and C. J. 483
Orihuela. 2006. Identification of a candidate Streptococcus pneumoniae core genome 484
and regions of diversity correlated with invasive pneumococcal disease. Infect Immun 485
74:4766-4777. 486
21. Orihuela, C. J., G. Gao, K. P. Francis, J. Yu, and E. I. Tuomanen. 2004. Tissue-487
specific contributions of pneumococcal virulence factors to pathogenesis. J Infect Dis 488
190:1661-1669. 489
22. Pedersen, P. L. 2005. Transport ATPases: structure, motors, mechanism and 490
medicine: a brief overview. J Bioenerg Biomembr 37:349-357. 491
23. Pettigrew, M. M., K. P. Fennie, M. P. York, J. Daniels, and F. Ghaffar. 2006. 492
Variation in the presence of neuraminidase genes among Streptococcus pneumoniae 493
isolates with identical sequence types. Infect Immun 74:3360-3365. 494
24. Phillips, N. J., C. M. John, L. G. Reinders, B. W. Gibson, M. A. Apicella, and J. M. 495
Griffiss. 1990. Structural models for the cell surface lipooligosaccharides of Neisseria 496
gonorrhoeae and Haemophilus influenzae. Biomed Environ Mass Spectrom 19:731-497
745. 498
25. Post, D. M., R. Mungur, B. W. Gibson, and R. S. Munson, Jr. 2005. Identification of a 499
novel sialic acid transporter in Haemophilus ducreyi. Infect Immun 73:6727-6735. 500
26. Roy, S., C. W. Douglas, and G. P. Stafford. 2010. A novel sialic acid utilization and 501
uptake system in the periodontal pathogen Tannerella forsythia. J Bacteriol 192:2285-502
2293. 503
27. Severi, E., A. H. Hosie, J. A. Hawkhead, and G. H. Thomas. 2010. Characterization 504
of a novel sialic acid transporter of the sodium solute symporter (SSS) family and in vivo 505
comparison with known bacterial sialic acid transporters. FEMS Microbiol Lett 304:47-506
54. 507
28. Severi, E., G. Randle, P. Kivlin, K. Whitfield, R. Young, R. Moxon, D. Kelly, D. 508
Hood, and G. H. Thomas. 2005. Sialic acid transport in Haemophilus influenzae is 509
essential for lipopolysaccharide sialylation and serum resistance and is dependent on a 510
novel tripartite ATP-independent periplasmic transporter. Mol Microbiol 58:1173-1185. 511
29. Shakhnovich, E. A., S. J. King, and J. N. Weiser. 2002. Neuraminidase expressed by 512
Streptococcus pneumoniae desialylates the lipopolysaccharide of Neisseria meningitidis 513
and Haemophilus influenzae: a paradigm for interbacterial competition among 514
pathogens of the human respiratory tract. Infect Immun 70:7161-7164. 515
30. Steenbergen, S. M., C. A. Lichtensteiger, R. Caughlan, J. Garfinkle, T. E. Fuller, 516
and E. R. Vimr. 2005. Sialic Acid metabolism and systemic pasteurellosis. Infect Immun 517
73:1284-1294. 518
31. Sung, C. K., H. Li, J. P. Claverys, and D. A. Morrison. 2001. An rpsL cassette, janus, 519
for gene replacement through negative selection in Streptococcus pneumoniae. Appl 520
Environ Microbiol 67:5190-5196. 521
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
22
32. Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. 522
Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. 523
Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. 524
R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. 525
Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, 526
I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. 527
Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence 528
of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506. 529
33. Uchiyama, S., A. F. Carlin, A. Khosravi, S. Weiman, A. Banerjee, D. Quach, G. 530
Hightower, T. J. Mitchell, K. S. Doran, and V. Nizet. 2009. The surface-anchored 531
NanA protein promotes pneumococcal brain endothelial cell invasion. J Exp Med 532
206:1845-1852. 533
34. Vimr, E., C. Lichtensteiger, and S. Steenbergen. 2000. Sialic acid metabolism's dual 534
function in Haemophilus influenzae. Mol Microbiol 36:1113-1123. 535
35. Vimr, E. R., K. A. Kalivoda, E. L. Deszo, and S. M. Steenbergen. 2004. Diversity of 536
microbial sialic acid metabolism. Microbiol Mol Biol Rev 68:132-153. 537
36. Vimr, E. R., and F. A. Troy. 1985. Identification of an inducible catabolic system for 538
sialic acids (nan) in Escherichia coli. J Bacteriol 164:845-853. 539
37. Ward, R. E., M. Ninonuevo, D. A. Mills, C. B. Lebrilla, and J. B. German. 2007. In 540
vitro fermentability of human milk oligosaccharides by several strains of bifidobacteria. 541
Mol Nutr Food Res 51:1398-1405. 542
38. Watt, J. P., K. L. O'Brien, S. Katz, M. A. Bronsdon, J. Elliott, J. Dallas, M. J. Perilla, 543
R. Reid, L. Murrow, R. Facklam, M. Santosham, and C. G. Whitney. 2004. 544
Nasopharyngeal versus oropharyngeal sampling for detection of pneumococcal carriage 545
in adults. J Clin Microbiol 42:4974-4976. 546
39. Webb, A. J., K. A. Homer, and A. H. Hosie. 2008. Two closely related ABC 547
transporters in Streptococcus mutans are involved in disaccharide and/or 548
oligosaccharide uptake. J Bacteriol 190:168-178. 549
40. Weiser, J. N., R. Austrian, P. K. Sreenivasan, and H. R. Masure. 1994. Phase 550
variation in pneumococcal opacity: relationship between colonial morphology and 551
nasopharyngeal colonization. Infect Immun 62:2582-2589. 552
41. Whatmore, A. M., V. A. Barcus, and C. G. Dowson. 1999. Genetic diversity of the 553
streptococcal competence (com) gene locus. J. Bacteriol. 181:3144-3154. 554
42. World Health Organization. 2008. The global burden of disease: 2004 update. 555
43. Yesilkaya, H., S. Manco, A. Kadioglu, V. S. Terra, and P. W. Andrew. 2008. The 556
ability to utilize mucin affects the regulation of virulence gene expression in 557
Streptococcus pneumoniae. FEMS Microbiol Lett 278:231-235. 558
559
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
23
560
Figure legends 561
Figure 1. Sialic acid supports S. pneumoniae growth. 1121 Smr was grown on chemically 562
defined medium for 60 h supplemented with 12 mM sialic acid, or 12 mM glucose as the sole 563
carbon source. Growth was measured by the optical density at 600 nm. Data points are the 564
mean of three independent experiments performed in triplicate. Gray shading indicates a 95% 565
confidence interval. 566
Figure 2. Schematic of regions encoding known and putative neuraminidases and 567
transporters as found in S. pneumoniae strain TIGR4. Arrows indicate open reading frames. 568
Neuraminidases are depicted in gray and predicted transporter components are depicted in 569
black. Open reading frames predicted to be involved in sialic acid utilization are labeled as 570
follows: sugar kinase nanK, N-acetylneuraminate lyase nanA (note this is distinct from 571
neuraminidase nanA), and N-acetylmannosamine-6-phosphate 2-epimerase nanE. 572
Figure 3. satABC (SP1681-3) is required for efficient growth on sialic acid. 1121 Smr and 573
mutants were grown for 60 h on chemically defined medium supplemented with 12 mM sialic 574
acid as the sole carbon source. Growth was measured by the optical density at 600 nm. Data 575
points are the mean of three independent experiments performed in triplicate. Gray shading 576
indicates a 95% confidence interval. 577
Figure 4. satABC is required for transport of sialic acid. 1121 Smr and mutants were 578
incubated for the designated amount of time in chemically defined media supplemented with 579
2.5 µM sialic acid containing 1% [3H]-sialic acid. Following incubation, bacteria were filtered, 580
washed, and radioactivity associated with cells was measured using a scintillation counter. (A) 581
Data is a representative of two time course experiments with strain 1121 Smr conducted in 582
triplicate. (B + C) Data are averages from parental and mutant strains from three independent 583
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
24
experiments performed in triplicate. Standard deviation is depicted. Statistical significance was 584
tested by a two-tailed Student’s t-test; * indicates P≤0.05. 585
Figure 5. satABC contributes to growth on a human glycoprotein. 1121 Smr and mutants 586
were grown for 60 h on chemically defined medium supplemented with 5 mg ml-1 alpha-1 587
glycoprotein as the sole carbon source. Growth was measured by the optical density at 600 588
nm. Data points are the mean from three independent experiments performed in triplicate. 589
Gray shading indicates a 95% confidence interval. 590
Figure 6. satABC contributes to pneumococcal colonization. Groups of 10 mice received 591
intranasal inoculation with 1 x 108 CFU of mutant or parental strain (1121 Smr). Five days after 592
inoculation, mice were sacrificed by carbon dioxide asphyxiation. Nasal lavage fluid was 593
collected and bacterial titers assessed. The gray dashed line indicates the limit of detection. 594
The mean and standard error of the mean are depicted. Statistical significance was tested by 595
a two-tailed Student’s t-test; * indicates P≤0.05. 596
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
25
Table 1: Strains of Streptococcus pneumoniae used in this study
Strain Name Serotype Characteristics/genotypea
Site of
isolationb
Source or reference
1121 23F Clinical isolate McCool et. al. (2002)
1121 Smr 23F Lys56→Thr in RpsL [rpsL(K56T)] conferring Sm
r Marion et. al. (2009)
1121 ∆satABC 23F ∆satABC rpsL(K56T) (Smr) This study
1121 ∆satABC/satABC+ 23F ∆satABC/satABC
+ , rpsL(K56T) (Sm
r) This study
1121 ∆1688-90 23F ∆1688-90 rpsL(K56T) (Smr) This study
1121 ∆1688-90/1688-90+ 23F ∆1688-90/1688-90
+, rpsL(K56T) (Sm
r) This study
1121 ∆satABC ∆1688-90 23F ∆satABC ∆1688-90 rpsL(K56T) (Smr) This study
1121 ∆satABC ∆1688-90/ satABC
+ 1688-90
+ 23F
∆satABC ∆1688-90/
satABC
+ 1688-90
+, rpsL(K56T) (Sm
r) This study
1121 ∆nanA 23F ∆nanA (Cmr), rpsL(K56T) (Sm
r) This study
TIGR4 4 Clinical isolate Tettelin et al. (2001)
TIGR4 Smr 4 Lys56→Thr in RpsL [rpsL(K56T)] conferring Sm
r Bender et. al. (2006)
TIGR4 ∆satABC 4 ∆satABC rpsL(K56T) (Smr) This study
TIGR4 ∆satABC/satABC+ 4 satABC, rpsL(K56T) (Sm
r) This study
TIGR4 ∆1328 4 ∆SP1328 rpsL(K56T) (Smr) This study
TIGR4 ∆satABC ∆1688-90 ∆1328 4 ∆satABC ∆1688-90 ∆1328 rpsL(K56T) (Smr) This study
C06_18 22F Clinical isolate blood Burnaugh et al. (2008)
C06_29 15B/C Clinical isolate BAL Burnaugh et al. (2008)
C06_31 23F Clinical isolate BAL Burnaugh et al. (2008)
C06_57 6A/B Clinical isolate BAL Burnaugh et al. (2008)
C06_58 19A Clinical isolate blood Burnaugh et al. (2008)
a Sm
r indicates resistance to streptomycin.
b BAL indicates bronchioalveolar lavage/aspirate.
+ indicates the genetic mutation has been reconstituted to wild type.
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
26
Table 2: Primers used in this study
Group Number Primer sequence (5' → 3') a Location (accession number)
satABC A.1 CTATATGTTGTTCACGCATTC 1505216-1505236 (AE007317)
A.2 CATTATCAATTAAAAATCAAACGGTCATCCATCACTCTCCTCTGT1 1504642-1504662 (AE007317)
A.3 GCATACCCTCCATTTTGTAGATCATCCATCACTCTCCTCTGT2 1504642-1504662 (AE007317)
A.4 GGAAAGGGGCCCAGGTCTCTACAAAATGGAGGGTATGC3 1501066-1501086 (AE007317)
A.5 TCTACAAAATGGAGGGTATGC 1501066-1501086 (AE007317)
A.6 GAATGCTACTGCCTCGTCTTTGA 1500702-1500724 (AE007317)
A.7 TTTGCAGGTCGTTTCTC 1505403-1505419 (AE007317)
A.8 TATTCTCATTTCTCTACCTC 1500451-1500470 (AE007317)
A.9 GCCTTTGAGGCGACAGC 1652124-1652146 (AE007317)
A.10 ACACGATGCCCCACTTCTTTCTG 1652408-1652433 (AE007317)
SP1688-90 B.1 TGGTAATCGATTGTTTGGG 1513786-1513804 (AE007317)
B.2 CATTATCAATTAAAAATCAAACGGTTTTTCATCGTTCTTCTCTTTC1 1513451-1513472 (AE007317)
B.3 CCTTCTTTCGTCTACTTCACAGTTTTTCATCGTTCTTCTCTTTC4 1513451-1513472 (AE007317)
B.4 GGAAAGGGGCCCAGGTCCTGTGAAGTAGACGAAAGAAGG3 1510314-1510335 (AE007317)
B.5 CTGTGAAGTAGACGAAAGAAGG 1510314-1510335 (AE007317)
B.6 GAAGCTGGTCTAGAAAATAAATAA 1509913-1509936 (AE007317)
B.7 GTTTAGGAACTTATGTGGGAGTA 1513885-1513907 (AE007317)
B.8 GGATTTGATAAGGGAATAGTTGA 1509625-1509647 (AE007317)
B.9 GTGTATTTTCAACTGCCTGTCC 1509872-1509893 (AE007317)
B.10 ATGCGAATGAATTAAACTATGGTC 1510202-1510225 (AE007317)
SP1328 C.1 GCAACAATGCGTCAAAATCCTC 1254113-1254134 (AE005672)
C.2 CATTATCCATTAAAAATCAAACGGTAGATACCTGCAACCAACAC1 1253572-1253591 (AE005672)
C.3 AACTTGAATCCGCTTTAATTTCTAGATACCTGCAACCAACAC5 1253572-1253591 (AE005672)
C.4 AAGCATAAGGAAAGGGGCCCGAAATTAAAGCGGATTCAAGTT3 1252127-1252148 (AE005672)
C.5 GAAATTAAAGCGGATTCAAGTT 1252127-1252148 (AE005672)
C.6 TTCTTCAAAAGTCACCAACATA 1251714-1251735 (AE005672)
C.7 CAGCTATCCCACCTATTTATTT 1254259-1254280 (AE005672)
C.8 AGTTTTTTAACAGTTTCATCATT 1251664-1251686 (AE005672)
C.9 GTGATTCTGATTAGTGGTGTC 1253070-1253090 (AE005672)
C.10 ACAGCTGTTGGAGGAAGGA 1252270-1252288 (AE005672)
aroE RT.F TGCAGTTCARAAACATWTTCTAA 1232187-1232203 (AE007317)
RT.R TGCTAGCCCATCATATTCGTTTGTTG 1231725-1231747 (AE007317)
Janus J.F CCGTTTGATTTTTAATGGATAATG 7-30 (AY334019)
J.R GGGCCCCTTTCCTTATGCTT 247511-247527 (AE005672)
a Underlining indicates reverse complement sequence of primer J.F
( 1 ) A.5
( 2 ) J.R
( 3 ), B.5
( 4 ) and C.5
(5).
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Optical D
ensity 6
00 n
m
0.9
0.7
0.8
0.6
0.5
0.4
0.3
0.2
0.1
0
-0.1 Time (hours)12 24 36 48 60
12 mM sialic acid12 mM glucose
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
predicted transport component
neuraminidase
1 kb
nanC
SP1331 SP1324
SP1674SP1693
nanBnanA nanA nanKnanE
nanA nanKnanE
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
0.5
0.4
0.3
0.2
0.1
0
-0.1
Op
tical de
nsity 6
00
nm
Time (hours)
12 24 36 48 60
1121 Smr
1121 ∆satABC
1121 ∆1688-90
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
nM
[3H
] sia
lic a
cid
/ 1
07 C
FU
**
1121 Sm
r
1121 ∆satA
BC
1121 ∆SP1688-90
1121 ∆satA
BC ∆SP1688-90
1121 ∆satA
BC /satA
BC+
B
nM
[3H
] sia
lic a
cid
/ 1
07 C
FU
**
TIGR4 Sm
r
TIGR4 ∆
satABC
TIGR4 ∆satA
BC∆SP1688-90 ∆
SP1328
TIGR4 ∆
satABC /s
atABC
+
C
A
nM
[3H
] sia
lic a
cid
/ 1
07 C
FU
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
0.6
0.5
0.4
0.3
0.2
0.1
0
-0.1
Op
tical de
nsity 6
00
nm
Time (hours)
12 24 36 48 60
1121 Smr
1121 ∆satABC
1121 ∆1688-90
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Lo
g C
FU
/mL
101
102
103
104
105
106
1121 Sm
r
1121 ∆satA
BC
1121 ∆SP1688-90
1121 ∆satA
BC
∆SP1688-90
**
on February 15, 2018 by guest
http://iai.asm.org/
Dow
nloaded from