Post on 01-Jan-2017
1
Misidentification of Saprochaete clavata as Magnusiomyces capitatus in clinical isolates: 1
Utility of ITS sequencing, MALDI-TOF and Importance of reliable databases 2
3
Marie Desnos-Ollivier,a,b Catherine Blanc,a,b Dea Garcia-Hermoso,a,b Damien Hoinard,a,b 4
Alexandre Alanio,a,b,c,d Françoise Dromera,b* 5
Institut Pasteur, Unité de Mycologie Moléculaire, Centre National de Référence Mycoses 6
Invasives et Antifongiques, Paris, Francea, CNRS URA3012b, Laboratoire de Parasitologie-7
Mycologie ; Groupe Hospitalier Saint-Louis-Lariboisière-Fernand-Widal, Assistance 8
Publique-Hôpitaux de Parisc, Université Paris-Diderot, Sorbonne Paris-Citéd 9
Address correspondence to 10
Françoise Dromer : 11
Unité de Mycologie Moléculaire, 12
Institut Pasteur, 13
28, rue du Dr. Roux, 75724 Paris Cedex 15, France. 14
Phone: +33 1 40 61 32 50. Fax: +33 1 45 68 84 20. E-mail: dromer@pasteur.fr 15
16
Running title 17
Misidentification of Geotrichum spp. clinical isolates 18
Abstract 19
Saprochaete clavata and Magnusiomyces capitatus are human pathogens, frequently mistaken 20
for each other due to similar phenotypes and erroneous or limited databases. Based on ITS 21
sequences, we propose species-specific carbon assimilation patterns and MALDI-TOF 22
JCM Accepts, published online ahead of print on 2 April 2014J. Clin. Microbiol. doi:10.1128/JCM.00039-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
2
fingerprints that allow identification of S. clavata, M. capitatus and Galactomyces candidus to 23
the species level. 24
Short Form Paper 25
Saprochaeta clavata (de Hoog, Smith & Guého) de Hoog & Smith (2004) (synonym 26
Geotrichum clavatum de Hoog, Smith & Guého 1986) is an ascomycetous fungus (1, 2). 27
Colonies are white farinose, dry and consist of true hyphae that branch at acute angles and 28
disarticulate into arthroconidia. This species has rarely been isolated from human samples. Its 29
ecology, reservoir and importance in agriculture and food are unknown (3). This species is 30
closely related to a known human pathogen Magnusiomyces capitatus (de Hoog, Smith & 31
Guého) de Hoog & Smith (2004) (formerly known as Geotrichum capitatum) (4). 32
Magnusiomyces capitatus is reported causing invasive infections especially in patients with 33
hematological malignancies (5, 6) and has even been involved in several outbreaks often 34
associated with contaminated dairy products (7-9). Initially, De Hoog et al. (1986) described 35
the new species G. clavatum to distinguish strains identified as G. capitatum but with a 36
distinct growth on cellobiose, salicin and arbutin (2). However, commercially available strips 37
lack salicin and arbutin, and are thus useless for an accurate identification. Furthermore, the 38
databases coming with the automated platforms for microbial identification based on sugar 39
assimilation patterns or mass-spectrometry profiles lack this species (10) or even show low 40
discrimination for M. capitatus (11, 12). 41
From analysis of D1/D2 sequence divergence, Phaff et al. mentioned the apparent 42
conspecificity of G. clavatum, Dipodascus spicifer and G. capitatum (13). In fact, the D1/D2 43
sequences of the three species have 99% of similarity. But Kurtzman and Robnett, considered 44
only G. clavatum and D. spicifer to be synonymous (14). Based on the ITS sequence analysis 45
it was demonstrated that G. clavatum differed from G. capitatum (96% of similarity) and that 46
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
3
it belongs to the Saprochaete/Magnusiomyces clade and therefore G. clavatum was 47
transferred to the anamorph genus Saprochaete (1). Despite the use of ITS regions 48
sequencing, the majority of clinical isolates of S. clavata are identified as M. capitatus 49
because nucleotide sequences of S. clavata available in the public database such as Genbank 50
are either misidentified or too short (163 bp). In order to provide clues for species 51
identification that could be apart from ITS sequencing, we analyzed phenotypic 52
characteristics of clinical isolates identified as Geotrichum sp. based on techniques on profiles 53
generated by routinely available techniques (sugar assimilation pattern (ID32C, BioMérieux) 54
or MALDI-TOF). 55
For the 101 clinical isolates received as Geotrichum spp. since 2003 at the National Reference 56
Center for Mycoses and Antifungals (NRCMA), purity was checked by using chromogenic 57
medium (BBL™ CHROMagar™, Becton-Dickinson, USA). Urease activity (urea-indole 58
medium, bioMérieux, Marcy-l’Etoile, France) and carbon assimilation patterns (ID32C and 59
50CH, bioMérieux) were determined. The D1/D2 and ITS1-5.8S-ITS2 regions of the 60
ribosomal DNA were sequenced by using universal primers (NL1/NL4 (15) and V9D/LS266 61
(16, 17), respectively). The sequences of the ITS1-5.8S-ITS2 regions were delimited by the 62
sequences of the primers ITS1 and ITS4 (TCCGTAGGTGAACCTGCGG / 63
GCATATCAATAAGCGGAGGA) and sequences were compared with the nucleotide 64
sequence of the type strain of S. clavata CBS425.71 (Genbank accession number KF984489), 65
M. capitatus CBS 162.80 (Accession number KF984490) and Galactomyces candidus 66
(teleomorph of Geotrichum candidum) CBS 178.71 (Accession number KF984491). For all 67
clinical isolates and type strains, PCR fingerprinting technique was performed with the core 68
sequence of phage M13 (5’-GAGGGTGGCGGTTCT-3’) and OPE4 (5’-GTGACATGCC-3’) 69
as a single primer (7, 18). For 19 clinical isolates (15 S. clavata, 4 M. capitatus) and the 3 70
type strains, MALDI-TOF fingerprints were obtained using mass spectrometry technology on 71
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
4
the Vitek® MS automate (bioMérieux) after 24h and 48h growth on malt extract agar plates 72
with gentamycin and chloramphenicol (Merck) and on Sabouraud agar slants with gentamycin 73
and chloramphenicol (Biorad) and analyzed using the Vitek MS version 2.0 reference strain 74
database. 75
Based on ITS regions sequencing, 59/101 isolates were eventually identified as S. clavata, 27 76
as M. capitatus and 15 as G. candidus. Delimited sequences of ITS and D1/D2 regions 77
between S. clavata (464pb) and M. capitatus (454pb) have 96% and 99% of similarity, 78
respectively. RAPD analysis suggests that species-specific fingerprintings may be obtained 79
(Figure 1). This technique however cannot be envisioned as a routine means for species 80
identification. Comparison of ID32C profiles allowed differentiating species-specific carbon 81
assimilation profiles (Table), with 10 codes specific for M. capitatus, 8 for S. clavata and 4 82
for G. candidus. Using Vitek® MS and the corresponding database, identification was 83
confirmed for the 4 clinical isolates and the type strain of M. capitatus, but no identification 84
was obtained for the other 17 isolates in the v. 2.0 database. However, when analyzing 85
MALDI-TOF profiles of the 22 isolates, three groups corresponding to the three species could 86
be delineated based on specific peaks (Figure 2). 87
These results underline the importance of using specialized databases such as that of the 88
Centraalbureau voor Schimmelcultures (CBS, 89
http://www.cbs.knaw.nl/collections/BioloMICSSequences.aspx?file=all) where taxonomy is 90
more reliable than in public repositories as pointed out by Nilsson and colleagues (19). It also 91
shows the importance of incrementing databases according to the latter developments of 92
fungal taxonomy. 93
This work was supported by Institut Pasteur and Institut de Veille Sanitaire. 94
Acknowledgments 95
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
5
The technical help of the sequencing facility and specifically that of Laure Diancourt, Anne-96
Sophie Delannoy, Jean-Michel Thiberge (Genotyping of Pathogens and Public Health, Institut 97
Pasteur) is gratefully acknowledged. We thank members of the French Mycoses Study Group, 98
who provided the isolates used in the present study, in alphabetical order of the cities: 99
Nathalie Brieu, Evelyne Lagier (Aix-en-Provence); Jean-Philippe Bouchara, Marc Pihet, 100
(Angers); Cécile Jensen (Avignon), Frédéric Grenouillet (Besançon) ; Christian Chochillon 101
(Hôpital Bichat, Paris) ; Isabelle Accoceberry, Olivier Albert (Bordeaux); Julie Bonhomme 102
(Caen); Nathalie Fauchet (Créteil) ; Philippe Poirier, Monique Cambon (Clermont-Ferrand); 103
Pierre Cahen (Foch); André Paugam, Marie-Thérèse Baixench (Hôpital Cochin, Paris) ; 104
Dominique De Briel (Colmar) ; Frédéric Dalle (Dijon); Bernadette Lebeau (Grenoble); 105
Françoise Botterel (Hôpital Henri Mondor, Paris) ; Muriel Cornet (Hôpital de l’Hôtel Dieu, 106
Paris); Odile Eloy (Le Chesnay), Boualem Sendid (Lille); Stéphane Ranque (Marseille) ; 107
Nathalie Bourgeois, Philippe Rispail (Montpellier); Malik Al Nakib (Montsouris, Paris) ; 108
Marie Machouart (Nancy); Florent Morio (Nantes) ; Marie-Elisabeth Bougnoux (Hôpital 109
Necker Enfants Malades, Paris); Martine Garri-Toussaint (Nice) ; Didier Poisson (Orléans); 110
Marie-Francoise David, Najiby Kassis-Chikhani Liliana Mihaila (Villejuif), Charles Soler 111
(Percy, Clamart); Anne Gaschet, Philippe Geudet (Perpignan); Annick Datry, Sophie Brun 112
(Hôpital de la Pitié-Salpêtrière, Paris); Christine Chaumeil (Quinze-Vingt, Paris), Dominique 113
Toubas (Reims); Jean-Pierre Gangneux (Rennes); Stéphane Bonacorsi (Hôpital Robert Debré, 114
Paris); Loïc Favennec, Gilles Gargala (Rouen); Hélène Raberin (St Etienne) ; Stéphane 115
Bretagne (Hôpital Saint-Louis, Paris) ; Valérie Letscher-Bru (Strasbourg); Sophie Cassaing 116
(Toulouse) and our Europeans colleagues Konrad Mühlethaler, Stefan Zimmerli (Institute for 117
Infectious Diseases, University of Bern, Bern, Switzerland); Polona Zalar (Biology 118
Department, Biotechnical Faculty, University of Ljubljana, Ljubljana, Slovenia); Ferran 119
Sánchez-Reus, Merce Gurgui (Hospital de la Santa Creu i Sant Pau, Barcelona, Spain). 120
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
6
References 121
1. De Hoog G.S.,Smith M.T. 2004. The ribosomal gene phylogeny and species 122
delimitation in Geotrichum and its teleomorphs. . Studies in Mycology. 50:489-515. 123
2. De Hoog G.S., Smith M.T.,Guého E. 1986. A revision of the genus Geotrichum and 124
its teleomorphs. . Stud. Mycol. 29:1-131. 125
3. de Hoog G.S.,Smith M.T. 2011. Saprochaete Coker & Shanor ex D.T.S. Wagner & 126
Dawes (1970). In The Yeasts, a taxonomic study. J.W.F.a.T.B. Kurtzman C.P., editor: 127
Elsevier. 1317. 128
4. de Hoog G.S.,Smith M.T. 2011. Magnusiomyces Zender (1977). In The Yeasts, a 129
taxonomic study. J.W.F.a.T.B. Kurtzman C.P., editor: Elsevier. 565. 130
5. Garcia-Ruiz J.C., Lopez-Soria L., Olazabal I., Amutio E., Arrieta-Aguirre I., 131
Velasco-Benito V., Ponton J.,Moragues M.D. 2013. Invasive infections caused by 132
Saprochaete capitata in patients with haematological malignancies: Report of five 133
cases and review of the antifungal therapy. Rev Iberoam Micol 30:248-255. 134
6. Girmenia C., Pagano L., Martino B., D'Antonio D., Fanci R., Specchia G., Melillo 135
L., Buelli M., Pizzarelli G., Venditti M.,Martino P. 2005. Invasive infections caused 136
by Trichosporon species and Geotrichum capitatum in patients with hematological 137
malignancies: a retrospective multicenter study from Italy and review of the literature. 138
J Clin Microbiol 43:1818-1828. 139
7. Ersoz G., Otag F., Erturan Z., Aslan G., Kaya A., Emekdas G.,Sugita T. 2004. An 140
outbreak of Dipodascus capitatus infection in the ICU: three case reports and review 141
of the literature. Jpn J Infect Dis 57:248-252. 142
8. Gurgui M., Sanchez F., March F., Lopez-Contreras J., Martino R., Cotura A., 143
Galvez M.L., Roig C.,Coll P. 2011. Nosocomial outbreak of Blastoschizomyces 144
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
7
capitatus associated with contaminated milk in a haematological unit. J Hosp Infect 145
78:274-278. 146
9. Martino P., Venditti M., Micozzi A., Morace G., Polonelli L., Mantovani M.P., 147
Petti M.C., Burgio V.L., Santini C., Serra P., Mandelli F. 1990. Blastoschizomyces 148
capitatus: an emerging cause of invasive fungal disease in leukemia patients. Rev 149
Infect Dis 12:570-582. 150
10. Bader O., Weig M., Taverne-Ghadwal L., Lugert R., Gross U.,Kuhns M. 2011. 151
Improved clinical laboratory identification of human pathogenic yeasts by matrix-152
assisted laser desorption ionization time-of-flight mass spectrometry. Clin Microbiol 153
Infect 17:1359-1365. 154
11. Lohmann C., Sabou M., Moussaoui W., Prevost G., Delarbre J.M., Candolfi E., 155
Gravet A.,Letscher-Bru V. 2013. Comparison between the Biflex III-Biotyper and 156
the Axima-SARAMIS systems for yeast identification by matrix-assisted laser 157
desorption ionization-time of flight mass spectrometry. J Clin Microbiol 51:1231-158
1236. 159
12. Giacchino M., Chiapello N., Bezzio S., Fagioli F., Saracco P., Alfarano A., 160
Martini V., Cimino G., Martino P.,Girmenia C. 2006. Aspergillus galactomannan 161
enzyme-linked immunosorbent assay cross-reactivity caused by invasive Geotrichum 162
capitatum. J Clin Microbiol 44:3432-3434. 163
13. Phaff H.J., Blue J., Hagler A.N.,Kurtzman C.P. 1997. Dipodascus starmeri sp. 164
nov., a new species of yeast occurring in cactus necroses. Int J Syst Bacteriol 47:307-165
312. 166
14. Kurtzman C.P.,Robnett C.J. 1998. Identification and phylogeny of ascomycetous 167
yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. 168
Antonie Van Leeuwenhoek 73:331-371. 169
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
8
15. O'Donnell. 1993. Fusarium and its near relatives. In The fungal holomorph : Mitotic, 170
Meiotic and Pleiomorphic speciation in Fungal Systematics. D.R.R.a.J.W. Taylor, 171
editor. Wallingford, UK: CAB. 226. 172
16. de Hoog G.S.,Gerrits van den Ende A.H. 1998. Molecular diagnostics of clinical 173
strains of filamentous Basidiomycetes. Mycoses 41:183-189. 174
17. Masclaux F., Gueho E., de Hoog G.S.,Christen R. 1995. Phylogenetic relationships 175
of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS 176
rRNA sequences. J Med Vet Mycol 33:327-338. 177
18. Gadea I., Cuenca-Estrella M., Prieto E., Diaz-Guerra T.M., Garcia-Cia J.I., 178
Mellado E., Tomas J.F.,Rodriguez-Tudela J.L. 2004. Genotyping and antifungal 179
susceptibility profile of Dipodascus capitatus isolates causing disseminated infection 180
in seven hematological patients of a tertiary hospital. J Clin Microbiol 42:1832-1836. 181
19. Nilsson R.H., Ryberg M., Kristiansson E., Abarenkov K., Larsson K.H.,Köljalg 182
U. 2006. Taxonomic reliability of DNA sequences in public sequence databases: a 183
fungal perspective. PLos ONE 1:e59. 184
185
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
9
Table 1: ID32C profiles for the 101 Geotrichum spp. clinical isolates identified by ITS 186
regions sequencing 187
Isolates with the corresponding profile
Species Number (%) ID32 profile
Magnusiomyces capitatus (n=27)
6 (22.2) 20000100010 6 (22.2) 32000100030 3 (11.1) 22000100010 3 (11.1) 22000100030 3 (11.1) 32000100010 2 (7.4) 30000100010 1 (3.7) 20000100020 1 (3.7) 22000100011 1 (3.7) 30400100030 1 (3.7) 32001100031
Saprochaete clavata (n=59)
23 (38.9) 30100100031 16 (27.1) 30100100011 9 (15.2) 32100100031
3 (5) 30000100030 3 (5) 30000100031
2 (3.4) 30000100011 2 (3.4) 30100100010 1 (1.6) 32100100011
Galactomyces candidus (n=15)
6 (40) 32003100130 6 (40) 32003100131
2 (13.3) 32003100031 1 (6.6) 32003100150
188
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
10
189
Figure 1: Examples of PCR fingerprintings obtained by using M13 primer for clinical isolates 190
of Saprochaete clavata (#1,3,4,5 and 7), Magnusiomyces capitatus (#2, 6, 8 and 9) and type 191
strains of S. clavata (CBS 425.71), M. capitatus (CBS 162.80) and Galactomyces candidus 192
(CBS 178.71). 193
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
11
194
Figure 2: MALDI-TOF raw spectra for 19 clinical isolates and the type strains (CBS 425.71 195
type strain of Saprochaete clavata, CBS 178.71 type strain of Galactomyces candidus, CBS 196
162.80 type strain of Magnusiomyces capitatus) after 24 hours subculture on 2% Malt 197
dextrose agar plates plus gentamicin and chloramphenicol. 198
on February 11, 2018 by guest
http://jcm.asm
.org/D
ownloaded from