“PCR for diagnosis and characterization of Leishmania in

clinical samples from Kala Azar and Post Kala-azar Dermal Leishmaniasis patients”

At National institute of Pathology, Safdarjung Hospital

Campus ,New delhi

 

Submitted by:- Upma

Gandhi

7251616222 B.tech

biotech

Institute of Pathology, New delhi is a premier research institute which was established in 1965 under ICMR. Its areas of reasearch are.

1. Metabolic syndromes(diabetes,obesity), chronic diseases biology fibrosis liver/ lung/)

2. Idiopathic skin diseases (Breast Cancer,

Lymphoma,3.infectiousdiseases(Tuberculosis,Leis

hmaniasis,)4.adult stem cell biology 5. environmental toxicology.

I

Leishmaniasis is a protozoan parasitic disease transmitted by the bite of sand flies.

Endemic in more than 88 countries and affecting 12 million people worldwide.

The majority of human cases occur in a small number of countries:

90% of visceral leishmaniasis cases occur in parts of India, Bangladesh, Nepal, Sudan, Ethiopia and Brazil

90% of cutaneous leishmaniasis cases occur in parts of Afghanistan, Algeria, Iran, Saudi Arabia, Syria, Brazil, Colombia, Peru and Bolivia 

Three main forms of Leishmaniasis

Cutaneous: affects the skin and mucus membranes. Skin sores usually start at the site of the sandfly bite.

Visceral: involving liver, spleen, and bone marrow

Mucocutaneous:involvingmucous membranes of the mouth and nose after spread from a nearby cutaneous lesion (very rare)

PhylumPhylum

OrderOrder

FamilyFamily

GenusGenus

SarcomastigophoraSarcomastigophora

KinetoplastidaKinetoplastida

TrypanosomatidaeTrypanosomatidae

LeishmaniaLeishmania

In India, states of Bihar, Uttar Pradesh and West Bengal are highly endemic foci of Kala azar where periodic epidemics are common.

The most common type of Leishmaniasis present in india is Visceral leishmaniasis or kala azar and Post kala azar dermal leishmaniasis.

Visceral leishmaniasis, also known in Asia as ' black fever/ 'kala azar', It is characterized by:-

1. Irregular fever,2. Loss of weight, 3.Splenomegaly, 4.Hepatomegaly 5. Thrombocytopenia.

VL is caused by L. donovani in the Indian subcontinent

in East Africa, by L. infantum L. chagasi in the in Brazil,

Peru and Paraguay

Post kala-azar dermal leishmaniasis (PKDL) is a dermatosis, caused as a sequel to KA.

Characterized by a macular, maculopapular and nodular rash in a patient who has recovered from VL and is otherwise well

PKDL is also caused by L. donovani

These include: Meglumine antimonate Sodium stibogluconate Other drugs that may be used include: Amphotericin B Fluconazole Pentamidine

A. Plastic surgery may be needed to correct the disfigurement caused by sores on the face (Cutaneous Leishmaniasis).

B. Patients with drug-resistant viral Leishmaniasis may need to have their spleen removed (splenectomy).

As the symptoms of Leishmaniasis can vary and may be confused with other etiologic agents, diagnostic confirmation of the parasite is mandatory.

Methods of diagnosis of Leishmaniasis 1. Microscopy 2. Culture 3. Serodiagnosis (IFAT, ELISA ,DAT)4. PCR ( polymerase Chain reaction )

  PCR will be used as a sensitive and

specific technique for diagnosis of KA and PKDL.

PCR-RFLP assay based on internal transcribed spacer-1 (ITS-1) and PCR based on Kinetoplast DNA (kDNA) will be applied for diagnosis and species identification of parasite.

Leishmania spp. parasites will be used for this study.

Promastigotes will be cultured at 26C in M199 medium with 25mM HEPES (pH7.4) supplemented with 10% FBS, 100 IU and 100 g/ml each of penicillin G and streptomycin, respectively.

Blood sample will be collected from KA patient in heparinized tubes. Skin scrapings were collected in NET buffer from PKDL Patients. (150mM NaCl, 15mM Tris- HCl[pH 8.30], 1mM EDTA). Then DNA isolation

is done using QIAamp DNA blood minikit (Qiagen).

 

Template DNA (genomic, plasmid, cosmid, bacterial/yeast colony, etc.)

Gene Specific Primers :(Leishmania donovani specific primers, Salotra et al, JCM 2001)

Forward Primer-5`CTGGATCATTTTCCGATG3’ Reverse Primer- 5`TGCATACCACTTATCGCACT

3’ Buffer (usually 10X supplied along with Taq

polymerase) MgCl2 (1.5 mM) Taq DNA polymerase (1.25 Units) dNTPs (2.5 mM stock)

All the components Template DNA,Forward Primer, Reverse Primer,Buffer 10X

MgCl2,Taq DNA polymerase and dNTPs

A master mix is prepared with all thecomponents of PCR reaction.

24μL of the master mix is added into all aliquots , then DNA sample is added , mixed properly & centrifuged

PCR conditions- 40 cycles of   Denaturation : 95°C for 4 min, Annealing : 95°C for 20

sec, Extension : 53°C for 30

secInitial Denaturation : 72°C for 1 minFinal extension : 72°C for 3 min  

An excellent target for a sensitive and rapid detection method of Leishmania donovani is the Kinetoplast DNA PCR. It can detect DNA upto conc. of 1 fg

This DNA from cultured parasites (1 ng) and from KA and PKDL patients will be taken for amplification using KDNA specific primers

Template DNA (genomic, plasmid, cosmid, bacterial/yeast colony, etc.)

Gene Specific Primers :(Leishmania donovani specific primers, Salotra et al, JCM 2001)

Forward Primer-5`-CTGGATCATTTTCCGATG-3’ Reverse Primer- 5`-

TGCATACCACTTATCGCACTT -3’ Buffer (usually 10X supplied along with Taq

polymerase) MgCl2 (1.5 mM) Taq DNA polymerase (1.25 Units) dNTPs (2.5 mM stock)

PCR conditions- 40 cycles of Denaturation : 94°C for 1

min, Annealing : 45°C for

30 sec, Extension : 72°C for

60 sec Initial Denaturation : 94°C for 2

min Final extension : 72°C for 3

min

  Detection and analysis of the reaction

product

PCR product is loaded with 6X loading dye , along with appropriate molecular-weight markers which is 1Kb Ladder , onto an agarose gel (1 %) containing EtBr. DNA bands on the gel can then be visualized under ultraviolet trans-illumination.

Identification of Leishmania species in clinical material using ITS-1 PCR and restriction enzyme analysis was done. DNA (1ng) was subjected to pcr and analyzed. Lane1, 100bp ladder; lane 2 , L.donovani ; Lane 3, Sample DNA, Lane 4 L. tropica ; lane 5 L.major .

Identification of Leishmania species in clinical material using kDNA specific PCR was done. DNA (1ng) was subjected to PCR and analyzed. Lane1, 1kb ladder; Lane2 , L.donovani positiive control, lane 3, negative control ; lane 4, control blood; Lane 5 -8 KA sample.

Identification of Leishmania species in clinical samples using kDNA specific PCR was done. DNA (1ng) was subjected to PCR and analyzed. Lane1, 1kb ladder; lane 2, L.donovani positive control; Lane 3, negative control Lane 4 -6 PKDL sample

Current diagnostic methods based on parasite

detection are invasive and have poor sensitivity,

while immunological methods have limited specificity,

This method is rapid and reproducible, it can be used for the reliable identification and characterization of cultured parasites.

The test has other potential values in detecting and typing parasites in vectors for epidemiological surveys