MODERN GENETICS Name some foods that you eat. How many of them do you think are genetically altered?...

Post on 11-Jan-2016

216 views 0 download

Transcript of MODERN GENETICS Name some foods that you eat. How many of them do you think are genetically altered?...

MODERN GENETICS

• Name some foods that you eat.• How many of them do you think

are genetically altered?

How is Genetics used in everyday life?

Genetically Modified Foods

What are the Benefits?

What are the Risks?

Believe It or Not,

YOU are the generationthat will decide

how to use this technology!!!!

Genome

Is the complete set of genetic material in an organism- the order of the bases in the DNA

Can fit into the nucleus of a single cell because of the “packing system”

The Human Genome ProjectThe Human Genome Project

• Mapping the sequence of nucleotides…• ACCGTTTAACCGTATAGGACCACT…• for the entire amount of DNA in our cells

• This info is then entered into a computer database

• Researchers then compare the data to find genes, evolutionary links, and more

Recombinant DNA

• Combines genes from different sources into a single DNA molecule

Examples:1. Bacteria that could clean up oil spills or toxic waste sites2. Vaccine production3. Insulin production – Pure human form 4. Gene cloning 5. Genetically modified plants and animals

Why is this useful?• Organisms can be modified to produce

products that benefit everyone

Biotechnology• The use of organisms to perform practical tasks

for humans- to analyze and manipulate the genomes of organisms

Plasmids• A small circular DNA molecule separate from

the much larger bacterial chromosome.

Plasmids – BIG DEAL• What can they be used for?

Restriction Enzymes• These are tools used to “cut” DNA in specific

locations

AAAATTCCGAGACGAATTCAATACGAATTCGGGTTAAACCCCCGAATTCGGGCCTCA

• How many times do you see GAATTC?

• Draw a line between the G&A (in these sections)

• So how many sections of DNA do you have now?

The Good With the Bad

The manipulation of DNA allows scientists to do some interesting things.

**Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms.

Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

1. **Transgenic animals are often used in research.

• What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?

2. **Transgenic plants and animals may have increased value as food sources.

• What might happen to native species if transgenic animals or plants were released into the wild?

Nucleic Acid Probe• A complimentary strand of DNA that has been radioactively labeled

Let’s say we want to find the sequence TAGGCT

What is it How is it done When?

Plants

Animals

Animal Cloning

To improve the characteristics of the plants

Use of plasmids from the soil to introduce new genes

•To delay ripening•Improved nutritional content•Resistance to spoilage or disease

Same as plants- better quality “wool”Or to mature in a shorter time

•Extract an egg cell•Sperm fertilizes the egg•Desired gene is injected into the fertilized egg

•To make vaccines•Growth hormones

Entire genomes can be cloned

“Dolly”

The nucleus from a single cell replaces the nucleus of an unfertilized egg from another animal- the egg develops into an animal that has the same genome as the nuclear donor

Cloning can offer the potential to mass produce an animal

Polymerase Chain Reaction (PCR)

•A method for amplifying a DNA base sequence.

•The newly synthesized DNA strands can serve as templates for making more DNA—amplifying the desired sequence.

How?

When?

Can detect viral genes infected with the virus that causes AIDS

PCR

**Genetic Markers- particular stretches of DNA that are variable among individuals

Ex.) DNA fragments that include certain disease alleles have distinct genetic markers

**DNA fingerprinting- a particular banding pattern produced by your restriction fragments

- Unless you have an identical twin, it is unlikely to have the exact same fingerprint

Gel Electrophoresis

• A method of separating large molecules (such as DNA fragments or proteins).

How?

• An electric current is passed through a medium containing the mixture

• Each kind of molecule travels through the medium at a different rate, depending on its electrical charge and size.

• Separation is based on these differences.

DNA plus restriction enzyme

Mixture of DNA fragments

Power source

Longer fragments

Shorter fragments

Gel Electrophoresis

Gel

                           

                    

Stem cells

•-Cells with the potential to “turn into” an undifferentiated cells•-Have the potential into various types of cells

DNA Sequencing•Any lab technique used to find out the sequence of nucleotide bases in a DNA molecule or fragment.

Fluorescent dye Single strand of DNA

Strand broken after A

Strand broken after C

Strand broken after G

Strand broken after T

Power source

Gel

DNA Sequencing

Go to Section:

Gene Therapy

•The process of introducing new genes into the DNA of a person's cells to correct a genetic disease or flaw

Section 13-3

Making Recombinant DNA

Human Cell

Gene for human growth hormone

Recombinant DNA

Gene for human growth hormone

Sticky ends

DNA recombination

DNA insertion

Bacterial Cell

Plasmid

Bacterial chromosome

Bacterial cell containing gene for human growth hormone

Go to Section:

CloningFlowchart

A body cell is taken from a donor animal.

An egg cell is taken from a donor animal.

The fused cell begins dividing, becoming an embryo.

The nucleus is removed from the egg.

The body cell and egg are fused by electric shock.

The embryo is implanted into the uterus of a foster mother.

The embryo develops into a cloned animal.

A donor cell is taken from a sheep’s udder.

Donor Nucleus These two

cells are fused using an electric shock.

Fused Cell

The fused cell begins dividing normally.

Embryo

The embryo is placed in the uterus of a foster mother.

Foster Mother

The embryo develops normally into a lamb—Dolly

Cloned Lamb

Egg Cell

An egg cell is taken from an adult female sheep.

The nucleus of the egg cell is removed.

Cloning of the First Mammal

Go to Section: