Post on 07-Apr-2015
Department of Microbiology and Infectious Diseases
Faculty of Veterinary Science
Szent István University
Comparison of putative, virulence-associated genetic markersof West Nile virus strains
Written by:
Majid Al-Qasimi
Supervisor:
Tamás Bakonyi, DVM, PhD
Budapest
2009
1
CONTENTS
List of abbreviations 3
I. INTRODUCTION 4
Historical background 4
Etiology 4
Distribution 5
Epizootiology 6
Pathogenesis 7
Clinical signs 7
Lesions 8
Differential Diagnosis 9
West Nile virus in Hungary 9
Pathogenicity markers of WNV 11
II. MATERIALS AND METHODS 14
Samples 14
RNA extraction, RT-PCR, sequencing and genetic comparison 15
III. RESULTS AND DISCUSSION 18
V. REFERENCES 23
VI. SUMMARY 28
VII. ÖSSZEFOGLALÁS 29
2
List of abbreviations
aa: amino acid
ALFV: Alfuy virus
BLAST: Basic local alignment search tool
CNS: Central nervous system
CPCV: Cacipacore virus
JEV: Japanese encephalitis virus
KOUV: Koutango virus
MVEV: Murray valley encephalitis virus
RER: Rough endoplasmic reticulum
RNA: Ribonucleic acid
RT-PCR: Reverse transcription polymerase chain reaction
SLEV: St. Louis encephalitis virus
USUV: Usutu virus
WNF: West Nile fever
WNV: West Nile virus
YAOV: Yaounde virus
3
I. INTRODUCTION
West Nile virus (WNV) a member of the family Flaviviridae, genus Flavivirus, is
currently widespread over Africa, Eurasia, Australia and North America (Zeller and
Schuffnecker, 2004). This arbovirus is the causative agent for West Nile fever
(WNF), a disease characterized by fever, general symptoms, and encephalitis in
different vertebrate hosts (Heinz et al., 2000).
WNV is naturally found to infect and circulate in wild bird populations, and
transmitted via haematophagous arthropods, mainly mosquitoes. Certain bird species
are reservoir hosts of the virus, while infections of other hosts, such as other bird
species and mammals (predominantly horses and humans), may lead to development
of clinical symptoms, and even fatal central nervous system (CNS) disease.
Mosquitoes play a central role of the infection of incidental hosts, acting as bridge
vectors between them and the reservoir birds.
Due to the emergence of WNV infections in the United States and the economic
losses caused to horse and geese populations, as well as the zoonotic danger to
humans, emphasis on the research into WNV characteristics has been conducted over
the last few years. (Hayes et al., 2005 a and b)
HISTORICAL BACKGROUND
WNV was first identified in the West Nile district of Uganda in 1937. Blood collected
from an African woman suffering, mild fever revealed a virus that was later called
West Nile virus (Smithburn et al., 1940). Although antibodies against WNV are
commonly found in Africa, association with human disease was not apparent at first.
The same virus was later (1951) isolated in Egypt from healthy children, wild birds,
mosquitoes and from the brain of a horse with encephalitis (Melnick et al., 1951).
Cross-neutralization experiments demonstrated that the virus was serologically related
to Japanese encephalitis virus (JEV) (Smithburn, 1942).
ETIOLOGY
The virus:
Flaviviruses are single stranded RNA viruses. They are spherical and enveloped
measuring 40 to 60 nm in diameter. The virion structure is made up of three structural
4
proteins, the capsid (C), membrane (M), and the envelope (E) proteins and carries
~11kb single-stranded, positive-sense RNA genome. The genomic RNA contains a 5’
cap structure, however lacks a polyadenylated tail. Upon translation of the genomic
RNA, it acts as a single open reading frame encoding viral polyproteins that are post-
transitionally processed by cellular and viral proteases yielding a minimum of 10
separate products. Moving from the N terminal the encoding follows as such:
structural proteins C, pre-M, and E, then the non-structural proteins NS1, NS2A and
NS2B, NS3, NS4A and NS4B, and NS5 (Rice, 1985 and 1986).
Based on cross-neutralization studies employing polyclonal antisera, flaviviruses have
been divided into eight antigenic complexes; several viruses, however, could not be
assigned to any group (Calisher et al., 1989). A comprehensive phylogenetic analysis
involving 68 flaviviruses was carried out on partial nucleotide sequences of the NS5
coding- and 3' noncoding regions (Kuno et al., 1998). According to the sequence
identities and phylogenetic trees, the genus Flavivirus segregated into 14 clades
belonging to three clusters.
Hemaglutination inhibition and cross neutralization data have demonstrated that
WNV is a member of the JE virus serocomplex. Other members of the JEV group
flaviviruses are Cacipacore virus (CPCV), Koutango virus (KOUV), St. Louis
encephalitis virus (SLEV), Murray Valley encephalitis virus (MVEV), Alfuy virus
(ALFV), Usutu virus (USUV), and Yaounde virus (YAOV) (Heinz et al., 2000).
Strains:
The WNV has many strains that show relatively high nucleotide and amino acid
sequence diversity. Of the studies conducted on their phylogenetic relatedness, it was
revealed that the WNV could be grouped into two main lineages (Berhet et al., 1997;
Lanciotti et al., 2002; Charrel et al., 2003). Lineage 1 holds the WNV strains from
different regions and so, is divided into three clades. Clade “a” contains strains from
Europe, Africa, Near East and America. Clade “b” represents Australian (Kunjin)
strains and Clade “c” has strains of Indian isolates. Lineage 2 viruses are endemic to
Africa and Madagascar as well as the B956 prototype strain. Recent work done in
isolation of new genotypes found in Central Europe, in Russia and in India, suggest
the existence of further genetic lineages of WNV (Bakonyi et al., 2005; Bondre, 2007)
DISTRIBUTION
5
West Nile virus was first isolated in Uganda 1937. Later it has been identified as the
causative agent of endemics and epidemics of viral encephalitis in Europe, Africa,
Asia, and has resulted in an epidemic outbreak in the United States in 1999 (Hubálek
and Halouzka, 1999). The epidemic in America occurred in the late summer, in the
north eastern states, causing an outbreak of human encephalitis as well as concurrent
widespread mortality in crows and exotic birds of a zoological park (Anderson et al.,
1999). The WNV has since spread west across to Canadian provinces and Mexico
(Blitvich et al., 2003). After its emergence, within six years WNV caused >17 000
human infections and >670 deaths (CDC, 2005).
The spread of West Nile virus across continents has been attributed to migratory birds
belonging to the Palearctic-African migration system or wintering in the
Mediterranean area, playing a central role, and are presumably responsible for
periodic introductions of African or Middle Eastern WNV into Europe (Hubálek,
2000). The strain, which emerged in the USA is presumably originated from Israel,
however the route of introduction remained unclear (Giladi et al., 2001).
EPIZOOTIOLOGY
The WNV natural cycle involves the main vertebrate hosts (avian species) and
arthropod vectors, which feed on the hosts. Vectors responsible for the spread of
WNV are mosquitoes of various genera, with Culex being the predominant one
(Komar et al., 2003). When a female mosquito takes a blood meal from an infected
host (bird) they become infective after 10-14 days of incubation. After this they are
capable of transmitting the WNV through a second blood meal. Birds involved in this
enzootic cycle do not develop disease, and hence act as reservoirs. The more
susceptible species, avian and mammalian, are infected when a “bridge-vector” feeds
on both an infected host and then, after an extrinsic incubation time, on the
susceptible species. This is thought to be the method of transmission of WNV to
humans, horses and other species (Taylor et al., 1956).
Host to host transmission has been described possible if bird secretions (oral or
cloacal) contaminate water and food (Banet-Noach et al., 2003).
There may be a direct bird to bird transmission, but the cause is unknown. Research
has also shown that the virus may be passed to raptors by eating infected birds
(Garmendia et al., 2000). Ticks in Asia and Africa, infected with the virus have been
found, but there are no verified reports of ticks spreading the virus and their role in
6
transmission has not been determined, the most likely route of transmission still being
the mosquito (Hayes, 1989).
PATHOGENESIS
When WNV is inoculated into the skin via a mosquito bite, a local replication starts
which then spreads to the regional lymph nodes. The virus is then carried via the
lymphatic system to the thoracic duct to then enter the systemic circulation. The
viraemia level is affected by the rate of clearance of macrophages and ends when
humoral antibodies appear, one week post infection.
Viral penetration of the CNS appears to follow stimulation of toll-like receptors and
increased levels of tumor necrosis factor-, which increases permeability of the
blood-brain barrier (Wang et al. 2004). WNV directly infects neurons in grey matter
and deep nuclei of the CNS. Simultaneous destruction of bystander nerve cells may
contribute to symptoms of paralysis. It is also believed the immune mediated tissue
damage also contributes to pathological consequences.
There are 3 degrees of pathogenesis: 1) Early viraemia and large-scale extraneural
replication resulting in fatal encephalitis. 2) Low viraemia with and late established
brain infection resulting in subclinical encephalitis. 3) Trace viraemia and limited
extraneural replication, with no neural invasion evident (Ceccaldi et al, 2004).
CLINICAL SIGNS
Most WNV infections are mild and subclinical, however approximately 20 % of the
infections result in symptoms ranging from mild fever to fatal encephalitis both in
humans, horses, free-flying and captured birds (Banet-Noach et al., 2003.).
Clinical signs of WNF in humans are usually mild and include fever, headache, body
aches and, in some cases, skin rash and swollen lymph glands (Watson et al., 2004).
Severe infections include high fever, neck stiffness, muscle weakness, convulsions
and paralysis. Death rates associated with severe infection range from 3% to 15% and
are highest among the elderly. In horses the most common sign is weakness in the
hindquarters, indicated by a widened stance, stumbling, leaning, and toe dragging. In
extreme cases, paralysis develops. Sometimes other symptoms, such as fever,
depression and fearfulness, can follow. Approximately 33% of cases of WNV
encephalitis in horses proved fatal during the 2001 outbreak in the United States
(Porter et al., 2003).
7
In several wild bird species the disease is not systematic, making them good
reservoirs that mobilise the virus along their migration paths. In contrast, most corvids
infected with WNV die within 3 weeks of infection (Komar et al., 2003). Clinical
signs are generalized and may include incoordinated walking, weakness, lethargy,
tremors, and abnormal head posture. Wild birds infected with WNV are most often
found dead; therefore, descriptions of clinical signs in these cases are not readily
available. Domestic birds such as chicken do not seem to develop the disease;
however ducks and pigeons develop similar signs to those observed in wild birds
(Kramer and Bernard, 2001). Clinical signs associated with WNV infection in dogs,
cats, domestic rabbits and other small mammalians have not been well described. It
appears that, although they may be infected, many members of these latter species
rarely develop clinical signs of disease. However if clinical signs do develop, they
include fever, listlessness, stumbling, lack of coordination, ataxia, partial paralysis
and death (Austgen et al., 2004).
LESIONS
WNV shows no pathonomic lesions. Observed changes in humans and experimental
animals with WNV encephalitis include neuronal and glial damage caused directly by
viral injury and characterized by central chromatolysis, cytoplasmic eosinophilia, cell
shrinkage, and neuronophagia; inflammation, including perivascular infiltration of
small lymphocytes, plasma cells, and macrophages; cellular nodule formation
composed of activated microglia and mononuclear cells; and cerebral interstitial
edema (Sampson et al., 2000). Infection of neurons is characterized by marked
proliferation and hypertrophy of rough endoplasmic reticulum (RER), accumulation
of vesicular structures derived from the RER and containing virus particles, and
progressive degeneration of the RER and Golgi apparatus. It is suggested the neurone
dysfunction is responsible for fatality in the host, as apposed to neuronal destruction.
Residual changes and disturbances have been noted to persist after recovery from
acute encephalitis. In experimental animals, changes in behaviour and learning ability
have been documented (Austgen et al., 2004).
In birds, necropsy usually shows no pathological signs indicative of WNV infection,
but histologically the signs of encephalitis are visible (Komar et al., 2003). In horses,
no gross pathologic lesions have been detected. Histologically, animals exhibit slight
to moderate nonsuppurative encephalomyelitis, primarily in the spinal cord and lower
8
brainstem, in both grey and white matter. The most severe lesions are usually in the
thoracic and lumbar spinal cord (Castillo-Olivares and Wood, 2004).
DIFFERENTIAL DIAGNOSIS
Since most infections of WNV are subclinical, they can be diagnosed only on the
basis of the detection of the virus or specific anti-viral antibodies. Cases that do
manifest clinical signs, are of the neurological type, and must therefore be
differentiated from other neurological disorder causing diseases.
In birds WNV must be differentiated from Newcastle disease, Avian
encephalomyelitis, Avian influenza, Marek’s disease, Eastern encephalitis and non
viral causes of neurological disorders as avian encephalomalacia (vitamin E
deficiency), vitamin B1 or B2 deficiency, and encephalitis caused by bacteria, fungi
(i.e. aspergillosis), or mycoplasmas.
In horses, differential diagnostic includes Equine protozoal myeloencephalitis,
Cervical vertebral myelopathy, Equine herpesvirus 1 infection, Equine degenerative
myelopathy, Western-, Eastern- and Venezuelan equine encephalitis, Japanese
encephalitis, Borna disease or botulism. Considering the ascending paralysis,
mentation changes, and hyperesthesia in some cases, all horses that die or are
euthanized should be sent for rabies diagnostics.
WEST NILE VIRUS IN HUNGARY
WNV has been present in Hungary a long time. Seroprevalence in humans has been
reported in 1969 (Koller et al.), and the virus was isolated from rodents (bank vole,
Clethrionomys glareolus, 1972, and yellow-necked mouse, Apodemus flavicollis,
1976) (Molnár, 1982). However, clinical symptoms were never prevalent until 2003,
when enzootic encephalitis emerged in a Hungarian goose flock resulting in a 14%
mortality rate of 6 weeks-old geese (Anser anser domesticus). Based on the
histopathological alterations, serological investigations and nucleic acid detection by
RT-PCR, WNV was diagnosed as the causative agent of the disease (Glávits et al.,
2005). At the same time, an endemic of WNV was observed also in humans in
Hungary, which involved 14 reported cases of mild encephalitis and meningitis
(Ferenczi et al., 2005).
One year later, in September 2004, a goshawk (Accipiter gentilis) showed CNS
symptoms and died in a national park at the south-eastern part of Hungary. Clinical
9
signs were sudden in onset and comprised ataxia, head tremors and, in the terminal
phase, seizures. On post-mortem, macroscopic lesions were found to be non-specific,
showing only the congestion of internal organs in cases. Examination of hematoxylin-
eosin stained histological sections of the central nervous system revealed multi-focal,
lymphocytic panencephalitis with marked gliosis, and neuronal degeneration
comprising chromatolysis, necrosis and neuronocytophagia. Additionally,
demyelination of the cerebellar white matter and lymphocytic meningitis were
detected, and mild, focal mononuclear infiltration was present in peripheral nerves of
the sciatic plexus. Spleen displayed multi-focal proliferation of reticulocytes and
lymphoid depletion. Multi-focal lympho-histiocytic myocarditis was detected in the
heart. Multi-focal interstitial lympho-histiocytic nephritis was detected, lungs were
congested, and mild lymphocytic enteritis and proventriculitis was present in the bird
(Erdélyi et al., 2007). Using histopathological methods and RT-PCR, WNV antigen
and nucleic acid were detected in the organs of the bird (Erdélyi et al., 2007).
The virus isolated in 2003 was indicated as belonging to lineage 1. The virus in 2004
was traced to a lineage 2 West Nile virus, thereafter establishing itself in Hungary.
Sporadic cases were detected in the next year in birds of prey (goshawk, sparrow-
hawk [Accipiter nisus]) and the virus was also isolated from the brain of a sheep,
which died in encephalitis in 2005 (Erdélyi et al., 2007, Kecskeméti et al., 2007) In
2007 WNV was detected in an encephalitic horse, and further outbreaks in wild and
domestic birds were diagnosed in the eastern part of Hungary. In 2008 significant
geographic spread of the virus strain was observed. WNV was detected in 22 wild
birds, in 17 horses (3 direct and 14 indirect diagnoses) and 14 human cases were also
diagnosed in the enzootic season (between August and October). The cases were
detected in the central and western regions of Hungary too, and the strain emerged in
Austria. In 2009, 15 wild bird, 4 horse (1 lethal) and 4 human WNV cases were
diagnosed in Hungary. Since 2004, in all diagnosed Hungarian WNV cases, the
lineage 2 strain was demonstrated in the samples. It indicates that the virus established
a successful infection cycle, became resident in the country, and was able to cause
neurological diseases.
PATHOGENICITY MARKERS OF WNV
It has been suggested that the most important amplifying hosts of WNV are birds, in
particular Passeriformes (song birds), Charadriiformes (shorebirds), Strigifromes
10
(owls) and Falconiformes (hawks) (Hayes et al, 2005a). After amplification of the
virus, the incidence of human populations being infected by this zoonosis can lead to
severe consequences. The work by Hayes (2005b) indicated the neuroinvasive
damage lasting up to 12 months post illness in only 37% with 9% fatalities and the
rest having permanent neuromotor deficits with little improvement. Hence the
importance of understanding the way WNV becomes or elicits this neuroinvasive
character has focussed research to this field.
It was suggested that the difference between the lineages 1 and 2 showed differences
in virulence. Earlier work involved comparisons of different strains from the two
different lineages to be able to establish differences that could be explained by
genotype basis. Experimental infection of mice compared the neuroinvasive
phenotype by inoculating directly into the nervous system and outside the brain
barrier to establish the capability of neuroinvasiveness, and then comparing results
between a representative set of data from both lineages (Beasley et al., 2002). A
similar set of experiments aimed to investigate the variance of virulence of a smaller
set of WNV in the American Crow (Brault et al., 2004), and house sparrows
(Langevin et al., 2005), hoping to illustrate some correlation between the genotype
and phenotype. A recent paper by Botha et al. (2008) however has attempted to make
a full comparison of different WNV strains and cloned strains with focus on the
genome and the lineage background. The paper indicates that difference occur within
the lineages resulting in different virulence within lineage 2 strains. From this
conclusion many loci were identified as possible sites of consequence to virulence and
neuroinvasive phenotype of these strains, as well as indicate certain positions on the
genome that could relate to neuroinvasive phenotype of the virulent strains.
The results of the studies of Chambers et al. (1998) indicated that the envelope protein
contains the important regions which translated into the virus ability to be
neuroinvasive as well as indicate a possible primary locus that, if mutated, attenuated
the virus. A secondary locus was also indicated by Chambers et al., (1998) but has not
been further investigated. This led to work by other groups to investigate this
proposal, leading to support of this theory by Shirato et al. (2004) and Beasley et al.
(2005) indicating the importance of the primary locus on the envelope protein coding
region at amino acid positions 154-156. Investigations into other regions showed
11
importance of the NS2A coding region (Liu et al., 2006) and the NS3 helicase coding
region (Brault et al., 2007). These regions have been summarised in Table 1.
Table 1.: Identified genetic markers influencing the neuroinvasiveness and virulence
of lineage 1. WNV strains.
Source virus strain Test species Location on genome Effect on phenotype Reference
New York strains:
NY99-6922 from
mosquitoes and BC787
from a horse
Mouse
(suckling) and
cell culture
154 - 156 of the E-
protein (nt 1432-1433)Altered glycosylation
Beasley et
al., 2002
New York strain
(NY99), Old world
Lineage 1
An4766(ETH76a)
Mouse
Full genome
comparison (154 of E-
protein)
Altered glycosylationBeasley et
al., 2005
WNI , WNI-568, WNI-
567, WNI-25, WNI-
25A, WNI-25R
MouseE-68, E-154 to E-157,
E-307Altered glycosylation
Shitaro et al.,
2005
WNV Kunjin strain
(Australia)Mouse NS2A (A30P mutation)
Reduced ability to
inhibit alpha/beta
interferon induction
Liu et al.,
2004 and
2006
NY99 and KN3829 American crowamino acid residue 249
on the NS3 helicase
Thermosensitivity,
virulence to birds
Brault et al.,
2007
The virus strain which emerged in Hungary has shown to cause multiple pathologic
lesions in the CNS with fatalities in wild birds and in mammals (Erdélyi et al., 2007;
Kecskeméti et al., 2007), therefore it exhibits neuroinvasive and neurovirulent
phenotype. The aim of the present study was to compare the nucleotide sequences of
Hungarian, lineage 2 WNV strains (goshawk, 2004 and horse 2007) with a
neuroinvasive lineage 1 virus (New York 1999), at those loci, which were identified
as possible genetic markers for neuro-invasiveness in hosts with neurological
pathology. The complete genome sequence of the goshawk 2004 strain was
12
determined in previous studies. Within this work, partial nucleotide sequences of the
horse 2007 strain were determined and compared to the previously-mentioned viruses.
13
II. MATERIALS AND METHODS
SAMPLE
The examined virus was detected in the CNS of a horse, which died after showing
symptoms of encephalitis. The five-year-old Frisian warmblood mare was admitted to
the Large Animal Clinic of the Faculty of Veterinary Science, Szent István
University, in Üllő on the 3rd of September in 2007. The horse was admitted to the
clinic because of showing non-typical colic symptoms for 24 hours. The mare showed
general depression, muscle rigidity and tremors, stiff movement mainly on the rear
limbs, was periodically shifting weight from the rear to the hind limbs, and was
sweating. The horse had decreased anal reflex and tail tone, and was generally
hyporeflexic with some areas of hyperreflexion behind the last rib. The neurological
condition of the horse deteriorated rapidly. Within hours it became more ataxic both
on the rear and hind quarters and showed propioceptive deficits on all four limbs.
Within 24 hours it had abnormal mentation, teeth-grinding, became completely
recumbent and was unable to stand even with the help of slings. Finally, in terminal
phase, it had seizures, and was euthanized due to animal welfare reasons.
The horse was submitted to necropsy at the Pathology of the Large Animal Clinic,
and tissue samples were collected for histopathological and microbiological
investigations. Native samples were stored at -20°C.
Approximately 2 g of brain and spinal chord tissue samples were pooled and
homogenized with the help of sterile quartz sand in a ceramic mortar, and the
homogenate was suspended in 2 ml RNase-free distilled water.
14
RNA EXTRACTION, RT-PCR, SEQUENCING AND GENETIC COMPARISONS
Viral RNA samples were obtained by extraction from the supernatant of the brain
homogenate, after centrifugation at 4,500 ×g for 10 min. RNA was extracted from
140 l of the supernatant with the QIAamp viral RNA Mini kit (Qiagen, Hilden,
Germany) according to manufacturer’s instructions.
In diagnostic submission, viral RNA was amplified by using universal JEV-group
specific oligonucleotide primer pair, designed on the NS5 and 3’-UTR regions of
WNV (Weissenböck et al, 2002), in a continuous RT-PCR system, using the
QIAGEN OneStep RT-PCR kit (Qiagen, Hilden, Germany). Every 25 l reaction
mixture contained: 5 l of 5 × buffer (MgCl2 2.5mM), 0.4 mM of each
deoxynucleoside triphosphate (dNTP), 10 U RNasin RNase Inhibitor (Promega,
USA), 0.8 µM genomic and reverse primers, 1 l of enzyme mix (containing
Omniscript and Sensiscript reverse transcriptases and HotStarTaq DNA
polymerase) and 2.5 l of template RNA. The reverse transcription was carried out
for 30 minutes at 50oC, followed by a denaturing step at 95oC for 15 minutes. The
cDNA was amplified in 40 cycles (heat denaturation at 94oC for 40s, primer annealing
at 57oC for 50s, and DNA extension at 72oC for 1 min), and the reaction was
completed by final extension for 7 min at 72oC. These reactions were performed in a
GeneAmp PCR System 2700 thermocycler (Applied Biosystems, USA).
For the genetic characterization of the virus, further selected genomic regions were
amplified, using WNV lineage 2 specific oligonucleotide primerpairs (Bakonyi et al.,
2006). Primers are shown in Table 2.
15
Table 2.: Oligonucleotide primers used for the amplification and sequencing of
selected genomic regions of the WNV strain Horse-Hungary-2007.
*Numbers refer to nucleic acid positions at the 5’-end, according to the complete
genomic sequence of the closely related WNV strain B956 (NC_001563). f: forward
(genomic) primer, r: reverse (complementary) primer.
Name* Sequence 5' to 3' Product length (bp)
WNVII 870f CCTCGTTGCAGCTGTCATTG761
WNVII 1630r TCCATGGCAGGTTCAGATCC
WNVII 1584f CTTCCTGGTTCACCGAGAAT908
WNVII 2491r CTTGCCTGCCAATGTCAATG
WNVII 3027f CAACATGGCTGTGCATAGTG673
WNVII 3699r GCCGACGAGAATGACATATC
WNVII 3861f GGCTTACTATGACGCCAAGA594
WNVII 4454r CCATCATCATCCAGCCTAAC
WNVII 5294f TTGCTGCTGAGATGTCTGAG324
WNVII 5617r TGTCCGAGATAGGAGCATTG
Electrophoresis followed amplifications using 10 l of the PCR products in 1.5% Tris
acetate-EDTA-agarose gels at 5V/cm for 80 min. Stained with ethidium bromide the
bands were visualized under UV light and photographed with a Kodak DS
Electrophoresis Documentation and Analysis system using the Kodak Digital Science
1D software program. A reference ladder (100-bp DNA ladder by Promega, USA)
was used to determine the product sizes.
Where clear PCR products of the previously calculated sizes were observed, the
fragments were excised from the gel, and DNA was extracted using the QIAquick Gel
Extraction Kit (Qiagen, Germany). Fluorescence- based direct sequencing was
performed in both directions on the PCR products. Sequencing of the PCR products
was carried out using the ABI Prism 310 Genetic Analyzer automated sequencing
system (Applied Biosystems). The nucleotide sequence identification was done using
the BLAST search against gene bank databases
(http://www.ncbi.nlm.nih.gov/BLAST/). Nucleotide sequences were aligned with
other WNV sequences deposited in the GenBank database; putative amino acid
sequences were translated, and processed using the Align Plus 4 (Scientific and
16
Educational software) and ClustalX (Thompson et al., 1997) softwares. The
nucleotide sequences of the New York-horse-1999 strain (AF260967) and the
Hungary-goshawk-2004 strain (DQ116961) was downloaded from the GenBank
database (http://www.ncbi.nlm.nih.gov).
17
III. RESULTS AND DISCUSSION
In this study, partial nucleotide sequences of the lineage 2 WNV strain Horse -
Hungary - 2007 were determined at the E protein coding region between nucleotide
positions 870-2491, at the NS2A and NS3 protein coding regions between nucleotide
positions 3027-3699 and 3861-4454, and at the NS3 protein coding region between
nucleotide positions 5294-5617. The putative amino acid sequences were deduced
from the nucleotide sequences. These sequences were aligned and compared with the
corresponding regions of the lineage 1 WNV strain Horse - New York - 1999 and the
lineage 2 strain Goshawk - Hungary - 2004. The lineage 1 and lineage 2 strains
showed 78% nucleotide and 88% amino acid identity values at the investigated
regions. Amino acid substitutions between the three strains are shown in Table 3. The
nucleotide mutations in the background of these amino acid changes are summarized
in Table 4.
Particular attention was devoted to the loci, which might play a role in the
neuroinvasive and neurovirulet character of the virus. The data collected has shown
the envelope protein differed between the lineage 1 and 2 strains by 5 % (25 amino
acids of 514), while the nucleotide sequences showed 79% similarities (1287 of 1622
nucleotides). The glycosilation motif at position 154-156 (N-Y-S/T) as indicated by
Chambers et al (1998), Shitaro et al (2005) and Beasley et al (2005) as a determinant
for the neuroinvasivenes of NY99 is intact in the Hungarian, lineage 2 strains.
Chambers et al (1998) mentioned the possibility of another position that could result
in attenuation at the position 68, however all strains carry leucine and so is concurrent
with the original hypothesis. This finding supports the idea that the glycosilation
motif confers the phenotypic neuroinvasiveness, with the other mutations present not
hindering the neuroinvasive phenotype.
18
Table 3.: Alignments of partial, putative amino acid sequences of the envelope, NS2A and NS3 strains of WNV strains Horse-New York-1999 (Horse NY99), Goshawk-Hungary-2004 (Goshawk Hu04) and Horse-Hungary-2007 (Horse Hu07). Amino acid positions refer to the sequence of the putative precursor polypeptide of the virus. Only the differences are indicated. Amino acid positions, where the Hungarian sequences differ from each other are highlighted underlined in the Horse Hu07 sequence. Putative virulence markers are indicated in bold.
Envelope Protein
Amino acid position 34
5
354
361
373
378
383
412
416
418
419
421
449
462
489
495
498
500
522
543
602
659
703
732
773
Horse NY99 E T K D P R S I R T L V A N T T T V I L A K V LGoshawk
Hu04D S R E S K T T W I G I S S S A S T V A S R I M
Horse Hu07 D S R E P K T T W I G I S S S A S T V A S R I M
NS2A Protein
Amino acid position 11
44
1177
1181
1182
1211
1233
1247
1255
1262
1265
1266
1267
1269
1272
1280
1290
1293
1310
1326
1331
1336
1344
1346
1355
1366
Horse NY99 Y M L I S M R V H R Q I L I A T T R I R A S L L IGoshawk
Hu04H I M L A L S A Y K N V S V S S N K V K S C I V M
Horse Hu07 Y I M L A L S A Y K N V S V S S N K V K S C I V M
NS3 Protein
Amino acid position 15
16
1597
1635
1677
1680
1708
1720
1738
1754
1758
1788
1807
1836
1841
1852
1861
1889
1941
1944
1955
2011
2014
2042
2061
2067
2102
2115
Horse NY99 K Q F D I R R A P N V S S L S T V T E V I F L V R I AGoshawk
Hu04R H Y E A K K S H S I A A M T V I E D I V L F I K A S
Horse Hu07 R H Y E A K K S H S I A A M T V I E D I V L F I K A S
Table 4.: Alignments of partial nucleotide sequences of the envelope, NS2A and NS3 strains of WNV strains Horse-New York-1999 (Horse NY99), Goshawk-Hungary-2004 (Goshawk Hu04) and Horse-Hungary-2007 (Horse Hu07). Nucleotide positions refer to the
complete genome sequence of the virus. Only the differences resulting amino acid changes (shown in Table 3) are indicated. Nucleotide positions, where the Hungarian sequences differ from each other are highlighted in bold underlined in the Horse Hu07 sequence.
Envelope Region
Nucleotide position 10
35
1060
1062
1082
1119
1132
1134
1148
1149
1234
1236
1247
1248
1252
1254
1256
1261
1262
1344
1346
1383
1465
1466
1483
1485
1492
1494
1498
1500
1564
1565
1627
1629
1804
1805
1975
1977
2108
2194
2196
2317
2319
Horse-NY99 G A C A C C A G A T T T A A A C T T G T G A T A T A A A G G T A A C G G T A G C C CGoshawk-
Hu04T T G G G T C A G A A C T T G T C A A A T G C T A G G T C A C G G G A T G G A A A G
Horse-Hu07 T T G G G C C A G A A C T T G T C A A A T G C T A G G T C A C G G G A T G G A A A G
NS2A Region
Nucleotide Position 34
30
3432
3531
3541
3544
3631
3633
3697
3740
3741
3764
3784
3786
3793
3794
3795
3796
3798
3799
3805
3806
3807
3814
3816
3838
3840
3869
3870
3878
3879
3929
3976
3978
3992
3993
4006
4008
4030
4032
4036
4038
4063
4065
4098
Horse-NY99 T T G C A T T A A C T C C C G C C A A C T C A C G G C A C G G A A G G G A A T C A C T TGoshawk-
Hu04C C T A C G A C G T C T T A A G A T G T C A G G T C G C A C A G T A A T T T C A C G G G
Horse-Hu07 T C T A C G A C G T C T T A A G A T G T C A G G T C G C A C A G T A A T T T C A T G G G
NS3 Region
Nucleotide Position 45
46
4790
4904
4905
5031
5038
5039
5040
5123
5136
5212
5261
5273
5362
5364
5419
5421
5506
5508
5521
5523
5554
5581
5582
5583
5685
5821
5822
5823
5832
5863
5865
6031
6033
6040
6042
6124
6126
6181
6183
6200
6304
6305
6306
6343
6345
Horse-NY99 A G T C T A T C G G G C A G G T C T A T A T A C C G A C A A G G A C T C C G G G G A T T G GGoshawk-
Hu04G T A T A G C A A A T A G A A G A G T A G A G T T A G A G T A C G G C A T C A A A G A G T C
Horse-Hu07 G T A T A G C A A A T A G A A G A G T A G A G T T A G A G T A C G G C A T C A A A G A G T C
20
20
The NS2A protein differed between the lineage 1 and 2 strains by 10.8% (25 of 231 amino acids),
while the nucleotide sequences showed 78% similarities (540 of 693 nucleotides). At position 30
of the NS2A the Hungarian, lineage 2 strains contains the same alanine, as in the NY99 strain.
This supports the investigation by Liu et al. (2006), with the other mutations having no obvious
consequence on the neuroinvasiveness.
The NS3 protein having a difference of 4.4% between the lineage 1 and 2 strains (27 of 619
amino acids) while the nucleotide sequences showed 81% similarities (1504 of 1857 nucleotides).
The data shows a mutation resulting in a substitution of the proline to histidine in the Hungarian
strain at position 249 (aa 1754 of the putative precursor polypeptide), and the substitution of
threonine to valine at position 356 (aa 1861 of the putative precursor polypeptide), this does not
support the findings by Beasley et al (2005) or Brault (2007) regarding the role of NS3 in the
virulence.
Within the investigated region the Hungarian goshawk and horse strains’ amino acid sequences
differed in two amino acids (E protein, aa position 378 S and P; NS2 protein, aa position 1144 H
and Y); in these loci the two horse strains were identical.
The results of this study support the possible role of the E protein gylcosylation sites and the
NS2A region mutations in the background of the neuroinvasiveness of WNV. The NS3 specific
loci (249, 356) were identified as genetic markers connected to thermosensitivity and virulence of
the American lineage 1 strain in American crow (Brault et al, 2007). The effects of the mutations
were tested by reverse genetic methods (site-specific mutagenesis) and animal experiments in the
bird host. The authors compared neuroinvasive and non-neuroinvasive lineage 1 WNV strains in
their experiments, and found that neuroinvasive lineage 1 strains have proline at the aa site 249,
while non-neuroinvasive strains exhibit threonine. The authors compared the sequence of the
prototype lineage 2 strain (Uganda, human 1937), which is a non-neurovirulent strain. This virus
contains histidine, therefore the authors concluded that histidine in this locus also result in non-
neuroinvasive character. Our investigations indicate, that in the case of lineage 2 viruses the
NS3 249 locus is presumably not influencing the neuroinvasiveness, because both neuroinvasive
and non-neuroinvasive strains have the same amino acid in this position. Recent comparisons
with further, neuroinvasive and non-neuroinvasive lineage 2 strains (Botha et al., 2008),
supported our findings (data not shown). The role of the NS3 249 locus was investigated in bird
model. The lineage 2 strain, which emerged in Hungary, caused encephalitis both in birds and in
mammals, and at the aa 249 locus they did not differ from each other. Further studies are
necessary to clarify the exact role of the aa 249 site in the virulence of WNV. On one hand, the
neuroinvasive character of mutant strains of the lineage 1 with histidine at the 249 position
should be investigated in animal models. On the other hand, site-specific mutagenesis studies
involving full-length clones of lineage 2 strains could clarify further possible genetic markers for
the virulence of WNV. The study of Botha et al. (2008) suggest several potential regions
(including NS5), however, specific loci were not identified yet.
Recent serological studies revealed that the since 2008 the lineage 2 WNV strain causes
widespread infections in the Hungarian horse populations (10 to 70% seropositivity in different
studs), although most of the infections did not manifest in CNS symptoms. Specific antibodies
were also find is several wild bird species, without apparent mortality. These observations
indicate that besides the neuroinvasive and neurovirulent character of the virus, so-far
unidentified individual or species-specific factors of hosts also contribute the clinical outcome of
the disease. Immune suppression due to other infectious diseases or parasitic infection could
result in a state of vulnerability allowing neuroinvasion. Further studies on the pathogenesis of
the virus would be necessary to assess the risk of different WNV strains to the health of humans,
domestic and wild animals in WNV endemic regions.
22
22
V. REFERENCES
Anderson JF, Andreadis TG, Vossbrink CR, Tirrell S, Wakem EM, French RA, Garmendia AE,
van Kruiningen HJ. Isolation of West Nile virus from mosquitoes, crows, and a Cooper’s
hawk in Connecticut. Science. 1999; 286:2331-3.
Austgen LE, Bowen RA, Bunning ML, Davis BS, Mitchell CJ, Chang GJ. Experimental infection
of cats and dogs with West Nile virus. Emerg. Infect. Dis. 2004; 10:82-6.
Bakonyi T, Hubalek Z, Rudolf I, Nowotny N. Novel flavivirus or new lineage of West Nile virus,
central Europe. Emerg. Infect. Dis. 2005; 11:225-31.
Bakonyi T, Ivanics E, Erdelyi K, Ursu K, Ferenczi E, Weissenbock H, Nowotny N. Lineage 1
and 2 strains of encephalitic West Nile virus, central Europe. Emerg Infect Dis 2006; 12:618-
23.
Banet-Noach C, Simanov L, Malkinson M. Direct (non-vector) transmission of West Nile virus
in geese. Avian Pathol. 2003; 32:489-94.
Beasley DW, Li L, Suderman MT, Barrett AD. Mouse neuroinvasive phenotype of West Nile
virus strains varies depending upon virus genotype. Virology. 2002; 296:17-23.
Beasley DWC, Whiteman MC, Zhang S, Huang CYH, Scheider BS, Smith DR, Gromowski GD,
Higgs S, Kinney RM, Barret ADT. Journal of Virology, 2005; 79:8339-47
Berthet FX, Zeller HG, Drouet MT, Rauzier J, Digoutte JP, Deubel V. Extensive nucleotide
changes and deletions within the envelope glycoprotein gene of Euro-African West Nile
viruses. J. Gen. Virol. 1997; 78:2293-7.
Blitvich BJ, Fernandez-Salas I, Contreras-Cordero JF, Marlenee NL, Gonzalez-Rojas JI, Komar
N, Gubler DJ, Calisher CH, Beaty BJ. Serologic evidence of West Nile virus infection in
horses, Coahuila State, Mexico. Emerg. Infect. Dis. 2003; 9:853-6.
Bondre VP, Jadi RS, Mishra AC, Yergolkar PN, Arankalle VA. West Nile virus isolates from
India: evidence for a distinct genetic lineage. J Gen Virol. 2007 Mar;88(Pt 3):875-84.
Botha EM, Markotter W, Wolfaardt M, Paweska JT, Swanepoel R, Palascios G, Nel LH, Venter
M. Genetic Determinants of Virulence in Pathogenic Lineage 2 West Nile Virus Strains.
Emerging Infectious Diseases 2008 Vol. 14, No. 2, 222-30.
23
23
Brault AC, Huang CYH, Langevin SA, Kinney RM, Bowen RA, Ramey WN, Panella NA,
Holmes EC, Powers AM, Miller BR. A single positively selected West Nile viral mutation
confers increased virogenesis in American crows. http://www.nature.com/naturegenetics
2007
Brault AC, Langevin SA, Bowen RA, Panella NA, Biggerstaff BJ, Miller BR, Komar N.
Differential Virulence of West Nile Strains for American Crows. Emerging Infectious
Diseases 2004 Vol.10, No.12
Calisher CH, Karabatos N, Dalrymple JM, Shope RE, Porterfield JS, Westerway EG, Brandt WE.
Antigenic relationships between flaviviruses as determined by cross-neutralisation tests
with polyclonal antisera. J. Gen. Virol. 1989; 70:37-43.
Castillo-Olivares J, Wood J. West Nile virus infection of horses. Vet. Res. 2004; 35:467-83.
Ceccaldi PE, Lucas M, Despres P. New insights on the neuropathology of West Nile virus. FEMS
Microbiol. Lett. 2004; 233:1-6.
Centers for Disease Control and Prevention (CDC). West Nile virus activity--United States, 2005.
MMWR Morb Mortal Wkly Rep. 2005; 54:678-9.
Chambers TJ, Havely M, Nestorowicz A, Rice CM, Lustig S. West Nile virus envelope proteins:
nuleotide sequence analysis of strains differing in mouse neuroinvasivness. Journal of
General Virology, 1998; 79:2375-80
Charrel RN, Brault AC, Gallian P, Lemasson JJ, Murgue B, Murri S, Pastorino B, Zeller H, de
Chesse R, de Micco P, de Lamballerie X. Evolutionary relationship between Old World
West Nile virus strains. Evidence for viral gene flow between Africa, the Middle East, and
Europe. Virology. 2003; 315:381-8.
Erdélyi K, Ursu K, Ferenczi E, Szeredi L, Rátz F, Skáre J, Bakonyi T. Clinical and pathologic
features of lineage 2 West Nile virus infections in birds of prey in Hungary. Vector Borne
Zoonotic Dis 2007; 7:181-188.
Ferenczi E, Rácz G, Faludi G, Czeglédi A, Mezey I, Berencsi Gy. Natural foci of viral zoonoses
in Hungary. NATO Science Series. 2005.
24
24
Garmendia AE, van Kruiningen HJ, French RA, Anderson JF, Andreadis TG, Kumar A, West
AB. Recovery and identification of West Nile virus from a hawk in winter. J Clin
Microbiol. 2000; 38:3110-1.
Giladi M, Metzkor-Cotter E, Martin DA, Siegman-Igra Y, Korczyn AD, Rosso R, Berger SA,
Campbell GL, Lanciotti RS. West Nile encephalitis in Israel, 1999: the New York
connection. Emerg. Infect. Dis. 2001; 7:654-8.
Glávits R, Ferenczi E, Ivanics É, Bakonyi T, Mató T, Zarka P, Palya V. Occurrence of West Nile
Fever in a circovirus infected goose flock in Hungary. Avian Pathol. 2005; 43:408-14.
Hayes CG. West Nile fever. In: Monath TP (ed) The arboviruses: epidemiology and ecology, vol.
V. 1989; CRC Press, Boca Raton, FL, pp 59–88.
Hayes EB, Komar N, Nasci RS, Montgomery SP, O’leary DR, Campbell GL. Epidemiology and
Transmission Dynamics of West Nile Virus Disease. Emerging Infectious Diseases 2005a
Vol. 11, No. 8, 1167-73
Hayes EB, Sejvar JJ, Zaki SR, Lanciotti RS, Bode AV, Campbell GL. Virology, Pathology, and
Clinical Manifestations of West Nile Virus Disease. Emerging Infectious Diseases 2005b
Vol. 11, No. 8, 1174-79
Heinz FX, Collett MS, Purcell RH, Gould EA, Howard CR, Houghton M, Moormann RJ, Rice
CM, Thiel HJ. Family Flaviviridae In: van Regenmortel MHV, Faquet, CM, Bishop, DHL
editors. Virus Taxonomy, Seventh International Committee for the Taxonomy of Viruses.
San Diego: Academic Press; 2000. p. 859–78.
Hubálek Z, Halouzka J. West Nile fever--a reemerging mosquito-borne viral disease in Europe.
Emerg. Infect. Dis. 1999; 5:643-50.
Hubálek Z. European experience with the West Nile virus ecology and epidemiology: could it be
relevant for the New World? Viral. Immunol. 2000; 13:415-26.
Koller M, Gresikova M, Berencsi Gy, Schablik M. Hemagglutination inhibition antibodies to
arboviruses in the population of Hajdú-Bihar district, Hungary. Folia Parasitologica. 1969;
16:75-9.
Komar N. West Nile virus: epidemiology and ecology in North America. Adv Virus Res.
2003;61:185-234.
25
25
Komar N, Langevin S, Hinten S, Nemeth N, Edwards E, Hettler D, Davis B, Bowen R, Bunning
M. Experimental infection of North American birds with the New York 1999 strain of West
Nile virus. Emerg. Infect. Dis. 2003; 9:311-22.
Kramer LD, Bernard KA. West Nile virus infection in birds and mammals. Ann. N. Y. Acad. Sci.
2001; 951:84-93.
Kuno G, Chang GJ, Tsuchiya KR, Karabatsos N, Cropp CB. Phylogeny of the genus Flavivirus.
J. Virol. 1998; 72:73-83.
Lanciotti RS, Ebel GD, Deubel V, Kerst AJ, Murri S, Meyer R, Bowen M, McKinney N, Morrill
WE, Crabtree MB, Kramer LD, Roehrig JT. Complete genome sequences and phylogenetic
analysis of West Nile virus strains isolated from the United States, Europe, and the Middle
East. Virology. 2002; 298:96-105.
Langevin SA, Brault AC, Panella NA, Bowen RA, Komar N. Variation in Virulence of West Nile
virus strains for house sparrows (Passer domesticus) Am. J. Trop. Med Hyg., 2005, 72(1),
99-102
Liu WJ, Wang XJ, Clark DC, Lobigs M, Lobigs M, Hall RA, Khromykh AA. A Single Amino
Acid Sunstitution in the West Nile Virus Nonstructural Protein NS2A Disables its ability to
Onhibit Alpha/Beta Interferon Induction and Attenuates Virus Virulence in Mice. American
Society of Microbiology. 2006, Vol. 80, No. 5, 2396- 2404.
Melnick JL, Paul JR, Riordan JT, Barnett VH, Goldblum N, Zabin E. Isolation from human sera
in Egypt of a virus apparently identical to West Nile virus. Proc. Soc. Exp. Biol. Med. 1951;
77:661-665.
Molnár E. Occurence of tick-borne encephalitis and other arboviruses in Hungary. Geographia
Medica. 1982; 12:78-120.
Porter MB, Long MT, Getman LM, Giguere S, MacKay RJ, Lester GD, Alleman AR, Wamsley
HL, Franklin RP, Jacks S, Buergelt CD, Detrisac CJ. West Nile virus encephalomyelitis in
horses: 46 cases (2001). J. Am. Vet. Med. Assoc. 2003; 222:1241-7.
Rice CM, Lenches EM, Eddy SR, Shin SJ, Sheets RL, Strauss JH. Nucleotide sequence of yellow
fever virus: Implications for flavivirus gene expression and evolution. Science. 1985;
229:726–33.
26
26
Rice CM, Strauss EG, Strauss JH. Structure of the flavivirus genome. In: Schlesinger, S.,
Schlesinger, M.J. (Eds.), The Togaviridae and Flaviviridae. 1986; Plenum Press, New York,
pp. 279–326.
Sampson BA, Ambrosi C, Charlot A, Reiber K, Veress JF, Armbrustmacher V. The pathology of
human West Nile Virus infection. Hum. Pathol. 2000; 31:527-31.
Shirato K, Miyoshi H, Goto M, Ako Y, Ueki T, Kariwa H, Takashima I. Viral evelope protein
glycosylation is a molecular determinant of the neuroinvasiveness of the New York strain
of West Nile virus. Journal of General Virology 2004; 85:3637-45
Smithburn KC, Hughes TP, Burke AW, Paul JH. A neurotropic virus isolated from the blood of a
native of Uganda. Am. J. Trop. Med. Hyg. 1940; 20:471
Smithburn KC. Differentiation of West Nile virus from the viruses of Saint Louis encephalitis
and Japanese B encephalitis. J. Immunol. 1942; 42:25-31.
Taylor RM, Work TH, Hurlbut HS, Rizk F. A study of the ecology of West Nile virus in Egypt.
Am. J. Trop. Med. Hyg. 1956; 5:579-620.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 1997; 25:4876-82.
Wang T, Town T, Alexopoulou L, Anderson JF, Fikrig E, Flavell RA. Toll-like receptor 3
mediates West Nile virus entr into the brain causing lethal encephalitis. Nat Med.
2004;10:1366-73
Watson JT, Pertel PE, Jones RC, Siston AM, Paul WS, Austin CC, Gerber SI. Clinical
characteristics and functional outcomes of West Nile Fever. Ann. Intern. Med. 2004;
141:360-5.
Weissenböck H, Kolodziejek J, Url A, Lussy H, Rebel-Bauder B, Nowotny N. Emergence of
Usutu virus, an African mosquito-borne flavivirus of the Japanese encephalitis virus group,
central Europe. Emerg. Infect. Dis. 2002; 8:652-6.
Zeller HG, Schuffenecker I. West Nile virus: an overview of its spread in Europe and the
Mediterranean basin in contrast to its spread in the Americas. Eur. J. Clin. Microbiol. Infect.
Dis. 2004; 23:147-56.
27
27
VI. SUMMARY
West Nile virus (WNV) is a mosquito borne flavivirus, which is widespread over the World.
WNV infections may cause febrile illnesses (West Nile fever), and in several cases neurological
diseases, with symptoms neck stiffness, ataxia, tremor, muscle weakness, convulsions and
paralysis develops. Encephalitic WNV infections are frequently lethal. The natural hosts of WNV
are wild birds, and the infection is mainly transmitted by culicide mosquito vectors. Mammals are
incidental, dead-end hosts; horses and humans show most frequently symptoms, however
neurological disease was also reported in several other species. Two main genetic lineages of
WNV exist. Lineage 1 is widespread, while lineage 2 was previously present only in Africa. In
2004 a lineage 2 WNV strain emerged in Hungary, caused encephalitis in a Goshawk (Accipiter
gentilis). The strain became resident in Hungary and caused encephalitis in birds and in mammals
(sheep, horse, human) in the subsequent years.
Genetic studies on lineage 1 WNV strains identified genetic markers, which may influence the
virulence and the neuroinvasive / neurovirulent phenotype of WNV. The aim of this study was to
determine the partial nucleotide sequence of a Hungarian WNV strain, which was isolated from
an encephalitic horse case in 2007, and to compare the differences of the putative amino acid
sequences of thee strains (lineage 1: Horse - New York -1999; and lineage 2: goshawk - Hungary
- 2004 and horse - Hungary - 2007) at the suspected virulence marker loci.
The study revealed that at the suspected virulence markers of the E protein region (glycosylations
sites) and at the NS2A region the neuroinvasive lineage 1 and 2 strains contain identical amino
acids. At the NS3 region, however, the amino acids differ at the suggested virulence-associated
loci; therefore in lineage 2 viruses these markers are not influencing the neuroinvasiveness.
28
28
VII. ÖSSZEFOGLALÁS
A Nyugat-nílusi vírus (West Nile virus, WNV) egy szúnyogok által terjesztett flavivírus, amely
világszerte előfordul. WNV fertőzés hatására lázas betegség alakulhat ki (Nyugat-nílusi láz), és
bizonyos esetekben idegrendszeri tünetek (tarkómerevség, ataxia, remegés, izomgyengeség,
görcsök, kóma) is megjelennek. A WNV okozta agyvelőgyulladásos esetek jelentős része halálos
kimenetelű. A vírus természetes gazdái vadmadarak, a terjesztésében főként Culex nemzetségbe
tartozó szúnyogok vesznek részt. Az emlősök alkalmi gazdák, nem terjesztői a vírusnak.
Leggyakrabban lovak és emberek mutatnak tüneteket, de számos más fajban is leírtak már WNV
okozta agyvelőgyulladást. A vírusnak két fő genetikai vonala van. Az 1-es vonalhoz világszerte
előforduló vírusok tartoznak, 2-es genetikai vonalhoz tartozó vírust viszont korábban csak
Afrikában találtak. Egy 2-es vonalhoz tartozó törzs bukkant fel 2004-ben Magyarországon és
okozott agyvelőgyulladást héjában (Accipiter gentilis). Következő években a vírus megtelepedett
az országban és agyvelőgyulladásos eseteket okozott madarakban és emlősökben (juhban, lóban,
emberben).
A vírus neuroinvazív tulajdonságát 1-es vonalba tartozó törzseknél vizsgálták és genetikai
markereket írtak le. Jelen vizsgálatok célja az volt, hogy a 2007-es hazai ló agyvelőgyulladásos
esetből kimutatott és a 2004-ben héjában felbukkant vírustörzsek származtatott nukleotid és
aminosav szekvenciáit összehasonlítsuk az 1999-ben New Yorkban lóból izolált víruséval a
feltételezett virulencia-markerek területén. A vizsgálatok eredményei alátámasztják az E fehérje
glikolizációs helyeinek és az NS2A fehérje egyes lókuszainak feltételezett szerepét, viszont az
NS3 régióban tapasztaltak eltérnek a különböző genetikai vonalú WNV törzsek esetén.
29
29