Post on 27-Jun-2020
ORIGINAL PAPER
Retention of agronomically important variation in germplasmcore collections: implications for allele mining
Patrick A. Reeves • Lee W. Panella •
Christopher M. Richards
Received: 19 July 2011 / Accepted: 15 December 2011 / Published online: 7 January 2012
� Springer-Verlag (outside the USA) 2012
Abstract The primary targets of allele mining efforts are
loci of agronomic importance. Agronomic loci typically
exhibit patterns of allelic diversity that are consistent with
a history of natural or artificial selection. Natural or arti-
ficial selection causes the distribution of genetic diversity
at such loci to deviate substantially from the pattern found
at neutral loci. The germplasm utilized for allele mining
should contain maximum allelic variation at loci of inter-
est, in the smallest possible number of samples. We show
that the popular core collection assembly procedure ‘‘M’’
(marker allele richness), which leverages variation at
neutral loci, performs worse than random assembly for
retaining variation at a locus of agronomic importance in
sugar beet (Beta vulgaris L. subsp. vulgaris) that is under
selection. We present a corrected procedure (‘‘M?’’) that
outperforms M. An extensive coalescent simulation was
performed to demonstrate more generally the retention of
neutral versus selected allelic variation in core subsets
assembled with M?. A negative correlation in level of
allelic diversity between neutral and selected loci was
observed in 42% of simulated data sets. When core col-
lection assembly is guided by neutral marker loci, as is the
current common practice, enhanced allelic variation at
agronomically important loci should not necessarily be
expected.
Introduction
Adaptations are the currency of biodiversity. Genetically
based adaptive diversity, which has arisen via the process
of natural selection, is the principal object of interest in
fields attempting to understand, preserve, or utilize biodi-
versity. Adaptations, and the genes that underlie them, are
a valuable resource for evolutionary biologists, conserva-
tion managers, and agricultural researchers. Adaptive var-
iation, in addition to its importance for ensuring the success
of the species in which it originated, has great intellectual,
cultural, and economic value to humankind.
Gene banks operate at a unique nexus between evolu-
tionary biology, conservation genetics, and crop science,
where description, preservation, and utilization of adaptive
diversity play equally important roles (Schoen and Brown
2001; Borner 2006; Walters et al. 2008). By collecting
biodiversity from nature, establishing long-term storage,
and organizing and distributing genetic variation to users,
gene banks broker the benefits of adaptive biodiversity
from nature to human society. Unfortunately, efficient
extraction and exploitation of the adaptive variation and
valuable traits maintained in gene banks have yet to be
fully achieved, though it remains a high priority of gene
bank managers (Hoisington et al. 1999; Richards 2004).
Traditional methods, which screen large, heterogeneous
collections for phenotypic variation in agricultural traits,
are not only logistically challenging but they may overlook
Communicated by A. Graner.
Electronic supplementary material The online version of thisarticle (doi:10.1007/s00122-011-1776-4) contains supplementarymaterial, which is available to authorized users.
P. A. Reeves (&) � C. M. Richards
National Center for Genetic Resources Preservation,
United States Department of Agriculture, Agricultural Research
Service, 1111 South Mason Street, Fort Collins, CO 80521, USA
e-mail: pat.reeves@ars.usda.gov
L. W. Panella
Northern Plains Area Sugarbeet Research Unit,
United States Department of Agriculture, Agricultural Research
Service, 1701 Centre Ave, Fort Collins, CO 80521, USA
123
Theor Appl Genet (2012) 124:1155–1171
DOI 10.1007/s00122-011-1776-4
valuable genotypic variation concealed by epistasis in non-
elite genetic backgrounds (Tanksley and McCouch 1997).
Allele mining offers the prospect for expedited recovery
of useful adaptations from gene banks. Allele mining
experiments seek to identify naturally occurring allelic
variants at loci of agronomic importance, i.e. those genes
that affect crop characteristics and performance. Agro-
nomic loci have been identified using a variety of approa-
ches including mutant screens (Johal and Briggs 1992;
Whitham et al. 1994; Bishop et al. 1996), QTL analysis
(Backes et al. 1995; Xiao et al. 1996; Bernacchi et al. 1998),
association mapping (Gonzalez-Martınez et al. 2007;
Crossa et al. 2007), and genomewide surveys for the sig-
nature of artificial selection (Vigouroux et al. 2002; Casa
et al. 2005; Yamasaki et al. 2005; Chapman et al. 2008).
Novel alleles recovered at loci of agronomic importance
can be integrated into crop breeding programs using con-
ventional or molecular approaches, and might be utilized to
combat disease (Caicedo 2008; Kaur et al. 2008; Wang et al.
2008; Bhullar et al. 2009, 2010), to promote yield increases,
to produce better storage and nutritional properties, or to
improve stress tolerance (Latha et al. 2004).
The success of allele mining operations is dependent on
the availability of diverse germplasm collections (Kumar
et al. 2010). The majority of allelic variation at any given
locus is predicted to occur in the wild relatives of a crop,
and not the crop itself, due to the inevitable loss of varia-
tion at the domestication bottleneck (Tenaillon et al. 2004;
Hyten et al. 2006; Zhu et al. 2007). Thus allele mining
efforts will increasingly focus on wild material to identify
useful new alleles not already present in the crop gene pool
(Tanksley and McCouch 1997; Gur and Zamir 2004; Johal
et al. 2008; Prada 2009). The curation of wild germplasm
collections is complicated by this wealth of diversity.
Organizing natural genetic variation for efficient charac-
terization and exploitation, without a priori knowledge of
the phenotype that will be targeted for improvement, is a
major challenge for contemporary gene banking.
The core collection, a representative subset of the
complete collection that has been optimized to contain
maximal diversity in a minimal number of accessions, has
been the primary solution proposed for facilitating the
utilization of diverse germplasm collections (Frankel 1984;
Brown 1989). Core collections are designed to streamline
the integration of new, useful alleles into conventional
breeding programs by reducing the number of accessions
necessary in experimental crosses or phenotypic screening
studies while maintaining, to the maximum extent possible,
allelic diversity at loci controlling traits of interest. The
potential improvement in screening efficiency offered by
the core collection concept to conventional breeding is
equally applicable to modern allele mining efforts. But, in
order to identify subsets of the collection optimized for
discovering the alleles necessary to solve future challenges,
it will be necessary to predict the level of variation present
at an undiscovered target locus affecting a thus far unde-
termined phenotype using simple-to-obtain information,
such as ecogeographical attributes of sampling localities or
molecular marker variation at easily assayed reference loci.
A number of optimization procedures for assembling
core collections have been proposed. Most methods use
some form of a priori splitting, or stratification, of the
accessions into ‘‘diversity groups’’ that typically reflect
ecogeographical differences among the original sampling
localities (Brown 1989). Following an initial stratification
step, core sets can be assembled by selecting a constant
number of accessions at random from each diversity group
(the ‘‘C’’ procedure), by choosing accessions at random in
proportion to the size of the diversity group (‘‘P’’ proce-
dure) or in proportion to the logarithm of the size of the
diversity group (‘‘L’’), or by choosing accessions at random
in proportion to an estimate of heterozygosity within
diversity groups (‘‘H’’) (Schoen and Brown 1993). Other
methods for core assembly include selecting accessions in
proportion to the mean genetic distance between individ-
uals within diversity groups (‘‘D’’, Franco et al. 2005;
‘‘genetic distance sampling’’, Jansen and van Hintum
2007), and choosing accessions such that the total allelic
diversity at a set of neutral reference loci is maximized in
the resulting subset, provided that at least one accession
from each diversity group is included (‘‘M’’, for marker
allelic richness; Schoen and Brown 1993). In practice, both
genetic distance sampling and the M procedure do not
require initial stratification, an advantage in our opinion
because divisions based on ecogeographic region might be
arbitrary with respect to the distribution of allelic diversity
at loci of agronomic importance. Of all procedures, M has
been applied most frequently, in part because of its dem-
onstrated efficiency for retaining maximal allelic diversity
at reference loci in a small subset of accessions (e.g.
McKhann et al. 2004; Balfourier et al. 2007; Escribano
et al. 2008; Le Cunff et al. 2008).
Under the M procedure, the selection of accessions is
guided by patterns of variation at neutral reference loci,
with the final subset consisting of those accessions that,
collectively, contain the highest possible number of distinct
alleles at the reference loci. Using simulated data, M has
been shown to be effective for assembling subsets that,
additionally, retain elevated levels of diversity at target loci
of interest, i.e. loci that have not been used to guide
assembly (Bataillon et al. 1996). The finding that the
number of allelic variants retained at unlinked target loci is
also maximized by applying M suggests that allelic
diversity at one locus within an accession (or population) is
correlated with allelic diversity at other loci within that
accession. The results from the simulations of Bataillon
1156 Theor Appl Genet (2012) 124:1155–1171
123
et al. (1996) thus lead to the hypothesis that allelic diversity
is not simply a property of an individual locus, but is a
property of populations as well—those populations with
high allelic diversity at one set of loci (in this case, the
reference loci) tend to have high allelic diversity at other,
independent loci (the target loci).
Patterns of variation at neutral loci, including properties
such as total allelic diversity, reflect population demogra-
phy and shared ancestry among members. Because such
historical attributes are common to all members of a pop-
ulation, allelic diversity is expected to be correlated across
unlinked neutral loci. For loci under selection, however, the
pattern may be very different and run counter to that pre-
dicted by demographic history and common ancestry (Reed
and Frankham 2001; McKay and Latta 2002; Charlesworth
et al. 2003). Indeed, it is precisely these differences that are
leveraged in genomewide scans for the signature of
selection (Nielsen 2005; Wright and Gaut 2005; Walsh
2008). These scans identify genes of agronomic importance
as those genes inferred to have been under positive
(directional) selection during domestication based upon a
deviation in allele frequency spectrum from neutral
expectations (Vigouroux et al. 2002; Casa et al. 2005;
Yamasaki et al. 2005).
To produce subsets of germplasm collections for effi-
cient allele mining at agronomic loci using the M proce-
dure, one must assume that allele counts at neutral
reference loci are predictive of allele counts at selected
target loci (i.e. target loci with a history of natural or
artificial selection). This assumption is questionable.
Allelic diversity is primarily controlled by population size
(Frankham 1996). For neutral loci, allelic variation is dri-
ven by the balance between mutation and extinction such
that the larger the population, the greater the number of
segregating neutral alleles (n = 4Nel ? 1 at equilibrium,
where n is the number of alleles, Ne is the effective pop-
ulation size, and l is the mutation rate) (Kimura and Crow
1964). A converse relationship holds for selected loci.
Directional selection, which winnows segregating varia-
tion, is most efficient with large population sizes because
allele frequencies are less affected by genetic drift. As
population size decreases, alleles under selection become,
in effect, neutral in terms of their expected frequency
distribution. This occurs when Ne drops below 1/2s, where
s is the selection coefficient (Wright 1931). Thus, at
selected loci, larger populations do not necessarily have
greater numbers of segregating alleles. As stated most
plainly by Frankham (1996), ‘‘The relationship between
genetic variation and population size should be strongest
for neutral genetic markers and poorest for the most
strongly selected markers…’’ (p. 1502). Hence we should
not expect allele counts at neutral and selected loci to be
correlated within any given population. Nevertheless, the
simulation study of Bataillon et al. (1996) states that
‘‘Results for retention of neutral alleles in the core col-
lections were found to be similar to those seen for alleles at
selected loci…’’ (p. 413): in other words, that the M pro-
cedure performed similarly regardless of whether target
loci were neutral or selected. This finding seems counter to
theory.
In this study, we use both empirical and simulated data
to examine the potential of the M procedure to improve the
efficiency of allele mining at loci of agronomic interest. By
doing so, we re-examine the suggestion that allelic diver-
sity is correlated between neutral and selected loci. We
consider molecular polymorphism data from germplasm
accessions derived from native populations of the sea beet,
Beta vulgaris subsp. maritima, the wild progenitor of the
sugar beet, collected along the Mediterranean and Atlantic
coasts of France. The target locus, BvFL1, is a homolog of
the Arabidopsis flowering time gene FLC and a locus of
agronomic importance in sugar beet (Reeves et al. 2007). A
coalescent simulation of neutral and selected loci under a
broad range of population structures and demographic
histories is performed to provide generality to conclusions.
Materials and methods
Acquisition of molecular polymorphism data
DNA was sampled from 28 Beta vulgaris subsp. maritima
germplasm accessions preserved in the U.S. National Plant
Germplasm System (Table 1). Accessions contain progeny
from collections of wild populations made along the
Atlantic and Mediterranean coasts of France, including five
populations from Corsica (Fig. 1a). Two hundred eighty-
four individuals were sampled, with 8 or 12 individuals
representing each population. Twelve SSR (simple
sequence repeat) loci were genotyped for all individuals as
described previously (Viard et al. 2002; Richards et al.
2004; McGrath et al. 2007). These loci were treated as
reference loci to guide subset assembly. The likelihood
ratio test for linkage among loci implemented in FSTAT
(Goudet 2001) identified two pairs of linked loci. For each
pair, the locus with fewer alleles was eliminated, resulting
in a reference data set containing codominant genotypes at
ten unlinked SSR loci. Allelic richness was calculated
using the rarefaction method of El Mousadik and Petit
(1996) in FSTAT.
Two SSR loci tightly linked to the gene BvFL1 were used
as target loci to test the potential for anonymous reference
loci to predict variation at agronomic loci. The loci were
identified within the genomic BvFL1 sequence (EF036526)
and genotyped for all individuals. Locus 509 is located
*24 Kbp upstream from the BvFL1 start codon; locus
Theor Appl Genet (2012) 124:1155–1171 1157
123
BvFL1 SSR1 is located within the BvFL1 gene, in intron 1,
*1 Kbp downstream from the start codon (Fig. 1b). Primer
sequences for amplification were 509 (509.83F = TGCTCT
CATCATCTTCTCCAATAG, 509.61R700 = ATATTT
TTAGTGAATTTAGAAAG); BvFL1 SSR1 (BvFL1 ?
948F = ATGAAGTTCTAACCTTTATCACAA, BvFL1 ?
1208R800 = AATGGTACGTGTATTATGAAACAT). PCR
reactions contained 3 mM MgCl2, 0.2 mM each dNTP, 0.05
units Taq DNA polymerase per ll, 2.5 pmol each primer, and
4 ng of DNA template. Cycling conditions consisted of an
initial denaturation step at 95� for 5 min, followed by 30
cycles between 94�, 53�, and 72�, holding at each temperature
for 45 s, then a final incubation at 72� for 10 min. Markers
were visualized using a LI–COR 4200 DNA sequencer
and scored using Saga GT software (LI–COR Biosciences,
Lincoln, NE).
For all genotyped loci, PyPop (Lancaster et al. 2007)
was used to perform the Ewens–Watterson–Slatkin (EWS)
homozygosity test of neutrality (Slatkin 1994, 1996). This
test evaluates the deviation of observed levels of homo-
zygosity from levels expected under Hardy–Weinberg
equilibrium. Higher than expected levels suggest direc-
tional or stabilizing selection (where a single allele is
favored), and lower than expected levels suggest balanc-
ing selection (heterozygote advantage). A two-tailed test
was used to distinguish the two alternative forms of
selection from the null hypothesis of neutrality. For
a = 0.05, p [ 0.975 indicated significant directional
Table 1 Beta vulgaris subsp. maritima germplasm accessions
sampled
PI n Latitude Longitude
504266 12 41.3889 9.1656
504269 8 41.5167 9.2167
504279 12 41.9161 8.7392
504277 12 42.6328 8.9422
504273 8 42.7022 9.4508
540562 12 43.4667 4.3333
540557 12 44.0978 0.2772
540578 12 45.3000 -0.7833
540582 8 45.8000 -1.1500
540592 12 46.2442 -1.5611
540595 8 46.3000 -1.0167
540599 8 46.6333 -1.8667
540602 12 47.0167 -1.9667
540606 12 47.2333 -2.1500
540609 8 47.6667 -3.1667
540692 8 47.7664 -3.5486
540613 12 47.9333 -4.3908
540618 8 48.5167 -4.7500
540637 8 48.6167 -2.0333
540640 12 48.6333 -1.4833
540641 12 48.6500 -1.4000
540690 8 48.7828 -3.0575
540645 12 49.0000 -1.5500
540656 8 49.2833 -0.1333
540647 12 49.3333 -1.7000
540651 8 49.5833 -1.2667
540661 12 50.0167 1.3333
540665 8 50.7667 1.6167
Fig. 1 a Geographic sampling of Beta maritima ssp. maritimaaccessions along coastal France. Site markers are shaded according to
membership coefficient in one of two genetic clusters (Richards et al.,
in preparation). b Genomic region containing SSR loci linked to
BvFL1, a locus of agronomic importance in sugar beet. Trianglesmark the position of each SSR locus; vertical lines represent BvFL1exons. Translation initiation point is indicated above exon 1. Allele
frequency spectra for neutral SSR locus 509 and selected locus BvFL1SSR1 shown using pie charts
1158 Theor Appl Genet (2012) 124:1155–1171
123
selection, and p \ 0.025 indicated significant balancing
selection.
Distribution of neutral and selected variation
at the agronomic locus BvFL1
We wished to determine which of the 28 Beta vulgaris ssp.
maritima accessions were required in subsets that captured
100% of the allelic diversity at the neutral or selected target
locus in BvFL1. Because many different subsets, each
comprised of different accessions, might be ‘‘ideal’’ (i.e.
contain all possible alleles), it is necessary to calculate a
probability of occurrence for each accession. A Monte
Carlo algorithm was used to determine constituents and
calculate the probability of occurrence of each accession in
idealized subsets. The algorithm proceeded as follows
(with each target locus treated separately):
1. Assign all accessions to the subset.
2. Drop one accession, A, at random.
3. Determine the number of distinct alleles in the subset
at the target locus. If all possible alleles are present,
eliminate A. If some alleles have been lost, return A to
the subset.
4. Repeat steps 2 and 3 until no further accessions can be
eliminated without diminishing the number of alleles.
5. Record the identity of accessions included in the
resulting, ideal subset.
6. Repeat steps 1–5 a total of 10,000 times. Calculate the
probability of occurrence of each accession as the
frequency it was recovered across replicates in the ideal
subsets from step 5.
This Monte Carlo procedure was repeated, but with only
85% of total allelic diversity mandated to occur in the
subset at step 3. Last, the procedure was applied to indi-
viduals, rather than accessions, to determine the probability
of each individual occurring in a subset required to retrieve
85 or 100% of allelic diversity present at the target loci.
Core collection assembly
The M procedure (Schoen and Brown 1993), using the
same search heuristic employed in MSTRAT (Gouesnard
et al. 2001), was used to assemble subsets by choosing
accessions such that the number of alleles recovered at
reference loci was maximized. One thousand subsets were
constructed for sizes ranging from 2 to 28 accessions. The
number of alleles recovered at target loci was tabulated for
each recommended subset. We modified the optimality
criterion used in M (a simple count of distinct alleles at the
reference loci) by normalizing allelic diversity to the total
number of alleles observed at a locus across the data set
(divide actual allele count by total possible alleles) and
then standardizing the sum of the normalized allelic
diversity values to the total number of reference loci
examined (divide by number of loci). The MSTRAT search
heuristic was then used to assemble subsets as before with
one additional difference. MSTRAT does not support
proper coding of codominant data; it treats each column of
genotypic data as a distinct variable. The modified M
procedure described, which we designate ‘‘M?’’, allows
multiple columns to be assigned to a single locus and
considered jointly during estimation of allelic diversity,
permitting proper treatment of codominant data. Retention
of allelic diversity at target loci under M? was tabulated as
for M so that relative performance could be compared.
Simulation of neutral and selected loci
Allelic variation at neutral and selected target loci was
simulated under a coalescent model of evolution (Kingman
1982; Hudson 1983) using the software MSMS (Version
1.2.1; Ewing and Hermisson 2010). We assumed 50 seg-
regating populations consisting of 1,000 individuals each,
from which 10 diploid genotypes were sampled. The
mutation parameter, h = 4Nel, was varied randomly from
0 to 0.5, so that for a theoretical mutation rate (l) of
1 9 10-8, the effective population size (Ne) can be thought
of as varying from 0 to 6.25 9 106, a plausible range for
plant species. Loci included 1,000 segregating sites (con-
ceptually, a 1,000-bp fragment) and the recombination
parameter, q, was established such that the ratio q/h varied
randomly from 0 to 10, consistent with estimates of the
recombination rate in several crop species (Morrell et al.
2006; Chen et al. 2008). A low uniform migration rate
(M = 4Nem) of 0.01 was established by default between all
populations to permit coalescence. To simulate more
elaborate population structures, the default migration rate
was modified between randomly chosen pairs of popula-
tions. The total number of such modifications varied from 0
to 9,900 (all possible unidirectional migration vectors for
50 populations), and the modified migration rate was drawn
from a gamma distribution with a mean from 0 to 4 and a
shape parameter from 0 to 10. This approach resulted in a
wide diversity of possible population structures, from
highly interconnected to highly isolated to complex com-
binations of the two.
Three categories of data sets were simulated: neutral
reference loci, other neutral loci, and selected loci. Ten
thousand distinct models were constructed and 50 loci were
simulated for each model for each of the three categories of
data. For a given model, all three data set categories had
identical neutral parameters (i.e. identical migration
matrices, h and q). However, for the selected loci, three
additional parameters were specified. The software MSMS
uses a discrete, forward simulation approach for loci under
Theor Appl Genet (2012) 124:1155–1171 1159
123
selection; hence the population size must be defined. For
selected loci, the discrete population size was set to 50,000,
which can be thought of as 50 populations of 1,000 indi-
viduals each, from which 500 individuals (10 per popula-
tion) were eventually sampled. The strength of selection
was varied at random from 1 to 1,000 (from ‘‘weak’’ to
‘‘strong’’ according to the MSMS manual) and codomi-
nance was assumed such that the selection strength on a
heterozygote was half that of the homozygote at the
selected site. We assumed that the selected site was fixed 0
to 10,000 generations in the past. For each locus, variable
sites output by MSMS were interpreted as haplotypes
which could be simplified into allelic states using the Perl
utility ConStruct (Huelsenbeck and Andolfatto 2007).
Because MSMS only returns variable sites, and our selec-
ted site was, by definition, fixed prior to the time of sam-
pling, loci exhibited the signature of selection via the effect
of linked polymorphism. Therefore, resulting allele fre-
quency spectra at selected loci were dependent upon the
interplay between randomly assigned values for strength of
selection and q. EWS tests were performed to confirm that
allele frequencies at neutral and selected loci conformed to
expectations.
To consider whether findings from the single empirical
data set suggest a general phenomenon, performance of the
M? optimization procedure was examined using the sim-
ulated data. Two optimized subsets were assembled for
subset sizes ranging from 2 to 50 using the 50 neutral
reference loci as a guide. A single locus was chosen from
the set of 50 simulated loci, for each data set category.
Allele counts were made at this single target locus for each
of the two optimized subsets. The average allelic diversity
retained was tabulated. This procedure was repeated, with
all 50 simulated loci targeted. A comparison of the relative
capability to recover variation at the neutral loci used to
inform subset assembly, at other neutral loci evolving
under the same model, and at selected loci, could then be
made.
Results
Empirical data
In the Beta vulgaris ssp maritima data, at the 10 reference
SSR loci, the number of distinct alleles ranged from three
to 30, and allelic richness from 2.028 to 6.235, across the
set of 28 accessions (Table 2). Target loci showed similar
levels of diversity and richness. Locus 509, *24 Kbp
upstream of the BvFL1 coding region, had 8 alleles and an
allelic richness of 3.721 while BvFL1 SSR1, located within
intron 1, had 19 alleles and an allelic richness of 2.852.
Target locus 509 was inferred to be neutral using the EWS
test, while BvFL1 SSR1, although tightly linked to 509,
showed a statistically significant signature of directional
selection. BvFL1 SSR1 contained a single allele at high
frequency, but many additional alleles at low frequency,
whereas the allele count at 509 was lower and allele fre-
quencies more uniform, as expected for selected and neu-
tral loci (Fig. 1b). Only one of ten reference loci was
inferred to be under selection using the EWS test; the
remainder of loci were consistent with neutral expectations.
A Monte Carlo procedure was used to calculate the
probability of occurrence of each accession in ideal subsets
targeting either 509 or BvFL1 SSR1. The sets of accessions
found in ideal subsets for neutral locus 509 were largely
non-overlapping with accessions found in ideal subsets for
BvFL1 SSR1 (Fig. 2). The probability of occurrence of
each accession in ideal subsets for the two distinct target
genes was not correlated (p = 0.629). Relatively few
Table 2 Allelic diversity and
evidence for selection at
reference and target loci in Betavulgaris ssp. maritima
* p \ 0.05; ** p \ 0.01a Locus described in Richards
et al. (2004)b Locus described in Viard
et al. (2002)c Locus described in McGrath
et al. (2007)d Locus developed by V.
Laurent, personal
communication
# Alleles Allelic richness EWS p value Selection
Reference loci
SB13a 9 3.166 0.419 Neutral
GTT1b 6 3.034 0.245 Neutral
FDSB1002c 17 5.122 0.151 Neutral
FDSB1005d 7 3.346 0.132 Neutral
FDSB1001d 17 3.084 0.986* Directional
FDSB1026d 30 6.235 0.103 Neutral
FDSB1027c 17 3.986 0.861 Neutral
GCC1b 3 2.028 0.214 Neutral
GAA1b 6 2.080 0.769 Neutral
SB09a 7 2.839 0.375 Neutral
Target loci
509 8 3.721 0.2003 Neutral
BvFL1 SSR1 19 2.852 0.9966** Directional
1160 Theor Appl Genet (2012) 124:1155–1171
123
accessions (3–4) were necessary to retain all alleles at
509. A single population from southern mainland France
and one from Corsica were sampled most frequently.
Retention of all alleles at BvFL1 SSR1 required substan-
tially more accessions (9–11), and they originated in
sampling sites across the latitudinal range. Of the six
accessions that contained private alleles at BvFL1 SSR1
(and thus were always found in ideal subsets) two were
never found in subsets targeting 509, and the other four
were only found infrequently. Likewise, a Corsican
accession containing a private allele at 509 was never
required in ideal subsets targeting BvFL1 SSR1. Similar
patterns were observed when only 85% of alleles were
required, although accessions containing private alleles
then occurred with probabilities less than 1. When indi-
viduals rather than accessions were used the result was
similar: 509 diversity was recovered most efficiently by
sampling individuals from southern mainland France and
Corsica; BvFL1 SSR1 diversity was distributed in indi-
viduals across latitudes.
When applied to empirical data from Beta vulgaris ssp.
maritima, core subsets assembled using either the M or
M? procedure contained more alleles than random subsets
for the neutral locus 509 (Fig. 3a). In contrast, when
selected locus BvFL1 SSR1 was targeted, the same or fewer
alleles than random were recovered (Fig. 3b). Recovery
varied little across iterations (CV \ 15%). For locus 509,
on average across subset sizes, M and M? procedures
recovered 10 and 11% more alleles, respectively, than a
random assembly strategy (up to 36% more alleles recov-
ered for certain subset sizes). For BvFL1 SSR1, M recov-
ered 3% fewer alleles than random. Although for some
small subsets more alleles were found (up to 50% more),
Fig. 2 Opposed bar graphs indicate the frequency of occurrence of
accessions in subsets required to contain all alleles at target loci.
Shaded circles between graphs refer to sampling site shown in Fig. 1.
Sites in the south appear at the top, northerly sites at the bottom. The
accessions necessary to maximize diversity in a core collection
differed depending on whether a neutral locus (509) or a selected
locus (BvFL1 SSR1) was targeted
Fig. 3 Effect of core subset optimization algorithms on recovery of
allelic diversity at neutral and selected target loci in Beta vulgaris ssp.
maritima. Number of alleles retained in the core using random
selection indicated with smooth gray line. Allelic retention using
standard MSTRAT algorithm (M) shown with solid triangles.
Improved algorithm (M?) shown with open circles. Both optimiza-
tion algorithms performed well when targeting (a) neutral locus 509,
but failed when targeting (b) selected locus BvFL1 SSR1. M?
outperformed M in both cases
Theor Appl Genet (2012) 124:1155–1171 1161
123
other subsets contained as much as 24% fewer alleles. M?
recovered 4% more alleles than random; however, the
difference was not significant (p = 0.196, paired t test). M
performance was significantly worse than random
(p = 0.028). M? performed equal to or better than M for
the majority of core sizes, regardless of target locus.
Simulated data
Ten thousand unique coalescent models were prepared. Ran-
dom choice of migration parameters resulted in complete or
nearly complete isolation for some populations in a minority of
models. Forward simulations of selection in a coalescent
context are memory intensive; thus models with highly
restricted gene flow between some populations exceeded
program memory limitations before all 50 loci could be
simulated. Such incomplete models (15% of total) were dis-
carded as were the corresponding models in the neutral sim-
ulations. In spite of removal of some models, the remaining
8,492 appeared to provide a diverse, random, sample from a
relevant parameter space, as judged by the distribution of G0ST
values and ordination analyses of population structure (Fig. 4).
Mean GST (±1 SD) for neutral reference loci, other neutral
loci, and selected target loci was 0.061 ± 0.081,
0.061 ± 0.080, and 0.063 ± 0.081, respectively (G0ST:
0.528 ± 0.282, 0.527 ± 0.282, 0.069 ± 0.089). The range of
GST values encountered across data sets was similar between
data set categories (0–0.788). G0ST values ranged from 0 to 1
for neutral loci, and from 0 to 0.759 for selected loci.
On average, 137.9 ± 94.2 (±1 SD) segregating alleles
were sampled from simulated neutral loci. Approximately
0.6% of loci were fixed. The maximum number of alleles
sampled was 427. Selected target loci contained
15.9 ± 12.3 alleles. Five percent were fixed. The maxi-
mum number of segregating alleles observed at a selected
locus was 170. Using the EWS test, 4.8% of variable,
neutral loci had allele frequency distributions consistent
with a history of directional selection, 2.7% with balancing
selection, and the rest were neutral. The percentage of
simulated neutral loci exhibiting a significant signature of
selection was therefore just slightly higher than what might
be expected given a = 0.05. Ninety-five percent of loci
simulated under a model with selection showed a signifi-
cant signature of directional selection. Only one of the
404,565 variable simulated selected loci showed the sig-
nature of balancing selection. Hence, the simulation strat-
egy produced data consistent with expectations (Type I
error = 0.075, Type II error = 0.05).
Using M?, diversity was best retained when reference
loci, those used for core optimization, were targeted. On
average, for core sizes between 18 and 22, four additional
alleles were retained relative to that retained when subsets
were assembled at random (Fig. 5). Variation at neutral
target loci that had not been used for optimization was not
retained nearly as well. Fewer than two additional alleles
were recovered relative to random, regardless of core size.
Variation at selected loci was poorly retained. On average,
less than one additional allele was recovered. The maxi-
mum degree of enrichment occurred at core size = 26, and
was only 0.13 additional alleles.
The retention of target alleles in optimized cores was not
correlated with values used for model parameters, although
the variance in retention between models increased with
increasing h. The degree of population subdivision, on the
other hand, as measured by G0ST, was significantly corre-
lated with allelic enrichment and with the total number of
alleles. When allelic enrichment values were normalized
by total alleles, a significant positive linear relationship
remained between G0ST and allelic enrichment for neutral
Fig. 4 a Four representative population structures from coalescent
simulation of neutral reference loci, visualized using principal
coordinate analysis. Models produced nearly panmictic to highly
subdivided assemblages of populations. b Distribution of population
differentiation observed in simulated data sets. Standardized metric
G0ST plotted in gray
1162 Theor Appl Genet (2012) 124:1155–1171
123
reference loci and other neutral loci, but not for selected
loci (p = 5.1 9 10-60, 4.9 9 10-64, 0.066; R2 = 0.276,
0.145, 0.003). Therefore, as population subdivision
increased, improved retention of neutral, but not selected
diversity was found (Supplementary Figure 1). This rela-
tionship can be explained at a more fundamental level by
examining the correlation in allele count between reference
and target loci within populations. When 50 target loci
were considered simultaneously, a strong, positive, curvi-
linear relationship was observed between neutral reference
loci and neutral target loci (third order polynomial
R2 = 0.598) (Fig. 6a), whereas for target loci under
selection a slight, positive, linear relationship was found
(R2 = 0.180, slope = 0.3) (Fig. 6b). For neutral targets, no
models produced a negative correlation when G0ST was
greater than *0.5. Negative correlations existed for
selected targets even for models with G0ST & 1. When
only a single target locus was considered, the interlocus
correlation between neutral reference and neutral target
diversity remained positive (Fig. 6c), but the correlation
Fig. 5 Additional alleles retained in core subsets relative to randomly
assembled subsets using M? algorithm. On average, less than one
additional allele was retained at simulated selected loci when using
neutral loci to guide core assembly. Inset shows relative performance
normalized to account for differences in the total number of alleles
between categories of target loci
Fig. 6 Relationship between population subdivision and correlation
in allelic diversity between loci. G0ST based on neutral reference loci.
Correlation coefficient (r) calculated between reference loci and
(a) 50 neutral target loci, (b) 50 target loci under selection, (c) 1
neutral target locus, (d) 1 selected target locus. Ten thousand distinct
coalescent models were sampled. White line indicates linear
regression (third order polynomial regression for (a)). Increasing
subdivision resulted in tighter interlocus correlation in allelic
diversity, except when loci under selection were considered individ-
ually. Little opportunity exists to enhance variation at any individual
selected locus using neutral loci to guide core collection assembly
Theor Appl Genet (2012) 124:1155–1171 1163
123
between neutral reference and selected target diversity was
near zero (R2 = 0.007, slope = 0.046) (Fig. 6d).
Discussion
Efficient screening of diverse germplasm, especially wild
germplasm (Tanksley and McCouch 1997; Gur and Zamir
2004), will be necessary to retrieve valuable phenotypes to
combat emerging agricultural challenges (Kumar et al.
2010). In principle, utilization of core collections should
accelerate the extraction of beneficial adaptations from
genebanks by making the exploration of large germplasm
collections for novel alleles more efficient. Inexpensive
genotyping has made marker-based core collection opti-
mization popular. There is, however, a theoretical road-
block to successful use of marker-based core collections
for allele mining: the primary targets of allele mining
projects—loci of agronomic importance—often exhibit
patterns of allelic diversity consistent with a history of
artificial or natural selection, while the types of loci used to
inform core subset assembly are, more often than not,
neutral loci.
Neutral loci are useful for describing the genetic struc-
ture of populations that has emerged as a consequence of
historical demography and patterns of gene flow within a
species. Patterns of polymorphism at selected loci may
conflict with patterns at neutral loci because the movement
of adaptive alleles among populations is not a passive
process. A useful trait or adaptation can move rapidly
through a set of populations (Slatkin 1976; Morjan and
Rieseberg 2004). The number of neutral alleles segregating
in a population, on the other hand, is primarily a conse-
quence of its size (Kimura and Crow 1964), with a fre-
quency spectrum consistent with principles of random
sampling (Ewens 1972). The number and frequency spec-
trum of alleles at loci under selection depends upon the
strength of selection at the selected site as well as recom-
bination rates in the adjacent portion of the genome
(Braverman et al. 1995; Fay and Wu 2000). The strength of
selection for a particular trait value may vary widely
among populations across a species’ geographical range,
whereas the effect of population size on variation at neutral
and selected loci is fixed. Strength of selection and popu-
lation size need not be correlated. Therefore, the distribu-
tion of variation at loci under selection will not necessarily
be correlated with that at neutral loci. The distribution of
allelic diversity at a locus under selection might only be
predictable if the environmental factors acting to modify
allele frequencies at the locus could be explicitly quantified
across the sample, or set of accessions. Empirical data
support these theoretical arguments. Using data from 29
species, McKay and Latta (2002) argued that a correlation
between neutral markers and adaptive (selected) diversity
is not expected. Their explanation for the lack of expected
correlation is that (a) alleles at neutral loci are free to
migrate, selected alleles are not, and (b) differentiation due
to drift is slower than differentiation due to selection—
neutral and selected loci will seldom be sampled in
equilibrium.
Neutral and selected loci exhibit conflicting
distributions of allelic diversity
We examined variation at two SSR loci linked to BvFL1, a
vernalization-responsive gene in sugar beet which may
have a role in controlling flowering time, an economically
important trait in the crop (Reeves et al. 2007). Locus
BvFL1 SSR1, located within the transcription unit (in intron
1), showed a strong signature of directional selection, while
locus 509, in spite of its proximity (24 Kbp upstream of the
BvFL1 start codon), exhibited a neutral pattern of genetic
variation. Thus, two distinct evolutionary processes have
affected the pattern of polymorphism at the two tightly
linked loci. BvFL1 SSR1 contained a single allele at high
frequency, but many additional alleles at low frequency,
whereas the allele count at 509 was lower and allele fre-
quencies were more uniform, as expected for selected and
neutral loci, respectively (Fig. 1b).
Using a Monte Carlo procedure, the frequency of occur-
rence of 28 Beta vulgaris ssp. maritima accessions in ideal
core subsets for the two loci was computed. The accessions
sampled most in ideal cores for locus 509 were not the same
as for BvFL1 SSR1 (Fig. 2). Thus, the distribution of allelic
diversity across the sampled accessions differed markedly
between neutral 509 and selected BvFL1 SSR1. While we
present only a single empirical case, the finding is in agree-
ment with theory and suggests that it may not be possible to
simultaneously maximize retention of allelic diversity at
both neutral and selected loci within the same core subset.
This may hold true even if the neutral reference loci are
tightly linked, both physically and statistically, to the agro-
nomic locus of interest, as is the case here.
The M? optimization procedure outperforms M
In order to come to a general understanding of the effect of
core collection assembly using neutral reference loci on the
retention of alleles at selected target loci, many data sets
must be examined. The need for a core assembly procedure
that is uniformly applicable across widely varying data
sets, regardless of differences in the number of reference
loci, or levels of variation at those loci, motivated our
reexamination of the optimality criterion used in the most
popular method for core assembly based on genotypic data,
Schoen and Brown’s (1993) M procedure.
1164 Theor Appl Genet (2012) 124:1155–1171
123
In this study we introduce the M? core assembly
procedure. This modification of the M procedure is meant
to address technical problems present in MSTRAT
(Gouesnard et al. 2001) and PowerCore (Kim et al. 2007),
as well as some conceptual issues. First, when performing
M optimization, MSTRAT and PowerCore overestimate
the total number of alleles in a data set by treating all loci
as haploid. This weakens optimization, particularly for
subsets made of individuals, because heterozygotes cannot
be recognized and leveraged as such. Second, MSTRAT
treats properly coded missing data as a distinct allele.
These problems are simple to remedy by revising computer
code (as has been done for M?), and do not reflect any
problems with the M procedure per se.
A more fundamental problem with M is that it does not
treat all loci equally. M uses a simple allele count as its
optimality criterion. Loci with many alleles exert a greater
influence on subset assembly than loci with few alleles by
virtue of their greater potential to push the optimality cri-
terion higher. M? solves this by employing a normaliza-
tion routine wherein the count of alleles at a locus in a
subset is divided by the maximum possible number of
alleles that would be observed at that locus if the entire
data set were to be examined. This renders every locus
equal in terms of its potential to elevate the optimality
criterion. This improvement results in better estimation of
genomewide patterns of polymorphism, because unusual,
highly polymorphic portions of the genome are not
emphasized during optimization. Second, because M uses a
simple allele count, improvement in allele retention is not
directly comparable between data sets. M? solves this by
dividing the normalized metric described above by the total
number of reference loci in the data set. Thus, the diversity
metric and optimality criterion used in M? varies from 0 to
1, with equal contribution from all reference loci.
Using M?, recovery of target diversity was improved
relative to M (Fig. 3). On average, across all subset sizes,
M? outperformed M for both neutral and selected target
loci (although neither performed better than random for
selected loci). For neutral locus 509, M? offered predict-
able performance across the range of subset sizes. The
performance of M, on the other hand, was erratic, sur-
passing M? for very small subsets (n = 2, 3, 5), but lag-
ging for medium-sized subsets (n = 6–10). This erratic
behavior is likely attributable to the non-standardized allele
counts used for the optimality criterion in M.
Coalescent simulations of neutral and selected loci
Empirical data sets containing genotypes at both neutral
reference loci and target loci of agronomic importance are
currently rare. Coalescent simulations were performed to
explore a large variety of different such data sets in an
effort to produce a more general conclusion. Simulations
can never fully model the complexities of natural popula-
tion genetic processes; however, examination of the data
sets simulated here suggests that they provide reasonable
coverage of the range of variation in magnitude and
apportionment of genetic diversity that might be found in
the wild, or within germplasm collections. Because of the
random approach used to assign parameter values, a broad
diversity of population structures could be considered,
encompassing scenarios from panmictic to highly struc-
tured (Fig. 4a). While simulated data cannot be expected to
permit precise predictions for any given individual data set
that might be the subject of an empirical study, these
simulated data sets seem suitable for exploring average
effects.
The mean level of variation observed within simulated
subpopulations relative to total variation (FST & GST =
0.06 ± 0.08) was, on average, lower than that observed in
nature. Hamrick and Godt (1997) calculated GST & 0.3
and 0.2, for crops and wild species, respectively, using
allozyme data. DNA-based RAPD data was similar
(Nybom and Bartish 2000). Nevertheless, the range of
values encountered in the simulated data sets (Fig. 4b)
overlapped substantially with that observed across plants
(GST = 0.036–0.510; 40% of models overlap). It is
important to realize, however, that GST is a biased esti-
mator of population differentiation, one whose value
depends on the level of within-population homozygosity
(Hedrick 2005). GST and related measures are not useful
for comparing levels of differentiation between data sets
(Jost 2008). When we use a standardized metric, G0ST, we
find little bias in our set of models toward any particular
level of differentiation. Levels of population differentiation
between G0ST = 0 and 1 (mean G0ST = 0.53 ± 0.28) were
uniformly explored (Fig. 4b).
Using the M? core assembly algorithm, substantial
improvements in the retention of diversity were only
achieved for neutral target loci that were drawn from the
set of reference loci (Fig. 5). Improvement in this category
of loci is not likely to be of interest for users of germplasm
collections because such loci do not impact crop
improvement, nor are they indicative of adaptation to local
environments (McKay and Latta 2002). Retention of var-
iation at other neutral loci, those not used for optimization,
was not so readily achieved, despite being simulated using
the same model as the reference loci. Worse still was our
ability to recover variation at selected loci. Although sig-
nificantly better than random assembly, recovery of allelic
diversity at selected loci was not meaningfully better
because, on average, less than one additional allele was
retained. Only for 14% of models was the average
improvement in allelic recovery across core sizes greater
than one additional allele. Although selected loci had fewer
Theor Appl Genet (2012) 124:1155–1171 1165
123
alleles overall than neutral loci, poor retention was not a
numerical artifact. When allelic retention was normalized
by the maximum number of alleles possible for a given
core size, the performance of selected target loci, and
neutral target loci not used for optimization, became sim-
ilar, and was still substantially worse than single targeted
reference loci (Fig. 5, inset). On average, the (normalized)
improvement seen for non-reference neutral target loci, and
selected target loci, was 27 and 19%, respectively, of that
observed when reference loci were used as target. Only
occasionally would such average gains translate into the
retention of additional alleles at any given target locus.
Marker-based core collections may be worse
than random
Our results, both empirical and based on simulations,
present a perspective that is counter to the prevailing one
on the utility of core collections. Our results suggest that
variation at a given locus of agronomic interest may not be
elevated in core collections built using neutral loci, and
may, in fact, be lower than collections assembled at ran-
dom. The use of neutral marker–based core collections for
allele mining may not expedite the discovery of useful
variation at loci of agronomic importance. We arrive at this
conclusion uncomfortably, because we have heretofore
been generally supportive of the concept.
While at first glimpse this conclusion appears to con-
tradict the critical studies on the topic, a more detailed
reading reveals some points of agreement. Schoen and
Brown (1993) examined the M strategy for its ability to
enhance diversity at neutral target loci, noting that varia-
tion potentially useful in the future may be selectively
neutral at present. They concluded that M might be espe-
cially useful for crops and inbreeding species, where the
correlation between reference and target loci is greater due
to elevated levels of genomewide linkage disequilibrium.
Relatively lackluster performance (although still better
than random) of M? with non-reference, neutral target loci
in our simulation might be attributed to a model that
explicitly included migration and recombination, properties
common in outcrossing species.
Schoen and Brown (1993) considered only nine empir-
ical data sets, of which seven showed significantly
improved allelic retention using M. Assuming an equal
probability of retaining either more or less alleles than
random, the binomial probability of observing seven or
more positive results out of nine observations is 0.09, not
statistically significant using the conventional a = 0.05.
Allelic retention was meaningfully improved ([1 addi-
tional allele) in five of the nine data sets, an equivocal
result (binomial probability = 0.5). Schoen and Brown
(1993) also calculated a metric of correlation of the levels
of allelic diversity among loci (R). Six of eight data sets
had a positive R value, while two (which failed to enrich
using M) were zero or negative indicating no, or a negative,
correlation in levels of diversity among loci. There is no
significant difference between the mean of their empirical
distribution of R values and a similarly sized distribution
with mean zero and the same standard deviation (t test,
p = 0.216). Hence, the specific data sets examined by
Schoen and Brown (1993) do not, in a statistical sense,
support the idea that allelic diversity is correlated among
neutral loci. However, we do not dispute this notion, both
on theoretical grounds, and based upon the results of our
simulation. Our results provide statistical rigor to Schoen
and Brown’s hypothesis, and demonstrate, in addition, that
meaningful enrichment might also be obtained at neutral
target loci in outcrossing species.
Our results appear to conflict more directly with Bataillon
et al. (1996) who, using a different simulation strategy,
found that (a) retention of selected alleles was improved
using neutral marker loci and the M strategy, and (b) reten-
tion of neutral alleles was similar to alleles at selected loci
regardless of the subset assembly procedure used. We found
substantial differences in retention of neutral compared with
selected target loci and that selected target locus diversity
could not be meaningfully elevated (Fig. 5). Moreover, they
predicted that M, in particular, would never perform more
poorly than random assembly, arguing that ‘‘For this to
happen, there would have to be a negative correlation
between diversity at marker and selected loci’’ (p. 415).
Monte Carlo simulations undertaken here demonstrate pre-
cisely this kind of negative correlation with real data
(Fig. 2), and, as a consequence, M performed worse than
random for the selected target locus BvFL1 SSR1 (Fig. 3b).
With simulated data, we observed a negative correlation in
allele count between neutral reference and selected target
loci for 21% of the models examined. In contrast, for neutral
target loci, only 2.6% of models showed a negative corre-
lation (Fig. 7a, 50 target loci considered simultaneously).
Likewise, the mean correlation of reference loci diversity
with selected target loci was much lower (r = 0.16 ± 0.20)
than with non-reference, neutral target loci (r = 0.65 ±
0.27).
Based upon simulated data, only a very slight positive
correlation between neutral and selected variation is pre-
dicted. Furthermore, that slight positive correlation is an
average effect, calculated across many loci. If target loci
are considered individually (as they would be in an allele
mining experiment) the ability to predict, based on neutral
reference loci, which populations will retain elevated var-
iation at the target locus worsens. A negative correlation
between diversity at neutral reference loci and diversity at
a single target locus under selection was observed for 42%
of models (Fig. 7b). The average correlation was very
1166 Theor Appl Genet (2012) 124:1155–1171
123
close to zero (0.03 ± 0.14). Therefore, one should not
expect the retention of diversity at an individual selected
target locus to be improved by using neutral loci to guide
core collection assembly. Random assembly would be
predicted to achieve a similar level of enrichment. When
individual neutral loci were targeted the mean correlation
was higher (0.22 ± 0.21) and only 16% of models showed
a negative correlation. Thus, consistent with Schoen and
Brown (1993), our simulation predicts that it should be
straightforward to enhance variation in a set of unsampled
neutral loci in core collections. A single neutral target locus
will be more difficult, and an individual locus with a his-
tory of selection nearly impossible using conventional
approaches.
Because this conclusion is strongly supported by the
simulated data, yet runs completely counter to the broadly-
accepted findings presented in Bataillon et al. (1996), we
shall make a detailed effort to explain the apparent dis-
crepancy. We propose that the conflict between our study
and that of Bataillon et al. (1996) is most likely attributable
to differences in how selected loci were simulated and
measured. Their model considered three selective
environments, among which 18 demes (populations) were
distributed, forming a structured set of populations.
Migration occurred under a finite island model. The sim-
ulation strategy was based on that of David et al. (1993)
and used selection on individual fitness as a way, in prin-
ciple, to produce a data set containing selected loci. This
was accomplished using fitness curves, which described the
fitness contribution of all alleles segregating at each of the
ten physically unlinked loci. Individual fitness was calcu-
lated additively, as the sum of fitness values for all alleles
present in an individual’s multilocus genotype. The devi-
ation of this value from the population mean was then used
to choose parents for the subsequent generation. Under
these conditions, M performed significantly better than
random for selfers and when migration among demes was
prohibited for outcrossers.
It is unclear to us the extent to which this protocol would
produce independent loci exhibiting the characteristic
allele frequency spectra that form the statistical signature
of selection (EWS test values for selected loci were not
presented). Selection performed thusly in finite, genetically
isolated populations will not necessarily drive individual
loci to their respective optima because of the establishment
of strong linkage disequilibrium between loci (Fisher 1930;
Kimura 1956; Lewontin 1964). When fitness is determined
in an additive manner across two or more loci, selection
generates negative linkage disequilibrium (where favored
alleles at one locus become associated with unfavored
alleles at another locus), which reduces the response
to selection, and decreases the rate of change of allele
frequencies—the so–called ‘Hill–Robertson effect’
(Felsenstein 1965; Hill and Robertson 1966). Beneficial
alleles caught in inferior combinations disappear due to
selection (and/or drift) before they can be recombined into
superior multilocus genotypes (Fisher 1930; Muller 1932).
Under these conditions, gene flow between isolated popu-
lations (or more precisely, recombination) is critical for
maintaining the additive genetic variation necessary to
achieve the optimal allelic combination (Felsenstein 1974;
David et al. 1993; Martin et al. 2006).
Bataillon et al. (1996) only found a correlation in
diversity between neutral and selected loci for selfing
populations and for genetically isolated outcrossing popu-
lations. These are precisely the cases where selection is
expected to be inefficient in moving allele frequency dis-
tributions away from neutral expectations. Among the
categories of mating system and demography they con-
sidered, theory predicts that loci in outcrossing populations
with migration would exhibit the strongest statistical sig-
nature of selection. No correlation between neutral and
selected diversity was found for this category of popula-
tions. In other words, a correlation was observed when loci
under selection likely did not show the signature of
Fig. 7 Correlation in allelic diversity between simulated neutral and
selected loci. X axis is correlation coefficient r; Y axis is frequency of
occurrence. Distribution of r values for neutral target loci shown in
gray, target loci under selection in black. a 50 target loci. b A single
target locus. Allelic diversity is positively correlated for neutral
loci—populations exhibiting high allelic diversity at neutral reference
loci were also highly diverse at neutral target loci. The correlation in
allelic diversity between neutral reference loci and selected target loci
was weak, and frequently negative
Theor Appl Genet (2012) 124:1155–1171 1167
123
selection and was not observed when the loci likely did
show the signature of selection.
We suspect that excessive population subdivision may
be the source of the strong correlation between neutral and
putative selected diversity observed by Bataillon et al.
(1996). They considered a single population structure and
eight demographic conditions. Using a two-population
coalescent model, Hudson and Coyne (2002) showed that
after 4–7 Ne generations without gene flow, 50% of loci
will exhibit reciprocal monophyly, where, for a given
locus, all alleles found within one population will be more
closely related to one another than they are to any alleles
found at the same locus in a second population (95% of loci
reciprocally monophyletic at 9–12 Ne generations). This is
a sufficient level of differentiation to be considered distinct
species under a variety of species definitions (Donoghue
1985; Nixon and Wheeler 1990; Baum and Shaw 1995;
Mallet 1995). With simulated population sizes ranging
from 100 to 3,000 (Ne expected to be lower, especially for
selfing populations) and 5,000 generations without gene
flow, levels of differentiation between some populations in
their simulation surely reached magnitudes expected for
distinct species. Hudson and Coyne’s (2002) work predicts
that for Ne = 500, 95% of loci would be reciprocally
monophyletic in 4,500–6,000 generations. The data sets
considered by Bataillon et al. (1996) must therefore have
been extremely subdivided and may not appropriately
represent the levels of population differentiation expected
within a typical species-level germplasm collection. Ele-
vated genomewide linkage disequilibrium is the hallmark
of strong population subdivision (Nei and Li 1973; Ohta
1982; practical applications: Pritchard et al. 2000; England
et al. 2010) and would seem to be a likely source of the
correlation in level of diversity they observed.
Last, when calculating enrichment, Bataillon et al.
(1996) measured allelic retention additively, at all ten
selected target loci simultaneously. Simultaneous consid-
eration of ten target loci is not necessarily pertinent to
allele mining, which is generally concerned with a single
target locus. Such a procedure may, however, be appro-
priate for understanding the retention of diversity at the
QTL underlying polygenic traits of agronomic importance.
Therefore, we believe that the simulation model used in
Bataillon et al. (1996) is not applicable to the issue of allele
mining for agronomically important genetic variation. It
likely created a situation where the signature of selection
could not be achieved due to extreme population subdivi-
sion and the Hill–Robertson effect. We suggest that the
correlation in allelic diversity observed between neutral
loci and those purported to be under selection was, in fact,
the strong correlation in diversity that is expected to arise
between all loci in genetically isolated populations. Nev-
ertheless, our results do not entirely contradict their
conclusions. We agree with their finding that increased
subdivision results in better performance for M (or M?)
(Fig. 6; Supplementary Figure 1). The two studies, how-
ever, pertain to different units of conservation and imply
different conservation objectives. Using the coalescent
rather than a discrete, time-forward simulation, we were
able to explore a vastly larger set of possible population
structures, containing levels of differentiation consistent
with what might be observed within single species, the unit
of conservation in most gene banking efforts.
The findings presented here are not optimistic with
respect to the utility of neutral marker-based core collections
for allele mining. They should not, however, be surprising.
Natural selection is a powerful force that can drive allele
frequencies in patterns counter to neutral expectations. Very
little of the historical signature written across the genome
onto neutral loci need remain on individual selected genes in
the same genome. Elimination of obvious redundancy and
basic stratification of collections using geography or habitat
type prior to subset assembly should still generate modest
efficiency increases. Likewise, core sets based on pheno-
typic surveys of the agronomic traits of interest might be
enhanced for allelic diversity at the genes underlying those
traits (although this remains to be demonstrated). Addi-
tionally, it may be possible to rely on an assembly procedure
like M? to improve the retention of diversity, on average,
across a targeted gene network, or at a group of loci
underlying a polygenic trait, wherein each locus may have
experienced different selection pressures during its history.
A deeper understanding of the effect of historical patterns
of selection, genetic drift, and population subdivision on
genomewide linkage disequilibrium will be necessary (1) to
determine whether correlations in diversity between neutral
and selected loci are expected for a given germplasm col-
lection and (2) to leverage that correlation for the formation
of core subsets optimized for allele mining.
Acknowledgments We thank Ann Fenwick for genotyping the
reference loci, and Gayle Volk and Dale Lockwood for comments on
the manuscript.
References
Backes G, Graner A, Foroughi–Wehr B, Fischbeck G, Wenzel G,
Jahoor A (1995) Localization of quantitative trait loci (QTL) for
agronomic important characters by the use of a RFLP map in
barley (Hordeum vulgare L.). Theor Appl Genet 90:294–302
Balfourier F, Roussel V, Strelchenko P, Exbrayat-Vinson F, Sourdille
P, Boutet G, Koenig J, Ravel C, Mitrofanova O, Beckert M,
Charmet G (2007) A worldwide bread wheat core collection
arrayed in a 384–well plate. Theor Appl Genet 114:1265–1275
Bataillon TM, David JL, Schoen DJ (1996) Neutral genetic markers
and conservation genetics: simulated germplasm collections.
Genetics 144:409–417
1168 Theor Appl Genet (2012) 124:1155–1171
123
Baum DA, Shaw KL (1995) Genealogical perspectives on the species
problem. In: Hoch PC, Stephenson AG (eds) Experimental and
molecular approaches to plant biosystematics. Missouri Botan-
ical Garden, St. Louis, pp 289–303
Bernacchi D, Beck–Bunn T, Eshed Y, Lopez J, Petiard V, Uhlig J,
Zamir D, Tanksley S (1998) Advanced backcross QTL analysis
in tomato. I. Identification of QTLs for traits of agronomic
importance from Lycopersicon hirsutum. Theor Appl Genet
97:381–397
Bhullar NK, Street K, Mackay M, Yahlaoul N, Keller B (2009)
Unlocking wheat genetic resources for the molecular identifica-
tion of previously undescribed functional alleles at the Pm3resistance locus. Proc Natl Acad Sci USA 106:9519–9524
Bhullar NK, Zhang Z, Wicker T, Keller B (2010) Wheat gene bank
accessions as a source of new alleles of the powdery mildew
resistance gene Pm3: a large scale allele mining project. BMC
Plant Biol 10:88
Bishop GJ, Harrison K, Jones JDG (1996) The tomato Dwarf gene
isolated by heterologous transposon tagging encodes the first
member of a new cytochrome P450 family. Plant Cell 8:959–969
Borner A (2006) Preservation of plant genetic resources in the
biotechnology era. Biotechnol J 1:1393–1404
Braverman JM, Hudson RR, Kaplan NL, Langley CH, Stephan W
(1995) The hitchhiking effect on the site frequency spectrum of
DNA polymorphisms. Genetics 140:783–796
Brown AHD (1989) Core collections: a practical approach to genetic
resources management. Genome 31:818–824
Caicedo AL (2008) Geographic diversity cline of R gene homologs in
wild populations of Solanum pimpinellifolium. Am J Bot
95:393–398
Casa AM, Mitchell SE, Hamblin MT, Sun H, Bowers JE, Paterson
AH, Aquadro CF, Kresovich S (2005) Diversity and selection in
sorghum: simultaneous analyses using simple sequence repeats.
Theor Appl Genet 111:23–30
Chapman MA, Pashley CH, Wenzler J, Hvala J, Tang S, Knapp SJ,
Burke JM (2008) A genomic scan for selection reveals
candidates for genes involved in the evolution of cultivated
sunflower (Helianthus annuus). Plant Cell 20:2931–2945
Charlesworth B, Charlesworth D, Barton NH (2003) The effects of
genetic and geographic structure on neutral variation. Annu Rev
Ecol Evol S 34:99–125
Chen H, Morrell PL, de la Cruz M, Clegg MT (2008) Nucleotide
diversity and linkage disequilibrium in wild avocado (Perseaamericana Mill.). J Hered 99:382–389
Crossa J, Burgueno J, Dreisigacker S, Vargas M, Herrera–Foessel SA,
Lillemo M, Singh RP, Trethowan R, Warburton M, Franco J,
Reynolds M, Crouch JH, Ortiz R (2007) Association analysis of
historical bread wheat germplasm using additive genetic covari-
ance of relatives and population structure. Genetics
177:1889–1913
David JL, Savy Y, Brabant P (1993) Outcrossing and selfing
evolution in populations under directional selection. Heredity
71:642–651
Donoghue MJ (1985) A critique of the biological species concept and
recommendations for a phylogenetic alternative. Bryologist
88:172–181
El Mousadik A, Petit RJ (1996) High level of genetic differentiation
for allelic richness among populations of the argan tree [Arganiaspinosa (L.) Skeels] endemic to Morocco. Theor Appl Genet
92:832–839
England PR, Luikart G, Waples RS (2010) Early detection of
population fragmentation using linkage disequilibrium estima-
tion of effective population size. Conserv Genet 11:2425–2430
Escribano P, Viruel MA, Hormaza JI (2008) Comparison of different
methods to construct a core germplasm collection in woody
perennial species with simple sequence repeat markers: a case
study in cherimoya (Annona cherimola, Annonaceae), an
underutilised subtropical fruit tree species. Ann Appl Biol
153:25–32
Ewens WJ (1972) The sampling theory of selectively neutral alleles.
Theor Popul Biol 3:87–112
Ewing G, Hermisson J (2010) MSMS: a coalescent simulation
program including recombination, demographic structure and
selection at a single locus. Bioinformatics 26:2064–2065
Fay JC, Wu C-I (2000) Hitchhiking under positive Darwinian
selection. Genetics 155:1405–1413
Felsenstein J (1965) The effect of linkage on directional selection.
Genetics 52:349–363
Felsenstein J (1974) The evolutionary advantage of recombination.
Genetics 78:737–756
Fisher RA (1930) The genetical theory of natural selection. Clarendon
Press, Oxford
Franco J, Crossa J, Taba S, Shands H (2005) A sampling strategy for
conserving genetic diversity when forming core subsets. Crop
Sci 45:1035–1044
Frankel OH (1984) Genetic perspectives of germplasm conservation.
In: Arber W, Illmensee K, Peacock WJ, Starlinger P (eds)
Genetic manipulation: impact on man and society. Cambridge
University Press, Cambridge, pp 161–170
Frankham R (1996) Relationship of genetic variation to population
size in wildlife. Conserv Biol 10:1500–1508
Gonzalez-Martınez SC, Wheeler NC, Ersoz E, Nelson CD, Neale DB
(2007) Association genetics in Pinus taeda L. I. wood property
traits. Genetics 175:399–409
Goudet, J (2001) FSTAT, a program to estimate and test gene
diversities and fixation indices (version 2.9.3). Software distrib-
uted by the author
Gouesnard B, Bataillon TM, Decoux G, Rozale C, Schoen DJ, David
JL (2001) MSTRAT: an algorithm for building germ plasm core
collections by maximizing allelic or phenotypic richness.
J Hered 92:93–94
Gur A, Zamir D (2004) Unused natural variation can lift yield barriers
in plant breeding. PLoS Biol 2:e245
Hamrick JL, Godt MJW (1997) Allozyme diversity in cultivated
crops. Crop Sci 37:26–30
Hedrick PW (2005) A standardized genetic differentiation measure.
Evolution 59:1633–1638
Hill WG, Robertson A (1966) The effect of linkage on limits to
artificial selection. Genet Res 8:269–294
Hoisington D, Khairallah M, Reeves T, Ribaut J-M, Skovmand B,
Taba S, Warburton M (1999) Plant genetic resources: what can
they contribute toward increased crop productivity? Proc Natl
Acad Sci USA 96:5937–5943
Hudson RR (1983) Properties of a neutral allele model with intragenic
recombination. Theor Popul Biol 23:183–201
Hudson RR, Coyne JA (2002) Mathematical consequences of the
genealogical species concept. Evolution 56:1557–1565
Huelsenbeck JP, Andolfatto P (2007) Inference of population
structure under a Dirichlet process model. Genetics
175:1787–1802
Hyten DL, Song Q, Zhu Y, Choi I–Y, Nelson RL, Costa JM, Specht
JE, Shoemaker RC, Cregan PB (2006) Impacts of genetic
bottlenecks on soybean genome diversity. Proc Natl Acad Sci
USA 103:16666–16671
Jansen J, van Hintum T (2007) Genetic distance sampling: a novel
sampling method for obtaining core collections using genetic
distances with an application to cultivated lettuce. Theor Appl
Genet 114:421–428
Johal GS, Briggs SP (1992) Reductase activity encoded by the HM1disease resistance gene in maize. Science 258:985–987
Johal GS, Balint–Kurti P, Weil CF (2008) Mining and harnessing
natural variation: a little MAGIC. Crop Sci 48:2066–2073
Theor Appl Genet (2012) 124:1155–1171 1169
123
Jost L (2008) GST and its relatives do not measure differentiation. Mol
Ecol 17:4015–4026
Kaur N, Street K, Mackay M, Yahiaoui N, Keller B (2008) Molecular
approaches for characterization and use of natural disease
resistance in wheat. Eur J Plant Pathol 121:387–397
Kim K–W, Chung H–K, Cho G–T, Ma K–H, Chandrabalan D, Gwag
J–G, Kim T–S, Cho E–G, Park Y–J (2007) PowerCore: a
program applying the advanced M strategy with a heuristic
search for establishing core sets. Bioinformatics 23:2155–2162
Kimura M (1956) A model of a genetic system which leads to closer
linkage by natural selection. Evolution 10:278–287
Kimura M, Crow JF (1964) The number of alleles that can be
maintained in a finite population. Genetics 49:725–738
Kingman JFC (1982) On the genealogy of large populations. J Appl
Prob 19A:27–43
Kumar GR, Sakthivel K, Sundaram RM, Neeraja CN, Balachandran
SM, Rani NS, Viraktamath BC, Madhav MS (2010) Allele
mining in crops: prospects and potentials. Biotechnol Adv
28:451–461
Lancaster AK, Single RM, Solberg OD, Nelson MP, Thomson G
(2007) PyPop update—a software pipeline for large-scale mul-
tilocus population genomics. Tissue Antigens 69(s1):192–197
Latha R, Rubia L, Bennett J, Swaminathan MS (2004) Allele mining
for stress tolerance genes in Oryza species and related
germplasm. Mol Biotechnol 27:101–108
Le Cunff L, Fournier–Level A, Laucou V, Vezzulli S, Lacombe T,
Adam–Blondon A-F, Boursiquot J–M, This P (2008) Construc-
tion of nested genetic core collections to optimize the exploi-
tation of natural diversity in Vitis vinifera L. subsp. sativa. BMC
Plant Biol 8:31
Lewontin RC (1964) The interaction of selection and linkage. II.
Optimum models. Genetics 50:757–782
Mallet J (1995) A species definition for the modern synthesis. Trends
Ecol Evol 10:294–299
Martin G, Otto SP, Lenormand T (2006) Selection for recombination
in structured populations. Genetics 172:593–609
McGrath JM, Trebbi D, Fenwick A, Panella L, Schulz B, Laurent V,
Barnes, Murray SC (2007) An open–source first–generation
molecular genetic map from a sugarbeet 9 table beet cross and
its extension to physical mapping. The Plant Genome 47:S27–
S44
McKay JK, Latta RG (2002) Adaptive population divergence:
markers, QTL and traits. Trends Ecol Evol 17:285–291
McKhann HI, Camilleri C, Berard A, Bataillon T, David JL, Reboud
X, Le Corre V, Caloustian C, Gut IG, Brunel D (2004) Nested
core collections maximizing genetic diversity in Arabidopsisthaliana. Plant J 38:193–202
Morjan CL, Rieseberg LH (2004) How species evolve collectively:
implications of gene flow and selection for the spread of
advantageous alleles. Mol Ecol 13:1341–1356
Morrell PL, Toleno DM, Lundy KE, Clegg MT (2006) Estimating the
contribution of mutation, recombination and gene conversion in
the generation of haplotypic diversity. Genetics 173:1705–1723
Muller HJ (1932) Some genetic aspects of sex. Am Nat 66:118–138
Nei M, Li W-H (1973) Linkage disequilibrium in subdivided
populations. Genetics 75:213–219
Nielsen R (2005) Molecular signatures of natural selection. Annu Rev
Genet 39:197–218
Nixon KC, Wheeler QD (1990) An amplification of the phylogenetic
species concept. Cladistics 6:211–223
Nybom H, Bartish IV (2000) Effects of life history traits and sampling
strategies on genetic diversity estimates obtained with RAPD
markers in plants. Perspect Plant Ecol Evol Syst 3:93–114
Ohta T (1982) Linkage disequilibrium due to random genetic drift in
finite subdivided populations. Proc Natl Acad Sci USA
79:1940–1944
Prada D (2009) Molecular population genetics and agronomic alleles
in seed banks: searching for a needle in a haystack? J Exp Bot
60:2541–2552
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population
structure using multilocus genotype data. Genetics 155:945–959
Reed DH, Frankham R (2001) How closely correlated are molecular
and quantitative measures of genetic variation? A meta–analysis.
Evolution 55:1095–1103
Reeves PA, He Y, Schmitz RJ, Amasino RM, Panella LW, Richards
CM (2007) Evolutionary conservation of the FLC–mediated
vernalization response: evidence from the sugar beet (Betavulgaris). Genetics 176:295–307
Richards CM (2004) Molecular technologies for managing and using
gene bank collections. In: MC de Vicente (ed) The evolving role
of genebanks in the fast developing field of molecular genetics.
Issues Genet Resour 11:13–18. IPGRI, Rome, Italy
Richards CM, Brownson M, Mitchell SE, Kresovich S, Panella L
(2004) Polymorphic microsatellite markers for inferring diver-
sity in wild and domesticated sugar beet (Beta vulgaris). Mol
Ecol Notes 4:243–345
Schoen DJ, Brown AHD (1993) Conservation of allelic richness in
wild crop relatives is aided by assessment of genetic markers.
Proc Natl Acad Sci USA 90:10623–10627
Schoen DJ, Brown AHD (2001) The conservation of wild plant
species in seed banks. Bioscience 51:960–966
Slatkin M (1976) The rate of spread of an advantageous allele in a
subdivided population. In: Karlin S, Nevo E (eds) Population
genetics and ecology. Academic Press, New York, pp 767–780
Slatkin M (1994) An exact test for neutrality based on the Ewens
sampling distribution. Genet Res 64:71–74Slatkin M (1996) A correction to the exact test based on the Ewens
sampling distribution. Genet Res 68:259–260
Tanksley SD, McCouch SR (1997) Seed banks and molecular maps:
unlocking genetic potential from the wild. Science 277:418–423
Tenaillon MI, U’Ren J, Tenaillon O, Gaut BS (2004) Selection versus
demography: a multilocus investigation of the domestication
process in maize. Mol Biol Evol 21:1214–1225
Viard F, Bernard J, Desplanque B (2002) Crop–weed interactions in
the Beta vulgaris complex at a local scale: allelic diversity and
gene flow within sugar beet fields. Theor Appl Genet
104:688–697
Vigouroux Y, McMullen M, Hittinger CT, Houchins K, Schulz L,
Kresovich S, Matsuoka Y, Doebley J (2002) Identifying genes of
agronomic importance in maize by screening microsatellites for
evidence of selection during domestication. Proc Natl Acad Sci
USA 99:9650–9655
Walsh B (2008) Using molecular markers for detecting domestica-
tion, improvement, and adaptation genes. Euphytica 161:1–17
Walters C, Volk GA, Richards CM (2008) Genebanks in the post-
genomic age: emerging roles and anticipated uses. Biodiversity
9:68–71
Wang M, Allefs S, van den Berg RG, Vleeshouwers VGAA, van der
Vossen EAG, Vosman B (2008) Allele mining in Solanum:
conserved homologues of Rpi–blb1 are identified in Solanumstoloniferum. Theor Appl Genet 116:933–943
Whitham S, Dinesh–Kumar SP, Choi D, Hehl R, Corr C, Baker B
(1994) The product of the tobacco mosaic virus resistance gene
N: similarity to toll and the interleukin–1 receptor. Cell
78:1101–1115
Wright S (1931) Evolution in Mendelian populations. Genetics
16:97–159
Wright SI, Gaut BS (2005) Molecular population genetics and the
search for adaptive evolution in plants. Mol Biol Evol
22:506–519
Xiao J, Li J, Yuan L, Tanksley SD (1996) Identification of QTLs
affecting traits of agronomic importance in a recombinant inbred
1170 Theor Appl Genet (2012) 124:1155–1171
123
population derived from a subspecific rice cross. Theor Appl
Genet 92:230–244
Yamasaki M, Tenaillon MI, Vroh Bi I, Schroeder SG, Sanchez–
Villeda H, Doebley JF, Gaut BS, McMullen MD (2005) A large–
scale screen for artificial selection in maize identifies candidate
agronomic loci for domestication and crop improvement. Plant
Cell 17:2859–2872
Zhu Q, Zheng X, Luo J, Gaut BS, Ge S (2007) Multilocus analysis of
nucleotide variation of Oryza sativa and its wild relatives: severe
bottleneck during domestication of rice. Mol Biol Evol
24:875–888
Theor Appl Genet (2012) 124:1155–1171 1171
123