Post on 05-Dec-2018
NATIONAL VETERINARY RESEARCH INSTITUTE
PARTYZANTOW 5724-100 PULAWY, POLAND
tel. (48) 81 8863051fax (48) 81 8862595
http://www.piwet.pulawy.pl
Pulawy
NATIONAL VETERINARY RESEARCH INSTITUTE
established in 1945
as a scientific institution of theMinistry of Agriculture
The major mission of the NVRI is applied research in veterinarymedicine and provide services for
the public veterinary sector
Ministry of Agriculture and Rural Development
Veterinary InspectionChief Veterinary Officer
Voivodship Veterinary InspectorateVoivodship Veterinary Officer
16
District Veterinary InspectorateDistrict Veterinary Officer
295
Border Veterinary Inspectorate27
NationalNational VeterinaryVeterinary ResearchResearch InstituteInstituteNationalNational ReferenceReference LaboratoriesLaboratories
Regional Veterinary Diagnostic Laboratories16
Branch laboratories29
Private practicioners
Scheme of veterinary services in Poland
Prime Minister’s Office
Private laboratories60
NationalNational VeterinaryVeterinaryResearchResearch InstituteInstitute
Research staff
The Institute employs 350 persons
33 researchers with Sc.D. and Ph.D.
40 researchers with Ph.D
49 researchers with D.V.M. or M.Sc
102 technicians
Organization of the NVRI
Laboratories representing basic disciplines(bacteriology, virology, biochemistry, parasitology,pathology,toxicology and pharmacology, food andfeedingstuffs hygiene
Laboratories for the diseases of particular animalspecies: equine, swine, poultry, fish
Laboratories for diseases of special significance foranimals and husbandry (tuberculosis, foot and mounthdisease, mastitis) and zoonoses
The NVRI contributes the activity on the following fields:
Experimental research into animal diseases
Reference activity dedicated to the regional diagnostic laboratories and the Veterinary Inspection
Active surveillance - implementation and execution of the Multiannual Monitoring Programme
17.01.2005
Construction of the newlaboratories started
National reference laboratories (NRL)
A network of 14 laboratories within different departments of NVRI appointed with the Act ofMinistry of Agriculture and Rural Development
of October 21, 2004 for the reference activities
The most important elements in the functioning of the NRL are:
Reference duties are fully integrated with activity of NVRI departments undertaking research and training
Reference activity has its own budget
PAP, medicated feedingstuff, microbiological agentsHigiene of Animal Feedingstuff
Food microbiology Higiene of Food of Animal Origin
Residues of pesticides, PCBs, toxic elements, veterinary drugs, hormones, mycotoxins
Pharmacology &Toxicology
Dioxines, nitrosoaminesRadiology & Toxicology
IHN, ISA, SV, VHS, IPN, BKDFish Diseases
FMD, SVDFood and Mouth Disease
HPAI, Newcastle Dis., Gumboro Dis., Marek Dis., mycoplasmosis, Poultry Diseases
Q fever, chlamydiosis, CBPP,Cattle & Sheep Disease
Bovine leukosis, MVV, CAEVBiochemistry
BSE, scrapiePathology
CSF, Aujeszky’s Dis., leptospirosis, TGE Swine Diseases
BSE, rabies, IBR/IPV, EAV, EVA Virology
Brucellosis, antrax, listeriosis, tubercullosisMicrobiology
Reference activityDepartment/Laboratory
Activities of NRL (46)
What are the duties of NRL?
to collaborate with the regional laboratories in terms of harmonization standards and diagnostic methods
to carry out the proficiency tests
to control the quality of diagnostic reagents used for thetests reffered to the diagnosis of infectious diseases
to collect and process epidemiological data related to animal infectious diseases and official food control
to perform laboratory examinations to confirm the resultsdone by authorized laboratories, if there are some doubts
to train the employees of the authorised laboratories
NRL for Campylobacter
Located at Department of Hygiene ofFood of Animal Origin of NVRI
Campylobacter – mainactivities (since 2004)
Development of molecular identificationmethods (PCR)
Application of PCR and RFLP methods for differentiation of the strains
Isolation and identification of Campylobacterfrom poultry
PCR methods
500asp(C. coli)
GGTATGATTTCTACAAAGCGAGATA AAAGACTATCGTCGCGTG
CC18FCC519R
m-PCR 2**
57916S rRNA(C. lari)
ATGCAAGTCGAACGATGAAGCGAC CCACTCTAGATTACCAGT TTCCC
CL55 CL632
735hipO(C. jejuni)
GAAGAGGGTTTGGGTGGTAGCTAGCTTCGCATAATAACTTG
HIP400FHIP1134R
PCR 3***
462ceuE(C. coli)
AATTGAAAATTGCTCCAACTATGTGATTTTATTATTTGTAGCAGCG
COL3MDCOL2
589mapA(C. jejuni)
CTATTTTATTTTTGAGTGCTTGTGGCTTTATTTGCCATTTGTTTTATTA
MDmapA1MDmapA2
85716S rRNA(C. coli and C. jejuni)
ATCTAATGGCTTAACCATTAAAC GGACGGTAACTAGTTTAGTAT T
MD16S1MD16S2
m-PCR 1*
Size ofPCR
amplicon(bp)
Target geneSequence (5´→3´)PrimersPCR test
* Denis M., Soumet C., Rivoal K., Ermel G., Blivet D., Salvat G., Colin P.: Development of a m-PCR assay for simultaneous identification of Campylobacter jejuni and C. coli. Lett. Appl. Microbiol. 1999, 29, 406-410.
** Linton D., Lawson A. J., Owen R. J., Stanley J.: PCR detection, identification to species level, and fingerprinting of Campylobacter jejuniand Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol. 1997, 35, 2568-2572.
***Oyarzabal O. A., Wesley I. V., Barbaree J. M., Lauerman L. H., Conner D. E.: Specific detection of Campylobacter lari by PCR. Journal ofMicrob. Methods, 29, 1997, 97-102.
Multiplex PCR results
M 1 2 3 4 5 6 7 8 9 10 M
500 bp →
Lanes: 1 – C. jejuni and C. coli, 2 – C. coli, 3 - C. jejuni, 4 – E. coli EDL 933, 5 – negative control (H2O), 6 - C. jejuni and C. coli, 7 - C. coli, 8 – C. jejuni, 9 - E. coli EDL 933, 10 –negative control (H2O), M - 100 bp DNA marker
Differentiation by molecular methods
94°C/5 min, 30 cycles:48°C/1 min, 72°C/2 min, 94°C/1 min and 72°C/5
minGGATTTCGTATTAACACAAATGGTGC
CTGTAGTAATCTTAAACATTTTGflaAFflaAR
flaA typing
SmaI, SacII and bothPFGE
94°C/4 min, 40 cycles: 25°C/45 s, 72°C/1 min, 94°C/45 s and 72°C/5
min
ATGTAAGCTCCTGGGATCACAAGTAAGTGACTGGGGTGAGCG
ERIC1RERIC2
ERIC-PCR
94°C/5 min, 40 cycles:37°C/1 min, 72°C/1 min, 94°C/1 min and
72°C/10 minCAATCGCCGT CCGCAGCCAA
OPA-111254
RAPD-PCR
Amplifictions conditionsSequence (5´→3´)Primername
Method
1009080706050
C. j. 3C. j. 6C. j. W20C. j. W25C. j. W35C. j. W7C. j. W11C. j. W18C. j. 21C. j. W47C. j. W40C. j. W41
ERIC-PCR results
M 3 6 21 W7 W11 W18 W20 W25 W35 W40 W41 W47 M
3 6 21 W7 W11 W18 M W20 W25 W35 W40 W41 W47
100908070605040302010
C. j. W40C. j. W41C. j. W25C. j. W35C. j. 21C. j. W7C. j. W11C. j. W18C. j. W20C. j. 3C. j. 6C. j. W47
RFLP/PFGE (SmaI) results
Proficiency tests
• Detection of Campylobacter in chickenmatrix, organized by FEPAS, UK, November 2005
• Identification of Campylobacter, organizedby WHO Global Salm-Surv, ExternalQuality Assurance System, Denmark, October 2006
Selected publications• K. Wieczorek, J. Osek: Multiplex PCR assays for simultaneous identification of
Campylobacter jejuni and C. coli. [in Polish]. Medycyna Weterynaryjna 2005, 61, 797
• K. Wieczorek, J. Osek: Campylobacter as a cause of gastrointestinal infections. A review. [in Polish]. Medycyna Weterynaryjna 2005, 61, 847
• K. Wieczorek, J. Osek: The usefulness of some selected PRC techniques indifferentiating thermotolerant Campylobacter strains. [in Polish]. Zywnosc, Nauka, Technologia, Jakosc 2005, 45, 132
• K. Wieczorek, J. Osek: Prevalence of virulence markers in Campylobacter jejuniand Campylobacter coli obtained from chicken carcasses. [in Polish]. Zoonozy, 2005, 92
• K. Wieczorek, J. Osek: Identification of thermophilic Campylobacter jenuni andCampylobacter coli by multiplex PCR. Hygiena Alimentorum XXVII, 2006, 253
• K. Wieczorek, J. Osek: Differentiation of Campylobacter jejuni isolates by random amplified polymorphic DNA method. [in Polish]. Medycyna Weterynaryjna 2006, 62, 663
Contact
Prof. Jacek Osek, DVM, PhDNational Veterinary Research InstituteDepartment of Hygiene of Food of Animal OriginPartyzantow 5724-100 Pulawy, PolandPhone: +48 81 8863051Fax: +48 81 8862595E.mail: josek@piwet.pulawy.plwww.piwet.pulawy.pl