Post on 13-Mar-2020
1
Cohesin plays a dual role in gene regulation and sister-chromatid cohesion during meiosis in
Saccharomyces cerevisae
Weiqiang Lin, Mian Wang, Hui Jin, and Hong-Guo Yu
Department of Biological Science, The Florida State University, Tallahassee, FL 32306-4370
Genetics: Published Articles Ahead of Print, published on January 26, 2011 as 10.1534/genetics.110.122358
Copyright 2011.
2
Total character count: 51,234
Running title: Cohesin regulates gene expression
Keywords: SCC3, SMC1; transcription; meiosis; cell differentiation
Abbreviations used in this paper: DAPI, 4’, 6-diamidino-2-phenylindole; GFP, green fluorescent
protein
Correspondence to H.-G. Yu: telephone (850) 645-7344; fax (850) 644-0481; e-mail
hyu@bio.fsu.edu.
3
ABSTRACT
Sister-chromatid cohesion mediated by cohesin ensures proper chromosome segregation
during cell division. Cohesin is also required for postreplicative DNA double-strand break repair
and gene expression. The molecular mechanisms of these diverse cohesin functions remain to be
elucidated. Here we report that cohesin subunits Scc3 and Smc1 are both required for the
production of the meiosis-specific subunit Rec8 in the budding yeast Saccharomyces cerevisiae.
Using a genetic approach, we depleted Scc3 and Smc1 independently in cells that were
undergoing meiosis. Both Scc3- and Smc1-depleted cells were inducible for meiosis, but the
REC8 promoter was only marginally activated, leading to reduced levels of REC8 transcription
and protein production. In contrast, the expression of MCD1, the mitotic counterpart of REC8,
was not subject to Scc3 regulation in vegetative cells. We provide genetic evidence to show that
sister-chromatid cohesion is not necessary for activation of REC8 gene expression. Cohesin
appears to positively regulate the expression of a variety of genes during yeast meiosis. Our
results suggest that the cohesin complex plays a dual role in gene regulation and sister-chromatid
cohesion during meiotic differentiation in yeast.
4
INTRODUCTION
Meiosis is a developmentally regulated cell division required for sexual reproduction in
eukaryotes. In the single-celled organism Saccharomyces cerevisiae, vegetative a/α diploid cells
switch to the meiotic program in response to starvation. A signal transduction cascade, which
leads to changes in gene expression, initiates meiosis (Mitchell 1994; Kupiec et al. 1997).
Consequently, the expression of meiosis-activating genes is increased and that of meiosis-
repressing genes decreased. The positive regulators of meiosis, of which many are
transcriptional factors, then activate the expression of early, middle, and late genes that are
required for recombination, chromosome segregation, and spore formation. Regulation of
meiotic differentiation is facilitated by chromosome structural reorganization, which can be
achieved by the actions of histone modifiers and ATP-dependent chromatin-remodeling
complexes (Kassir et al. 2003). Additional chromosomal factors might be required for activating
meiotic gene expression.
The evolutionarily conserved protein complex cohesin, which is composed of Smc1,
Smc3, Mcd1/Scc1, and Irr1/Scc3 in the budding yeast, mediates sister-chromatid cohesion (Onn
et al. 2008; Nasmyth and Haering 2009). Rec8 largely replaces Mcd1 and is the only meiosis-
specific cohesin subunit in yeast of which the encoding gene is expressed early in meiosis (Chu
et al. 1998). Cohesin binds to the yeast chromosome at discrete loci (Blat and Kleckner 1999;
Laloraya et al. 2000; Glynn et al. 2004; Lengronne et al. 2004), and purified cohesin complex
forms a ring-shaped structure (Gruber et al. 2003). The tripartite cohesin ring made of Smc1,
Smc3, and Mcd1 (probably Rec8) is sufficient for topologically entrapping a pair of sister
chromatids to generate cohesion in yeast (Haering et al. 2008). Meanwhile, Scc3, which is
called SA/STAG in animals, has been implicated in cohesin oligomerization (Zhang et al. 2008)
5
and is critical for cohesin release from the chromosome (Hauf et al. 2005). Cohesin is important
for establishing both the mitotic and meiotic chromosome architecture (Hirano 2006; Onn et al.
2008; Nasmyth and Haering 2009).
In addition to mediating sister-chromatid cohesion, cohesin appears to have a broad
influence on chromosome metabolism that includes postreplicative DNA double-strand break
repair and gene expression (Strom et al. 2004; Unal et al. 2004; Dorsett et al. 2005; Horsfield et
al. 2007). Functional analysis of cohesin and its loading factor, the Scc2 and Scc4 complex,
demonstrates that chromosomal binding of cohesin can generate a chromatin boundary that
insulates the transcriptional activity of surrounding genes in yeast and fly (Donze et al. 1999;
Rollins et al. 1999; Dorsett et al. 2005). Cohesin also plays a role in cell differentiation by
modulating gene expression as demonstrated in neuron morphogenesis in flies (Pauli et al. 2008;
Schuldiner et al. 2008). These studies provide insights into the understanding of the
noncanonical role of cohesin in regulation of gene expression. Cohesin function in gene
expression is further supported by recent findings in vertebrates that cohesin subunits physically
interact with the transcriptional factor CTCF and that they colocalize with CTCF on
chromosomes (Parelho et al. 2008; Rubio et al. 2008; Wendt et al. 2008). The above
observations also raise more questions yet to be answered. For example, how does cohesin
regulate gene expression during cell differentiation? Is this regulatory mechanism conserved in
eukaryotes? Is the cohesin holocomplex or individual subunit required for gene regulation? Is
the primarily role of cohesin in sister-chromatid cohesion separable from that of gene regulation?
Because cohesin subunits are essential for cell growth, genetic analysis of cohesin
function in many model organisms is limited to thermosensitive or partially functional mutant
alleles. Using a previously proven genetic approach (Lee and Amon 2003), we have created
6
conditional alleles of SCC3 and SMC1 that specifically deplete Scc3 and Smc1 in yeast meiotic
cells. In both Scc3- and Smc1-depleted cells, the level of the meiosis-specific subunit Rec8 is
significantly lowered by a reduction of REC8 gene transcription. Our work suggests that the
cohesin complex plays an important role in positively regulating the REC8 promoter when
vegetative yeast cells differentiate into meiosis.
MATERIALS AND METHODS
Yeast strains and culture conditions: Yeast strains used in this study are listed in
Supplemental Table 1. We used the CLB2 promoter to replace the endogenous promoters of
SCC3 and SMC1 by a PCR-based method as previously described (Jin et al. 2009). The PMET1-
DEGRON-SCC3 was generated by a similar PCR method with the plasmid p378. We used
plasmids pHG40 (Jin et al. 2009) and pHG105 to create PCUP1REC8 and PREC8GFP alleles by
standard yeast transformation. We cloned a 1900-bp DNA sequence upstream of the REC8 start
codon, which included the 5’ UTR, by PCR and placed it in front of the GFP open reading frame
to create pHG105. We used the DMC1 promoter to replace the REC8 endogenous promoter to
generate PDMC1REC8 using a similar method we described previously (Yu and Koshland 2005;
Jin et al. 2009). The rec8Δ, spo11-Y135F, and ndt80Δ alleles have been reported previously (Xu
et al. 1995; Keeney et al. 1997; Klein et al. 1999). The tetO array was inserted into the URA3
locus on chromosome V, and tetR-GFP at the LEU2 locus on chromosome III, as previously
described (Michaelis et al. 1997). A PCR-based strategy (Longtine et al. 1998) was used to
create C-terminal tags of the following alleles: SCC3-3HA, SMC3-3HA, SMC3-V5, and REC8-
3HA. Positive transformations were confirmed by colony PCR. PCR primer information
appears in Supplemental Table 2.
Synchronous meiosis was performed as previously described (Yu and Koshland 2005).
7
Briefly, yeast cells were grown in YPA overnight at 30° to an optical density (λ = 600 nm) of
~1.6, washed once with H2O, and resuspended in 2% KoAC for induction of meiosis. To induce
PCUP1REC8, 60 µM CuSO4 was added to the sporulation medium. The PMET1-DEGRON-SCC3
strain was grown in methionine-dropout synthetic medium at 25°. Cells were treated with α-
factor (10 ng/ml) for 2 h at 25° and washed twice with H2O. This culture was split into two
equal halves; one was incubated at 25° in methionine-dropout medium and the other at 37° in
complete medium.
Meiotic nuclear spreads and fluorescence microscopy: Yeast surface nuclear spreads
were performed as previously described (Jin et al. 2009). Rec8-3HA, Scc3-3HA, and Smc3-
3HA were detected by an anti-HA antibody (12CA5, Roche). FITC conjugated goat-anti-mouse
was used as secondary antibody (Jackson ImmunoResearch Laboratories). Chromosomal DNA
was stained with DAPI. Fluorescence images were acquired with a 100× objective lens (NA =
1.40) mounted on a motorized microscope (AxioImager, Zeiss). Acquired monotone images
were merged by the AxioVision software (Zeiss). For assay of sister-chromatid cohesion, yeast
aliquots were withdrawn at 2-h intervals and fixed with 1% formaldehyde. Green fluorescent
protein (GFP) foci were visualized by fluorescence microscopy. At least 100 cells were counted
at each time point.
Western blot: Yeast aliquots were collected at 2-h intervals and processed by the TCA
method for total protein extraction as previously described (Jin et al. 2009). Standard SDS-
PAGE and western-blot procedures were followed (Sambrook and Russell 2001). Rec8-3HA and
Scc3-3HA were detected by an anti-HA antibody (12CA5, Roche). Smc3-V5 was detected by an
anti-V5 antibody (Invitrogen). Dmc1 and Mcd1 were detected by protein-specific antibodies
(gifts of D. Bishop, University of Chicago, and V. Guacci, Carnegie Institution). GFP was
8
detected by a GFP-specific antibody (Ab290, Abcam). The level of Tub2 (β-tubulin) served as a
loading control.
Northern blot and RT-PCR: Yeast aliquots were collected at intervals after induction
of meiosis or after G1-phase release. We extracted total RNA and performed standard northern
blots (Sambrook and Russell 2001). Gene-specific probes were used to detect the mRNA of
genes of interest. Labeled blots were scanned with the Storm PhosphorImager (GE). Signal
intensity was quantified with the IPLab software (Scanalytics). We used the RNeasy kit
(Qiagen) to extract and purify mRNA. Purified mRNA was reverse-transcribed to cDNA
(Invitrogen), and a semiquantitative PCR method was used to determine the concentration of
target cDNA with gene-specific primers (primer information appears in Supplemental Table 2).
Chromatin Immunoprecipitation (ChIP): Yeast cells were induced to undergo
synchronous meiosis and fixed with 1% formaldehyde for 2 h at room temperature, then
subjected to a chromatin-immunoprecipitation procedure as described previously (Yu and
Koshland 2005). We used an anti-V5 antibody (Invitrogen) for ChIP of Rpb3-V5–tagged yeast
strains. A semiquantitative PCR-based method was used to detect the enrichment of Rpb3 at the
REC8 and DMC1 genes.
9
RESULTS
Scc3 is required for sister-chromatid cohesion and nuclear division during yeast
meiosis: To deplete Scc3 in meiosis, we replaced the endogenous SCC3 promoter with the
CLB2 promoter, which is expressed only in vegetative yeast cells (Lee and Amon 2003).
Semiquantitative analysis of Scc3 by western blot showed ~85% depletion of Scc3 in PCLB2SCC3
cells during meiosis (Figure 1A, t = 8 h). This conditional scc3 mutant allele was competent for
meiotic DNA replication (Supplemental Figure 1) and permitted us to determine whether Scc3 is
required for sister-chromatid cohesion in yeast meiosis (Figure 1, B and C). We marked the
centromere of one homolog of chromosome V with GFP to assay sister-chromatid cohesion
(Michaelis et al. 1997). In wild-type cells, sister chromatids were cohesive and formed one GFP
spot before meiosis I, which occurred ~5 h after induction of meiosis (Figure 1B). In contrast, in
PCLB2SCC3 cells, sister chromatids were not associated after DNA replication, forming two GFP
spots (Figure 1B). We incorporated an ndt80Δ mutation to arrest the cells at prophase I (Figure
1C; Xu et al. 1995). Less than 4% of ndt80Δ cells showed two GFP spots because chromosomes
did not segregate and sister chromatids remained cohesive. In contrast, 86% of PCLB2SCC3
ndt80Δ cells formed two GFP spots 12 h after induction of meiosis (Figure 1C). We therefore
conclude that Scc3 is required for sister-chromatid cohesion during yeast meiosis.
Next, to determined whether Scc3 is required for chromosome segregation, we monitored
meiotic nuclear divisions (Supplemental Figure 2). In wild-type cells 12 h after induction of
meiosis, 80% of cells had finished both meiosis I and meiosis II nuclear divisions (Supplemental
Figure 2A). In contrast, less than 5% of PCLB2SCC3 cells were able to complete either division
(Supplemental Figure 2B). To determine whether PCLB2SCC3 cells are blocked by the
recombination checkpoint, we introduced a spo11 mutation (spo11-Y135F, Keeney et al. 1997) to
10
by-pass the checkpoint (Supplemental Figure 2, C and D). More than 55% of PCLB2SCC3 spo11-
Y135F cells were able to complete at least one nuclear division when double-strand break
formation was eliminated (Supplemental Figure 2D). Together, these data suggest that Scc3-
depleted cells are competent for meiosis initiation but are primarily arrested by the
recombination checkpoint.
Reduced Rec8 protein level in Scc3-depleted meiotic cells: In loss of sister-chromatid
cohesion and failure to complete nuclear division, the mutant phenotypes of PCLB2SCC3 resemble
those of rec8Δ (Klein et al. 1999). We therefore localized Rec8 in Scc3-depleted cells by
immunofluorescence (Figure 2A). As previously shown, in wild-type cells at pachytene of
prophase I, Rec8 was localized along the length of chromosomes that revealed well-defined rod-
shaped structures (Figure 2A, left panels). In Scc3-depleted cells, chromosomes became
amorphous, and only traces of chromosome-associated Rec8 were observed above the
background noise (Figure 2A, right panels). Consistent with this observation, we found very low
levels of total Rec8 protein in Scc3-depleted cells by western blot (Figure 2B). In contrast, the
meiosis-specific protein Dmc1 was produced on time and in quantities similar to those in wild-
type and PCLB2SCC3 cells, although its degradation was delayed in PCLB2SCC3 cells because
these cells were blocked at prophase I (Figure 2B). Thus, by two different means,
immunofluorescence and western blot, we showed that the Rec8 protein level is dramatically
lowered when Scc3 is absent in meiosis.
Next, we determined whether Rec8 is required for maintaining the Scc3 protein level. By
immunofluorescence, we found that Scc3 remains to be chromosome associated in the absence of
Rec8 (Figure 2C). By western blot, we found that the total amount of Scc3 was present at a
wild-type level in rec8Δ cells during meiosis (Figure 2, C and D). Therefore, Scc3 is required
11
for mediating a normal level of Rec8 protein in meiosis, but not the reverse. Our data suggest
that Scc3 can bind to the chromosome without formation of the meiotic cohesin complex during
meiosis. Alternatively, a residual level of the mitotic cohesin complex remained in these cells.
Smc1 and Smc3 are the other subunits of the meiotic cohesin, and as a representative, we
show that Smc3 was present at similar levels in wild-type and Scc3-depleted meiotic cells
(Figure 3A). Therefore, Scc3 plays a specific role in maintaining a normal level of the meiosis-
specific cohesin subunit Rec8. In Scc3-depleted cells, however, Smc3 failed to bind to meiotic
chromosomes (Figure 3B), suggesting that Scc3 is required for Smc3 chromosome association.
To determine whether the prophase block of Scc3-depleted cells led to lowered levels of
Rec8, we assayed the total protein level of Rec8 in spo11-Y135F and PCLB2SCC3 spo11-Y135F
double-mutant cells by western blot (Figure 3C). Wild-type and spo11-Y135 cells did not differ
in the production and degradation of Rec8 (Figures 2B and 3C, left panels). In contrast, Rec8
protein level remained low in PCLB2SCC3 spo11-Y135F cells (Figure 3C, right panels).
Therefore, reduced Rec8 level in Scc3-depleted cells is not caused by prophase I block.
Scc3 regulates REC8 gene expression by increasing REC8 promoter activity: We
hypothesized that Scc3 regulates REC8 gene expression in yeast meiosis. To determine the level
of REC8 mRNA, we harvested yeast cells undergoing synchronous meiosis and performed
northern blots (Figure 4A). In wild-type cells, REC8 transcripts appeared 2 h, peaked around 4–
6 h, and diminished 12 h after induction of meiosis (Figure 4A). The REC8 transcripts emerged
on a similar time schedule in Scc3-depleted cells, but their levels never reached those of the wild
type (Figure 4A). Quantitative analysis by RT-PCR revealed that REC8 mRNA in Scc3-depleted
cells was 65% lower than that of the wild type 6 h after induction of meiosis (Figure 4B). In
contrast, the expression of the meiosis-initiating gene IME1 was only reduced by ~20% in
12
PCLB2SCC3 cells (Figure 4B). Scc3 therefore plays a role in REC8 gene expression in yeast
meiosis.
Our northern blots also showed that the expression of SCC3 was largely abolished in
PCLB2SCC3 cells during meiosis (Figure 4A). On the other hand, the level of SCC3 transcripts in
rec8Δ remained comparable to that of wild type (Figure 4A), which is consistent with the
observation that Scc3 protein levels remained normal in rec8Δ cells (Figure 2D). Therefore,
Rec8 is not required for meiotic expression of SCC3.
To determine whether Scc3 is responsible for REC8 gene transcription during yeast
meiosis, we assayed the density of RNA Pol II binding to the REC8 gene by ChIP (Figure 4C).
Using the Pol II subunit Rpb3 as a readout (Kolodziej et al. 1990), we found that the association
of Rpb3 with the REC8 gene was reduced by ~70% in PCLB2SCC3 cells after normalization of
Rpb3’s binding to the DMC1 gene (Figure 4C). Our data therefore suggest that the decrease in
REC8 mRNA level in Scc3-depleted meiotic cells is a result of transcriptional inactivation of the
REC8 promoter during yeast meiosis.
To determine further how Scc3 regulates REC8 gene transcription, we developed a
heterologous reporter assay by using the REC8 promoter to drive the expression of GFP (Figure
4D and our unpublished data). The expression of PREC8GFP, which was inserted at the REC8
locus, essentially mirrored that of the REC8 gene in wild-type cells (Figure 4, A and D). In
contrast, the level of GFP transcripts from PREC8GFP was low in Scc3-depleted cells during
meiosis, ~60% lower than in the wild type (Figure 4C, t = 4 h). Because a low level of activity
of the REC8 promoter still occurred in Scc3-depleted cells (Figure 4), our data suggest that Scc3
is required for increasing the REC8 promoter activity but not for its initiation. Alternatively, the
low level of REC8 expression results from residual Scc3 activity in PCLB2SCC3 cells.
13
Scc3 is not necessary for REC8 translation but is required for Rec8 chromosome
association: To produce Rec8 in Scc3-depleted cells, we constructed an inducible allele of
REC8 (PCUP1REC8), which served as the only source of REC8 in meiosis (Figure 5). Upon the
addition of copper ion at the time of induction of meiosis, PCUP1REC8 was expressed in wild-
type and Scc3-depleted cells at comparable levels (Figure 5A). These REC8 transcripts
produced by the CUP1 promoter appeared to be efficiently translated to produce Rec8 protein
(Figure 5 B). In wild-type SCC3 cells, ectopically produced Rec8 was subject to the same
regulation as the endogenous Rec8; it peaked around 6 h and was degraded by the end of meiosis
(Figures 2B and 5B). Furthermore, these Rec8 proteins localized to the meiotic chromosome
along its entire length just as the endogenous Rec8 did (Figures 2A and 5C). In PCLB2SCC3 cells,
PCUP1REC8 was expressed, and these cells produced amounts of Rec8 similar to those seen in
wild-type cells (Figure 5B). Because PCLB2SCC3 cells were arrested by the recombination
checkpoint at prophase I, the degradation of Rec8 was delayed in these cells (Figure 5B).
Therefore, in the absence of Scc3, Rec8 can be produced and remains relatively stable in
meiosis, but ectopically produced Rec8 failed to bind to the chromosome in PCLB2SCC3 cells
(Figure 5C), suggesting that Scc3 is required for Rec8 association with the chromosome.
One concern was that the CUP1 promoter perhaps overexpressed REC8 during meiosis
and could obscure our interpretation. We therefore constructed a PDMC1REC8 allele, which was
incorporated at the endogenous REC8 locus and produced Rec8 at a level similar to that of Dmc1
during meiosis (Supplemental Figure 3A). The expression levels of PDMC1REC8 in wild-type
and Scc3-depleted meiotic cells appeared comparable, because the two strains produced similar
amounts of Rec8 (Supplemental Figure 3A). To support further a specific role of Scc3 in
activating the REC8 promoter, we constructed a heterologous GFP reporter, PDCM1GFP, which
14
produced similar amounts of GFP in wild-type and Scc3-depleted meiotic cells (Supplemental
Figure 3B). Together, our results suggest that Scc3 is required for REC8 gene expression
because it specifically increases REC8 promoter activity during meiosis, but Scc3 is not
necessary for translation of REC8 mRNA.
Scc3 is not necessary for MCD1 gene expression in proliferating cells: The mitotic
counterpart of REC8 is MCD1, which probably arose from an ancient genome-duplication event
(Kellis et al. 2004). To determine whether Scc3 plays a similar role in regulating MCD1
transcription in proliferating yeast cells, we generated a degron allele of scc3 (PMET1-DEGRON-
SCC3) to deplete Scc3 in vegetative cells and observed MCD1 gene transcription and protein
production with northern and western blots (Figure 6). To synchronize yeast culture, we used α-
factor to arrest cells at the G1 phase and then released them to a nonpermissive condition to
deplete Scc3 (Figure 6, A and B). The transcription of SCC3 was completely shut off in cells
that were shifted to the nonpermissive condition (Figure 6C), and Scc3 became depleted in these
cells after G1 phase release (Figure 6D). In contrast, MCD1 was expressed after G1 release, and
its level of expression did not appear to differ greatly, except that cells expressed MCD1 earlier
at the elevated temperature (Figure 6C). As a result, Mcd1 protein levels in these two treatments
were comparable (Figure 6D). Scc3 is therefore required for positively regulating REC8 gene
expression in meiotic cells but not for MCD1 in mitotic cells. Together, our results show that the
cohesin kleisin subunit Rec8 or Mcd1 remains relatively stable when Scc3 is absent in either
meiotic or mitotic cells.
Smc1 has a similar role in positively regulating REC8 gene expression during
meiosis: To determine whether cohesin subunits other than Scc3 have a role in positively
regulating REC8 gene expression, we were able to deplete more completely Smc1 in meiosis
15
using the same CLB2 promoter-replacement approach (Figure 7A). As in Scc3-depleted meiotic
cells, the level of REC8 transcript was dramatically reduced in Smc1-depleted cells (Figure 7B).
Consequently, the Rec8 protein level was very low in mutant cells (Figure 7C). In contrast, the
meiosis-specific protein Dmc1 was produced at comparable levels in wild-type and PCLB2SMC1
cells (Figure 7C). These data suggest that Smc1 is also required for Rec8 production in meiosis.
Using the PREC8GFP reporter assay, we found that the production of GFP was dramatically
reduced in Smc1-depleted meiotic cells (Figure 7D). Taken together, our results suggest that the
cohesin complex is required for positively regulating the REC8 gene transcription during yeast
meiosis.
The presence of sister chromatids is not necessary for REC8 gene activation: To
determine whether sister-chromatid cohesion is required for activating REC8 gene expression,
we used a genetic approach to abolish meiotic DNA replication with the PSCC1CDC6 allele
(Hochwagen et al. 2005). In Cdc6-depleted meiotic cells, sister chromatids from chromosome V
were largely absent (data not shown), but Rec8 was produced efficiently in PSCC1CDC6 cells,
because its protein level was comparable to that of the wild type during meiosis (Figure 7E). In
addition, immunofluorescence microscopy revealed that Rec8 was localized to the chromosomes
in Cdc6-depleted cells (Figure 7F). Chromosome axes in the PSCC1CDC6 cells resembled those
from the wild-type cells even though Cdc6-depleted cells lacked sister chromatids in meiosis
(Figure 7F). These results suggest that REC8 can be efficiently transcribed in the absence of
sister chromatids, so the presence of sister chromatids is not necessary for REC8 gene
expression.
Additional meiotic genes are subject to cohesin regulation: To determine whether
cohesin globally regulates gene expression during meiotic differentiation in yeast, we surveyed
16
the gene-expression pattern using the expression microarray. Expression of 27 genes was
reduced by more than 75% in Smc1-depleted meiotic cells 6 h after induction of meiosis; only 8
genes showed more than a 4-fold increase (data not shown). We focused on the expression
pattern of ~52 meiotic genes like REC8 that belonged to the category of “early genes” in meiosis
(Chu et al. 1998). Among them, we found by microarray analysis that the expression level of
two genes (MRD1 and PAD1) was lowered by ~50% in the PCLB2SMC1 mutant (Supplemental
Figure 4). The expression level of REC8 was only slightly reduced in comparison to that of
DMC1 (Supplemental Figure 4), demonstrating that our microarray analysis of meiotic gene
expression is qualitative at best. Whether the cohesin target genes share common features is
currently unknown; but our preliminary analysis supports the idea that cohesin has a positive role
in meiotic gene expression.
DISCUSSION
Using a genetic approach, we have shown that cohesin subunits Scc3 and Smc1 are
required for efficient transcription of a target gene, REC8, because they increase its promoter
activity during yeast meiosis. Cohesin is a major chromosomal factor required for sister-
chromatid cohesion (Guacci et al. 1997; Michaelis et al. 1997), but its emerging role in
regulation of gene expression is best known in animal development (Dorsett et al. 2005;
Horsfield et al. 2007; Wendt et al. 2008). Nonlethal mutation in genes that encode cohesin and
cohesin-associated factors in human is directly linked to developmental disorders collectively
called cohesinopathies, which include Cornelia de Lange Syndrome and Roberts Syndrome (Liu
and Krantz 2009). The etiology of these human diseases remains to be elucidated. Our work in
yeast meiosis using the REC8 promoter activity as a readout of cohesin function in gene
regulation lends support to the notion that this noncanonical cohesin activity is evolutionarily
17
conserved; it also provides molecular insights into cohesin’s role in cell differentiation and
development.
Four lines of evidence support the idea that the cohesin complex increases REC8 gene
expression by modulating the REC8 promoter activity during meiosis. First, Scc3 and Smc1
have similar effects on regulation of REC8 gene expression; second, Scc3 modulates the density
of Pol II binding to the REC8 gene; third, a heterologous reporter assay using the REC8 promoter
shows that it is under the influence of cohesin; and finally, the REC8 open reading frame driven
by the inducible CUP1 or the meiosis-specific DMC1 promoter can be transcribed and translated
at comparable levels in wild type and cohesin mutants. Because Rec8 is a meiosis-specific
cohesin subunit, feedback control by meiotic cohesin of REC8 promoter activation is not
surprising (Lin et al. unpublished data). In addition, one prediction is that, if the cohesin
holocomplex formation and its association with the chromosome were important, the cohesin
loader, the Scc2/Scc4 complex, would have a similar role in meiotic gene activation. Indeed, our
analysis of Scc2 in yeast meiosis shows that it is required for recruiting cohesin to the
chromosome to activate the cohesin-regulated promoter REC8 (Lin et al. unpublished data), but
our observation differs from those in fly, where cohesin and its loader Scc2 (called Nipped B)
apparently have opposite effects on gene regulation (Rollins et al. 2004). The reason for this
discrepancy is currently unknown.
How, then, does cohesin activate gene transcription in yeast? In vertebrates, direct
binding of cohesin to the transcriptional factor CTCF, which has been implicated in insulating
gene transcription, may explain cohesin’s role in gene regulation (Parelho et al. 2008; Rubio et
al. 2008; Stedman et al. 2008; Wendt et al. 2008). In yeast, no equivalent of CTCF is yet known,
but currently no evidence indicates that cohesin binds directly to the transcriptional machinery.
18
Upon differentiation into meiosis, yeast cells reorganize the higher-order chromosome structure
that necessitates the change of gene expression pattern (Kassir et al. 2003), of which cohesin
could act as an important chromosomal factor. Furthermore, cohesin binds to the chromatin
remodeling complex RSC and also interacts with modified histones during double-strand break
repair (Unal et al. 2004; Chai et al. 2005). Finally, a recent study in yeast showed that scc2 and
eco1 mutations that mimic human diseases lead to altered chromosome organization (Gard et al.
2009). Therefore, cohesin-mediated chromosome organization may facilitate the recruitment of
transcriptional factors to the 5’ upstream sequences of cohesin-regulated genes to activate or
repress gene expression. Alternatively, cohesin might directly interact with the transcriptional
factors, for example with the mediator (Kagey et al. 2010), to regulate gene expression. These
two possibilities are not mutually exclusive, but the current work does not distinguish between
them.
Cohesin is required for REC8 gene expression during meiotic differentiation but not for
that of its duplicated gene MCD1 in vegetative cells. In addition, cohesin does not seem to
regulate meiotic genes universally, because the expression of the meiosis-specific genes IME1,
DMC1, and others is largely unaffected in Scc3- or Smc1-depleted cells (this report and data not
shown). These observations imply that a complex interplay takes place between trans-acting
factors and cis-acting DNA sequences in regulating the expression of cohesin-target genes during
meiotic differentiation. Cohesin associates with the chromosome at specific loci of the yeast
genome, which are predominately located at regions of convergent transcription (Glynn et al.
2004; Lengronne et al. 2004). These binding sites would position cohesin toward the 3’-end of
the transcribed genes, rather that at promoter-proximal sequences, which might explain why only
a subset of meiotic genes is subject to cohesin regulation (this study and our unpublished data).
19
In this regard, our study is consistent with a recent observation of cohesin activity in G1-arrested
vegetative cells, showing that a small number of genes changed expression pattern in response to
mcd1-1 inactivation in budding yeast (Skibbens et al. 2010).
Our genetic analysis using the cdc6 mutant indicates that the primarily role of cohesin in
sister-chromatid cohesion is not necessary for its regulation of its target gene. In the cdc6
mutant, cohesin, revealed by Rec8, is localized to the meiotic chromosome axis in a way similar
to that in the wild type. Because sister chromatid cohesion is coupled to DNA replication in
yeast (Uhlmann and Nasmyth 1998), our results suggest that chromosomal binding of cohesin is
sufficient for carrying out cohesin’s function in gene regulation. Therefore, cohesin’s role in
sister chromatid cohesion appears to be separable from its role in gene expression. Our results
also lend support to the notion that regulation of gene expression by cohesin is independent of
sister-chromatid cohesion in postmitotic and differentiating animal cells (Horsfield et al. 2007;
Pauli et al. 2008; Schuldiner et al. 2008; Nativio et al. 2009).
In summary, we have shown that cohesin plays a positive role in target gene activation
during yeast meiotic differentiation. Lack of cohesin is detrimental to yeast meiosis in many
aspects, including gene transcription, recombination, and chromosome segregation. The
identification of cohesin target genes in yeast provides a valuable tool for further elucidation of
the biological significance and mechanism of cohesin function in gene regulation during cell
differentiation in a model eukaryote.
20
Acknowledgements
We thank A. Amon, V. Guacci, and D. Bishop for sharing yeast strains and antibodies. S.
Miller provided technical assistance. A. B. Thistle assisted with text editing. This work was
supported in part by the National Science Foundation (MCB-0718384) and the Florida
Biomedical Research Program (08BN-08).
21
REFERENCES
Blat, Y., and N. Kleckner, 1999 Cohesins bind to preferential sites along yeast chromosome III,
with differential regulation along arms versus the centric region. Cell 98: 249–259.
Chai, B., J. Huang, B. R. Cairns and B. C. Laurent, 2005 Distinct roles for the RSC and Swi/Snf
ATP-dependent chromatin remodelers in DNA double-strand break repair. Genes Dev.
19: 1656–1661.
Chu, S., J. DeRisi, M. Eisen, J. Mulholland, D. Botstein et al., 1998 The transcriptional program
of sporulation in budding yeast. Science 282: 699–705.
Donze, D., C. R. Adams, J. Rine and R. T. Kamakaka, 1999 The boundaries of the silenced HMR
domain in Saccharomyces cerevisiae. Genes Dev. 13: 698–708.
Dorsett, D., J. C. Eissenberg, Z. Misulovin, A. Martens, B. Redding et al., 2005 Effects of sister
chromatid cohesion proteins on cut gene expression during wing development in
Drosophila. Development 132: 4743–4753.
Gard, S., W. Light, B. Xiong, T. Bose, A. J. McNairn et al., 2009 Cohesinopathy mutations
disrupt the subnuclear organization of chromatin. J. Cell Biol. 187: 455–462.
Glynn, E. F., P. C. Megee, H. G. Yu, C. Mistrot, E. Unal et al., 2004 Genome-wide mapping of
the cohesin complex in the yeast Saccharomyces cerevisiae. PLoS Biol. 2: E259.
Gruber, S., C. H. Haering and K. Nasmyth, 2003 Chromosomal cohesin forms a ring. Cell 112:
765–777.
Guacci, V., D. Koshland and A. Strunnikov, 1997. A direct link between sister chromatid
cohesion and chromosome condensation revealed through the analysis of MCD1 in S.
cerevisiae. Cell 91: 47–57.
Haering, C. H., A. M. Farcas, P. Arumugam, J. Metson and K. Nasmyth, 2008 The cohesin ring
22
concatenates sister DNA molecules. Nature 454: 297–301.
Hauf, S., E. Roitinger, B. Koch, C. M. Dittrich, K. Mechtler et al., 2005 Dissociation of cohesin
from chromosome arms and loss of arm cohesion during early mitosis depends on
phosphorylation of SA2. PLoS Biol. 3: e69.
Hirano, T., 2006 At the heart of the chromosome: SMC proteins in action. Nat. Rev. Mol. Cell.
Biol. 7: 311–322.
Hochwagen, A., W. H. Tham, G. A. Brar and A. Amon, 2005 The FK506 binding protein Fpr3
counteracts protein phosphatase 1 to maintain meiotic recombination checkpoint activity.
Cell 122: 861–873.
Horsfield, J. A., S. H. Anagnostou, J. K. Hu, K. H. Cho, R. Geisler et al., 2007 Cohesin-
dependent regulation of Runx genes. Development 134: 2639–2649.
Jin, H., V. Guacci and H. G. Yu, 2009 Pds5 is required for homologue pairing and inhibits
synapsis of sister chromatids during yeast meiosis. J. Cell Biol. 186: 713–725.
Kagey, M.H., J.J. Newman, S. Bilodeau, Y. Zhan, D.A. Orlando et al., 2010. Mediator and
cohesin connect gene expression and chromatin architecture. Nature 467: 430-435.
Kassir, Y., N. Adir, E. Boger-Nadjar, N. G. Raviv, I. Rubin-Bejerano et al., 2003 Transcriptional
regulation of meiosis in budding yeast. Int. Rev. Cytol. 224: 111–171.
Keeney, S., C. N. Giroux and N. Kleckner, 1997 Meiosis-specific DNA double-strand breaks are
catalyzed by Spo11, a member of a widely conserved protein family. Cell 88: 375–384.
Kellis, M., B. W. Birren and E. S. Lander, 2004 Proof and evolutionary analysis of ancient
genome duplication in the yeast Saccharomyces cerevisiae. Nature 428: 617–624.
Klein, F., P. Mahr, M. Galova, S. B. Buonomo, C. Michaelis et al., 1999 A central role for
cohesins in sister chromatid cohesion, formation of axial elements, and recombination
23
during yeast meiosis. Cell 98: 91–103.
Kupiec, M., B. Byers, R. E. Esposito and A. Mitchell, 1997. Meiosis and sporulation in
Saccharomyces cerevisiae, pp. 889–1036 in The Molecular and Cellular Biology of the
Yeast Saccharomyces, edited by J. R. Broach, J. R. Pringle, and Elizabeth W. Jones. Cold
Spring Harbor Labrotary Press, Cold Spring Harbor, New York.
Laloraya, S., V. Guacci and D. Koshland, 2000 Chromosomal addresses of the cohesin
component Mcd1p. J. Cell Biol. 151: 1047–1056.
Lee, B. H. and A. Amon, 2003 Role of Polo-like kinase CDC5 in programming meiosis I
chromosome segregation. Science 300: 482–486.
Lengronne, A., Y. Katou, S. Mori, S. Yokobayashi, G. P. Kelly et al., 2004 Cohesin relocation
from sites of chromosomal loading to places of convergent transcription. Nature 430:
573–578.
Liu, J., and I. D. Krantz, 2009 Cornelia de Lange syndrome, cohesin, and beyond. Clin. Genet.
76: 303–314.
Longtine, M. S., A. McKenzie III, D. J. Demarini, N. G. Shah, A. Wach et al., 1998 Additional
modules for versatile and economical PCR-based gene deletion and modification in
Saccharomyces cerevisiae. Yeast 14: 953–961.
Michaelis, C., R. Ciosk and K. Nasmyth, 1997 Cohesins: chromosomal proteins that prevent
premature separation of sister chromatids. Cell 91: 35–45.
Mitchell, A. P., 1994 Control of meiotic gene expression in Saccharomyces cerevisiae.
Microbiol. Rev. 58: 56–70.
Nasmyth, K. and C. H. Haering, 2009 Cohesin: its roles and mechanisms. Annu. Rev. Genet.
43: 525–558.
24
Nativio, R., K. S. Wendt, Y. Ito, J. E. Huddleston, S. Uribe-Lewis et al., 2009 Cohesin is required
for higher-order chromatin conformation at the imprinted IGF2-H19 locus. PLoS Genet.
5: e1000739.
Onn, I., J. M. Heidinger-Pauli, V. Guacci, E. Unal and D. E. Koshland, 2008 Sister chromatid
cohesion: a simple concept with a complex reality. Annu. Rev. Cell Dev. Biol. 24: 105–
109.
Parelho, V., S. Hadjur, M. Spivakov, M. Leleu, S. Sauer et al., 2008 Cohesins functionally
associate with CTCF on mammalian chromosome arms. Cell 132: 422–433.
Pauli, A., F. Althoff, R. A. Oliveira, S. Heidmann, O. Schuldiner et al., 2008 Cell-type-specific
TEV protease cleavage reveals cohesin functions in Drosophila neurons. Dev. Cell 14:
239–251.
Rollins, R. A., M. Korom, N. Aulner, A. Martens and D. Dorsett, 2004 Drosophila nipped-B
protein supports sister chromatid cohesion and opposes the stromalin/Scc3 cohesion
factor to facilitate long-range activation of the cut gene. Mol. Cell. Biol. 24: 3100–3111.
Rollins, R. A., P. Morcillo and D. Dorsett, 1999. Nipped-B, a Drosophila homologue of
chromosomal adherins, participates in activation by remote enhancers in the cut and
Ultrabithorax genes. Genetics 152: 577–593.
Rubio, E. D., D. J. Reiss, P. L. Welcsh, C. M. Disteche, G. N. Filippova et al., 2008 CTCF
physically links cohesin to chromatin. Proc. Natl. Acad. Sci. USA 105: 8309–8314.
Sambrook, J., and D. W. Russell, 2001 Molecular Cloning: A Laboratory Manual. Cold Sping
Harbor Laboratory Press. Cold Sping Harbor, New York.
Schuldiner, O., D. Berdnik, J. M. Levy, J. S. Wu, D. Luginbuhl et al., 2008 piggyBac-based
mosaic screen identifies a postmitotic function for cohesin in regulating developmental
25
axon pruning. Dev. Cell 14: 227–238.
Skibbens, R. V., J. Marzillier and L. Eastman, 2010 Cohesins coordinate gene transcriptions of
related function within Saccharomyces cerevisiae. Cell Cycle 9: 1601–1606
Stedman, W., H. Kang, S. Lin, J. L. Kissil, M. S. Bartolomei et al., 2008 Cohesins localize with
CTCF at the KSHV latency control region and at cellular c-myc and H19/Igf2 insulators.
EMBO J. 27: 654–666.
Strom, L., H. B. Lindroos, K. Shirahige and C. Sjogren, 2004 Postreplicative recruitment of
cohesin to double-strand breaks is required for DNA repair. Mol. Cell 16: 1003–1015.
Uhlmann, F., and K. Nasmyth, 1998 Cohesion between sister chromatids must be established
during DNA replication. Curr. Biol. 8: 1095–1101.
Unal, E., A. Arbel-Eden, U. Sattler, R. Shroff, M. Lichten et al., 2004, DNA damage response
pathway uses histone modification to assemble a double-strand break-specific cohesin
domain. Mol. Cell 16: 991–1002.
Wendt, K. S., K. Yoshida, T. Itoh, M. Bando, B. Koch et al., 2008 Cohesin mediates
transcriptional insulation by CCCTC-binding factor. Nature 451: 796–801.
Xu, L., M. Ajimura, R. Padmore, C. Klein and N. Kleckner, 1995 NDT80, a meiosis-specific
gene required for exit from pachytene in Saccharomyces cerevisiae. Mol. Cell. Biol. 15:
6572–6581.
Yu, H. G., and D. E. Koshland. 2005 Chromosome morphogenesis: condensin-dependent cohesin
removal during meiosis. Cell 123: 397–407.
Zhang, N., S. G. Kuznetsov, S. K. Sharan, K. Li, P. H. Rao et al., 2008 A handcuff model for the
cohesin complex. J. Cell Biol. 183: 1019–1031.
26
Figure legends
Figure 1. Requirement for Scc3 in sister-chromatid cohesion during yeast meiosis. (A) Protein
levels of Scc3 during yeast meiosis. Yeast cells were induced for synchronous meiosis, and
aliquots were withdrawn at indicated times. Total protein extracts were prepared by the TCA
method for western blots, which were probed by anti-HA (12CA5) and anti-β-tubulin antibodies.
The level of Tub2 (β-tubulin) served as a loading control. Note that Scc3 was largely depleted in
meiosis in PCLB2SCC3 cells. MT, mitosis, protein extracts were prepared from cells grown
asynchronously in the YPD medium. Wild-type (WT), 3072; PCLB2SCC3, 3200. (B and C)
Assay of sister chromatid cohesion in strains 3078C; 3206, HY2130, and HY1472. Yeast
aliquots were withdrawn at indicted time points and fixed for fluorescence microscopy. An array
of tetO was inserted at the URA3 locus, ~35 kb from centromere V. Expression of tetR-GFP
generated a GFP signal that could be visualized as a dot by fluorescence microscopy. Cohesed
sister chromatids formed only one GFP dot. At least 100 cells were counted at each time point.
Figure 2. Reduced Rec8 protein level in Scc3-depleted cells. Yeast cells were induced to
undergo synchronous meiosis as in Figure 1. (A) Chromosome association of Rec8 in wild-type
(2824) and PCLB2SCC3 (HY2294) cells. Yeast aliquots were collected 6 h after induction of
meiosis, and surface nuclear spreads were prepared for immunofluorescence with an anti-HA
antibody. Red, DNA; green, Rec8. (B) Rec8 protein level in wild-type and PCLB2SCC3 cells in
meiosis. Yeast aliquots were collected at indicated times and prepared for western blot as in
Figure 1A. An anti-Dmc1 specific antibody was used to detect the level of Dmc1. (C)
Chromosome association of Scc3 in wild-type (3072) and rec8Δ (HY1495) cells. Surface yeast
nuclear spreads were prepared as in A. Note that Scc3 remains chromosome bound in rec8Δ
cells. Red, DNA; green, Scc3. Bar, 2 µm. (D) Scc3 protein level in wild-type and rec8Δ cells.
27
Western blots were prepared as in B. Note that the level of Scc3 remains normal in rec8Δ cells.
Figure 3. Requirement for Scc3 for Rec8 but not for Smc3 production in yeast meiosis. Yeast
cells were induced for synchronous meiosis, aliquots were withdrawn at indicated times, and
protein extracts were prepared for western blots probed by anti-V5, anti-HA, and anti-β-tubulin
antibodies. (A) Protein level of Smc3 in wild-type (HY1510C) and PCLB2SCC3 (HY1566) cells.
(B) Chromosome localization of Smc3 during yeast meiosis. Yeast cells were collected 6 h after
induction of meiosis and prepared for surface nuclear spread as in Figure 2A. Tub1 (α-tubulin)
was detected by a specific antibody (YOL135). Red, Smc3; green, Tub1; blue, DNA. (C)
Protein levels of Rec8 in spo11-Y135F (HY1499) and PCLB2SCC3 spo11-Y135F (HY1483) cells.
Figure 4. Scc3 regulates REC8 promoter activity during yeast meiosis. (A) mRNA levels of
IME1, REC8, SCC3, and ACT1 in wild-type (NH144), PCLB2SCC3 (3200), and rec8Δ (HY1495)
cells. Yeast cells were induced to undergo synchronous meiosis, and aliquots were withdrawn at
the indicated times and prepared for northern blots probed by gene-specific probes. (B) RT-PCR
analysis of IME1, REC8, and ACT1 transcripts. Yeast aliquots were withdrawn 6 h after
induction of meiosis; total mRNA was extracted, reversed to cDNA, and amplified by gene-
specific primers. Quantitative analysis is shown to the right. Average of two independent
experiments is shown. Error bars show standard deviation. (C) Chromatin immunoprecipitation
(ChIP) of Rbp3 in wild-type (HY3000) and PCLB2SCC3 (HY3003) cells during yeast meiosis.
Yeast cells were induced to undergo synchronous meiosis; aliquots were withdrawn 6 h after
induction and prepared for ChIP analysis. A representative gel image is shown to the left.
Quantitative analysis of Rpb3 binding at the REC8 and DMC1 genes from two independent
experiments is shown to the right. (D) A heterologous reporter assay of REC8 promoter activity
(HY2106 and HY2108). Plasmid pHG105 was digested with MluI and transformed into the
28
REC8 locus. Yeast cells were induced to undergo synchronous meiosis, and aliquots were
withdrawn for northern blots as shown in A. Gene-specific probes were used to detect the
mRNA levels of IME1, GFP, and ACT1.
Figure 5. Ectopic expression of REC8 in meiotic cells. (A) The expression level of PCUP1REC8
in wild-type (HY1417C) and PCLB2SCC3 (HY1417) cells during meiosis. Yeast cells were
induced for synchronous meiosis and aliquots were withdrawn at indicated times for northern
blots as shown in Figure 4A. Note that PCUP1REC8 is expressed in PCLB2SCC3 cells. A
semiquantitative measurement of REC8 transcripts over those of ACT1 is shown to the right. (B)
Protein level of Rec8 in wild-type and PCLB2SCC3 cells. Western blots were prepared as in
Figure 1A to reveal the levels of Rec8-3HA and β-tubulin. (C) Chromosome association of Rec8
in wild-type and PCLB2SCC3 cells. Yeast surface nuclear spreads were prepared for
immunofluorescence as in Figure 2A. Note that Rec8 is produced but does not bind to
chromosomes in PCLB2SCC3 cells. Red, DNA; green, Rec8. Bar, 2 µm.
Figure 6. Scc3 is not required for MCD1 expression in vegetative cells. (A) A schematic
diagram showing the experimental procedure. Strain, HY1740. (B) Yeast budding index
showing cell progression. Yeast aliquots were withdrawn at indicated times after G1 release,
fixed, and examined by phase-contrast microscopy. (C) mRNA levels of SCC3, MCD1, and
ACT1 after release from α-factor arrest. Yeast aliquots were withdrawn at indicated times and
prepared for northern blots probed by gene-specific probes as shown in Figure 4A. Note that
MCD1 is only expressed after release from α-factor arrest. (D) Protein levels of Scc3 and Mcd1.
Yeast aliquots were withdrawn at indicated times and prepared for western blots probed by anti-
HA, anti-Mcd1, and anti-β-tubulin antibodies. Note that Mcd1 remains at a normal level in
Scc3-depleted vegetative cells.
29
Figure 7. Activation of REC8 promoter requires Smc1 but not sister-chromatid cohesion. (A)
Depletion of Smc1 during meiosis (2821and HY1875). Yeast cells were induced to undergo
synchronous meiosis, and aliquots were withdrawn at the indicated times for western blots as in
Figure 1A. (B) Transcriptional level of REC8 during meiosis (NH144 and HY1875). Total RNA
was extracted and probed with gene-specific probes as in Figure 4A. (C) Protein level of Rec8 in
wild-type (HY1503C) and PCLB2SMC1 (HY1868) cells in meiosis. Yeast protein extracts were
prepared for western blots, which detected the levels of Rec8 and Dmc1 as shown in Figure 2B.
The level of β-tubulin served as a loading control. (D) A heterologous reporter assay of REC8
promoter activity in wild-type (HY2460) and PCLB2SMC1 (HY2460-1) cells in meiosis.
PREC8GFP was placed at the URA3 locus by transformation. Yeast cells were induced to undergo
synchronous meiosis, and aliquots were withdrawn at the indicated times and prepared for
western blots probed by anti-GFP (Ab290) and anti-β-tubulin antibodies. (E) Rec8 protein level
in wild-type (HY2740) and PSCC1CDC6 (HY2741) cells during meiosis. Representative time
points are shown. (F) Chromosome localization of Rec8 in wild-type and PSCC1CDC6 cells
during meiosis. Yeast cells were collected 6 h after induction of meiosis and prepared for surface
nuclear spread as in Figure 2A. Note that chromosomes still formed rod-shaped structures in the
absence of sister chromatids. Red, DNA; green, Rec8. Bar, 2 µm.
30
Supplemental data
Supplemental Table 1. Yeast strains used in this study Strains Genotype 2821 leu2, ura3, his4-x, SMC1-3HA, lys2, ho::LYS2/ leu2 ura3 arg4-Nsp, lys2,
ho::LYS2 2824 leu2, ura3, his4, trp1, lys2, ho::LYS2, REC8-3HA::URA3/ leu2, ura3, arg4-
Nsp, trp1, lys2, ho::LYS2, REC8-3HA::URA3 3072 arg4-Nsp, ura3, leu2, lys2, ho::LYS2, SCC3-3HA::KAN/his4, lys2, ho::LYS2,
ura3, leu2, SCC3-3HA::KAN 3078C arg4, ura3, leu2, URA3::tetO, LEU2::tetR-GFP, lys2, ho::LYS2/his4, ura3,
leu2, lys2, ho::LYS2 3200 arg4, ura3, leu2, PCLB2SCC3::KAN, lys2, ho::LYS2/his4, ura3, leu2,
PCLB2SCC3::KAN, lys2, ho::LYS2 3206 ura3, leu2, URA3::tetO, PCLB2SCC3::KAN, lys2, ho::LYS2/ura3, his4, leu2,
LEU2::tetR-GFP, PCLB2SCC3::KAN, lys2, ho::LYS2 HY1417C leu2, ura3, PCUP1REC8::KAN, lys2, ho::LYS2 /leu2, ura3, PCUP1REC8::KAN,
lys2, ho::LYS2 HY1417 leu2, ura3, PCUP1REC8::KAN, PCLB2SCC3::KAN, lys2, ho::LYS2/leu2, ura3,
PCUP1REC8::KAN, PCLB2SCC3::KAN, lys2, ho::LYS2 HY1472 his4, PCLB2SCC3::KAN, ndt80Ä::CLONAT, leu2::tetR-GFP::LEU2,
ura3::URA3:: tetO, lys2, ho::LYS2/PCLB2SCC3::KAN, ndt80Ä::CLONAT, lys2, ho::LYS2
HY1483 his4, leu2, spo11-Y135F::HB, REC8-3HA::URA3, PCLB2SCC3::KAN, lys2, ho::LYS2/leu2, spo11-Y135F::HB, REC8-3HA::URA3, PCLB2SCC3::KAN
HY1495 leu2, ura3, arg4, rec8Ä::HB, SCC3-3HA, lys2, ho::LYS2/leu2, ura3, arg4, rec8Ä::HB, SCC3-3HA, lys2, ho::LYS2
HY1499 his4, leu2, spo11-Y135F::HB, REC8-3HA::URA3, lys2, ho::LYS2/his4, leu2, spo11-Y135F::HB, REC8-3HA::URA3, lys2, ho::LYS2
HY1503C arg4, his4, leu2, REC8-3HA::URA3, lys2, ho::LYS2/leu2, REC8-3HA::URA3, lys2, ho::LYS2
HY1510C ura3, leu2, SMC3-V5::HIS5, lys2, ho::LYS2/ura3, leu2, SMC3-V5::HIS5, lys2, ho::LYS2
HY1566 leu2, ura3, PCLB2SCC3::KAN, SMC3-V5::HIS5, lys2, ho::LYS2/leu2, ura3, PCLB2SCC3::KAN, SMC3-V5::HIS5, lys2, ho::LYS2
HY1740* MATa, his3∆1, leu2∆0, lys2∆0, ura3∆0, TDEGRON-SCC3-3HA::HIS5 HY1868 ura3, leu2, REC8-3HA::URA3, PCLB2SMC1::KAN, lys2, ho::LYS2/ura3, leu2,
REC8-3HA::URA3, PCLB2SMC1::KAN, lys2, ho::LYS2 HY1875 his3, leu2-k, ura3, PCLB2SMC1::KAN, lys2, ho::LYS2/ his3, leu2-k, ura3,
PCLB2SMC1::KAN, lys2, ho::LYS2 HY2087 leu2, his4, ura3, PSCC1CDC6::KAN, REC8-3HA::URA3, lys2, ho::LYS2/leu2,
his4, ura3, PSCC1CDC6::KAN, REC8-3HA::URA3, lys2, ho::LYS2 HY2106 his3Ä200, leu2-k, ura3, lys2, ho::LYS2, PREC8GFP::REC8, lys2,
ho::LYS2/his3Ä200, leu2-k, ura3, lys2, ho::LYS2, PREC8GFP::REC8, lys2,
31
ho::LYS2 HY2108 his4, ura3, PREC8GFP::REC8, PCLB2SCC3::KAN, lys2, ho::LYS2/arg4, ura3,
PREC8GFP::REC8, PCLB2SCC3::KAN, lys2, ho::LYS2 HY2130 ura3::tetO::URA3, leu2::tetR-GFP::LEU2, ndt80::HB, lys2, ho::LYS2/his4,
ura3, leu2, ndt80::Kan, lys2, ho::LYS2 HY2207 leu2, his4, PDMC1REC8-3HA::URA3, lys2, ho::LYS2/leu2, his4, PDMC1REC8-
3HA::URA3, lys2, ho::LYS2 HY2226 leu2, his4, PDMC1REC8-3HA::URA3, PCLB2SCC3::KAN, lys2, ho::LYS2/ leu2,
PDMC1REC8-3HA::URA3, PCLB2SCC3::KAN, lys2, ho::LYS2 HY2294 leu2, his4, REC8-3HA::URA3, PCLB2SCC3::KAN, lys2, ho::LYS2/leu2, his4,
REC8-3HA::URA3, PCLB2SCC3::KAN, lys2, ho::LYS2 HY2460 his4, lys2, ho::LYS2, leu2::hisG, PREC8GFP::URA3/leu2, arg4, lys2,
ho::LYS2, PREC8GFP::URA3 HY2460-1 his4, lys2, ho::LYS2, leu2::hisG, PREC8GFP::URA3, PCLB2SMC1::KAN/leu2,
arg4, lys2, ho::LYS2, PREC8GFP::URA3, PCLB2SMC1::KAN HY2464 his4, ura3, lys2, ho::LYS2, leu2::hisG, PDMC1GFP::LEU2/leu2-k, arg4-Nsp,
ura3, lys2, ho::LYS2, PDMC1GFP::LEU2 HY2466 his4, ura3, leu2, PCLB2SCC3::KAN, PDMC1GFP::LEU2, lys2, ho::LYS2/ his4,
ura3, leu2, PCLB2SCC3::KAN, PDMC1GFP::LEU2, lys2, ho::LYS2 HY3000 arg4-Nsp, leu2, ura3, RPB3-V5::HIS5/leu2, ura3, RPB3-V5::HIS5 HY3003 arg4-Nsp, leu2, ura3, RPB3-V5::HIS5, PCLB2SCC3::KAN/leu2, ura3, RPB3-
V5::HIS5, PCLB2SCC3::KAN NH144 his4, ura3, leu2, lys2, ho::LYS2/ arg4-Nsp, ura3, leu2, lys2, ho::LYS2 *This strain is from the S288C background; all others are diploids isogenic to SK1.
32
Supplemental Table 2. PCR primers used in this study.
Primer name Primer sequence PCLB2SCC3F1
AAGCTCGTACTTATCCTGCCTAGAACTTATTCTATTACTCTCATCTCTGAGCATAGGCCACTAGTGGATCTG
PCLB2SCC3R1
AATAACTTGAGATTTAGTCCTTATTCTAGTTGAGCGACGCACAGCAGTAGCAGCGTAATCTGGAACGTC
SCC3TAGF1 CCCAACCGTGGTAGATGCTATAGACAACAGCGACGAAATCACACAAGATGCCGCTCTAGAACTAGTGGAT
SCC3TAGR1 TTATTGTTTTACAAAAGAGCAATAAGTCTGACGTATATCTTTTCCCTTATCGACGGTATCGATAAGCTTC
PCLB2SMC1F1
TTTCAACGTTCCAAGGCTTGGTTCTATCGCTCTTCTCTTCAAATTGTAGCATAGGCCACTAGTGGATCTG
PCLB2SMC1R1
CTCTATAGGACTTGAAATTACTTAGTTCTAAGCCAACTAAACGTCCCATAGCAGCGTAATCTGGAACGTC
SMC1TAGF1 AGAAAACTCGTCGAAGATCATAACTTTGGACTTGAGCAATTACGCAGAAGCCGCTCTAGAACTAGTGGAT
SMC1TAGR1 TATTATTAGTTATTTGACGGGTTATAGCAGAGGTTGGTTTCATAGATTATCGACGGTATCGATAAGCTTC
SMC3TAGF1 AGAAGAAGCAATCGGATTCATTAGAGGTAGCAATAAATTCGCTGAAGTCGCCGCTCTAGAACTAGTGGAT
SMC3TAGR1 GTAAGCAAAACTGATATTTTTATATACAAATCGTTTCAAATATCTCTTATCGACGGTATCGATAAGCTTC
DEGRONSCC3F1
CCCGTTACAATGCGATTGTGGCTATCCTAATCATACAACTTATGCCGTGTATGCTTCCGGCTCGTATGTT
DEGRONSCC3R1
AATAACTTGAGATTTAGTCCTTATTCTAGTTGAGCGACGCACAGCAGTCATGGTACCGTCTTTCTTCTCGT
PDMC1REC8F1
TTTTATCGTAACGTTTTTCTTTCTTCTTTCACGTGTTCTTTTTGTCTCGGCATAGGCCACTAGTGGATCTG
PDMC1REC8R1
TATTTTTTGCTGTATCACTATCGATCTCAGTTCCTGTAACAGACATTGCAGAATATTTGTAATATTAATC
REC8PROBEF1
AATCACCTGCTTGTGCAGTT
REC8PROBER1
TCTTCCAAAACTTGAAGGAGG
IME1PROBEF1
CAAAATTGCCTCATCTCAGC
IME1PROBER1
TCAACGTCGAAGGCAATTTC
SCC3PROBEF1
CATCACTCCATTGTTTCCCA
SCC3PROBER1
TTGTAGCGTCTGCAGGCAATT
ACT1PROBEF1
TTTCTCCACCACTGCTGAAA
33
ACT1PROBER1
TCATGGAAGATGGAGCCAAA
34
Supplemental Figure 1. FACS analysis of meiotic S-phase progression in wild-type (NH144)
and PCLB2SCC3 (3200). Yeast cells were induced to undergo synchronous meiosis, and aliquots
were withdraw at indicated times and prepared for FACS determination of DNA content. Time
in hours is shown to the left.
Supplemental Figure 2. Requirement for Scc3 in nuclear division during yeast meiosis. Yeast
cells were induced to undergo synchronous meiosis; aliquots were withdraw at indicated times,
fixed in 4% formaldehyde, stained with DAPI, and visualized by fluorescence microscopy. (A–
D) Meiotic nuclear division in wild-type (WT, NH144), PCLB2SCC3 (3200), spo11-Y135F
(HY1499), and PCLB2SCC3 spo11-Y135F (HY1483) cells. At least 100 cells were counted at
each time point.
Supplemental Figure 3. The activity of the DMC1 promoter is not subject to Scc3 regulation in
meiosis. (A) Ectopic production of Rec8 in meiosis with PDMC1REC8 (HY2207 and HY2226).
Yeast cells were induced for synchronous meiosis, and protein extracts were prepared for western
blots probed by anti-HA and anti-β-tubulin antibodies. Note that Rec8 is produced by
PDMC1REC8 in PCLB2SCC3 cells. (B) A heterologous reporter assay of DMC1 promoter activity
in wild-type (HY2464) and PCLB2SCC3 (HY2466) cells. PDMC1GFP was inserted at the URA3
locus by standard yeast transformation with pHG112, which was digested by AflII. Yeast cells
were induced for synchronous meiosis, and protein extracts were prepared for western blots
probed by anti-GFP and anti-β-tubulin antibodies.
Supplemental Figure 4. Gene expression microarray survey of Smc1-regulated genes during
yeast meiosis. Yeast cells were induced to undergo synchronous meiosis, and aliquots were
withdrawn at indicated times. Samples were immediately frozen at –80°C. We used the RNeasy
kit (Qiagen) to extract and purify mRNA, which was reverse transcribed to cDNA. Reverse-
35
transcribed cDNA was labeled and hybridized to the 385K yeast expression array (Roche
NimbleGen). Scanned signals were analyzed by ArrayStar (DNAStar). (A) Heat map showing
the expression profile of the 52 early meiotic genes after 3, 4.5, and 6 h induction of meiosis.
Red indicates higher induction; green lower induction. * indicates the profile of the REC8 gene.
Log2 scale is shown a the bottom. (B) Representative genes showing changed expression level.
We used the DMC1 expression level as an internal control. Average of the three time points are
shown.