Post on 30-Jan-2017
Land Conflicts, Property Rights and the Rise of the
Export Economy in Colombia, 1850–1925.*
Fabio Sánchez Torres, School of Economics, Universidad de los Andes,
Calle 19ª # 1-37E, Bloque C, Bogotá, D.C. Colombia, fasanche@uniandes.edu.co1
Antonella Fazio Vargas, School of Economics, Universidad de los Andes,
Calle 19ª # 1-37E, Bloque C, Bogotá, D.C. Colombia, a-fazio@uniandes.edu.co2
María del Pilar López-Uribe, School of Economics, Universidad de los Andes,
Calle 19ª # 1-37E, Bloque C, Bogotá, D.C. Colombia, del-lope@uniandes.edu.co3
Land Conflicts, Property Rights and the Rise of the
* We are grateful to Enrique López, Jorge Orlando Melo, Jose Antonio Ocampo and the participants of the
CEDE´s seminar for their valuable observations. We would also like to thank Diego Jaramillo, Booris
Piraneque and Diana Rocha for their excellent work as research assistants. The authors appreciate the useful
and insightful referees´ and editor’s comments that certainly contributed to improve our research.
1 Full Professor, Universidad de los Andes, Bogotá.
2 Researcher at CEDE, Universidad de los Andes, Bogotá.
3 Researcher at CEDE – Instructor Professor, Universidad de los Andes, Bogotá. 1
Export Economy in Colombia, 1850–1925.
Abstract
This research attempts to explain the poor performance of the Colombian economy in the
world markets during the late nineteenth century. Based on data on production of
agricultural exports at county (municipal) level in 1892, coffee production in 1925 and of
public land allocation and land conflicts during the nineteenth and twentieth century, we
found that one of the greatest obstacles that faced Colombian export development was the
weakness of settlers’ property rights in the frontier lands. The quantitative results show
that in the absence of land conflicts, the per capita production of agricultural exports would
have been at least twice as much as that observed.
Introduction
The export performance of Colombia during the wave of globalization at the end of the
nineteenth century was extremely poor. Per capita exports reached only US $6.0, the
second worst performance in Latin America after Haiti and barely one tenth of the per
capita exports by Argentina or Brazil. The Colombian economy’s weak integration into
the world markets at the end of the nineteenth century was ultimately the result of the
weakness of settlers’ formal property rights in the frontier lands.
National legislation on public land allocation adapted to the boom in world demand for
primary products, facilitating land titling and protecting the peasant settlers from large
landowners´ encroachments. However, the de facto power of the large landowners and the
high transaction costs of titling land prevented all but a few peasant settlers from acquiring
formal property titles. The lack of formal property rights on the frontier together with
opportunities of higher revenue from exports of primary goods caused the emergence of 2
land conflicts4 at the turn of the twentieth century. The property rights disputes between
peasant settlers and landowners, in turn, led to a level of exportable production much lower
than its potential5.
The Colombian economy during the nineteenth century
The post Independence Colombian economy was deeply rooted in its colonial past and
inherited most of its features6. The structures of taxation, the foreign and domestic trade
and the labor force in the nineteenth century were quite similar to those of the Borbonic
period at the end of the eighteenth century. Nearly eighty percent of exports were precious
metals whose revenues were used to import mainly consumption goods, which were taxed
to provide most of the Government’s income. Thus, public finances were weak and
depended mainly on customs that made up more than fifty percent of public revenue7.
Only a small percentage of workers were free, and those workers were primarily located in
urban centers. The rest worked in the Haciendas under non-wage arrangements as
sharecroppers, tenants, peons or domestic laborers8 .
In the middle of the nineteenth century, the Colombian economy started to break free from
its colonial structure. Liberal administrations from 1850 to 1880 implemented several
reforms. They abolished slavery, began expropriating and publicly auctioning
disentailment of Church lands, passed legislation on public land settlements, eliminated
4 The conflicts are defined as the peasant settlers’ petitions to national authorities to restore their lands
invaded or encroached by large landowners.
5 Exportable production comprised the agricultural goods produced to be sold in the international markets.
6 Ocampo, Colombia y la Economía Mundial, 1830-1910.
7 Ibíd.,
8 Ocampo, Colombia y la Economía Mundial, 1830-1910, Tovar, Grandes empresas agrícolas y Ganaderas. 3
colonial taxes on aguardiente and tobacco, and no longer demanded tithes and fifths9 . In
addition, Colombia became a federal Republic (the United States of Colombia) and
adopted free trade policies (librecambio). The Conservative party gained the presidency in
1886 and remained in power until 1930. Under the Conservatives’ rule the federal
Republic was abolished, the country turned back to centralism, the Catholic Church
recovered their privileges, and the trade policy became more protectionist. At the end of
the nineteenth century Colombia underwent the One Thousand Days War (1898-1902), a
bloody civil conflict between liberals and conservatives.
During the second half of the nineteenth century, foreign trade expanded and diversified.
Precious metals as a share of exports fell, as exports of new products-- tobacco, coffee,
quinine, indigo and leather--augmented. Between 1850 and 1880 exports grew on average
four percent per year, prompting the expansion of river navigation and shipping, road
construction and banking10. Nevertheless, Colombia did not develop a stable export base
because successful export of most of the new products rose during the booms and
disappeared once they ended.
Only coffee became a major export in the long run, rising from an export share of
eight percent in 1860 to 12 percent circa 1880 to 50 percent around 1900 and 79 percent
by the mid-1920s11. Coffee remained the chief export throughout the twentieth century.
The increase of coffee production triggered the expansion of the agrarian frontier. Between
1885 and 1896 a 50 percent rise of international coffee prices spurred a movement from
the eastern regions into the central and western areas of the country, as can be seen in Map
9 Díaz, La desamortización de bienes eclesiásticos en Boyacá, Ocampo, Colombia y la Economía Mundial,
1830-1910.
10 Ocampo, Colombia y la Economía Mundial, 1830-1910.
11 GRECO, El Crecimiento Colombiano en el Siglo XX.4
1. Coffee prices halved between 1896 and 1900, ending the coffee boom, while the
fighting during the Thousand Days War disrupted harvests and exports.12 After the civil
war ended in 1902, coffee production steadily increased until the crisis of 1929. During
that expansion, the colonization of public lands in the Colombian west intensified, as
shown by the expansion of coffee production in Map 1.
The economic globalization between1850 to 1912 stimulated exports from Latin
America.13 However, Colombia’s export growth during the period was 3.5 percent, below
the average of 3.9 percent for Latin America as a whole. In 1913 Colombia’s exports of $6
per capita were among the lowest in Latin America, well below the Latin American
average of $2414. The traditional view states that price cycles and limited linkages to the
world trade circuits were the main causes of Colombia’s slow export development during
the second half of the nineteenth century.15 According to this view, Colombia exhibited
high vulnerability to the world demand cycles and was one of the Latin American countries
in which the exports gains prompted by booms were almost completely annulled during
busts. In addition, as Colombia did not become an important supplier of raw material for
12 Ocampo, Colombia y la Economía Mundial, p. 114.
13 O’Rourke and Williamson, Globalization and History. According to Madisson, at 1990 prices, world
exports rose from 7,300 million dollars in 1820 to 56,200 million in 1870, 236,300 million in 1913 and
334,400 in 1929, Maddison, Monitoring the World Economy, 1820–1992.
14 Bulmer-Thomas, The economic History of Latin America since independence. Cardoso and Pérez, Historia
Económica de América Latina.
15 The export producers did have in mind the creation of a stable export base but just to obtain easy profits as
international prices remained high. As soon as prices fell the producers abandoned their export activities.
Thus, no relationship or connections were developed between the export sector and the rest of the economy
impeding at the same time the consolidation of sectors that may have enhanced export competitiveness.
These hypotheses were called “production-speculation” and “lottery of goods”, Ocampo, Colombia y la
Economía Mundial; Bulmer-Thomas, The economic History of Latin America since independence. 5
the European manufacturing industries she was not attractive to immigrants or foreign
investors which in consequence reinforced her exporting backwardness. We offer a
supply-side complement to that explanation. The weakness of land property rights and
consequent conflict over the rights made it difficult for Colombia to take advantage of the
export opportunities available to them.
Land supply and property rights at the frontier
Population growth from two five million people between 1851 and 1913 prompted
the occupation of the vacant lands (baldios) in agrarian frontier areas. After Independence
in 1819 and more intensely after 1850, the national Government began granting public
lands or baldíos. Before the 1870s, property rights in these frontier lands were in general
weakly defined as informal agreements established the boundaries of the settlers’ terrains.
Little more was needed because the frontier land was abundant and economic opportunities
from land were limited. However, the expansion of world markets after 1870 offered new
economic prospects to producers of primary goods in the periphery as land prices in the
New World increased.16 For instance, the notary data on land sales for the Department of
Cundinamarca show that the price per fanegada (0.66 hectares) rose by more than 200
percent between the 1850s and the end of the century.17 As the demand for land rose,
agrarian producers sought more formal property rights that would allow them to take full
advantage of the opportunities offered by the world markets.18
16 An example of these new opportunities at the world level is the drastic increase in land prices in the
different regions of the world. O’Rourke and Williamson show that between 1870 and 1910 the price of land
increased by 250% in the United States, O’Rourke and Williamson, Globalization and History.
17 Sánchez et al., Precios de la Tierra en Cundinamarca.
18 The new economic opportunities brought about greater scarcity of land. Following Demsetz it was needed
the emergence of new property rights in order to internalize the new benefit-cost possibilities for land 6
Peasant settlers faced many obstacles to establishing formal title to the land they
occupied. Titling was costly since it involved hiring lawyers and surveyors, and
establishing fencing. Further, local large landowners (terratenientes) were powerful and
used every tool at their disposal to prevent land titling to peasants.19 On many occasions
big landowners successfully claimed the terrain already occupied by peasants. The
peasants responded by trying to remain on the land and farming it themselves. These
conflicts were stimulated by the weakness and instability of formal property rights in the
frontier in a context of expected higher land returns.20
According to LeGrand, there were two phases of legislation on public land allocation
during the nineteenth century. During the first phase from 1820 to 1873, the government
sought primarily to cover the expenses of the war of Independence.21 The central
“Increase internalization results from changes…stem from new technology and the opening of new markets,
changes to which old property rights are poorly attuned”, Demsetz, “Toward a Theory of Property Rigths” p.
350.
19 LeGrand, Colonización y Protesta Campesina.
20 Several incidents of large landowner’s encroachment have been described by historians. Tovar used
archival evidence to show that the practice of big landowners of claiming terrains already in hands of
peasants was quite common. For instance, in 1880 near Cauca River Mr. Máximo Duque attempted to take
crops and shacks from 80 families who had been living there for at least 5 five years, some for as many as 50
years. The peasants demanded that the government suspend the legal actions that Mr. Duque undertook
against them, Tovar, Que nos tengan en cuenta, p.108-109.
21 LeGrand, Colonización y Protesta Campesina. The expenses of independence included both internal and
foreign debts and payments to war veterans, their creditors or legitimate children, who were compensated
with lands of approximately 10 hectares, Parsons, La colonización antioqueña en el occidente colombiano.
According to Palacios until 1873 the main usage of baldios was to serve as collateral of the Colombia’s
foreign debt, Palacios, El café en Colombia, 1850-1970. Una historia economica, social y politica7
government issued bonds that were exchanged for or redeemable in public lands.22 This
policy meant that most of the public lands were allocated to rich businessmen and big
landowners. After 1873, land titling policy was redirected to bring it more in line with the
economic changes ignited by the growth in the export economy. Thus, law 61 of 1874 and
law 48 of 1882 established that settlers who occupied terrains for five years or more and
made productive use of them would be awarded property titles.23 The legislation limited as
well the concentration and unproductive use of the land. For instance, Law 48 of 1882
established that the maximum allocation would be 5,000 hectares. In 1912 it was reduced
to 2,500. The law also determined that if the land remained unproductive for more than ten
years, it would return to government’s hands24. However, the titling process typically
involved surveyors and lawyers’ fees, headed paper, stamps charges and property
registration, and the central government was not effective at enforcing land laws at the
22 The Colombian Congress issued certificates of public debt redeemable in public lands. “Such certificates
were used to back the national debt, to pay veterans of the Independence wars and to subsidize the
construction of roads and railroads. Once distributed the land certificates did not have to be exchanged for
land but could be freely bought and sold” LeGrand, Colonización y Protesta Campesina, p. 11.
23 LeGrand mentions that the legislation protected the settlers, guaranteeing them the property rights of any
baldíos they took over, thus preventing their expulsion from the lands that they occupied. Articles 2, 5 and 6
from law 48 of 1882 are examples of such legal protection. Article 2 indicated that the land cultivators
would be considered “good faith” owners and therefore could not be deprived of the property unless a
sentence ruled otherwise. Article 5 declared that should there be a case in which the cultivator lost the
property through a ruling, he could not have the land he occupied taken from him until he was compensated
with the value of the improvements he had made to the land. Lastly, article 6 stipulated that the agents of the
public Ministry must support the cultivators of baldíos in any case of land dispute against them.
24 LeGrand, Colonización y Protesta Campesina; Parsons, La Colonización Antioqueña; Brew, El Desarrollo
Económico en Antioquia. 8
local level.25 As a result, many settlers on the frontier decided not to pay the high
transactions costs and did not establish formal property rights to the land they settled.26 In
an environment of growing economic opportunities for agricultural activities, the
interaction between the settlers’ informal rights and the increase in the land returns and
export prices led to land conflicts.27
Policies to liberalize access to land during the second half of the nineteenth century
were implemented by the liberal party administrations to promote economic progress.
The government expanded the land available for economic exploitation by granting or
selling public lands (baldios), disentailing (expropriating and selling) church goods and
dissolving indigenous territories or communal lands (resguardos). Thus, between 1850
and 1930 land policies distributed nearly 6 percent of the inhabited Colombian territory
that belonged to the State to private owners.
The titling of public land followed the cycles in export prices as shown in Figure 1.
Before 1850 only about twenty square kilometers per year were titled. The titling rose to
25 LeGrand, Colonización y Protesta Campesina.
26 “By law, every applicant for a public land grant had to hire a surveyor to measure the territory. If the parcel
was less than fifty hectares in size, the surveying costs generally exceeded the market value of the land itself.
The settler also had to pay travel costs of witnesses and local authorities from the municipal seat to the site of
the claim and back” LeGrand, Colonización y Protesta Campesina, p.30. Once the settler completed at least
five years as squatters several steps were needed to finish the titling process: a) hiring a surveyor to measure
the terrains and a lawyer to fill the request’s paperwork ; b) mailing or taking the application to the nearest
town with judiciary authorities; c) having the authority’s approval after visiting the terrains; d) paying the
property registration if approval was given. Palacios also states that sometimes the legal procedure to title a
terrain was more expensive than the terrain itself. In addition, the frequent changes in the government entities
in charge of handling baldios also contributed to curbe titling for peasants. Palacios, El café en Colombia,
1850-1970.
27 Alston et al.,“Violence and the development of property rights”, p. 152.9
ninety square kilometers from 1850 to 1865 as the export economy grew and export prices
rose. During the quinine and tobacco export booms of the 1870s land granting sky-
rocketed to nearly 4,000 square kilometers per year as the export price index rose from 300
to over 400.28 After a reduction in titling in the early 1880s, a new rise in export prices and
export growth led titling to a new peak of 3,000 square kilometer in 1891-1895.29 Land
titling reached their lowest level, right after the Thousand Days War in 1901-1905 and then
rose to its highest levels during the early 1920s.
Figure 1 also presents the number of public land grants, which did not always follow the
pattern for land titling. Before 1900 the rise of the number of titles coincided with the
increase of the amount of land titled. In contrast, during 1900-1915 as the number of land
titles increased, the quantity of land titled grew at a slower pace, implying a reduction in
the size of the lots titled
According to Table 1 during 1853–1873, 61 percent (318) of the titling allotments
were comprised of land granted to peasant settlers (a titulo de cultivador) and 39 percent
(206) to public land sales through bonds to big landowners. The average of 25.8 square
kilometers (around 6400 acres) of land per title was for the land acquired by bonds was
much higher than the 5,1 average (around 1260 acres) for titles allotted to peasants
(cultivadores) through free grants. The peasant allotments seem rather large which may
suggest that those that decided to obtain formal titles were relatively well off and willing to
pay the high transaction costs the process involved. From 1874 to 1892, when legislation
was more favorable to squatters, 68 percent (413) of land allotments were granted to them, 28 The existing data show that the quantity of land granted between 1827 and 1850 was low, since the
government did not encourage as much the colonization of frontier lands. In fact, land sales were rather
regarded as a source of fiscal revenue, LeGrand, Colonización y Protesta Campesina.
29 According to LeGrand, with the extinction of the tobacco and quinine boom, the granting process slowed
down until the beginning of the coffee boom, LeGrand, Colonización y Protesta Campesina, p. 72.10
but the average amount of land per title was smaller at 4.6 square kilometers. Hence,
despite national government policies intended to favor and to attract those who would
occupy small parcels, most of the land titled ended up in large private buyers’ hands.
As table 1 shows from 1893 to 1917 the titling activity intensified particularly to
peasant settlers that obtained 82% (1479) of the total allotments (1803). In addition, the
average size of the plots both for large landowners and peasant settlers diminished to 12
(from 21.7) and to 2.9 (from 4.6) square kilometers respectively in compliance with the
Law that limited the maximum lot size to 25. From 1918 to 1930 titling was relatively more
moderate although the average lot size rose. It was precisely during the late nineteenth and
the early twentieth centuries when export agriculture experienced a vast geographical
expansion as the number of coffee municipalities jumped from 200 in 1892 to 387 in 1925.
Export Economy, Public Land Allotments and Conflicts
The largest part of the export agriculture in particular coffee located itself in the frontier
areas. Figure 2a evidences such relationship at departmental (state) level showing the high
correlation between the share of 1925 coffee production and share of public land
allotments30. It is observed that Antioquia, Valle and Norte de Santander were the leading
coffee producers and received from during the nineteenth and early twentieth centuries the
highest proportion of public lands allotments.
The agrarian conflicts arose as a consequence of a slow titling process of public lands
occupied by peasant settlers in an environment of increasing opportunities of primary
export. As land values went up with the rise in export opportunities, peasant settlers
demanded more formal property rights over the land they settled, but the government was
slow to supply the titles. Meanwhile, large landowners increasingly sought to usurp the
30 Similar correlation is observed for 1892 export production. 11
land occupied by squatters on the frontier. Between 1827 and 1869, just one agrarian
conflict was registered. The number of conflicts then rose to 69 between 1870 and 1900,
as coffee increased its share of exports, as large landowners sought to expand their land
where they already had properties.31 A steep rise in coffee prices from 7 to 25.9 U.S. cents
between 1900 and 1929 coincided with a rise in land conflicts to 137 between 1901 and
1917 and 241 from 1918 to 193132.
Figure 2b depicts the relationship between the department’s shares in the total numbers of
land conflicts during 1850-1917 and in the total amount of public land allotments
indicating that frontier expansion and agrarian conflicts are positively correlated. Figure 2b
suggests that in some regions the occupation of new territories brought about relatively less
disputes than in others implying that some areas had better provision of formal property
rights.
Two factors impeded a wide spreading of formal property rights among squatters:
the high cost of titling and the central government’s low capacity to enforce land laws and
to effectively provide titles at local level. These factors facilitated large landowners to
appropriate for themselves encroached peasants’ terrains33. Land conflict and inadequate 31 About 63 percent of the land conflicts occurred in municipalities where land was allotted to big landowners
through bonds. Calculations based on Gaceta Oficial (1854, 1856, 1858–1861), Registro Oficial (1862–
1864), Diario Oficial (1865–1931) and LeGrand, Colonización y Protesta Campesina.
32 LeGrand, Colonización y Protesta Campesina.
33 Alston et al. show how the agrarian polices during the 1980s in Brazil may have given incentives both
squatters and farmers to engage in violence. For instance, the fact that the Brazilian government would
expropriate private idle farms in favor of the landless peasants could have induced them to invade those
farms beforehand. At the same time, if the farmers requested the eviction of the invaders the final outcome
was higher violence, Alston et. al “ A Model of rural conflict” . In the Colombian case during the nineteenth
century the titling policy could have encouraged big landowners to usurp untitled peasant terrains expecting
to obtain for them the formal land titles. Landowners had in their favor both their ability to influence local 12
specification of property rights make investment in production of exports more difficult.
Hence, it is argued that such climate of property right insecurity contributed quite
negatively to Colombia’s performance in the world markets at the end of the nineteenth
century and even to long-term export performance in the twentieth century. In
consequence, regions with greater government supply of property rights land conflicts
could have been prevented and the export production should have performed better.
Nevertheless, as conflicts were more likely to emerge in regions where agricultural
production and expected returns on land were relatively high their probable endogeneity
should be corrected. The empirical test of this hypothesis and the identification strategy
will be presented in the next section.
Empirical model
The econometric strategy seeks to show the link between the production of agricultural
exports and the weakness of property rights, expressed as the presence of land conflicts at
the county (municipal) level. For this, the following model is estimated:
where Yji is the dependent variable measured in three ways: the natural logarithm of
municipal per capita value of exports (in pesos of 1892), per capita value of coffee
production (in pesos of 1892), or the number of per capita county (municipal) coffee trees
in 1925. For 1892, the value of per capita exports is calculated by multiplying the
production of each export product--tobacco, coffee, sugar, cacao and plantain—by their
domestic average price.
authorities and their capacity to finance a lengthy and expensive judicial process.
13
PhysicalGeographyi is a vector that includes measures of altitude, soil fertility,
precipitation, rivers in kilometers, temperature, humidity, distances to the Pacific and
Atlantic oceans and the distance to the Cauca River; DistancetoMarketsi is the distance of
each county to Bogota as the main administrative and economic center of Colombia.
Landsupplyi is a vector with the variables describing areas where took place
dissolution of indigenous communal lands during the eighteenth century, church land
disentailments from 1864 to 1884 and public land titling from 1830 to 1917. Titling
granting in a particular county indicates that frontier expansion indeed occurred there. In
fact, the first squatters may have settled years and even decades before the first titling
process occurred. The three types of land supply expansion not only influenced (positively
o negatively) production of exports in the county where they happened, but also in the
neighboring ones. In this regard, as most of the production of exports located themselves in
counties with public land allotments it is expected that some spillovers of the cropping
know-how may have transmitted to the neighboring counties. Likewise, if the agricultural
know-how was associated with traditional crops usually grown in the former indigenous
lands the spillover effect on agricultural exports was expected to be negative. In order to
observe such a spatial effect, we calculated three variables: “public land influence, 1850–
1892”, “ disentailment influence” and “dissolution of communal land influence.” Each
variable takes the value of one in a county where their existence is reported and zero if the
county is located more than 100 kilometers away from any county that had that type of
land expansion. If the county did not report that type of land expansion and is located
within 100 kilometers, it is given a value of ((100 – distance)/100)2, where distance is the
14
number of kilometers to the nearest county that reported the type of expansion was
assigned to it34.
Production1851i is a vector of dummy variables for the production of sugar, tobacco,
cacao, plantain and coffee in county i in 1851. We include this vector as it is expected that
a county that in the past had produced exports products was more likely to produce them
again if new market opportunities would arise. As Colombia exported during the
nineteenth century more tobacco than plantain or sugar in the counties with tobacco crops
in 1851 there was surely better knowledge of the export business. In this regard, different
crop production in 1851 would have different effects on export production in 1892 and
1925.
LandConflicti takes a value of 1 if any land conflicts occurred between 1827 and
1917 and 0 if not. As observed, the time span for land conflicts goes beyond 1892 the year
of production census on which one of the econometric exercises will be performed. In fact,
the report of land conflict to a Colombian court showed a) the lack of formal titles over a
terrain settled by peasants; b) that the terrain had been encroached by big landowners and
c) that the peasants attempted to restitute it for themselves through a legal process. In
consequence, property rights had been weak and quarrels between peasants and big
landowners took place while agricultural production was probably below its potential years
before the lawsuit was actually filed35.
34 We tried with other distances and although results did not change significantly the best results were
obtained with 100 kilometers,
35 One example of the weakness of property rights and quarrels between peasants and landowners long
before the legal process of restitution started was the attempt in Espiritu Santo County (Antioquia) near
Cauca River of some big landowners to appropriate for themselves in 1880 terrains that had been in hands of
eighty peasant’s families for over more than fifty years. The peasant reported the usurpation attempts to the
Courts during the 1880s. Tovar, Que nos tengan en cuenta. Palacio for instance describes the several 15
We are interested in the measuring the causal effect of land conflict on export
production, but there is a potential problem with endogeneity because land conflict itself
was likely to rise in response to higher expected land returns associated with expanded
production of exportable goods. To control for potential endogeneity bias, we use an
instrumental variable method with “closeness to colonial institutions” as the identifying
instrument. Thus, the first-stage equation for land conflicts takes the following form:
where ClosenessColonialInstitutionsi is a measure of the central government’s influence in
county i.36 In the counties where colonial institutions existed, the central government
authority at the end of the nineteenth century was stronger and it could better enforce the
land laws and property rights at local level than in those where such authority was weak or
did not exist at all. To create the variable, we determined the location of the Encomiendas
in 1560 and the places with more than 20 slaves in 1800.37 We then constructed a distance
measure with value 1 if a county had both an Encomienda in 1560 and slaves in 1800. The
value is zero if the county was more than 100 kilometers distant from the closest
disputes between large landowners and peasant settlers in the coffee zone at the beginning of the twentieth
century some of which lasted 10 or more years. Palacios, El café en Colombia, 1850-1970, chapter 13.
36 Based on the visits of 1560 transcribed by Tovar, the Spaniards began to found “villages of Indians” in the
places with indigenous populations, as they needed to use them as a workforce, Tovar, No hay caciques ni
señores. Similarly, the slave population was used to work in economic activities, such as gold extraction,
domestic work in some urban centers or on the sugar or cotton plantations, Colmenares, Historia Ecónomica
y Social de Colombia. Hence, the existence of tributary Indians and of slaves reveals the presence of the
State and of the Spanish colonial institutions.
37 Tovar, Grandes Empresas Agrícolas y Ganaderas; Tovar et al., Convocatoria al Poder del Número.16
Encomienda and the closest slave area. To obtain the value for the remaining locations we
calculated the distance to the nearest Encomienda and the distance to the nearest slave area
and then used the following formula:38
There is evidence that the power of the central government in the 1800s was
stronger and its ability to provide land formal titles more effective in locations where
encomiendas in 1560 and slaves in 1800 were located. Further, the effectiveness of
enforcing property rights was lower as the distance from these colonial locations increased.
The locations with encomiendas and slave populations had long histories of close
monitoring by central authorities. During the conquest of Latin America the Spaniards
settled in places where the indigenous labor force was relatively abundant. In order to
allocate this labor force in mining and agriculture in the early 1500s, the Crown created the
Encomienda, which commended or entrusted a Spaniard and his heirs with the right to
38 The formula was taken from Naritomi, Soares and Assuncao, Rent Seeking and the Unveiling of “De
Facto” Institutions. “Closeness to Colonial Institutions” was derived from information provided by Duque y
Sánchez, Instituciones Coloniales e Instituciones Republicanas en el Desarrollo Económico Colombiano:
¿Cuáles Pesan Más?. So as to locate colonial sites, the authors used the information on tributary Indians
compiled by Tovar who transcribed the archival data on villages, and number of Indians and their Chiefs that
the Spanish Visitador registered in 1560 Tovar, No hay caciques ni señores. So as to localize the 1560
Encomienda sites in today’s municipalities and to georeference Tovar’s data we replicated the Visitador’s
route on the current Colombian map. Using the Geographical Diccionario of Colombia (IGAC, 1996) that
contains the toponymy of more 100 thousand places we matched the 1560 Indian settlements to each of the
current Colombian municipalities,. The same methodology was used for 1800 slave population compiled by
Tovar et al, Tovar et al, Convocatoria al Poder del Número. Censos y Estadísticas de la Nueva Granada,
1750–1830.17
extract tribute goods from a group of indigenous Colombians. The Spaniard was obliged
to Christianize the indigenous group and to pay taxes to the Crown on the goods extracted.
To monitor the proper functioning of the arrangement, the Spanish Crown sent visitors and
judges to determine the taxes to be paid and to enforce the legislation for the protection of
indigenous population. Hence, in the areas where Encomiendas existed compliance of law
was indeed stronger39.
Similarly, in zones with slaves descendant from Africans the Spanish Crown
granted privileges to exploit mining deposits and also limited and controlled the miners’
usage rights of deposits and nearby water sources. The authority regulated the mining
technology to be employed. Likewise, the Reales de Minas –villages inhabited by mining
slaves- were constantly visited by Crown’s officers who verified the observance of laws
and regulations regarding those settlements40. In both of these regions the Spanish Crown
or the local cabildos granted land titles and enforced property rights. In particular, the
central government discouraged the encroachment onto peasant settlers’ lands by
landowners, reducing the existence of conflicts. Since the types of exports in 1892 and
1925 were dramatically different from those in 1560 with the Encomienda or in mining
with slaves in 1800 these variables are suitable instruments.
Empirical Results
Table 2 shows the results of the empirical strategy. We use OLS and TSLS models to
explain the per capita levels of 1892 production of exports and of 1925 coffee production.
Columns 2 and 5 show the OLS results. The bias of the coefficient for conflict coefficient
39 Colmenares, Historia Económica y Social de Colombia, Burkholder and Johnson, Colonial Latin America.
40 Colmenares, Historia Económica y Social de Colombia.18
is expected to be positive because as export augmented so did land disputes. In fact, the
OLS coefficients for both years are not statistically different from zero. Columns 4 3-4 and
6-7 contain the first and second stage estimates for production of exports in 1892 and of
coffee production in 1925 respectively. Column 3 and 6 that the instrument for land
conflicts “closeness to colonial institutions” is negative and significant at 99 percent,
suggesting that counties with or close to colonial institutions in the past experienced a
lower probability of land conflicts at the end of the nineteenth century as property rights
were better defined. In those counties, the central government could more strongly enforce
the land laws and deter landowners’ encroachments41.
As expected both the closer to the markets –higher land returns but more formal
property rights- and the farther away from them –small land returns- the lower would be
the likelihood of land disputes. This result is maintained for 1892 and 1925 and is quite
important for the paper’s hypothesis since it indicates that whatever the impact of land
conflicts on production it will certainly capture only such effect. In other words, counties
located at the same distance to Bogotá would differ in production of exports depending
ceteris paribus upon land disputes.
Columns 4 and 7 of the same table exhibit the second stage results for production
of export in 1892 and of coffee in 1925. In both models land conflicts have a negative and
significant impact on the presence of exportable production. Thus, land conflicts lowered
agriculture for exports in 1892 and coffee in 1925 confirming that the weakness of
property rights contributed to the poor performance of the export economy and hence to
the meager integration of Colombia in the international markets at the end of the nineteenth
41 Although the variable land conflicts is dichotomous with values 0 and 1, the first stage values are predicted
with OLS. However, no predicted value is greater than 1 and 139 (out of 712) are lower than zero.
Nevertheless, only 11 predicted values are below –0.1.19
century42. As robustness check we also ran second stage models using the probit
predicted values of land conflicts obtaining coefficients similar to TSLS. After calculating
the bootstrapped standard errors the significance of the predicted land conflict coefficients
both for 1892 and 1925 was above 99% (See appendix 2)
As for the effects of other variables, public land allotments in a county increased in
0.6 log points (0.75 standard deviations) the production of exports in 1892 and in 1.26 log
points (0.57 standard deviations) coffee production in 1925. Alternatively, the existence of
disentailed Church assets raised agriculture of exports in 0.26 log points (0.32 standard
deviations) only for 1892 In contrast, dissolution of communal lands during the eighteenth
century impacted quite negatively (nearly 0.57 standard deviations) 1925 coffee production
as those lands turned into Haciendas strongly oriented to cattle raising and foodstuff crops
for the domestic market43.
This model specification allows testing the weakness of the instrument. The F-test
indicates that the null hypothesis that the instrument equation is weakly identified is
rejected as its value is 14.2 (p=0.0011). In addition, critical values for the Stock and Yogo
weak instrument test44 (5% significance) based on the TSLS size with exact identification
is 16.38 for the 10% size distortions and 8.96 for the 15%. The value for Cragg-Donald
weak identification test obtained is 14.2 very close to most stringent critical value. Thus,
the hypothesis of weak instrument is rejected (see table 2). Finally, the endogeneity tests
42 We also estimated instrumental variables probit and tobit models for presence and per capita level of export
agriculture. The results obtained for both estimation are similar to TSLS’s ones (see appendix 2).
43 The highland Haciendas produced mainly livestock and agricultural goods for the domestic markets
(potatoes, corn) The low lands Haciendas produced sugar cane for panela (a product derived form sugar cane
with high caloric contain) Tovar, Hacienda Colonial y Formación Social.
44 Stock and Yogo, “Testing for weak instruments in linear IV regression”. 20
both for 1892 and 1925 indicate that the land conflict variable is indeed endogenous and
should be instrumented.
In order to determine the impact of the conflicts on exportable agriculture we just
compare the mean values of Yij (the observed production with land disputes) against the Yij
–β5*LandConflicti (the production without land disputes). The result indicates that, in 1892
in absence of land conflicts per capita exportable production would have been twice as
much higher than the observed actual production. Thus, the average per capita exportable
output in 1892 was 1.77 pesos whereas in the absence of land conflicts it would have been
3.50 pesos. Likewise the average number of coffee trees in 1925was 62 while in the
absence of conflicts it would have been 31045.
In summary, the econometric results confirm the hypothesis that the poor
integration of the Colombian economy into the world market at the end of the nineteenth
century was to a large extent the result of the weakness of property rights in agrarian
frontier that prompted an important number of land conflicts. The peasant settlers’ lack of
land titles fed their fear of encroachment, which may have inhibited them from sowing or
increasing productivity to their highest potential. The limited transformation of informal
property rights into formal ones, more in line with the economic opportunities of
globalization, was one of the factors that heavily contributed to delay export development.
Thus land conflicts as manifestations of weak property rights affected production of
exports at the end of the nineteenth century and even more severely coffee production at
the beginning of the twentieth century. Hence, property rights institutions (or the lack of
45 Similar results are found if the calculations are carried out taken into account only counties with 1925
production greater than zero. In this case, average number of per capita coffee trees in absence of land
conflicts rises from 109 to 518.21
them) have a substantial effect on economic performance, as other research has extensively
confirmed46.
Conclusions
This article shows the relationship between the expansion of the agrarian frontier,
land conflicts and the production of exportable goods at the end of the nineteenth century.
It starts out with the hypothesis that land conflicts were the result of the combination of
economic opportunities offered by globalization and the lack of formal property rights on
the frontier. As large landowners had incentives to encroach on those lands that had been
occupied by peasant settlers the latter restrained themselves from sowing or investing,
which may have determined that the production of agricultural exports was below its
potential.
So as to correct the likely endogeneity of the “land conflicts” variable, we used as
instrument the average distance – standardized from 0 to 1 – between a county with no
colonial institutions and the nearest one that had colonial institutions (Encomienda in 1560
or more than 20 slaves in 1800). Our econometric evidence indicates that land conflicts
had a negative effect on the potential production of exports. In fact, it is estimated that, in
the absence of land conflict, production of exports in 1892 could have been two times
larger. For the 1925 coffee production the negative effect was even more critical. Other
results indicate the existence of a positive and strong relationship between the production
of exportable goods and allotments of public lands.
46 Acemoglu and Johnson contrast the effect of the contracting institutions with the property rights
institutions and they find that the latter affect the most countries’ long-term economic performance, either
measured by income per capita or by the rate of investment, Acemoglu and Johnson, “Unbundling
Institutions”. 22
This article concludes that internal factors, namely the informal structure of
property rights on the frontier areas and the central government’s incapacity to restrict the
encroaching behavior of the landowners, significantly curbed the Colombian export
development during the late nineteenth and early twentieth centuries.
Appendix 1
Variable Definition Source
Production of
exportable products
per capita (Log
1892)
Logarithm of the value of the production of exportable
products that includes coffee, cacao, sugar, plantain and
tobacco in 1892 prices.
Boletín Trimestral de la
Estadística Nacional (1894)
Coffee production
per capita (Log
1892) Logarithm of the value of the coffee production in 1892 prices.
Boletín Trimestral de la
Estadística Nacional (1894)
Coffee production
per capita (Log
1925) Logarithm of the quantity of coffee trees in existence in 1925. Monsalve (1927)
Distance from
colonial institutions
Calculated as the normalization of the average distance
(between 0 and 1) of a county with respect to the nearest
counties where there were Encomiendas in 1560 and more
than 20 slaves in 1800. Takes a value of 1 in the counties
where there were both institutions and 0 if there was neither
institution in the counties at a maximum of 100 km distance.
Tovar (1988) and Duque percent
Sánchez (2007)
Distance from
disentailments
Calculated taking into account the distance between the county
in question and the nearest county with disentailed church
properties. It takes a value of 1 when the county had
disentailed properties and 0 if the nearest county with this
institution was at more than 100 km distance. For those
counties within the 100 km range, a value of between 0 and 1
Archivo General de la Nación
(AGN), Sección República,
Fondo de Bienes
Desamortizados (Rolls 1 to 30),
Registro Oficial 1862–1864 and
23
was calculated, depending on the distance to the nearest
county that reported this institution. Diario Oficial 1865–1884
Distance from
public lands
Calculated taking into account the distance between the county
in question and the nearest county with public land
concessions. It takes a value of 1 when the county had public
land concessions and 0 if the nearest county with this
institution was at more than 100 km distance. For those
counties within the 100 km range, a value of between 0 and 1
was calculated, depending on the distance to the nearest
county that reported this institution.
Registro Oficial (1862–1864)
and Diario Oficial (1865–1931)
Distance from
dissolution of
communal lands in
18th century
Calculated taking into account the distance between the county
in question and the nearest county with dissolution of
communal lands in the eighteenth century. It takes a value of
1 when the county had dissolution of protection in the
eighteenth century, and 0 if the nearest county with this
institution was at more than 100 km distance. For those
counties within the 100 km range, a value of between 0 and 1
was calculated, depending on the distance to the nearest
county that reported this institution. Tovar (1980) and Tovar (1988)
Dummy conflict
1827–1917
It takes a value of 1 if the county had land conflict between
1827 and 1917 and 0 if not. LeGrand (1988)
Dummy conflict
1827–1931
It takes a value of 1 if the county had land conflict between
1827 and 1931 and 0 if not. LeGrand (1988)
Dummy production
1851
Matrix of variables of the production of sugar, tobacco, cacao,
plantain and coffee that takes a value of 1 if the product was
produced in the county in 1851 and 0 if not.
Geografía Física y Política de la
Confederación Granadina,
volumes I, II, III, IV, V, directed
by general Agustín Codazzi
(2002)
Geographical Variables
Altitude Meters above sea level. Sánchez percent Nuñez (2000)
Fertility Index reflecting the aptitude of the land for agricultural Sánchez percent Nuñez (2000)
24
activities (drainage, erosion, natural slopes, sodium contents,
etc.).
Precipitation Average rain lprecipitation in cubic centimeters per year. Sánchez percent Nuñez (2000)
Rivers
Index of extension of primary, secondary and tertiary rivers
that run through the area of a county.
Sánchez percent Nuñez (2000)
Temperature Average centigrade degrees in the county. Sánchez percent Nuñez (2000)
Distance to River
Cauca
Index of minimum distance of the county from the River
Cauca.
Sánchez percent Nuñez (2000)
Distance to Bogotá Index of minimum distance of the county from Bogotá. Sánchez percent Nuñez (2000)
Distance to Atlantic
Ocean
(Barranquilla) Index of minimum distance of the county from Barranquilla.
Sánchez percent Nuñez (2000)
Distance to Pacific
Ocean
(Buenaventura) Index of minimum distance of the county from Buenaventura.
Sánchez percent Nuñez (2000)
Appendix 2
25
Panel A: Reports the second stage of the estimation both of the probit and the tobit for the dummy of export
production for 1892 and 1925 and log of the export production per capita as dependent variables,
respectively. This panel also reports the second stage estimation of the 2TSLS for the coffee production per
capita in 1892. Others controls included are altitude, fertility, precipitation, rivers, temperature, distance to
river Cauca, Distance to Barranquilla, Distance to Cali and Distance to Buenaventura.
Panel B: Reports the first stage for the two models with conflict (1827–1917) as a dependent variable. The
instrumental variable is the average distance from Encomienda for the year 1560 and from municipalities
with more than 20 slaves in 1800. Others controls included in both stages are: altitude, soil fertility, rain
precipitation, kilometers of rivers, temperature, distance to Cauca river, distance to Barranquilla and Distance 26
to Buenaventura. Standard error in brackets. Critical values for the Stock and Yogo weak instrument test (5-
percent significance) based on TSLS size with exact identification are 16.38, 8.96, 6.66 and 5.53, for the 10-
percent, 15-percent, 20-percent, and 25-percent sizes respectively.
Primary sources
Archivo General de la Nación (AGN), Sección República, Fondo de Bienes
Desamortizados (Rollo 1 to 30).
Geografía Física y Política de la Confederación Granadina, volumes I, II, III, IV, V,
under the direction of the General Agustín Codazzi (2002).
Gaceta Oficial (1854, 1856, 1858–1861).
Registro Oficial (1862–1864).
Diario Oficial (1865–1931).
Boletín Trimestral de la Estadística Nacional (1894).
GRECO, El Crecimiento Colombiano en el Siglo XX, Aspectos Globales, Bogotá: Banco
de la República, 2002.
Instituto Geográfico Agustín Codazzi. Diccionario Geográfico de Colombia, Bogotá,
1996.
Monsalve, Diego. Colombia Cafetera, 1927.
Tovar, Hermes. Grandes Empresas Agrícolas y Ganaderas, Bogotá: Universidad Nacional
de Colombia, 1980.
Tovar, Hermes. No Hay Caciques ni Señores, Barcelona: Sendai Ediciones,1988.
Tovar, Hermes; Tovar, Camilo; Tovar, Jorge. Convocatoria al Poder del Número. Censos
y Estadísticas de la Nueva Granada, 1750–1830. Bogotá: Archivo General de la Nación,
1994.
Bibliography
27
Acemoglu, Aaron; Johnson, Simon. “Unbundling Institutions”, Journal of Political
Economy, 113, no 5 (2005): 949–995.
Alston, Lee, Liebcap, Gary, Mueller Bernardo “A model of rural conflict: violence and land reform policy in
Brazil”, Environment and Development Economics4 (1999): 133-160.
Alston, Lee; Libecap, Gary; Mueller, Bernardo “Violence and the Development of
Property Rights to Land in the Brazilian Amazon” in The Frontiers of the New Institutional
Economics, Drobak, John and Nye, John (Editors), Academic Press, 1997.
Brew, Roger. El Desarrollo Económico de Antioquia desde la Independencia Hasta 1920,
Medellín: Editorial Universidad de Antioquia, 2000.
Bulmer-Thomas, Victor. The Economic History of Latin America since Independence,
New York: Cambridge University Press,1994. .
Burkholder, Mark, Johnson, Lyman. Colonial Latin America, New York: Oxford
University Press, 2008.
Cardoso Ciro; Pérez Héctor. Historia Económica de América Latina, Barcelona: Editorial
Crítica, 1987.
Colmenares, Germán. Historia Económica y Social de Colombia, 1537–1719, Vol. 1,
Bogotá: Tercer Mundo Editores, 1999Bogotá.
Demsetz, Harold “Toward a Theory of Property Rigths”, American Economic Review 57,
Issue 2. (1967): 347-359.
Díaz, Fernando. La desamortización de bienes eclesiásticos en Boyacá, Tunja: UPTC,
1977.
Duque, Valentina; Sánchez, Fabio. Instituciones Coloniales e Instituciones Republicanas
en el Desarrollo Económico Colombiano: ¿Cuáles Pesan Más?, Mimeo, 2007.
Furubotn, Eirik; Richter, Rudolf. Institutions and Economic Theory. The Contribution of
the New Institutional Economics, The University of Michigan Press, 2005.
28
Instituto Geográfico Agustín Codazzi, www.igac.gov.co.
LeGrand, Catherine. Colonización y Protesta Campesina en Colombia: 1850–1930,
Bogotá: Universidad Nacional de Colombia, 1988.
Maddison, Angus. Monitoring the World Economy, 1820–1992, París: OECD, 1995.
Naritomi, Joana; Soares, Rodrigo; Assuncao, Juliano (2007) Rent Seeking and the
Unveiling of ‘De Facto’ Institutions: Development and Colonial Heritage within Brazil,
Mimeo.
Ocampo, José Antonio. Colombia y la Economía Mundial, 1830–1910, Bogotá: Tercer
Mundo Editores, 1984.
O’Rourke, Kevin; Williamson, Jeffrey. Globalization and History, Massachusetts: The
MIT Press, 1999.
Palacios, Marco. El Café en Colombia, 1850-1970. Una Historia Económica, Social y
Política, Thrid Edition, Bogota, Editorial Planeta 2002.
Parsons, James. La Colonización Antioqueña en el Occidente Colombiano, Bogotá: El
Áncora Editores y Banco de la República, 1997.
Sánchez, Fabio; Fazio, Antonella; López-Uribe, María del Pilar Precios de la Tierra en
Cundinamarca durante el Siglo XIX, Mimeo, 2009.
Sánchez, Fabio; Nuñez, Jairo “La Geografía y el Desarrollo Económico: una
Aproximación Municipal”, Desarrollo y Sociedad, 46 (2000).
Stock, James; Yogo, Motohiro “Testing for weak instruments in linear IV regression”,
NBER, Technical Working Paper, 284 (2002): 1-73.
Tovar, Hermes. Que nos tengan en cuenta, Bogotá: Colcultura-Tercer Mundo Editores,
1995.
Table 1. Land allocation by type of titling, 1853–1930.29
Source: Gaceta Oficial (1854, 1856, 1858–1861), Registro Oficial (1862–1864), Diario
Oficial (1865–1931) and authors’ calculates.
Table 2. Econometric Results. Dependent Variables: Exportable Production in 1892 and in
1925 (Per Capita Values).
30
The table reports the OLS and the first and second stage of the TSLS using the log of the exportable
production per capita in 1892 and 1925 as dependent variable. The number of counties with conflicts is 110.
The instrumental variable is the average distance from Encomienda for the year 1560 and from counties with
more than 20 slaves in 1800. Others controls (not reported) are: altitude, soil fertility, rain precipitation,
kilometers of rivers, temperature, distance to Cauca River, distance to Barranquilla, Distance to Cali and
Distance to Buenaventura. Standard error in brackets.
Critical values for the Stock and Yogo weak instrument test (5-percent significance) based on TSLS size with
exact identification are 16.38, 8.96, 6.66 and 5.53, for the 10-percent, 15-percent, 20-percent, and 25-percent
sizes respectively.
31
Figure 1. Export Price Index, Number of transactions and square kilometers of public lands
titled 1850–1910 (in five-year periods).
0
50
100
150
200
250
300
350
400
450
500
0
1000
2000
3000
4000
5000
6000
1851-55 1856-60 1861-65 1866-70 1871-75 1876-80 1881-85 1886-90 1891-95 1896-00 1901-05 1906-10
Num
ber o
f tra
nsac
tions
and
Exp
orta
tion
Price
Inde
x
KM2
Number of square kilometres of Public Land Allocated Number of Public Lands Allotments Export Price Index
Source: Gaceta Oficial (1854, 1856, 1858–1861), Registro Oficial (1862–1864), Diario
Oficial (1865–1931), Ocampo (1990) and authors’ calculations
Figure 2a. Departmental share of land allotments and coffee production in 1925.
32
CALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCAL
NARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAG
SANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSAN
NORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNORNOR
RISRISRISRISRISRISRISRISRISRISRIS
HUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUI
VALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVAL
CUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUN
QUIQUIQUIQUIQUIQUIQUIQUI
TOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOL
ANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANT
05
1015
2025
Dep
arm
enta
l sha
re o
f cof
fee
prod
uctio
n (%
)
0 5 10 15 20Departmental share of land allotments (%)
Figure 2b. Departmental share of land allotments and conflicts lands in 1925.
BOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOLBOL
SUCSUC
CAUCAUCAUCAU
SUCSUC
CAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAUCAU
SUCSUC
CAU
SUC
CAU
SUCSUC
CAUCAU
SUC
CAUCAU
SUC
CAU
SUCSUC
CAUCAUCAU
SUCSUCSUCSUCSUC
CAUCAUCAU
SUC
CORCORCORCORCORCORCORCORCORCORCORCORCORCORCOR
CHOCHOCHOCHOCHOCHOCHOCHOCHOCHOCHOCHOCHO
CESCESCESCESCESCESCESCESCESCESCESCES
CALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCALCAL
NARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNARNAR
MAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAGMAG
SANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSANSAN
METMETMETMETNOR
BOYBOY
NOR
BOYBOYBOYBOYBOY
NORNOR
BOYBOYBOYBOYBOYBOYBOYBOYBOYBOY
NOR
BOYBOY
NORNORNOR
BOY
NOR
BOYBOYBOYBOYBOYBOYBOYBOYBOYBOY
NOR
BOYBOYBOYBOYBOYBOY
NORNORNORNORNORNORNORNOR
BOYBOYBOY
NOR
BOY
NOR
BOY
NOR
BOYBOYBOY
NORNOR
BOY
NORNOR
BOYBOYBOYBOY
NOR
BOYBOYBOYBOYBOYBOY
NOR
BOYBOY
NOR
BOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOY
NOR
BOY
NOR
BOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOYBOY
NOR
BOYBOYBOYBOYBOYBOYBOY
NOR
BOYBOYBOY
NOR
BOYBOYBOY
NOR
BOYBOYBOY
NOR
RISRISRISRISRISRISRISRISRISRISRIS
HUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUIHUI
VALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVALVAL
CUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUNCUN
QUIQUIQUIQUIQUIQUIQUIQUI
TOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOLTOL
ANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANTANT
05
1015
Dep
arm
enta
l sha
re o
f con
flict
land
s (%
)
0 5 10 15 20Departmental share of land allotments (%)
Source: Boletín Trimestral de Estadística Nacional (1894), LeGrand (1988), Gaceta Oficial
(1854, 1856, 1858–1861), Registro Oficial (1862–1864), Diario Oficial (1865–1893),
authors’ calculations.
Map 1. Presence of coffee production in 1851, 1892 and 1925.
33
Source: Geografía Física y Política de la Confederación Granadina, volumes I, II, III, IV,
V (2002), Boletín Trimestral de Estadística (1894), Monsalve (1927).
34