Post on 27-Feb-2022
Heterologous expression and characterization of the antibacterial lasso peptide LP2006
by
Gaelen Moore
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Biochemistry University of Toronto
© Copyright by Gaelen Moore, 2019
ii
Heterologous expression and characterization of the antibacterial
lasso peptide LP2006
Gaelen Moore
Master of Science
Department of Biochemistry University of Toronto
2019
Abstract
The lasso peptides are a class of ribosomally synthesized peptide natural products with diverse
bioactivities and structures resembling a lasso. Although the targets of several antibacterial lasso
peptides have been investigated to date, the majority remain uncharacterized. Among those that
have been characterized, the antibacterial lasso peptides have diverse targets and unique
mechanisms of action. One antibacterial lasso peptide with a unique structure, LP2006, is the
only member of the class IV peptides. Currently the target and mechanism of action of LP2006
remains unknown. The aim of this study is to develop a system for the heterologous expression
of LP2006 to allow for the study of its target and mode of action. I demonstrate that LP2006 can
be heterologously expressed using Streptomyces coelicolor M1146, and that purified LP2006
does not appear to activate the cell wall stress response gene liaI.
iii
Acknowledgments
The past two years of my Master’s research project would not have been possible without the
support of many people.
Firstly, I would like to thank Dr. Justin Nodwell for providing me with the opportunity to work
in his laboratory. Despite his busy schedule, he always manages to make plenty of time to meet
with his students and never fails to inspire his students. I would also like to thank my committee
members, Dr. Karen Maxwell and Dr. Alex Ensminger for their input and thoroughness over the
course of my project.
I am deeply grateful to Dr. Sheila Pimental-Elardo for her guidance and support in conducting
this project. I have thoroughly enjoyed our discussions about marine natural products in addition
to our non-scientific discussions. Sheila's kindness and empathy have had a very positive
influence on the lab. I am very thankful to have had the opportunity to meet and work with all of
the Nodwell Lab members. I am appreciative of not only their scientific suggestions, but also
their friendship, which has made my time in the lab highly enjoyable.
I would also like to thank my undergraduate thesis project mentor, Sohee Yun, for her guidance
and enthusiasm. She inspired me to pursue research and she was always a positive presence
during my time as her trainee. Finally, I would like to thank my parents for their steadfast
support over the years.
iv
Table of Contents
Acknowledgments.......................................................................................................................... iii
Table of Contents ........................................................................................................................... iv
List of Tables ................................................................................................................................ vii
List of Figures .............................................................................................................................. viii
Chapter 1 Introduction .....................................................................................................................1
Introduction .................................................................................................................................1
1.1 RiPPs ....................................................................................................................................1
1.1.1 Thiopeptides .............................................................................................................4
1.1.1.1 Biosynthesis of Thiopeptides ....................................................................4
1.1.1.2 Antibiotic Targets of Thiopeptides ............................................................5
1.1.2 Lanthipeptides ..........................................................................................................6
1.1.2.1 Biosynthesis of lanthipeptides ...................................................................9
1.1.2.2 Activity of lanthipeptides ........................................................................11
1.1.3 Lasso peptides ........................................................................................................12
1.1.3.1 Classification of lasso peptides ...............................................................13
1.1.3.2 Biosynthesis of lasso peptides .................................................................17
1.1.3.3 Activity of lasso peptides ........................................................................20
1.1.3.4 Discovery and Heterologous expression of lasso peptides ......................24
1.2 Aim of this work ................................................................................................................26
Chapter 2 Materials and Methods ..................................................................................................27
Materials and Methods ..............................................................................................................27
2.1 General experimental procedures ......................................................................................27
2.1.1 Materials ................................................................................................................27
2.1.2 Strains and plasmids used ......................................................................................27
2.1.3 Primers Used ..........................................................................................................28
v
2.1.4 Culture conditions ..................................................................................................29
2.1.5 Heterologous expression of LP2006 ......................................................................29
2.2 Isolation and purification of bioactive metabolites ............................................................30
2.2.1 Metabolite extraction .............................................................................................30
2.2.2 Flash chromatography purification ........................................................................30
2.2.3 High-performance liquid chromatography purification .........................................31
2.2.4 Liquid chromatography mass spectrometry analysis .............................................31
2.3 Susceptibility testing ..........................................................................................................32
2.3.1 Disk diffusion assays .............................................................................................32
2.3.2 Broth microtiter dilution assay...............................................................................32
2.4 Target identification ...........................................................................................................32
2.4.1 LacZ reporter assay ................................................................................................32
Results and discussion ..............................................................................................................33
3.1 Nocardiopsis sp. HB141 extract testing.............................................................................33
3.1.1 Extracts of Nocardiopsis sp. HB141 have antibacterial activity ...........................33
3.1.2 Nocardiopsis sp. HB141 is a producer of an antibacterial lasso peptide, LP2006 ...................................................................................................................34
3.1.3 Purification of LP2006 ...........................................................................................35
3.2 Heterologous expression of LP2006 ..................................................................................38
3.2.1 Heterologous expression in Escherichia coli .........................................................38
3.2.2 Heterologous expression in Streptomyces coelicolor M1146 ................................43
3.3 Bioactivity of LP2006 ........................................................................................................46
Conclusions and future directions .............................................................................................48
References ......................................................................................................................................50
Appendix 1 Screen for novel bioactive natural products from marine bacteria ...........................62
Appendix 1 ................................................................................................................................62
vi
5.1 Introduction ........................................................................................................................62
5.2 Methods..............................................................................................................................62
5.2.1 Bioactivity screen...................................................................................................62
5.2.1.1 Collection and Isolation of maritime strains ...........................................62
5.2.1.2 Culture conditions ...................................................................................63
5.2.1.3 Broth microtiter dilution and disk diffusion assay ..................................63
5.2.2 Isolation of the Marinobacter sp. N33 bioactive metabolite(s) .............................64
5.2.2.1 Metabolite extraction ...............................................................................64
5.2.2.2 Flash chromatography and HPLC purification ........................................64
5.2.3 Genomic studies .....................................................................................................65
5.2.3.1 Genomic DNA extraction ........................................................................65
5.2.3.2 Phylogenetic analysis ..............................................................................65
5.2.3.3 Whole genome sequencing of Marinobacter sp. N33 .............................66
5.3 Results and discussion .......................................................................................................66
5.3.1 Screen of marine bacteria .......................................................................................66
5.3.1.1 Phylogenetic analysis ..............................................................................66
5.3.1.2 Bioactivity screening ...............................................................................70
5.3.2 Marinobacter sp. N33 extract testing ....................................................................72
5.3.2.1 Bioactivity testing ....................................................................................72
5.3.2.2 Genome sequencing and genome mining ................................................73
5.3.2.3 Bioactivity guided fractionation and purification ....................................75
Copyright Acknowledgements.......................................................................................................77
vii
List of Tables
Table 1.1. Characterized lasso peptides and their tested bioactivity. ........................................... 14
Table 1.2. Heterologously produced lasso peptides. ..................................................................... 25
Table 2.1. Strains and plasmids used in this study. ...................................................................... 27
Table 2.2. Primers used in this study. ........................................................................................... 28
Table 3.1. Ion comparison of HB141 mass and LP2006 .............................................................. 35
Table 3.2. Sequence identity of LP2006 biosynthetic proteins of Nocardiopsis alba ATCC BAA-
2165 and Nocardiopsis sp. TP-A0876 compared to Nocardiopsis alba DSM 43377. .................. 39
Table 3.3. Comparison of LP2006 masses from the Nocardiopsis sp. HB141 and those produced
by heterologous expression in S. coelicolor M1146. .................................................................... 46
Table 5.1. Identity and characteristics of maritime strains ........................................................... 67
Table 5.2. Comparison of Marinobacter sp. N33 genome statistics to close relatives................. 75
viii
List of Figures
Figure 1.1. Structures of selected commercially used RiPPs.......................................................... 2
Figure 1.2. Generalized RiPP Biosynthesis .................................................................................... 3
Figure 1.3. Biosynthesis of the thiomuracin core scaffold ............................................................. 5
Figure 1.4. Post-translational modifications characteristic in lanthipeptides ................................. 7
Figure 1.5. Distribution of lasso peptide, lanthipeptide and thiopeptide clusters in Streptomyces
genomes .......................................................................................................................................... 8
Figure 1.6. Mechanisms of lanthipeptide synthesis ...................................................................... 10
Figure 1.7. Classes of lanthionine synthetases.............................................................................. 11
Figure 1.8. Lasso peptide cyclization and structure ...................................................................... 13
Figure 1.9. Classes of lasso peptides ............................................................................................ 14
Figure 1.10. Lasso peptide gene clusters and biosynthesis ........................................................... 18
Figure 1.11. Proposed mechanism of microcin J25 biosynthesis ................................................. 19
Figure 1.12. Antibacterial targets of lasso peptides ...................................................................... 20
Figure 3.1. Disk diffusion assay of Nocardiopsis sp. HB141 extract ........................................... 33
Figure 3.2. Extracted ion chromatogram of LP2006 M+2H mass ................................................ 34
Figure 3.3. Mass spectrum of the Nocardiopsis sp. HB141 mass of 1002.9335 m/z ................... 35
Figure 3.4. Disk diffusion assay from flash chromatography fractionated Nocardiopsis sp.
HB141 extract ............................................................................................................................... 36
Figure 3.5. HPLC chromatogram of first-round purification of LP2006 ..................................... 37
Figure 3.6. HPLC chromatogram of second-round purification of LP2006 ................................. 37
ix
Figure 3.7. LP2006 biosynthetic gene cluster from N. alba DSM 43377 .................................... 39
Figure 3.8. Vectors used for E. coli heterologous expression ...................................................... 40
Figure 3.9. Protein expression testing of LpeCEB ....................................................................... 42
Figure 3.10. Construct used for S. coelicolor heterologous expression ........................................ 44
Figure 3.11. Detection of heterologously expressed LP2006 by mass spectrometry ................... 45
Figure 3.12. Antibacterial MIC testing of pure LP2006 ............................................................... 47
Figure 3.13. LP2006 does not activate the cell wall stress response gene liaI in B. subtilis 1A980
....................................................................................................................................................... 47
Figure 5.1. Phylogenetic tree of Nodwell Maritime Collection strains. ....................................... 69
Figure 5.2. Screen of Nodwell Maritime Collection strains ......................................................... 70
Figure 5.3. Distribution of growth inhibition values. ................................................................... 71
Figure 5.4. Phylogenetic tree and antibacterial activity of Nodwell Maritime Collection strains
tested against B. subtilis ................................................................................................................ 72
Figure 5.5. Disk diffusion assay of Marinobacter sp. N33 crude extract using B. subtilis JH642.
....................................................................................................................................................... 73
Figure 5.6. Circular representation of the Marinobacter sp. N33 genome ................................... 74
Figure 5.7. UV chromatogram of the purification of fraction 19 from flash chromatography by
HPLC ............................................................................................................................................ 76
1
Chapter 1 Introduction
Introduction
The discovery of antibiotics has produced enormous benefits for both human and animal
medicine. Today, many routine medical procedures would not be possible without effective
antibiotics to prevent post-procedural infections. In the clinic, natural products and derivatives
remain the primary source of novel antibiotics, even decades after the golden era of natural
product-based antibiotic discovery of the 1940s to 1960s1. With the advent of next-generation
sequencing, it has become apparent that our knowledge of natural product chemistry and biology
is incredibly incomplete. Further exploration of the natural product chemical space will
undoubtedly lead to new therapeutics.
With the escalating threat of antibiotic resistance, it is important to continue to develop novel
antibiotics to prevent the emergence of pathogens that are untreatable with our existing antibiotic
arsenal. While antibiotics synthesized by nonribosomal peptide synthases and polyketide
synthases are familiar in medicine, one overlooked class of natural products are the ribosomally
synthesized and post-translationally modified peptides (RiPPs) which have a long history of
documented antibiotic activity but have not been thoroughly explored for their therapeutic and
industrial applications.
1.1 RiPPs
Peptide synthesis can occur either ribosomally or nonribosomally. Nonribosomal peptides are
familiar to many – the class includes medically important compounds such as the beta-lactams,
the glycopeptides, the depsipeptides, cyclosporine and daptomycin. The nonribosomal peptides
have had an enormous impact on science and medicine. In contrast, ribosomally synthesized and
post-translationally modified peptides (RiPPs) are less well-known but possess impressive
structural diversity and potent bioactivity2. The RiPPs, which are produced by all domains of
life, are comparatively understudied in spite of their interesting bioactivity and therapeutic
potential. Commercialized RiPPs include thiostrepton, an antibacterial used in veterinary
2
medicine, nisin, a food preservative, and omega-conotoxin MVIIA, which has been developed
into the synthetic antinociceptive drug, Ziconotide (Figure 1.1)3–6.
Figure 1.1. Structures of selected commercially used RiPPs. A. Structure of thiostrepton. B.
Structure of Ziconotide, the synthetic analogue of the omega-conotoxin MVIIA. C. Structure of
nisin. The post-translationally modified residues are highlighted in red.
The RiPPs share a biosynthetic process, unifying the family which would otherwise be
unrelated2. Like other classes of microbial natural products, the genes required for RiPP
biosynthesis are clustered within the genome. RiPPs are genetically encoded in the form of a
3
precursor peptide, which consists of an N-terminal leader sequence and a C-terminal core
sequence (Figure 1.2). The core sequence undergoes a series of post-translational modifications,
which are introduced by modification enzymes encoded in the biosynthetic gene cluster of the
RiPP. RiPP biosynthetic gene clusters also encode a leader peptidase, which cleaves the N-
terminal leader sequence from the C-terminal core, ultimately yielding the mature RiPP. RiPP
clusters may sometimes encode genes for the export of the mature RiPPs or the regulation of the
production of the RiPPs.
Figure 1.2. Generalized RiPP Biosynthesis. A. General biosynthetic cluster of a RiPP natural
product. B. Generalized biosynthetic logic of RiPP biosynthesis. Adapted from Tan et al.,
Antibiotics, 20197.
The RiPPs possess a unique ability to generate substantial chemical diversity at a low metabolic
cost. The RiPP model has evolved to produce structural diversity as many of the enzymes that
introduce post-translational modifications are permissive to mutations in the core sequence and
primarily recognize the leader sequence. In fact, certain classes of RiPPs contain core regions
that are naturally hypervariable8. The broad chemical diversity of RiPPs, combined with their
suitability for genome mining, heterologous expression and their potential for engineering proves
advantageous in their therapeutic development. In the following sections I will discuss the
4
structural characteristics, biosynthesis and bioactivity of three RiPP classes which have a large
body of literature and well-documented antibiotic activity.
1.1.1 Thiopeptides
Few classes of RiPPs have been studied as thoroughly as the thiopeptides. The thiopeptides are
macrocyclic peptides characterized by sulfur-rich heterocycles and a central 6-membered
nitrogen-containing oxidized ring. There are currently more than 100 known thiopeptides, which
are classified into five categories based on the structure and oxidation state of the central
nitrogen-containing ring9. The first thiopeptide discovered was micrococcin in 1948, although
the first thiopeptide gene clusters were only identified in 200910–12. Most thiopeptides are potent
antibacterial translation inhibitors and some have long been used in agricultural feed and
veterinary treatments13–16.
1.1.1.1 Biosynthesis of Thiopeptides
For more than half a century after the discovery of the micrococcin in 1948 it was unclear
whether the thiopeptides were synthesized ribosomally or nonribosomally. Finally, in 2009,
several thiopeptide gene clusters were published, revealing that thiopeptides indeed belong to the
RiPP family10,11,17,18.
After translation, thiopeptide biosynthesis typically involves three steps: installation of the
sulfur-rich heterocycles, installation of the central nitrogen-containing ring, and leader peptide
removal by the leader peptidase, producing the mature thiopeptide. The first step involves the
dehydration of Cys and sometimes Ser/Thr residues to produce the sulfur and oxygen-containing
heterocycles, thiazol(in)e or oxazol(in)e (Figure 1.3)19. This step is catalyzed by a trimeric
heterocycle synthetase, and is shared with the closely related class of RiPPs the linear azol(in)e-
containing peptides, of which the DNA-gyrase inhibitor microcin B17 is a member20,21. Next,
unmodified Ser/Thr residues are dehydrated by a LanB-like dehydratase to yield dehydroalanine
(Dha) and dehydrobutyrine (Dhb)22. Finally, a [4 + 2] cycloaddition reaction occurs between two
Dha residues and an amide backbone to produce a 6-membered nitrogen-containing ring, which
constitutes part of the macrocycle23. Subsequent modifications such as hydroxylation,
methylation, or the addition of a tryptophan-derived macrocycle have been reported for certain
5
thiopeptides11,18,24,25. Finally, after all post-translational modifications the leader peptide is
cleaved from the core peptide, resulting in the mature thiopeptide.
Figure 1.3. Biosynthesis of the thiomuracin core scaffold. Thiazole heterocycles are depicted
in purple; dehydroalanine residues are depicted in green; and the central nitrogen-containing
heterocycle is depicted in orange. Figure adapted from Hudson et al., 201526.
1.1.1.2 Antibiotic Targets of Thiopeptides
The thiopeptides have long been known for their potent antibacterial activity, but their
development into clinical therapeutics has been hampered by poor bioavailability and high rates
of emergence of resistance27. Thiopeptides often have antibacterial activity with nanomolar
potency against Gram-positive bacteria but lack activity against Gram-negatives due to their
inability to bypass the outer membrane12. Thiopeptides are mostly protein synthesis inhibitors
6
and can inhibit translation through one of two mechanisms, dependent on the macrocycle size.
Thiopeptides containing 26 or 32-atom macrocycles, such as thiostrepton and micrococcin,
inhibit protein translation by binding directly to the ribosome, at the interface of the 23s rRNA
and the N-terminal domain of ribosomal protein L1128. This results in stabilization of the N-
terminal domain of ribosomal protein L11, restricting the interaction with elongation factor G
and preventing the conformational shifts necessary for translocation to occur29. Resistance to this
class of thiopeptides can occur through the three mechanisms: the deletion or mutation of the
gene encoding the ribosomal protein L11, mutation of A1067 or A1095 of 23S rRNA (E. coli
nomenclature) or methylation of the 23S rRNA30–35.
Thiopeptides that contain 29-atom macrocycles, such as GE2270A, inhibit translation by binding
to elongation factor Tu (EF-Tu), where they prevent the binding of amino-acyl tRNAs to the
protein. GE2270A partially occludes the binding of the aminoacyl-tRNA and GTP, but not GDP.
Resistance to EF-Tu-targeting thiopeptides increases the affinity of elongation factor Tu for
aminoacyl-tRNA in the presence of EF-Tu-targeting thiopeptides36,37.
Although the vast majority of thiopeptides are bacterial translation inhibitors, there are several
for which different activities have been reported. Notably, the cyclothiazomycins are reported to
inhibit RNA polymerase, while lactazole has no reported antibiotic activity38,39.
1.1.2 Lanthipeptides
The lanthipeptides are another relatively well-studied class of RiPPs which contain the
characteristic thioether amino acids lanthionine and methyllanthionine. The (methyl)lanthionine
bridges are introduced via Michael addition between free cysteines and the alkene-containing
amino acids, dehydroalanine (Dha) and dehydrobutyrine (Dhb) (Figure 1.4). This class of RiPPs
has been the subject of much research interest not only because of the interesting biology and
bioactivity, but also because of the potential of industrial and medical applications. Much of the
interest has been surrounding the prototypical lanthipeptide nisin, which was first discovered in
1928 and has been widely used as a food preservative for several decades40,41. Nisin is also
currently being pursued as a treatment for bovine mastitis42. Encouragingly, in spite of its heavy
use in food preservation, widespread resistance to nisin has yet to emerge. Beyond nisin, the
7
lanthipeptide NVB302 was found to have strong in vitro results in the treatment of Clostridioides
difficile infections when compared to vancomycin43.
Figure 1.4. Post-translational modifications characteristic in lanthipeptides. The
(methyl)lanthionine, dehydroalanine and dehydrobutyrine modifications are characteristic of all
classes of lanthipeptides, while the labionin modification is found only in the class III
lanthipeptides. Figure adapted from Knerr and van der Donk, 201244.
Lanthipeptides, along with other classes of RiPPs, are produced across many bacterial lineages,
particularly by Actinobacteria. In fact, the Streptomyces, which are known producers of many
important secondary metabolites of polyketide and nonribosomal peptide origin, appear to be
prolific producers of RiPPs as well (Figure 1.5)7. In a random sampling of 50 complete
Streptomyces genomes, the genomes were found to encode as many as 8 RiPPs, with
lanthipeptide clusters occurring more frequently compared to lasso peptide and thiopeptide
clusters. Some lanthipeptides are known to be important for Streptomyces development, which
may partially explain the frequency at which lanthipeptide clusters are found in the genus45.
8
Figure 1.5. Distribution of lasso peptide, lanthipeptide and thiopeptide clusters in
Streptomyces genomes. 50 randomly-selected Streptomyces genomes, were analyzed using
AntiSMASH 5.0 to detect for RiPP biosynthetic gene clusters. Lasso peptide clusters are shown
in red, lanthipeptide clusters in blue, and thiopeptide clusters in green. From each genome, the
genes atpD, gyrA, recA, rpoB, trpB and the 16S rRNA gene were compiled for cladogram
construction using FastTree 2.0 and visualized using the interactive Tree of Life.46–48 Figure
from Tan et al., 20197.
9
Lanthipeptides were originally categorized into two types: type A, including nisin and subtilisin
which are long, flexible molecules and type B, including duramycin and cinnamycin, which are
globular molecules49. With the discovery of lanthipeptides that did not fit well into these
categories, a new classification scheme was proposed based on the enzymes used to synthesize
lanthipeptides50,51. To date, there are four distinct classes of lanthipeptide biosynthetic enzymes,
which will be discussed in the following section.
1.1.2.1 Biosynthesis of lanthipeptides
The characteristic lanthionine or methyllanthionine cross-bridges are introduced in lanthipeptides
in two steps. First, Ser and Thr residues are selectively dehydrated to dehydroalanine or
dehydrobutyrine, respectively. Next, the unsaturated Dha and Dhb amino acids undergo
nucleophilic attack by select cysteines through a Michael reaction to generate lanthionine and
methyllanthionines and form cross-links in the peptide structure (Figure 1.6).
10
Figure 1.6. Mechanisms of lanthipeptide synthesis. A. Mechanism of dehydration in LanB-
type enzymes that synthesize class I lanthipeptides. B. Mechanism of dehydration in the
synthesis of class II-IV lanthipeptides. C. Mechanism of cyclization via Michael addition used in
lanthipeptide synthesis. Figure adapted from Ortega and van der Donk, 201652.
There are four classes of lanthipeptides, which are categorized according to the enzymes that
catalyze (methyl)lanthionine installation (Figure 1.7)44. Class I lanthipeptides have dedicated
proteins for dehydration and cyclization, named LanB and LanC, respectively. Class II have
fused N-terminal dehydratase and C-terminal cyclase enzyme functionalities, whereby the
enzymes are termed LanM. The N-terminal dehydratase domain does not display sequence
homology with other lanthionine synthetases, although the C-terminal cyclase domain is
homologous to the LanC cyclase protein of class I lanthionine synthetases. Class III and IV
enzymes both contain lyase and kinase domains and C-terminal cyclase domains that are
homologous to LanC cyclases, although the class III cyclase domain is missing several
11
conserved metal binding residues. The class III enzymes are the only class able to introduce
labionin structures, an additional carbon-carbon crosslink of the lanthionine amino acid53.
Figure 1.7. Classes of lanthionine synthetases. The conserved motifs are highlighted. Figure
adapted from Knerr and van der Donk, 201244.
Ser/Thr dehydration can occur through one of two mechanisms, which is dependent on the
biosynthetic machinery performing the dehydration. Class I enzymes convert Ser/Thr to
Dha/Dhb in a tRNA-dependent process54. The LanB enzymes transfer a glutamate from tRNAGlu
to Ser/Thr, thereby activating it for dehydration (Figure 1.6). In contrast, the class II-IV enzymes
transfer the ɣ-phosphate of ATP to activate Ser/Thr for dehydration55. After Cys-dependent
Michael addition to Dha/Dhb to produce (methyl)lanthionine residues, additional post-
translational modifications are sometimes introduced including decarboxylation, hydroxylation
and additional cross links between two amino acids56,57.
1.1.2.2 Activity of lanthipeptides
To date, only class I and II lanthipeptides are known to have antimicrobial activity. Nisin, the
prototypical lanthipeptide, has been shown to inhibit Gram-positive bacteria at single-digit
nanomolar concentrations which comparable to the potency of many clinical antibiotics58. Many
experiments have been performed to investigate the mechanism of antibacterial activity of nisin.
Nisin has since been found to target the bacterial cell wall by binding to the diphosphate of lipid
II and forming pores in the membrane, ultimately resulting in a loss of membrane potential58–60.
12
In addition to its pore-forming ability, nisin was later found to have a second activity, whereby it
sequesters lipid II at the cell division site, blocking cell wall synthesis and cell division61.
Certain class II lanthipeptides such as mersacidin complex with lipid II, but do not form pores62.
It is believed that lanthipeptides of this class bind to a region of lipid II that encompasses the N-
acetylglucosamine and the diphosphate, in contrast to nisin which has been shown to bind to the
diphosphate and not the N-acetylglucosamine. Importantly, lanthipeptides have also been
reported to have activities other than antibiotic. The SapB, SapT and catenulipeptin peptides,
discovered from S. coelicolor, S. tendae and Catenulispora acidiphila, respectively, are
morphogens in Streptomyces, enabling the formation of aerial mycelium45,63,64.
Although in vivo antimicrobial lanthipeptide resistance remains very rare, many mechanisms of
resistance to lanthipeptides have been reported in vitro65. In lanthipeptide-producing organisms,
self-resistance typically occurs through the expression of an ABC transporter or an immunity
protein, which localizes to the membrane66. In vitro, several groups have reported nisin
resistance occurring through changes in the phospholipid composition or rigidity of the
membrane67,68. Lysine esterification of membrane lipids through MprF (multiple peptide
resistance factor), reduces the net negative charge of the membrane, providing resistance against
many cationic antimicrobial peptides including nisin69. A plasmid-encoded nisin resistance
protein from certain strains of Lactococcus lactis was found to specifically degrade nisin through
proteolysis70,71. In addition to these mechanisms, a number of other genes have been associated
with lanthipeptide resistance including cell wall modification systems and two-component
systems65.
1.1.3 Lasso peptides
Lasso peptides are a unique class of RiPPs with a simple structure, yet interesting and diverse
bioactivities. The structure of the lasso peptides consists of a macrocycle formed by a
macrolactam linkage between the N-terminal amine of the peptide and a glutamate or aspartate
residue in the 7th to 9th position. The C-terminal tail of the peptide is threaded through the N-
terminal ring, producing a structure which resembles a lasso (Figure 1.8). The lasso peptide
structure is often stabilized by disulfide bridges or bulky residues such as Trp, Tyr or Phe, which
are positioned above and below the ring to prevent unthreading. As a result, the lasso peptides
13
are surprisingly stable both to heat and proteolytic degradation. In fact, some lasso peptides can
withstand temperatures up to 95°C for 8 hours, while others can withstand an autoclave cycle,
although this feature is not universal72–74.
Figure 1.8. Lasso peptide cyclization and structure. The teal circles denote amino acids that
form the N-terminal macrolactam ring, and grey circles represent amino acids that form the C-
terminal tail. The reaction is catalyzed by an ATP-dependent lasso cyclase. Figure from Tan et
al., 20197.
1.1.3.1 Classification of lasso peptides
The lasso peptides are classified into four structural classes based on the location of disulfide
bridges in their structure (Figure 1.9).Class I peptides contain two disulfide bridges; class II
contains no disulfide bridges; class III contains a single disulfide bridge joining the N-terminal
ring and the C-terminal tail; while class IV peptides contain a single intra-tail disulfide. An
estimate in 2017 stated that 96% of bioinformatically-predicted lasso peptides belong to class
II75. To date, 69 lasso peptides have been characterized, 47 of which belong to a unique family
(Table 1.1).
While, the vast majority of characterized lasso peptides belong to class II, there is currently only
a single member of the class IV peptides, LP200675. LP2006 was identified using the genome
mining algorithm RODEO and was reported to have antimicrobial activity against several Gram-
positive bacteria. These included Bacillus anthracis, vancomycin-resistant Enterococcus faecium
14
and Mycobacterium smegmatis which were inhibited at 6.25, 12.5 and 12.5 μM concentrations of
LP2006, respectively. Although LP2006 has antibacterial activity, it is not known what the target
of the antibiotic is, and whether its mechanism of action differs from those of other lasso
peptides because of its unique structure.
Figure 1.9. Classes of lasso peptides. The teal circles represent amino acids that form the
macrolactam ring, and grey circles represent amino acids that form the C-terminal tail. The four
classes differ in their disulfide bonds, which are depicted in yellow. Figure from Tan et al.,
20197.
Table 1.1. Characterized lasso peptides and their tested bioactivity.
Peptide Name Producing Organism Sequence Antibacterial
Activity?
Class I
Humidimycin MDN 0010
Streptomyces humidus F-100.629
CLGIGSCDDFAGCGYAIVCFW Not Tested
Specialicin Streptomyces sp. CLGVGSCVDFAGCGYAVVCFW Yes
Siamycin-1 Streptomyces sp. CLGVGSCNDFAGCGYAIVCFW Yes
Siamycin-2 Streptomyces sp. CLGIGSCNDFAGCGYAIVCFW Not Tested
Siamycin-3 Streptomyces sp. CLGIGSCNDFAGCGYAVVCFW Yes
SSV 2083/Sviceucin Streptomyces sviceus CVWGGDCTDFLGCGTAWICV Yes
Class II
Albusnodin Streptomyces albus GQGGGQSEDKRRAYNC Not Tested
15
Achromosin Streptomyces
achromogenes GIGSQTWDTIWLWD Yes
Acinetodin Acinetobacter
gyllenbergii GGKGPIFETWVTEGNYYG Yes
Actinokineosin Actinokineospora
spheciospongiae GYPFWDNRDIFGGYTFIG Yes
Astexin-1 (23 residue) Asticcacaulis
excentricus GLSQGVEPDIGQTYFEESRINQD Not Tested
Astexin-1 (19 residue) Asticcacaulis
excentricus GLSQGVEPDIGQTYFEESR No
Astexin-2 Asticcacaulis
excentricus GLTQIQALDSVSGQFRDQLGL Not Tested
Astexin-3 Asticcacaulis
excentricus GPTPMVGLDSVSGQYWDQHAPL Not Tested
Anantin A Streptomyces
coerulescens GFIGWGNDIFGHYSGDF Not Tested
Anantin B1 Streptomyces sp. NRRL S-146
GFIGWGNDIFGHYSGGF No
Anantin B2 Streptomyces sp. NRRL S-146
GFIGWGNDIFGHYSGD Yes
Benenodin-1 Asticcacaulis
benevestitus GVGFGRPDSILTQEQAKPMGLDRD Not Tested
Brevunsin Brevundimonas
diminuta DGMGEEFIEGLVRDSLYPPAG No
Burhizin Burkholderia
rhizoxinica GGAGQYKEVEAGRWSDR Not Tested
Capistruin Burkholderia
thailandensis GTPGFQTPDARVISRFGFN Yes
Caulonodulin-1 Caulobacter sp. GDVLNAPEPGIGREPTG Not Tested
Caulonodulin-2 Caulobacter sp. GDVLFAPEPGVGRPPMG Not Tested
Caulonodulin-3 Caulobacter sp. GQIYDHPEVGIGAYGCE Not Tested
Caulonodulin-4 Caulobacter sp. SFDVGTIKEGLVSQYYFA Not Tested
Caulonodulin-5 Caulobacter sp. SIGDSGLRESMSSQTYWP Not Tested
Caulonodulin-6 Caulobacter sp. AGTGVLLPETNQIKRYDPA Not Tested
Caulonodulin-7 Caulobacter sp. SGIGDVFPEPNMVRRWD Not Tested
Caulosegnin-1 Caulobacter segnis GAFVGQPEAVNPLGREIQG No
Caulosegnin-2 Caulobacter segnis GTLTPGLPEDFLPGHYMPG No
Caulosegnin-3 Caulobacter segnis GALVGLLLEDITVARYDPM No
Chaxapeptin Streptomyces
leeuwenhoekii C58 GFGSKPLDSFGLNFF Yes
Citrocin Citrobacter pasteurii GGVGKIIEYFIGGGVGRYG Yes
Citrulassin Streptomyces albulus LLGLAGNDRLVLSKN No
16
Fusilassin/Fuscanodin Thermobifida fusca WYTAEWGLELIFVFPRFI No
Klebsidin Klebsiella pneumoniae GSDGPIIEFFNPNGVMHYG Yes
Lariatin A Rhodococcus sp. K01-BI0171
GSQLVYREWVGHSNVIKP Yes
Lariatin B Rhodococcus sp. K01-BI0171
GSQLVYREWVGHSNVIKPGP Yes
Lagmysin Streptomyces sp. LAGQGSPDLLGGHSLL No
Lassomycin Lentzea kentuckyensis GFIGWGNDIFGHYSGDF Yes
Microcin J25 Escherichia coli AY25 GGAGHVPEYFVGIGTPISFYG Yes
Cattlecin/Moomysin Streptomyces cattleya SYHWGDYHDWHHGWYGWWDD No
Paeninodin Paenibacillus dendritiformis C454
AGPGTSTPDAFQPDPDEDVHYDS No
Propeptin-1 Microbispora sp. SNA-115
GYPWWDYRDLFGGHTFISP Yes
Propeptin-2 Microbispora sp. SNA-115
GYPWWDYRDLFGGHTFI Yes
Pseudomycoidin Bacillus pseudomycoides DSM 12442
QVFEDEDEQGALHHN Not Tested
RES 701 1 Streptomyces sp. RE-701
GNWHGTAPDWFFNYYW Not Tested
Rhodanodin Rhodanobacter thiooxydans LCS2
GVLPIGNEFMGHAATPG Not Tested
Rubrivinodin Rubrivivax gelatinosus GAPSLINSEDNPAFPQRV Not Tested
Snou-LP S. noursei ATCC 11455 YFGLTGYENLFHFYDKLH Not Tested
Sphaericin Planomonospora
sphaerica GLPIGWWIERPSGWYFPI Yes
Sphingonodin I Sphingobium japonicum GPGGITGDVGLGENNFG Not Tested
Sphingonodin II Sphingobium japonicum GMGSGSTDQNGQPKNLIGG Not Tested
Sphingopyxin I Sphingopyxis alaskensis RB2256
GIEPLGPVDEDQGEHYLFAGG Not Tested
Sphingopyxin II Sphingopyxis alaskensis RB2256
GEALIDQDVGGGRQQFLTG Not Tested
SRO15 2005 Streptomyces
roseosporus GYFVGSYKEYWSRRII Not Tested
Streptomonomicin Streptomonospora alba SLGSSPYNDILGYPALIVIYP Yes
Subteresin Sphingomonas
subterranea GPPGDRIEFGVLAQLPG No
Sungsanpin Streptomyces sp. SNJ013
GFGSKPIDSFGLSWL Not Tested
Syanodin-I Sphingobium yanoikuyae XLDN2-5
GISGGTVDAPAGQGLAG Not Tested
Xanthomonin I Xanthomonas gardneri GGPLAGEEIGGFNVPG No
17
Xanthomonin II Xanthomonas gardneri GGPLAGEEMGGITT No
Xanthomonin III Xanthomonas gardneri GGAGAGEVNGMSP No
Ulleungdin Streptomyces sp. KCB13F003
GFIGWGKDIFGHYGG Not Tested
Zucinodin Phenylobacterium zucineum HLK1
GGIGGDFEDLNKPFDV Not Tested
9810-LP Streptomyces sp. ADI94-01
GYFVGSYKEYWTRRIV Not Tested
Class III
BI-32169 Streptomyces sp. DSM 14996
GLPWGCPSDIPGWNTPWAC Not Tested
9401-LP1 Streptomyces sp. ADI94-01
AFGPCVENDWFAGTAWIC Not Tested
Class IV
LP2006 Nocardiopsis alba GRPNQGFENDWSCVRVC Yes
1.1.3.2 Biosynthesis of lasso peptides
Biosynthesis of lasso peptides requires a minimum of two enzymes: a lasso peptidase and a lasso
cyclase (Figure 1.1)76. The lasso peptidase is a cysteine protease which cleaves the leader
sequence from the core sequence in the lasso precursor peptide. Some lasso peptides may require
ATP in a pre-folding step prior to leader peptide removal and core cyclization, although this does
not appear to be a universal requirement77,78. Yan et al. have found that in vitro, the lasso
peptidase of microcin J25 requires the cyclase for proteolysis, likely forming a complex with the
cyclase77. Although, leader peptide proteolysis does not require the presence of the cyclase
protein in the case of fusilassin/fuscanodin78.
18
Figure 1.10. Lasso peptide gene clusters and biosynthesis. A. Generalized lasso peptide gene
cluster. Although all lasso peptide clusters have the genes ACEB, they are not necessarily
arranged in order depicted above. The E and B genes are sometimes fused into a single B gene.
B. General mechanism of lasso peptide biosynthesis.
Ubiquitously found in lasso peptide clusters and widespread in other RiPP gene clusters is the
RiPP recognition element (RRE). The RRE, which is present is roughly 50% of all RiPP clusters,
recognizes the leader sequence of the precursor peptide and enables lasso peptide proteolysis and
cyclization to occur78,79. The RRE forms a winged helix-turn-helix structure and interacts with
the leader peptidase through electrostatic interactions, some of which are under co-evolutionary
pressure78. In some gene clusters, including the microcin J25 gene cluster, the RRE is found
fused to the N-terminus of the lasso peptidase. Recently, Sumida et al. crystallized the
fusilassin/fuscanodin leader peptide with its cognate RRE80. They found that the RRE binds very
tightly to the leader peptide with a dissociation constant of 6 nM, and that conserved residues
play critical roles in the recognition of the leader sequence by the RRE. Specifically, the
conserved YxxP motif and a conserved leucine fit into a hydrophobic cleft formed by the RRE.
19
There is also evidence of coevolution between residues of the leader sequence and the RRE. The
conserved Tyr of the YxxP motif, as well as the conserved leucine are two of several residues
found to be under strong coevolutionary pressure78.
After the leader sequence is cleaved from the core sequence by the lasso peptidase, the second
lasso peptide biosynthesis enzyme, the lasso cyclase, catalyzes the cyclization of the peptide,
producing the mature lasso peptide. The lasso cyclase, which is homologous the aspartate-
dependent asparagine synthase AsnB, catalyzes the bond formation between the N-terminal
amine of the core peptide with a carboxylate macrolactam acceptor, either glutamate or aspartate,
ultimately producing a macrocycle. The Glu or Asp is located in the 8th or 9th and occasionally
the 7th position in the core sequence of the precursor peptide. The cyclase catalyzes macrolactam
formation presumably through adenylation of the carboxylate, thereby activating the carboxylate
for nucleophilic attack by the free N-terminal amine (Figure 1.11).
Figure 1.11. Proposed mechanism of microcin J25 biosynthesis. Although microcin J25
requires ATP for proteolysis, another lasso peptide, fusilassin/fuscanodin does not. Figure
adapted from Ortega and van der Donk, 201652.
In addition, lasso peptide biosynthetic gene clusters often contain ABC transporters. In microcin
J25, the dedicated ABC transporter, McjD, provides immunity to strains harbouring the microcin
biosynthesis genes81. Other post-translational modifications have been found to occur on some
lasso peptides, including phosphorylation, acetylation and methylation82–84.
The lasso peptide core sequence appears to be highly tolerant of substitutions. In a study
analyzing more than 380 single substitutions in the microcin J25 core sequence, Pavlova and
colleagues found that only three positions in the microcin J25 core sequence compromised
peptide stability85. Substitutions in most positions did not completely compromise RNA
polymerase inhibitory activity, demonstrating that lasso peptides are highly amenable to
engineering.
20
1.1.3.3 Activity of lasso peptides
The lasso peptides display diverse activities including antibacterial, anti-HIV and inhibition of
the glucagon receptor, endothelin B receptor, and cancer cell invasion86–89. Although diverse
activities have been reported for the lasso peptides, antibacterial activity is the most common. Of
the 69 studied lasso peptides, 21 have reported antibacterial activity and the targets of 8 of these
antibacterial lasso peptides have been investigated. Among these 8 lasso peptides, there are three
common targets: RNA polymerase, ClpC1P1P2 protease and cell wall/lipid II (Figure 1.12).
Figure 1.12. Antibacterial targets of lasso peptides. Figure from Tan et al., 20197.
1.1.3.3.1 Cell wall biosynthesis inhibitors
Siamycin-I, which is a 21-residue, class I lasso peptide produced by certain Streptomyces strains,
has been found to inhibit cell wall biosynthesis by targeting lipid II. It has antimicrobial activity
against many Gram-positive bacteria but not Gram-negatives90,91. Its antimicrobial activity
21
includes activity against pathogens such as vancomycin-resistant enterococci (VRE) and
methicillin-resistant Staphylococcus aureus, against both of which the minimum inhibitory
concentrations (MIC) of siamycin-I is 7μM. Daniel-Ivad et al. found that siamycin-I activates the
lia (lipid II-interfering antibiotics) promotor, suggesting that the antibiotic acts at the cell wall.
Further work by Tan et al., revealed that mutations in S. aureus that confer resistance to
siamycin-I were found in the walK/R genes92. The WalK/R two-component system is highly
conserved and involved in the regulation of cell metabolism93. Interestingly, the walK/R mutants
exhibited thickened peptidoglycan when compared to the wild type S. aureus. Further in vitro
enzymatic inhibition studies found that siamycin-I interacted with lipid II to prevent the
transglycosylation reaction catalyzed by penicillin-binding protein from occurring. Siamycin-I
displays some distinct differences from other lipid II-interfering antibiotics, including a specific
localization at the division septum of S. aureus and Bacillus subtilis and not resulting in the
accumulation of the of cytoplasmic peptidoglycan precursor, UDP-MurNAc-pentapeptide94.
Siamycin-I and its analogues have also been found to inhibit the entry of HIV into host cells
through binding to CD4, CCR5 and CXCR4 and to block fsr quorum sensing in Enterococcus
faecalis86,95,96.
The only other lasso peptide that has been found to target peptidoglycan synthesis is
streptomonomicin, which is produced by Streptomonospora alba and is a member of the class II
peptides that lack disulfide bridges97. Streptomonomicin has potent antibacterial activity against
various strains of the genus Bacillus including B. anthracis, the causative agent of anthrax,
against which the MIC is 2-4 μM. Similar to siamycin-I-resistant S. aureus, streptomonomicin-
resistant clones of B. subtilis were found to have mutations in the walR gene, including some
mutations that were identical between the resistant strains. This suggests that streptomonomicin
also targets the cell wall, although further experiments are required to determine its specific
molecular target.
1.1.3.3.2 RNA polymerase inhibitors
In contrast to siamycin-I and streptomonomicin, there are several lasso peptides produced by
Proteobacteria which target RNA polymerase in Gram-negative bacteria. These lasso peptides,
22
which all lack disulfide bonds and therefore all belong to class II, include microcin J25, the first
lasso peptide that was studied in-depth, capistruin, acinetodin, klebsidin and citrocin.
Microcin J25, a 21 amino acid plasmid-encoded peptide, was first discovered in 1992 by
Salomon and Farías73. Microcin J25 is produced by certain strains of Escherichia coli, and is
active against E. coli and Salmonella Newport at concentrations as low as 10 and 5 nM,
respectively. Initially, the mechanism of microcin J25 action was thought to be related to the
function of the cell envelope proteins fhuA, tonB, exbB and sbmA98,99. Later it was found that
mutations in the rpoC gene (which encodes the β’ subunit of RNA polymerase) confers microcin
resistance in E. coli100. RNA synthesis is impaired both in vitro and in vivo in E. coli treated with
microcin J25 and it is thought that the filamentous phenotype of microcin J25-treated E. coli may
result from impaired transcription of genes encoding cell division proteins.
It was then discovered that mutations in rpoB (encoding the β subunit of RNA polymerase) that
confer resistance to streptolydigin result in cross-resistance to microcin J25, suggesting a shared
mechanism of action101. Mutations conferring resistance to microcin J25 in both rpoC and rpoB
map to the secondary channel, which is thought to be important for nucleotide substrate access to
the active site as well as accepting the 3’ end of nascent RNA in backtracked elongation
complexes102. Indeed, microcin J25 binding completely obstructs the secondary channel,
inhibiting both the forward reaction of phosphodiester bond formation, and the reverse reaction
of pyrophosphorolysis103,104. A recent crystal structure has validated this view, demonstrating
that microcin binds deep within the RNA polymerase secondary channel, constricting the solvent
accessible channel to less than 5 Å105. Further, microcin J25 blocks folding of an important
mobile structural element of the β’ subunit called the trigger loop.
Much of the work understanding the mechanism of action of microcin J25 was performed prior
to a published structure that was correct. In fact, the first three published structures of microcin
J25 were later determined to be incorrect106–108. These structures proposed that microcin J25 was
a 21 amino acid peptide cyclized between its N and C terminus, as opposed to the lasso-like
structure known today109.
Another class II lasso peptide that targets RNA polymerase is capistruin. Capistruin is a 19
amino acid peptide, discovered in 2008 that is produced by Burkholderia thailandensis E264110.
23
It has antibacterial activity against certain strains of Burkholderia and E. coli, with MICs as low
as 12 and 25 μM, respectively. In 2011, Kuznedelov et al. showed that microcin J25-resistant
RNA polymerase is cross-resistant to capistruin, and that capistruin inhibits RNA polymerase-
dependent transcript elongation in vitro111. These results strongly suggested that capistruin and
microcin J25 have a common mechanism of action. Later, Braffman and colleagues determined
the structure of capistruin-bound RNA polymerase and found that the binding sites of capistruin
and microcin J25 largely overlap105. Among the differences, capistruin binds farther (12 Å) from
the RNA polymerase active site than does microcin J25 (6.5 Å) and as a result, capistruin does
not appear to restrict access of nucleotide substrates to the active site. Additionally, while
microcin competitively inhibits binding of nucleotides in the active site, capistruin binds too far
from the active site to be competitive with respect to nucleotide binding.
Acinetodin and klebsidin are two lasso peptide RNA polymerase inhibitors, produced by
Acinetobacter gyllenbergii CIP 110306 and Klebsiella pneumoniae 4541–2, respectively112.
Acinetodin and klebsidin were identified through a cysteine protease-guided genome mining
approach and heterologously expressed in E. coli. Acinetodin does not have antibacterial activity
against Gram-positive or Gram-negative bacteria, while klebsidin has very weak antibacterial
activity against certain strains of the genus Klebsiella.
Although acinetodin and klebsidin do not have strong antibacterial activity, in vitro testing
revealed that they are both inhibitors of RNA polymerase elongation112. Microcin J25, which
was used as a positive control, was the most potent RNA polymerase inhibitor, followed by
klebsidin, then finally acinetodin, which was significantly less potent. Further, a mutation in the
rpoC subunit of RNA polymerase that confers resistance to microcin J25 was found to result in
cross-resistance to acinetodin and klebsidin, indicating that similar to microcin J25 and
capistruin, acinetodin and klebsidin likely target the RNA polymerase secondary channel. A
crystal structure of acinetodin and klebsidin with RNA polymerase would reveal the differences
between the binding modes of acinetodin, klebsidin, capistruin and microcin J25.
Recently, a 19 amino acid class II lasso peptide from Citrobacter pasteurii and Citrobacter
braakii was characterized and also found to be an RNA polymerase inhibitor113. Citrocin has
antimicrobial activity against several Gram-positive strains of bacteria, with MICs as low as 16
24
μM. In spite of its weaker antimicrobial activity when compared to microcin J25, citrocin is a
more potent inhibitor of RNA polymerase. In fact, 100 μM of microcin J25 was required to
achieve the same level of RNA polymerase inhibition as 1 μM of citrocin. This suggests that
citrocin uptake is the factor limiting its antimicrobial activity.
1.1.3.3.3 ClpC1P1P2 protease inhibitors
Lassomycin, a class II lasso peptide, was identified in a screen of actinomycete extracts for those
that specifically inhibited the growth of Mycobacterium tuberculosis. Lassomycin, which is
produced by a Lentzea kentuckyensis sp, specifically inhibits the C1 subunit of the ClpC1P1P2
protease complex. Lassomycin potently inhibits strains of mycobacteria with MICs lower than 1
μM and is even able to inhibit the growth of multidrug-resistant M. tuberculosis. Lassomycin had
weaker activity against other Actinobacteria such as Propionibacterium (Cutibacterium) acnes,
and no activity against other Gram-positive or Gram-negative bacteria. Lassomycin-resistant
mutants of M. tuberculosis suggested that the target of lassomycin was the ClpC1 ATPase
subunit of the ClpC1P1P2, as all of the mutations mapped to this region. In vitro enzymatic work
revealed that lassomycin increased the ATPase activity of ClpC1, while decreasing the ability of
ClpC1P1P2 to perform proteolysis. This ability of lassomycin to decouple the ATP activity of
ClpC1 from proteolysis, represents a new antibiotic mechanism of action. Interestingly,
lassomycin was highly specific to the ClpC1P1P2 protease, and did not affect ATP hydrolysis in
any other AAA ATPases, including the E. coli ClpC1 homolog, ClpA.
Unlike nearly all other lasso peptides, the C-terminal tail of lassomycin is not threaded through
the N-terminal ring which, in contrast to threaded lasso peptides, allows for the chemical
synthesis of the peptide114. As a result of its potent anti-mycobacterial activity against resistant
strains and the ease with which it is able to be synthesized, lassomycin offers great therapeutic
promise115.
1.1.3.4 Discovery and Heterologous expression of lasso peptides
An advantageous feature of the RiPPs is their suitability for genome mining and heterologous
expression. The lasso peptide characterization in particular has benefitted from genome mining
and heterologous expression tools. Several groups have successfully characterized novel lasso
peptides, which they predicted to have unique features based on genomic data75,110,116. Currently,
25
there are six genome mining tools that are able to detect lasso peptide biosynthetic gene
clusters46,75,117–120. Perhaps the most commonly used genome mining tool for secondary
metabolite genome mining is AntiSMASH, which has integrated the RODEO lasso peptide
detection algorithm into its search function in its fourth and fifth releases.
Many of the lasso peptides that have been studied through heterologous expression, although the
study of actinobacterial lasso peptides has lagged behind the study of those from Proteobacteria
(Table 1.1). The most popular heterologous host for lasso peptide expression remains E. coli,
although several have been expressed in Streptomyces sp. and one in Sphingomonas
subterranean. To date, only two lasso peptides from Actinobacteria have been expressed in E.
coli: chaxapeptin and fuscanodin/fusilassin, which has been successfully produced in E. coli by
two separate groups. At 0.1 mg/L, the yield of heterologously-expressed chaxapeptin was much
lower than the 0.7 mg/L yield of the natively-expressed peptide121.
Table 1.2. Heterologously produced lasso peptides.
Peptide Name Native Organism Heterologous Host Organism
Class I
Siamycin-3 Streptomyces sp. S. coelicolor M1152
SSV 2083/Sviceucin Streptomyces sviceus S. coelicolor M1146
Class II
Albusnodin Streptomyces albus S. coelicolor M1146 and S. lividans 66
Astexin 1-3 Asticcacaulis excentricus E. Coli BL21
Benenodin-1 Asticcacaulis benevestitus E. Coli BL21
Brevunsin Brevundimonas diminuta Sphingomonas subterranea
Burhizin Burkholderia rhizoxinica E. Coli BL21
Capistruin Burkholderia thailandensis E. Coli BL21
Caulonodulin 1-7 Caulobacter sp. E. Coli BL21
Caulosegnin 1-3 Caulobacter segnis E. Coli BL21
Chaxapeptin Streptomyces leeuwenhoekii C58 E. Coli BL21
Citrocin Citrobacter pasteurii E. Coli BL21
Citrulassin Streptomyces albulus S. lividans 66
Fusilassin/Fuscanodin Thermobifida fusca E. Coli BL21
26
Klebsidin K. pneumoniae E. Coli BW25113
Microcin J25 E. coli AY25 E. Coli XL-1 Blue
Paeninodin Paenibacillus dendritiformis C454 E. Coli BL21
Rhodanodin Rhodanobacter thiooxydans LCS2 E. Coli BL21
Rubrivinodin Rubrivivax gelatinosus E. Coli BL21
Snou-LP Streptomyces noursei ATCC 11455 S. lividans TK24
Sphingonodin I-II Sphingobium japonicum E. Coli BL21
Sphingopyxin I-II Sphingopyxis alaskensis RB2256 E. Coli BL21
Syanodin-I Sphingobium yanoikuyae XLDN2-5 E. Coli BL21
Xanthomonin I-III Xanthomonas gardneri E. Coli BL21
Zucinodin Phenylobacterium zucineum HLK1 E. Coli BL21
9810-LP Streptomyces sp. ADI94-01 Streptomyces albus J1074
Class III
9401-LP1 Streptomyces sp. ADI94-01 S. albus J1074
1.2 Aim of this work
The aim of this thesis is to expand scientific knowledge about an emerging class of antibiotics,
the lasso peptides. Specifically, the aim of this project is to investigate a unique and
uncharacterized lasso peptide, LP2006. LP2006 is a structurally unique antibacterial lasso
peptide, which may indicate that it has a novel mechanism of action with respect to other
antibacterial lasso peptides. To facilitate the study of LP2006 and other lasso peptides, I intend
develop a system for the production of lasso peptides by heterologous expression. I attempt to
heterologously produce LP2006 in E. coli and several strains of Streptomyces, and successfully
detect the production of LP2006 in a host strain of S. coelicolor M1146.
27
Chapter 2 Materials and Methods
Materials and Methods
2.1 General experimental procedures
2.1.1 Materials
Unless otherwise stated, all chemicals were purchased from Sigma-Aldrich. Difco Marine Broth
2216 Agar was purchased from BD Biosciences. Bacto Agar, Bacto Malt Extract and Bacto
Yeast Extract were purchased from BD Biosciences.
2.1.2 Strains and plasmids used
Table 2.1. Strains and plasmids used in this study.
Strain/Plasmid Description Source
Environmental strains
Maritime Strains (Table 5.1) Isolates from the maritime provinces of eastern Canada
Nocardiopsis sp. HB141 (=H153) Environmental isolates from the sponge Halichondria panacea (harvested near Kiel, Germany)
(Schneemann et al., 2010)122
Cloning and expression strains
Streptomyces albus J1074 Used commonly for heterologous expression
Streptomyces avermitalis SUKA22 S. avermitalis containing a large, systematic deletions of nonessential genes
(Komatsu et al.,2013)123
Streptomyces coelicolor M1146 S. coelicolor M145, ∆cda ∆red ∆act ∆cpk (Gomes-Escribano and Bibb, 2011)124
Streptomyces coelicolor M1154 S. coelicolor M145, ∆cda ∆red ∆act ∆cpk + rpsL and rpoB mutations
Escherichia coli ET12567(pUZ8002) Methylation-deficient conjugal donor strain (dam-13::Tn9 dcm-6 hsdM Cmr)
Escherichia coli TOP10 General cloning host
Escherichia coli BL21(DE3) Protein expression host
Antimicrobial Testing strains
Bacillus subtilis 168 YB5018 dinC18::Tn917Iac metB5 trpC2 xin-1 SPβ- amyE+
(Jani et al., 2015)125
Bacillus subtilis 168 1A980 Em trpC2 liaI::pMUTIN attSPβ Bacillus Genetic Spore Center
Bacillus subtilis JH642 Common laboratory strain
Enterococcus ATCC 51299 Vancomycin-resistant ATCC
28
Enterococcus faecalis ATCC 29212 Vancomycin-sensitive ATCC
Escherichia coli BW25113 Common laboratory strain
Escherichia coli BW25113 ∆tolC ∆bamB Hyperpermeable strain of E. coli
Micrococcus luteus Antibacterial test strain
Mycobacterium smegmatis Antibacterial test strain
Saccharomyces cerevisiae Y7092 Anti-yeast test strain
Staphylococcus aureus ATCC BAA-41 Methicillin-resistant ATCC
Staphylococcus aureus ATCC 29213 Methicillin-sensitive ATCC
Staphylococcus epidermis ATCC 14990 Antibacterial test strain ATCC
Plasmids
pACYCDuet-1 Inducible co-expression plasmid Novagen
pRSFDuet-1 Inducible co-expression plasmid Novagen
pSET152-ermE*p Streptomyces overexpression plasmid Bibb et al., 1985126
pGEM T-Easy Cloning vector Promega
2.1.3 Primers used
Table 2.2. Primers used in this study.
Primer
Number Primer Name Sequence (5’ to 3’)
1 27F_16S_universal_primer GAGTTTGATCCTGGCTCA
2 1492R_16S_universal_primer TACGGCTACCTTGTTACGACTT
3 LpeA_For GCGCACACCATGGACGAAGAAAAGATCGGC
4 LpeA_Rev TAATTCAAGCTTTCAGCAGACCCGGACGCAGGA
5 LpeC_For GCGCACCATATGAAGTTCATCGTTCTTCCC
6 LpeC_Rev GACCACGATATCTCAGCCTTCCAGGATCGATAC
7 LpeE_For GCGCACACCATGGAATTCATCGACGACACG
8 LpeE_Rev TAATTCAAGCTTTCATCGCCGCAGCACCCCCAC
9 LpeB_For TAATTCCATATGACGGTACCCGTGGCCCTC
10 LpeB_Rev TAGCTCGATATCTCAGTCATCATCACGGACCAC
11 ACYCDuetUP1 GGATCTCGACGCTCTCCCT
12 DuetDOWN1 GATTATGCGGCCGTGTACAA
13 DuetUP2 TTGTACACGGCCGCATAATC
14 T7_Terminator GCTAGTTATTGCTCAGCGG
15 LpeACEBDD_For GCCGGTTGGTAGGATCAGGAGGATATCATATGGACGAAGAAAAGATCGGC
16 LpeACEBDD_Rev AAGCTTGGGCTGCAGGTCGACTCTAGACGGTCTCGCGACGCAGGTGGT
17 pSET152_ermE*_For GCTCACTCATTAGGCACCCCAGGC
18 pSET152_ermE*_Rev AGGGGGATGTGCTGCAAGGCG
29
2.1.4 Culture conditions
Nocardiopsis sp. HB141 was grown on either GYM medium (per L Milli-Q water: 4g yeast
extract, 10g malt extract, 4g dextrose), SMMS medium (per L Milli-Q water: 2g Difco casamino
acids, 5.3g TES buffer), ATCC medium 172 (per L Milli-Q water: 10g glucose, 20g soluble
starch, 5g yeast extract, 5g Bacto Peptone, 1g CaCO3), YEME medium (per L Milli-Q water:
10g glucose, 170g sucrose, 3g yeast extract, 5g Bacto Peptone, 3g malt extract) or TSB medium
(per L Milli-Q water: 2.5g glucose, 17g tryptone, 3g soytone, 5g NaCl, 2.5g K2HPO4). 16g per L
of Bacto agar was added to each media if solid growth medium was desired. Nocardiopsis sp.
HB141 was grown for 3 weeks at 30°C and extracted with methanol.
All strains used for antimicrobial testing, DNA manipulation and E. coli used for heterologous
expression were grown using LB medium (per L Milli-Q water: 10g tryptone, 10g NaCl, 5g
yeast extract) and grown at 37°C. All Streptomyces strains used for heterologous expression were
cultured on MYM medium (per L Milli-Q water: 4g yeast extract, 10g malt extract, 4g maltose,
16g agar) at 30°C unless otherwise indicated.
2.1.5 Heterologous expression of LP2006
For the heterologous expression of LP2006 in E. coli, the vectors pACYCDuet-1 and pRSFDuet-
1 were used. The genes lpeACEB were amplified from genomic DNA extracted from
Nocardiopsis sp. HB141 using the primers 3-8 (Table 2.2). A two-step reaction using Q5 DNA
polymerase was used for all PCR reactions unless otherwise specified due to the high GC content
of the template DNA and the high annealing temperature of the primers. The lpeAC gene
fragments were cloned into the pACYCDuet-1 vector, while the lpeEB gene fragments were
cloned into the pRSFDuet-1 vector, resulting in the vectors pACYCDuet-1-lpeAC and
pRSFDuet-1-lpeEB. The correct gene sequences were confirmed by Sanger sequencing with the
primers 11-14.
E. coli BL21(DE3), co-transformed with pACYCDuet-1-lpeAC and pRSFDuet-1-lpeEB was
grown at 37°C in 1L LB medium, induced with IPTG after reaching an OD of 0.4-0.8 and
returned to the shaking incubator for 4-16 hours at 20°C. Several IPTG concentrations were
tested, ranging from 50 μM to 500 μM. Cells were harvested, and the pellet was extracted with
methanol, sonicated and macerated overnight. The supernatant was combined with 20 g/L
30
XAD16 resin (Sigma Aldrich), stirred overnight, then removed by filtration. The resin was
washed several times with ddH2O, then adsorbed molecules were eluted with 100 mL of
methanol.
For the heterologous expression of LP2006 in S. coelicolor, the integrative vector pSET152-
ermE*p was used. The entire 8-gene LP2006 gene cluster was amplified from the Nocardiopsis
sp. HB141 genomic DNA using the primers 15 and 16 and cloned into pSET152-ermE*p. The
sequence was confirmed using the primers 11-16 and 17-18 (Table 2.2). The vector pSET152-
ermE*p-lpeACEBDD was transformed into E. coli ET12567(pUZ8002) to use as a conjugal
donor. Conjugation to S. coelicolor M1146, M1154, S. avermitalis SUKA22 and S. albus J1074
was performed according to the protocol outlined in Kieser et al., 2000127. Exconjugants were re-
streaked on MYM containing apramycin twice and genomic DNA was extracted to confirm that
the insert was present without mutations. S. coelicolor M1146 pSET152-ermE*p-lpeACEBDD
was grown on MYM and GYM media for 5-7 days and the production of LP2006 was assessed
by LC-MS.
2.2 Isolation and purification of bioactive metabolites
2.2.1 Metabolite extraction
Nocardiopsis sp. HB141 metabolites were extracted from agar or liquid cultures with HPLC-
grade methanol, using a volume of methanol equivalent to the volume of the culture or 200-300
mL, whichever is less. Organic solvent was evaporated from the extracts using a Genevac EZ-2
Elite series evaporator (SP scientific).
2.2.2 Flash chromatography purification
Crude extracts were resuspended in 5% aqueous HPLC-grade methanol to a concentration of 100
mg/mL. After centrifugation and/or filtration, the resuspended crude extracts were further
purified on a Reveleris® X2 Flash chromatography system (Buchi Labortechnik). A 20g C18 40-
60um 100Å cartridge (Aegio Technologies) was used for the separation by flash
chromatography, with a linear gradient from 5 to 100% aqueous HPLC-grade methanol at a flow
rate of 10mL/min. 20mL fractions were collected, dried by Genevac or rotary evaporation and
31
tested for bioactivity by broth microtiter dilution assay (5.2.1.3). Fractions that were bioactive
were pooled, resuspended and further purified by HPLC.
2.2.3 High-performance liquid chromatography purification
After flash chromatography, the Nocardiopsis sp. HB141 extract was further purified by HPLC
to study the activity of the bioactive metabolite(s). Individual and pooled bioactive flash
chromatography fractions were purified on a Waters Alliance HPLC with a Phenomonex Luna
C18 column (100 Å, 5 μm, 4.6x250mm). The Nocardiopsis sp. HB141 fractions from flash
chromatography were purified by HPLC over two steps. The first step involved the following 30-
minute linear solvent gradient of water/0.1% formic acid (solvent A) and acetonitrile/0.1%
formic acid was used: hold at 5% B for 2 minutes, followed by linear increase until 95% B at 20
minutes, hold at 95% B until 25 minutes, then return to 5% B until 30 minutes. The peak
containing LP2006 was collected and the fraction was dried by Genevac evaporator and
confirmed as LP2006 by mass spectrometry.
The second step involved the following 30-minute linear solvent gradient of water/0.1% formic
acid (solvent A) and acetonitrile/0.1% formic acid was used: hold at 20% B for 2 minutes,
followed by linear increase until 60% B at 20 minutes, hold at 60% B until 25 minutes, then
return to 20% B until 30 minutes. During both purification steps the column temperature was
35°C and the flow rate was 1 mL/min. Again, the LP2006-containing fraction was collected,
dried and confirmed by mass spectrometry.
2.2.4 Liquid chromatography mass spectrometry analysis
A Waters Xevo G2-S QTOF mass spectrometer with Acquity liquid chromatography was used to
analyze extract metabolites. An Acquity UPLC BEH C18 (1.7 μm 2.1*50mm) column was used
to achieve liquid chromatography separation of the sample with a column temperature of 40°C
and a flow rate of 0.2 mL/min. A 20-minute linear solvent gradient of water/0.1% formic acid
(solvent A) and acetonitrile/0.1% formic acid was used: linear increase from 5% to 95% B from
0-12 minutes, hold at 95% B until 17 minutes, return to 5% B at 18 minutes and hold at 5% B
until 20 minutes. Samples were analyzed in the positive mode, using the electrospray ionization
source.
32
2.3 Susceptibility testing
2.3.1 Disk diffusion assays
The test organism was inoculated from an agar streak plate into a 5mL liquid culture of LB or
YPD media, depending on the organism. The cultures were grown in a shaking incubator
overnight at 30°C or 37°C, depending on the test organism. The next day, the cultures were
diluted 1:100 into fresh media and returned to the shaking incubator. Cultures were grown to an
OD600 of 0.4-0.6, diluted 1:1000 in LB or YPD media and inoculated onto agar plates of the
desired medium to produce a lawn of growth. 6 mm paper filter disks (BS Biosciences) were
placed on the agar plates and 2-10 uL of crude extract resuspended in DMSO were placed onto
the filter disks. The agar plates were incubated overnight at 30°C or 37°C depending on the test
organism and the plates were imaged in the morning and the zone of inhibition surrounding each
filter disk was observed.
2.3.2 Broth microtiter dilution assay
The test organism was inoculated from an agar streak plate into a 5mL liquid culture of YPD
medium for S. cerevisiae or LB medium for all other test organisms. The liquid culture was
grown overnight at 30°C (for S. cerevisiae) or at 37°C for (all other organisms) and a 1:100
subculture was started in the morning. Each culture was grown to an OD of 0.4-0.6 and diluted
1:1000 with fresh media in a 96-well plate. The test compound or extract, resuspended in
DMSO, was added to each well and the plate was incubated overnight. The next morning, the
OD600 of each well was measured. When testing extracts, the extract was considered active if
inhibition of growth was greater than 50%. For the determination of MICs, the same protocol
was followed and antibiotics at twofold increasing concentrations were added to the 96 well plate
liquid cultures.
2.4 Target identification
2.4.1 LacZ reporter assay
Disk diffusion assays were performed using two B. subtilis lacZ reporter strains with 8mg/mL X-
gal added to monitor either cell envelope stress of the induction of the SOS response. The B.
33
subtilis reporter strain 1A980 (liaI-lacZ fusion) while the strain YB5018 was used to monitor the
DNA damage SOS response (dinC-lacZ fusion).
Results and discussion
3.1 Nocardiopsis sp. HB141 extract testing
3.1.1 Extracts of Nocardiopsis sp. HB141 have antibacterial activity
In a search for novel antimicrobial natural products, nearly 50 strains of marine bacteria were
screened against M. luteus, B. subtilis, E. coli, and S. cerevisiae. Each strain was grown on
several media types for 5 days, extracted with organic solvent and tested for antibacterial or anti-
yeast activity in a broth microtiter dilution assay (for details about the screen see section 5.3.1.2).
The extract was considered a hit if it produced a 50% reduction in the OD600 value of the
indicator organism as compared to the control. Among the hit strains was Nocardiopsis sp.
HB141, which was isolated from homogenates of the marine sponge Halichondria panacea
harvested in the Baltic Sea near Kiel, Germany122. Extracts of Nocardiopsis sp. HB141, grown
on GYM medium, have antibacterial activity against the Gram-positive bacteria M. luteus and B.
subtilis, as demonstrated by the growth inhibitory effect of the extracts in broth microtiter
dilution and disk diffusion assays (Figure 3.1).
Figure 3.1. Disk diffusion assay of Nocardiopsis sp. HB141 extract. DMSO or Nocardiopsis
sp. HB141 extract was added to the filter disk, which was placed on a lawn of bacteria grown on
an agar plate. The HB141 extract inhibits growth of B. subtilis and M. luteus, as indicated by the
zone of growth inhibition surrounding the filter disk demonstrating that has antibacterial activity
against these test organisms.
34
3.1.2 Nocardiopsis sp. HB141 is a producer of an antibacterial lasso peptide, LP2006
To identify bioactive metabolites that were responsible for the antibacterial activity of the
Nocardiopsis sp. HB141 extract, I analyzed the extract by LC-MS. Metabolite profiling by LC-
MS revealed that the HB141 crude extract contained a mass that was not present in the media
control extract, which eluted at 5 minutes (Figure 3.2). Based on the averaged mass spectra of
the sample, the mass of the identified peak was 1002.9335 m/z and was identified as an M+2H
ion based on the isotope pattern.
Figure 3.2. Extracted ion chromatogram of LP2006 M+2H mass. LC-MS chromatogram of
the ion 1002.93 m/z, the most abundant ion of LP2006. The ion is present in the HB141 crude
extract, but absent in the media control extract.
Next, I used The Dictionary of Natural Products to determine if there is a known natural product
with this mass. I found that the mass and fragmentation pattern of the Nocardiopsis sp. HB141
metabolite matches the reported values of a recently discovered lasso peptide, LP200675 (Figure
3.3 and Table 1.1). LP2006 was identified by a genome-mining tool and it is the establishing and
only member of the class IV lasso peptides.
The error values on all detected ions were all lower than 2 ppm, which is well within the
instrument error of the mass spectrometer. Additionally, there is a close phylogenetic
relationship between Nocardiopsis sp. HB141 and the strain from which LP2006 was first
discovered, Nocardiopsis alba NRRL B-24146. Since there is often a close association between
35
bacterial chemotype and phylotype, this provides more evidence that Nocardiopsis sp. HB141 is
a producer of LP2006128. Collectively, the phylogenetic data and the mass spectra strongly
suggest that Nocardiopsis sp. HB141 is a producer of LP2006.
Figure 3.3. Mass spectrum of the Nocardiopsis sp. HB141 mass of 1002.9335 m/z. The amino
acid sequence of LP2006 is overlaid on the spectrum and the ions are assigned based on the
values reported for LP2006 by Tietz et al., 201775.
Table 3.1. Ion comparison of HB141 mass and LP2006
Ion Calculated
Mass (Da)
Observed
Mass (Da) Error (ppm)
y6+ 664.2905 664.2905 0
y7+ 850.3698 850.3683 -1.7
[M+2H]2+ 1002.9338 1002.9335 -0.3
b10+ 1155.4966 1155.4951 -1.3
3.1.3 Purification of LP2006
To study the activity of LP2006, I decided to purify the peptide. I started with purification by
flash chromatography, a preparative method for the rapid purification of crude extracts. After
purification by flash chromatography, only two fractions retained antibacterial activity, fractions
6 and 7 (Figure 3.4). I found that fractions 6 and 7 contained the vast majority of the eluted
36
LP2006, with other fractions containing only trace amounts. These results are consistent with the
hypothesis that LP2006 is responsible for the antibacterial activity of the Nocardiopsis sp.
HB141 crude extract.
Figure 3.4. Disk diffusion assay from flash chromatography fractionated Nocardiopsis sp.
HB141 extract. The flash chromatography fractions of the purified Nocardiopsis sp. HB141
extract are added to a filter disk, which is placed on a lawn of M. luteus or B. subtilis. Fractions 6
and 7 were able to inhibit growth of M. luteus or B. subtilis, while the remaining fractions and
the DMSO control were not able to.
LP2006 was further purified in a two-step HPLC purification to remove co-eluting compounds
(Figure 3.5 and Figure 3.6). The purity of the LP2006 was confirmed by LC-MS and HPLC.
After the three-step purification, the yield of pure LP2006 was less than 100 μg per L of GYM
agar. Nocardiopsis sp. HB141 requires ~3 weeks to reach the sporulation stage of its growth on
GYM agar medium, which is substantially longer than the less than 1 week typical for the
secondary metabolite-rich Streptomyces to sporulate on solid media. As a result, the purification
of LP2006 from Nocardiopsis sp. HB141 is time and labour-intensive. Additionally,
Nocardiopsis sp. HB141 does not grow in the liquid growth media GYM, MYM, or YEME and
only grows on the solid growth media, GYM, MYM or ATCC172 agar. To combat such
challenges, I sought to produce LP2006 through another means. Chemical synthesis has not been
demonstrated for the lasso peptides (with the exception of lassomycin), thus I decided to pursue
the heterologous expression of LP2006. Lasso peptides are generally highly amenable to
heterologous expression, owing to the fact that their biosynthesis requires very few genes
(1.1.3.4).
37
Figure 3.5. HPLC chromatogram of first-round purification of LP2006. The major peaks
were collected and analyzed by mass spectrometry to determine which peak corresponded to
LP2006. The LP2006 peak was then further purified.
Figure 3.6. HPLC chromatogram of second-round purification of LP2006. The major peaks
were collected and analyzed by mass spectrometry to determine which peak corresponded to
LP2006.
38
3.2 Heterologous expression of LP2006
3.2.1 Heterologous expression in Escherichia coli
Since Nocardiopsis sp. HB141 is a slow-growing organism and the yields of LP2006 are very
low, I decided to heterologously express the peptide in a host strain. I decided to use E. coli to
heterologously express LP2006 as there has been much success expressing lasso peptides using
E. coli, although, at the time, no other labs had been able to heterologously express lasso
peptides from Actinobacteria in E. coli (Table 1.2).
As LP2006 was originally identified from a strain of Nocardiopsis alba, I searched the NCBI to
see if there were any genome sequences of N. alba available. Indeed, there are three N. alba
published, each of which contains a gene cluster capable of producing LP2006, as verified by
AntiSMASH. The LP2006 biosynthetic gene clusters of each of these three strains have >98%
sequence identity, with no differences in the sequence of the core peptide (Table 3.2). Based on
the high sequence identity between the LP2006 gene clusters and the taxonomic similarity
between N. alba DSM 43377 and Nocardiopsis sp. HB141, I reasoned that the LP2006 gene
cluster of Nocardiopsis sp. HB141 is likely highly similar to those in published genomes
sequences and to be amenable to amplification with primers based on published genome
sequences. Therefore, I designed primers based on the LP2006 cluster of N. alba DSM 43377,
with the primers designed to separately amplify the lpeACEB genes in the cluster (Table 2.2).
The lpeACEB genes are the core genes responsible for biosynthesis, while there are two
transporter genes in the cluster that I did not amplify and two genes flanking the ABC
transporters that are unrelated to the biosynthesis of LP2006 (Figure 3.7). The lpeACEB genes
were cloned into the protein expression vectors pACYCDuet-1 and pRSFDuet-1, with each gene
under the control of its own IPTG-inducible promotor (Figure 3.8).
39
Table 3.2. Sequence identity of LP2006 biosynthetic proteins of Nocardiopsis alba ATCC
BAA-2165 and Nocardiopsis sp. TP-A0876 compared to Nocardiopsis alba DSM 43377.
Strain LpeA
(Precursor)
LpeC
(Lasso
cyclase)
LpeE (RiPP
recognition
element)
LpeB
(Leader
peptidase)
LpeD1
(ABC
transporter)
LpeD2
(ABC
transporter)
Nocardiopsis alba ATCC BAA-2165
100.0 98.2 100.0 100.0 99.0 99.7
Nocardiopsis sp. TP-A0876
100.0 99.7 100.0 100.0 100.0 98.6
Figure 3.7. LP2006 biosynthetic gene cluster from N. alba DSM 43377. The cluster contains 6
genes important for the biosynthesis of LP2006, lpeACEB, two ABC transporters for export of
LP2006, and two genes flanking the transporters which are unrelated to the biosynthesis of
LP2006.
40
Figure 3.8. Vectors used for E. coli heterologous expression. The lpeACEB genes were
amplified from Nocardiopsis sp. HB141 using primers designed from the LP2006 gene cluster
from N. alba DSM 43377.
Heterologously expressed LP2006 in E. coli was undetectable by LC-MS under any tested
condition. The conditions manipulated included changing induction time, induction temperature,
inducer (IPTG) concentration. Other groups have been unable to express or have had incredibly
low yields expressing actinobacterial lasso peptides in E. coli, although it is not clear why this is
the case. In fact, only two lasso peptides from Actinobacteria have been expressed E. coli,
chaxapeptin and fusilassin/fuscanodin, although others have tried unsuccessfully83. It is likely
that additional failed heterologous expression attempts have gone unreported in the literature.
Chaxapeptin was the first successful expression of an actinobacterial lasso peptide in E. coli,
although the yield of the expression was 0.1 mg/L, which is lower than the yield of the natively-
produced chaxapeptin at 0.7 mg/L121. Martin-Gomez and colleagues used an approach where the
four chaxapeptin biosynthesis genes, cptACEB, were cloned into a single vector for expression.
cptA was placed under the inducible T7 promotor, while cptCEB were placed under the promotor
from the microcin J25 biosynthesis cluster. Following chaxapeptin, two groups were able to
independently produce the lasso peptide fusilassin/fuscanodin. The first group, who did not
report their final yield, took an approach of expressing the five biosynthesis genes tfuACEBD on
a single plasmid129. The second group took a similar approach used in this study whereby tfuA
was cloned into the pET28 vector and the tfuCEB genes were cloned into the pACYC vector. A
41
numerical value is not reported for the final yield by this method, although the yield is reported
to be “low”78.
It is possible that the transporter genes may be required for proper biosynthesis of LP2006. In
their heterologous expression of fusilassin/fuscanodin, Koos and Link included the transporter
gene in construct for heterologous expression, although it is not clear if the gene is required for
biosynthesis. Other groups have been able to heterologously express lasso peptides without the
transporter gene(s) present on the expression plasmid. Additionally, the ABC transporters were
not required during in vitro synthesis of the lasso peptides, microcin J25, paeninodin and
fusilassin/fuscanodin76–78,129,130. When recombinantly expressing proteins in E. coli, an approach
often taken to overcome low or no expression is to correct for codon bias in the recombinant
gene131. Koos and Link codon optimized the tfuE and tfuB genes for the in vitro biosynthesis of
fusilassin/fuscanodin129. In other classes of RiPPs, the biosynthetic genes have been codon
optimized for heterologous expression, although the optimization has not always resulted in
higher yields132,133.
I decided to investigate the production of the LP2006 biosynthesis enzymes by SDS-PAGE. As
no antibodies are available against LpeACEB, I relied simply on the observance of induced
bands in crude cell lysates. I compared the cell lysates of E. coli transformed with pACYC-
lpeAC and pRSF-lpeEB and E. coli transformed with the pACYC and pRSF empty vectors
(Figure 3.9). A single, prominent band is observed in +lpeACEB lanes at the expected molecular
weight for LpeC (68 kDa), becoming more prominent in the three hours following induction. It is
likely that this band corresponds to LpeC, although analysis by western blot or mass
spectrometry is required for confirmation. Despite my efforts, the remaining proteins (LpeA: 2
kDa, LpeE: 10 kDa and LpeB: 16 kDa) were not detectable by SDS-PAGE.
42
Figure 3.9. Protein expression testing of LpeCEB. The crude cell lysates of E. coli either
containing the vector with the lpeACEB genes or containing the empty vectors are compared.
The cells are induced with IPTG and are harvested at induction, or 1, 2 or 3 hours post-induction.
The appearance of a band at the molecular weight of LpeC is visible post-induction in the
lpeACEB-containing cells. Cells were grown at 37°C, and induced with 100 uM IPTG at 20°C.
It is becoming clear that the success of a heterologous expression experiment is dependent on the
lasso peptide and its biosynthetic enzymes as well as the host organism. It is therefore difficult to
predict whether the expression will be successful and what the resulting yield will be. Although
there have bene significant challenges associated with the expression of actinobacterial lasso
peptides in E. coli, the expression of these peptides in an actinobacterial host has been
successful. In light of these findings, I shifted my approach to express LP2006 in a Streptomyces
host strain.
43
3.2.2 Heterologous expression in Streptomyces coelicolor M1146
To overcome the challenges of expressing an actinobacterial lasso peptide in E. coli, I attempted
to heterologously express LP2006 in a host more closely related to Nocardiopsis sp. HB141. I
chose to try several strains of Streptomyces sp. that have been designed for the heterologous
expression of secondary metabolites, S. coelicolor M1146 and M1154 and S. avermitalis
SUKA22. S. coelicolor M1146 and M1154 are strains that were derived from S. coelicolor M145
through the deletion of four endogenous secondary metabolite gene clusters, allowing for the
strains to allocate resources for the production of heterologous secondary metabolites124. S.
coelicolor M1154 contains two additional point mutations in rpoB and rpsL from S. coelicolor
M1146, which have both been shown to enhance levels of antibiotic production134,135.
Additionally, I tried using S. albus J1074, a strain commonly used as a chassis strain for the
production of secondary metabolites due to its naturally minimized genome and fast growth136.
In contrast to the approach taken the heterologous expression of LP2006 in E. coli, for the
heterologous expression in the Streptomyces host strains, I PCR-amplified and cloned the entire
LP2006 cluster into a cloning vector (Figure 3.10). This approach takes into account the
possibility that the ABC transporters are required for LP2006 biosynthesis. The entire cluster
was cloned into a modified version of the nonreplicative pSET152 plasmid, which contains the
attP site and the integrase φC31 and can integrate in a site-specific manner into the attB site of
the chromosomal φC31 phage. A version of the pSET152 plasmid containing the promotor of the
erythromycin resistance gene (ermE), modified to provide strong, constitutive expression, was
used in this study126.
44
Figure 3.10. Construct used for S. coelicolor heterologous expression. The entire LP2006
gene cluster was amplified from Nocardiopsis sp. HB141 and cloned into the vector pSET152,
containing the constitutive promotor ermE*p.
Conjugation was attempted using the strains S. coelicolor M1146, M1154, S. avermitalis
SUKA22 and S. albus J1074, but exconjugants were only detected from S. coelicolor M1146 and
M1154. S. coelicolor M1154 exconjugants had a substantial growth defect, thus S. coelicolor
M1146 was chosen for the heterologous expression of the peptide. The integration of pSET152-
ermE*p-lpeACEBDD was confirmed by PCR amplification and Sanger sequencing; no mutations
were present in the cluster.
LP2006 was detected in trace quantities by LC-MS from 5 day MYM cultures, eluting in two
peaks (Figure 3.11).The elution pattern contrasts with that of LP2006 produced by Nocardiopsis
sp. HB141, which elutes in one peak just before 5 minutes. The mass and fragmentation pattern
of the peaks at 5 and 5.5 minutes are identical, suggesting that the molecule eluting at 5.5
minutes exists in a slightly different conformation than then peak at 5 minutes. The peak at 5.5
minutes may correspond to the unthreaded conformation of LP2006, although additional
experiments would be required to test this hypothesis.
45
Figure 3.11. Detection of heterologously expressed LP2006 by mass spectrometry. Mass
spectrometry chromatogram of the ion 1003.43 m/z, the [M+2H]2+ and most abundant ion of
LP2006. LP2006 is detected in the S. coelicolor M1146 pSET152-ermE*p-lpeACEBDD culture
but not the S. coelicolor M1146 negative control culture.
Additionally, there is a mass discrepancy between LP2006 produced by Streptomyces M1146
and Nocardiopsis sp. HB141 (Table 3.3). Although the y6+ and y7+ ions (corresponding to the
charged C-terminal fragments of the peptide) are at the expected masses for the peptide, the b10+
and b11+ ions are shifted approximately 1000 mDa higher than expected. This suggests that there
is either a mutation in the peptide or a modification on the peptide on the N-terminal half of the
peptide. A single-nucleotide N4D or N9D mutation would result in a mass shift of 0.98401 Da,
consistent with the experimental evidence. However, no mutations were detected in the precursor
peptide when sequenced after conjugation into the S. coelicolor M1146. It is possible that the
strain may have acquired a mutation in the peptide after the conjugation stage, perhaps in
response to peptide toxicity. Another possibility is that the mass shift is a result of a post-
translational modification occurs on the peptide. Analogous to N4D or N9D mutations,
nucleophilic addition of a water in the side chain of either Asn4 or Asn9 would yield the mass
observed by LC-MS. Unfortunately, the low ion intensity of the heterologous LP2006 precludes
the measurement of more accurate ion masses which would be valuable in determining the exact
molecular formulae of the peptide and fragment ions. Additionally, the low yield precludes
structure determination by NMR, which would reveal both modifications and the conformation
of the LP2006.
46
Table 3.3. Comparison of LP2006 masses from the Nocardiopsis sp. HB141 and those
produced by heterologous expression in S. coelicolor M1146.
Ion Calculated
Mass (m/z)
HB141 Extract M1146 Extract
Observed
Mass (m/z) Error (mDa)
Observed
Mass (m/z) Error (mDa)
y6+ 664.2905 664.2905 0 664.2877 -2.8
y7+ 850.3698 850.3683 -1.7 850.3655 -4.3
[M+2H]2+ 1002.9338 1002.9335 -0.3 1003.4315 497.7
b10+ 1155.4966 1155.4951 -1.3 1156.5081 1011.5
b11+ 1341.5759 1342.5654 989.5
Regardless of the exact nature of the heterologously produced LP2006, the yield of the peptide
was still too low to purify or perform functional studies. The peptide was undetectable by UV-
Vis, and only detectable in trace amounts by LC-MS. Other groups have had similar issues with
peptides expressed in Streptomyces host strains. Zong et al. attempted to heterologously express
albusnodin, encoded in the host strain S. albus DSM 41398, in the strains S. coelicolor M1146, S.
lividans 66 and S. albus J107483. Albusnodin was detected in S. coelicolor M1146 and S. lividans
66 cultures but surprisingly not in S. albus J1074. In all cases, albusnodin was truncated by a
single amino acid at the C-terminus, and it was only detectable by mass spectrometry due to low
yields, precluding NMR studies. The expression of lasso peptides in host Streptomyces strains
has worked for some groups, with some reported yields has high as 6-15 mg/L75,137.
3.3 Bioactivity of LP2006
In the absence of a heterologous producer of LP2006, I shifted efforts to produce the peptide
from the native strain, Nocardiopsis sp. HB141. Large-scale batch cultures of Nocardiopsis sp.
HB141 grown on GYM agar using aluminum baking sheets allowed the purification of nearly 1
mg of LP2006. Pure LP2006 from Nocardiopsis sp. HB141 was tested for antibacterial activity
using the broth microtiter dilution method but no activity was observed (Figure 3.12). The
solubility of the peptide was very likely the reason why no antibacterial activity was observed in
this case as precipitate was visible when resuspending the peptide into the stock solution to
perform the testing.
47
Figure 3.12. Antibacterial MIC testing of pure LP2006. LP2006 was tested in duplicate
against B. subtilis, E. coli and E. coli ∆tolC ∆bamB using the broth microtiter dilution assay.
Antibacterial activity was retested by disk diffusion assay with the peptide leftover from the first
round of antibacterial testing and with newly purified peptide. LP2006 was resuspended in
DMSO to a lower concentration to prevent precipitation and was tested against the liaI-lacZ
fusion strain, B. subtilis 1A980. LP2006 does not appear to activate the cell wall stress response
gene liaI, indicted by the absence of a blue ring surrounding the zone of inhibition of LP2006
(Figure 3.13). This result contrasts with the lipid II-targeting lasso peptide, siamycin I, which
does activate liaI, suggesting that the antibacterial target of LP2006 may not be the cell wall.
Figure 3.13. LP2006 does not activate the cell wall stress response gene liaI in B. subtilis
1A980. The presence of a blue ring indicates the activation of liaI, resulting in production of
LacZ.
48
This result may indicate that LP2006 does not target the cell wall, although further experiments
are required to rule out the cell wall as a target. More LP2006 is required to test against the
activation of the SOS response dinC gene using the dinC-lacZ reporter strain B. subtilis YB5018.
Additionally, LP2006-resistance mutants would like prove highly useful in elucidating the target
of LP2006.
Conclusions and future directions
The RiPPs are a diverse and underexplored class of peptides many of which have potent activity.
A subclass of the RiPPs, the lasso peptides, are highly stable to heat and proteolysis owing to
their eponymous structure and disulfide bonds. Many lasso peptides have antimicrobial activity,
targeting RNA polymerase, the ClpC1 protease and lipid II with unique mechanisms. The targets
of 8 lasso peptides have been characterized to date, and many more with antibacterial activity
have uncharacterized targets. LP2006, produced by Nocardiopsis sp. HB141, is a structurally
unique lasso peptide as the only class IV lasso peptide reported to date. It has antibacterial
activity against Gram-positive bacteria including Bacillus anthracis, vancomycin-resistant
Enterococcus faecium and Mycobacterium smegmatis. To investigate the activity of LP2006, the
heterologous expression of the peptide was pursued. First, expression was attempted using an E.
coli host strain, but with LP2006 remaining undetectable by LC-MS and the absence of
comparable expression in the literature, a strategy using a Streptomyces host strain was pursued
instead. LP2006 was successfully heterologously expressed in Streptomyces coelicolor M1146 as
detected by mass spectrometry, but low yield precluded any further experiments with the
heterologously expressed peptide. Additionally, an unexplained shift in the mass and retention
time calls into question the structure and conformation of the heterologously expressed peptide.
Ultimately, the LP2006 was purified from the native strain, Nocardiopsis sp. HB141, and tested
for antimicrobial activity and the activation of the cell wall stress response gene liaI. LP2006
does not appear to activate liaI, unlike the lasso peptide siamycin-I. This suggests that LP2006
differs from siamycin-I in its antibacterial mechanism and considering its unique structure, may
ultimately prove to have a mechanism unique from all other antibacterial lasso peptides.
Exploring the biology and chemistry of novel classes of antimicrobial compounds such as the
lasso peptides is important in the current climate of escalating antibiotic resistance. Identifying
49
the target of LP2006 will expand our knowledge of both the lasso peptides and the ability of
nature to produce chemically and functionally diverse molecules. In particular, the generation of
LP2006-resistant mutants would likely provide insight into the mechanism of action of the
peptide, at least revealing whether LP2006 shares a mechanism of action with the other
antibacterial lasso peptides. LP2006 could be screened against a library such as the B. subtilis
single gene deletion library to reveal LP2006-resistant and/or hypersensitive strains138.
Dependent upon which genes confer resistance to LP2006 and which B. subtilis single gene
deletion strains have altered susceptibility, molecular target inhibition assays could be performed
to understand the nature of its activity. Ultimately, a crystal or NMR structure would reveal the
precise interactions between LP2006 and its target. I believe this study has helped understand a
promising and understudied group of antibiotics, the lasso peptides, which will enable their
translation into therapeutic and industrial applications.
50
References
1. Newman, D. J. & Cragg, G. M. Natural Products as Sources of New Drugs from 1981 to
2014. J. Nat. Prod. 79, 629–661 (2016).
2. Arnison, P. G. et al. Ribosomally synthesized and post-translationally modified peptide
natural products: overview and recommendations for a universal nomenclature. Nat. Prod.
Rep. 30, 108–160 (2013).
3. Further Observations on an Inhibitory Substance (Nisin) From Lactic Streptococci. Lancet
250, 5–8 (1947).
4. Highland, J. H. et al. Identification of a Ribosomal Protein Necessary for Thiostrepton
Binding to Escherichia coli Ribosomes. J. Biol. Chem. 250, 1141–1145 (1975).
5. Olivera, B. M. et al. Peptide neurotoxins from fish-hunting cone snails. Science 230,
1338–1343 (1985).
6. Schmidtko, A., Lötsch, J., Freynhagen, R. & Geisslinger, G. Ziconotide for treatment of
severe chronic pain. Lancet 375, 1569–1577 (2010).
7. Tan, S., Moore, G. & Nodwell, J. Put a Bow on It: Knotted Antibiotics Take Center Stage.
Antibiotics 8, 117 (2019).
8. Woodward, S. R., Cruz, L. J., Olivera, B. M. & Hillyard, D. R. Constant and
hypervariable regions in conotoxin propeptides. EMBO J. 9, 1015–20 (1990).
9. Hensens, O. D. & Albers-Schönberg, G. Total structure of the peptide antibiotic
components of thiopeptin by 1H and 13C NMR spectroscopy. Tetrahedron Lett. 19,
3649–3652 (1978).
10. Wieland Brown, L. C., Acker, M. G., Clardy, J., Walsh, C. T. & Fischbach, M. A.
Thirteen posttranslational modifications convert a 14-residue peptide into the antibiotic
thiocillin. Proc. Natl. Acad. Sci. 106, 2549–2553 (2009).
11. Kelly, W. L., Pan, L. & Li, C. Thiostrepton Biosynthesis: Prototype for a New Family of
Bacteriocins. J. Am. Chem. Soc. 131, 4327–4334 (2009).
12. SU, T. L. Micrococcin, an antibacterial substance formed by a strain of Micrococcus. Br.
J. Exp. Pathol. 29, 473–81 (1948).
13. Bagley, M., Dale, J., Merritt, E. & Xiong, X. Thiopeptide Antibiotics. Chem. Rev. 105.
685-714 (2005).
14. Cromwell, G. L., Stahly, T. S., Speer, V. C. & O’Kelly, R. Efficacy of Nosiheptide as a
51
Growth Promotant for Growing-Finishing Swine-A Cooperative Study. J. Anim. Sci. 59,
1125–1128 (1984).
15. Dennis, S. M., Nagaraja, T. G. & Dayton, A. D. Effect of lasalocid, monensin and
thiopeptin on rumen protozoa. Res. Vet. Sci. 41, 251–256 (1986).
16. Miyairi, N. et al. Thiopeptin, a new feed additive antibiotic: microbiological and chemical
studies. Antimicrob. Agents Chemother. 1, 192–6 (1972).
17. Liao, R. et al. Thiopeptide biosynthesis featuring ribosomally synthesized precursor
peptides and conserved posttranslational modifications. Chem. Biol. 16, 141–7 (2009).
18. Morris, R. P. et al. Ribosomally Synthesized Thiopeptide Antibiotics Targeting
Elongation Factor Tu. J. Am. Chem. Soc. 131, 5946–5955 (2009).
19. Li, Y.-M. et al. From Peptide Precursors to Oxazole and Thiazole-Containing Peptide
Antibiotics: Microcin B17 Synthase. Science (80-. ). 274, 1188–1193 (1996).
20. Lee, S. W. et al. Discovery of a widely distributed toxin biosynthetic gene cluster. Proc.
Natl. Acad. Sci. 105, 5879–5884 (2008).
21. Dunbar, K. L., Melby, J. O. & Mitchell, D. A. YcaO domains use ATP to activate amide
backbones during peptide cyclodehydrations. Nat. Chem. Biol. 8, 569–575 (2012).
22. Zhang, Z. et al. Biosynthetic Timing and Substrate Specificity for the Thiopeptide
Thiomuracin. J. Am. Chem. Soc. 138, 15511–15514 (2016).
23. Bycroft, B. W. & Gowland, M. S. The structures of the highly modified peptide antibiotics
micrococcin P1 and P2. J. Chem. Soc. Chem. Commun.6, 256-258 (1978).
24. Yu, Y. et al. Nosiheptide biosynthesis featuring a unique indole side ring formation on the
characteristic thiopeptide framework. ACS Chem. Biol. 4, 855–64 (2009).
25. Zhang, Q. et al. Radical-mediated enzymatic carbon chain fragmentation-recombination.
Nat. Chem. Biol. 7, 154–60 (2011).
26. Hudson, G. A., Zhang, Z., Tietz, J. I., Mitchell, D. A. & Donk, W. A. van der. In Vitro
Biosynthesis of the Core Scaffold of the Thiopeptide Thiomuracin. J. Am. Chem. Soc.
137, 16012 (2015).
27. Bower, J. et al. Structure-based design of agents targeting the bacterial ribosome. Bioorg.
Med. Chem. Lett. 13, 2455–2458 (2003).
28. Weisblum, B. & Demohn, V. Thiostrepton, an inhibitor of 5OS ribosome subunit function.
J. Bacteriol. 101, 1073–5 (1970).
52
29. Harms, J. M. et al. Translational Regulation via L11: Molecular Switches on the
Ribosome Turned On and Off by Thiostrepton and Micrococcin. Mol. Cell 30, 26–38
(2008).
30. Cundliffe, E. et al. Ribosomes in thiostrepton-resistant mutants of Bacillus megaterium
lacking a single 50 S subunit protein. J. Mol. Biol. 132, 235–252 (1979).
31. Cameron, D. M., Thompson, J., Gregory, S. T., March, P. E. & Dahlberg, A. E.
Thiostrepton-resistant mutants of Thermus thermophilus. Nucleic Acids Res. 32, 3220–
3227 (2004).
32. Porse, B. T., Leviev, I., Mankin, A. S. & Garrett, R. A. The antibiotic thiostrepton inhibits
a functional transition within protein L11 at the ribosomal GTPase centre. J. Mol. Biol.
276, 391–404 (1998).
33. Wienen, B. et al. Ribosomal protein alterations in thiostrepton- and Micrococcin-resistant
mutants of Bacillus subtilis. J. Biol. Chem. 254, 8031–41 (1979).
34. Hummel, H. & Böck, A. Thiostrepton resistance mutations in the gene for 23S ribosomal
RNA of halobacteria. Biochimie 69, 857–61 (1987).
35. Thompson, J., Schmidt, F. & Cundliffe, E. Site of action of a ribosomal RNA methylase
conferring resistance to thiostrepton. J. Biol. Chem. 257, 7915–7 (1982).
36. Zuurmond, A.-M. et al. GE2270A-resistant Mutations in Elongation Factor Tu Allow
Productive Aminoacyl-tRNA Binding to EF-Tu·GTP·GE2270A Complexes. J. Mol. Biol.
304, 995-1005 (2000).
37. Möhrle, V. G., Tieleman, L. N. & Kraal, B. Elongation Factor Tu1 of the Antibiotic
GE2270A producer planobispora rosea has an unexpected resistance profile against EF-Tu
targeted antibiotics. Biochemical And Biophysical Research Communications 230, (1997).
38. Hashimoto, M. et al. An RNA polymerase inhibitor, cyclothiazomycin B1, and its isomer.
Bioorg. Med. Chem. 14, 8259–8270 (2006).
39. Hayashi, S. et al. Genome Mining Reveals a Minimum Gene Set for the Biosynthesis of
32-Membered Macrocyclic Thiopeptides Lactazoles. Chem. Biol. 21, 679–688 (2014).
40. Rogers, L. A. The inhibiting effect of streptococcus lactis on lactobacillus bulgaricus. J.
Bacteriol. 16, 321–5 (1928).
41. Cleveland, J., Montville, T. J., Nes, I. F. & Chikindas, M. L. Bacteriocins: safe, natural
antimicrobials for food preservation. Int. J. Food Microbiol. 71, 1–20 (2001).
53
42. Cao, L. T., Wu, J. Q., Xie, F., Hu, S. H. & Mo, Y. Efficacy of Nisin in Treatment of
Clinical Mastitis in Lactating Dairy Cows. J. Dairy Sci. 90, 3980–3985 (2007).
43. Crowther, G. S. et al. Evaluation of NVB302 versus vancomycin activity in an in vitro
human gut model of Clostridium difficile infection. J. Antimicrob. Chemother. 68, 168–
176 (2013).
44. Knerr, P. J. & van der Donk, W. A. Discovery, Biosynthesis, and Engineering of
Lantipeptides. Annu. Rev. Biochem. 81, 479–505 (2012).
45. Kodani, S. et al. From The Cover: The SapB morphogen is a lantibiotic-like peptide
derived from the product of the developmental gene ramS in Streptomyces coelicolor.
Proc. Natl. Acad. Sci. 101, 11448–11453 (2004).
46. Blin, K. et al. antiSMASH 5.0: updates to the secondary metabolite genome mining
pipeline. Nucleic Acids Res. 47, W81–W87 (2019).
47. Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree 2 – Approximately Maximum-
Likelihood Trees for Large Alignments. PLoS One 5, e9490 (2010).
48. Letunic, I. & Bork, P. Interactive Tree Of Life (iTOL) v4: recent updates and new
developments. Nucleic Acids Res. 47, W256–W259 (2019).
49. Jung, G. Lantibiotics—Ribosomally Synthesized Biologically Active Polypeptides
containing Sulfide Bridges and α,β‐Didehydroamino Acids. Angew. Chemie Int. Ed.
English 30, 1051–1068 (1991).
50. Pag, U. & Sahl, H.-G. Multiple Activities in Lantibiotics - Models for the Design of Novel
Antibiotics? Curr. Pharm. Des. 8, 815–833 (2002).
51. Willey, J. M. & van der Donk, W. A. Lantibiotics: Peptides of Diverse Structure and
Function. Annu. Rev. Microbiol. 61, 477–501 (2007).
52. Ortega, M. A. & Van Der Donk, W. A. New Insights into the Biosynthetic Logic of
Ribosomally Synthesized and Post-translationally Modified Peptide Natural Products. Cell
Chem. Biol. 23, 31–44 (2016).
53. Meindl, K. et al. Labyrinthopeptins: A New Class of Carbacyclic Lantibiotics. Angew.
Chemie Int. Ed. 49, 1151–1154 (2010).
54. Ortega, M. A. et al. Structure and mechanism of the tRNA-dependent lantibiotic
dehydratase NisB. Nature 517, 509–512 (2015).
55. Chatterjee, C. et al. Lacticin 481 Synthetase Phosphorylates its Substrate during
54
Lantibiotic Production. J. Am. Chem. Soc. 127, 15332–15333 (2005).
56. Kupke, T., Kempter, C., Jung, G. & Gotz, F. Oxidative decarboxylation of peptides
catalyzed by flavoprotein EpiD. Determination of substrate specificity using peptide
libraries and neutral loss mass spectrometry. J. Biol. Chem. 270, 11282–11289 (1995).
57. Ökesli, A., Cooper, L. E., Fogle, E. J. & van der Donk, W. A. Nine post-translational
modifications during the biosynthesis of cinnamycin. J. Am. Chem. Soc. 133, 13753–60
(2011).
58. Breukink, E. et al. Use of the cell wall precursor lipid II by a pore-forming peptide
antibiotic. Science 286, 2361–4 (1999).
59. Wiedemann, I. et al. Specific binding of nisin to the peptidoglycan precursor lipid II
combines pore formation and inhibition of cell wall biosynthesis for potent antibiotic
activity. J. Biol. Chem. 276, 1772–9 (2001).
60. Hsu, S.-T. D. et al. The nisin–lipid II complex reveals a pyrophosphate cage that provides
a blueprint for novel antibiotics. Nat. Struct. Mol. Biol. 11, 963–967 (2004).
61. Hasper, H. E. et al. An Alternative Bactericidal Mechanism of Action for Lantibiotic
Peptides That Target Lipid II. Science 313, 1636–1637 (2006).
62. Brotz, H., Bierbaum, G., Reynolds, P. E. & Sahl, H.-G. The Lantibiotic Mersacidin
Inhibits Peptidoglycan Biosynthesis at the Level of Transglycosylation. Eur. J. Biochem.
246, 193–199 (1997).
63. Kodani, S., Lodato, M. A., Durrant, M. C., Picart, F. & Willey, J. M. SapT, a lanthionine-
containing peptide involved in aerial hyphae formation in the streptomycetes. Mol.
Microbiol. 58, 1368–1380 (2005).
64. Wang, H. & van der Donk, W. A. Biosynthesis of the class III lantipeptide catenulipeptin.
ACS Chem. Biol. 7, 1529–35 (2012).
65. Draper, L. A., Cotter, P. D., Hill, C. & Ross, R. P. Lantibiotic resistance. Microbiol. Mol.
Biol. Rev. 79, 171–91 (2015).
66. Hill, C., Draper, L., Ross, R. & Cotter, P. Lantibiotic Immunity. Curr. Protein Pept. Sci.
9, 39–49 (2008).
67. Mazzotta, A. S. & Montville, T. J. Nisin induces changes in membrane fatty acid
composition of Listeria monocytogenes nisin-resistant strains at 10 degrees C and 30
degrees C. J. Appl. Microbiol. 82, 32–8 (1997).
55
68. Verheul, A., Russell, N. J., Van’T Hof, R., Rombouts, F. M. & Abee, T. Modifications of
membrane phospholipid composition in nisin-resistant Listeria monocytogenes Scott A.
Appl. Environ. Microbiol. 63, 3451–7 (1997).
69. Staubitz, P., Neumann, H., Schneider, T., Wiedemann, I. & Peschel, A. MprF-mediated
biosynthesis of lysylphosphatidylglycerol, an important determinant in staphylococcal
defensin resistance. FEMS Microbiol. Lett. 231, 67–71 (2004).
70. Froseth, B. R. & McKay, L. L. Molecular characterization of the nisin resistance region of
Lactococcus lactis subsp. lactis biovar diacetylactis DRC3. Appl. Environ. Microbiol. 57,
804–11 (1991).
71. Sun, Z. et al. Novel Mechanism for Nisin Resistance via Proteolytic Degradation of Nisin
by the Nisin Resistance Protein NSR. Antimicrob. Agents Chemother. 53, 1964–1973
(2009).
72. Zimmermann, M., Hegemann, J. D., Xie, X. & Marahiel, M. A. Characterization of
caulonodin lasso peptides revealed unprecedented N-terminal residues and a precursor
motif essential for peptide maturation. Chem. Sci. 5, 4032–4043 (2014).
73. Salomón, R. A., Farías, R. N., Salomn, R. A. & Farias, R. N. Microcin 25, a novel
antimicrobial peptide produced by Escherichia coli. J. Bacteriol. 174, 7428–35 (1992).
74. Zimmermann, M., Hegemann, J. D., Xie, X. & Marahiel, M. A. The Astexin-1 Lasso
Peptides: Biosynthesis, Stability, and Structural Studies. Cell Chem. Biol. 20, 558–569
(2013).
75. Tietz, J. I. et al. A new genome-mining tool redefines the lasso peptide biosynthetic
landscape. Nat. Chem. Biol. 13, 470–478 (2017).
76. Duquesne, S. et al. Two Enzymes Catalyze the Maturation of a Lasso Peptide in
Escherichia coli. Chem. Biol. 14, 793–803 (2007).
77. Yan, K.-P. et al. Dissecting the Maturation Steps of the Lasso Peptide Microcin J25 in
vitro. ChemBioChem 13, 1046–1052 (2012).
78. DiCaprio, A. J., Firouzbakht, A., Hudson, G. A. & Mitchell, D. A. Enzymatic
Reconstitution and Biosynthetic Investigation of the Lasso Peptide Fusilassin. J. Am.
Chem. Soc. 141, 290–297 (2019).
79. Burkhart, B. J., Hudson, G. A., Dunbar, K. L. & Mitchell, D. A. A prevalent peptide-
binding domain guides ribosomal natural product biosynthesis. Nat. Chem. Biol. 11, 564–
56
570 (2015).
80. Sumida, T., Dubiley, S., Wilcox, B., Severinov, K. & Tagami, S. Structural Basis of
Leader Peptide Recognition in Lasso Peptide Biosynthesis Pathway. ACS Chem. Biol. 14,
1619–1627 (2019).
81. Solbiati, J. O., Ciaccio, M., Farías, R. N. & Salomón, R. A. Genetic analysis of plasmid
determinants for microcin J25 production and immunity. J. Bacteriol. 178, 3661–3 (1996).
82. Zhu, S. et al. Insights into the Unique Phosphorylation of the Lasso Peptide Paeninodin. J.
Biol. Chem. 291, 13662–13678 (2016).
83. Zong, C., Cheung-Lee, W. L., Elashal, H. E., Raj, M. & Link, A. J. Albusnodin: An
acetylated lasso peptide from: Streptomyces albus. Chem. Commun. 54, 1339–1342
(2018).
84. Gavrish, E. et al. Lassomycin, a Ribosomally Synthesized Cyclic Peptide, Kills
Mycobacterium tuberculosis by Targeting the ATP-Dependent Protease ClpC1P1P2.
Chem. Biol. 21, 509–518 (2014).
85. Pavlova, O., Mukhopadhyay, J., Sineva, E., Ebright, R. H. & Severinov, K. Systematic
structure-activity analysis of microcin J25. J. Biol. Chem. 283, 25589–25595 (2008).
86. Constantine, K. L. et al. High-resolution solution structure of siamycin II: Novel
amphipathic character of a 21-residue peptide that inhibits HIV fusion. J. Biomol. NMR 5,
271–286 (1995).
87. Katahira, R., Shibata, K., Yamasaki, M., Matsuda, Y. & Yoshida, M. Solution structure of
endothelin B receptor selective antagonist RES-701-1 determined by 1H NMR
spectroscopy. Bioorg. Med. Chem. 3, 1273–1280 (1995).
88. Knappe, T. A., Linne, U., Xie, X. & Marahiel, M. A. The glucagon receptor antagonist
BI-32169 constitutes a new class of lasso peptides. FEBS Lett. 584, 785–789 (2010).
89. Um, S. et al. Sungsanpin, a lasso peptide from a deep-sea streptomycete. J. Nat. Prod. 76,
873–879 (2013).
90. Daniel-Ivad, M. et al. An Engineered Allele of afsQ1 Facilitates the Discovery and
Investigation of Cryptic Natural Products. ACS Chem. Biol. 12, 628–634 (2017).
91. Tsunakawa, M. et al. Siamycins I and II, New Anti-HIV Peptides. I. Fermentation,
Isolation, Biological Activity and Initial Characterization. J. Antibiot. (Tokyo). 48, 433–
434 (1995).
57
92. Tan, S., Ludwig, K. C., Mueller, A., Schneider, T. & Nodwell, J. R. The Lasso Peptide
Siamycin‐I Targets Lipid II at the Gram-Positive Cell Surface. ACS Chem. Biol. 14, 966–
974 (2019).
93. Dubrac, S., Bisicchia, P., Devine, K. M. & Msadek, T. A matter of life and death: Cell
wall homeostasis and the WalKR (YycGF) essential signal transduction pathway. Mol.
Microbiol. 70, 1307–1322 (2008).
94. Tiyanont, K. et al. Imaging peptidoglycan biosynthesis in Bacillus subtilis with
fluorescent antibiotics. Proc. Natl. Acad. Sci. 103, 11033–11038 (2006).
95. Lin, P. F. et al. Characterization of siamycin I, a human immunodeficiency virus fusion
inhibitor. Antimicrob. Agents Chemother. 40, 133–138 (1996).
96. Nakayama, J. et al. Siamycin Attenuates fsr Quorum Sensing Mediated by a Gelatinase
Biosynthesis-Activating Pheromone in Enterococcus faecalis. J. Bacteriol. 189, 1358–
1365 (2007).
97. Metelev, M. et al. Structure, Bioactivity, and Resistance Mechanism of
Streptomonomicin, an Unusual Lasso Peptide from an Understudied Halophilic
Actinomycete. Chem. Biol. 22, 241–250 (2015).
98. Salomon, R. A. & Farias, R. N. The FhuA Protein Is Involved in Microcin 25 Uptake. J.
Bacteriol. 175, 7741–7742 (1993).
99. Salomon, R. A. & Farias, R. N. The Peptide Antibiotic Microcin 25 Is Imported through
the TonB Pathway and the SbmA Protein. J. Bacteriol. 177, 3323–3325 (1995).
100. Delgado, M. A. A. et al. Escherichia coli RNA polymerase is the target of the
cyclopeptide antibiotic microcin J25. J. Bacteriol. 183, 4543–50 (2001).
101. Yuzenkova, J. et al. Mutations of bacterial RNA polymerase leading to resistance to
microcin j25. J. Biol. Chem. 277, 50867–75 (2002).
102. Korzheva, N. et al. A structural model of transcription elongation. Science 289, 619–25
(2000).
103. Adelman, K. et al. Molecular mechanism of transcription inhibition by peptide antibiotic
Microcin J25. Mol. Cell 14, 753–62 (2004).
104. Mukhopadhyay, J., Sineva, E., Knight, J., Levy, R. M. & Ebright, R. H. Antibacterial
peptide microcin J25 inhibits transcription by binding within and obstructing the RNA
polymerase secondary channel. Mol. Cell 14, 739–51 (2004).
58
105. Braffman, N. R. et al. Structural mechanism of transcription inhibition by lasso peptides
microcin J25 and capistruin. Proc. Natl. Acad. Sci. 116, 1273–1278 (2019).
106. Blond, A. et al. The cyclic structure of microcin J25, a 21-residue peptide antibiotic from
Escherichia coli. Eur. J. Biochem. 259, 747–756 (2001).
107. Blond, A. et al. Solution structure of microcin J25, the single macrocyclic antimicrobial
peptide from Escherichia coli. Eur. J. Biochem. 268, 2124–2133 (2001).
108. Blond, A. et al. Thermolysin-linearized microcin J25 retains the structured core of the
native macrocyclic peptide and displays antimicrobial activity. Eur. J. Biochem. 269,
6212–6222 (2002).
109. Bayro, M. J. et al. Structure of antibacterial peptide microcin J25: A 21-residue lariat
protoknot. J. Am. Chem. Soc. 125, 12382–12383 (2003).
110. Knappe, T. A. et al. Isolation and Structural Characterization of Capistruin, a Lasso
Peptide Predicted from the Genome Sequence of Burkholderia thailandensis E264. J. Am.
Chem. Soc. 130, 11446–11454 (2008).
111. Kuznedelov, K. et al. The Antibacterial Threaded-lasso Peptide Capistruin Inhibits
Bacterial RNA Polymerase. J. Mol. Biol. 412, 842–848 (2011).
112. Metelev, M. et al. Acinetodin and Klebsidin, RNA Polymerase Targeting Lasso Peptides
Produced by Human Isolates of Acinetobacter gyllenbergii and Klebsiella pneumoniae.
ACS Chem. Biol. 12, 814–824 (2017).
113. Cheung-Lee, W. L., Parry, M. E., Cartagena, A. J., Darst, S. A. & James Link, A.
Discovery and structure of the antimicrobial lasso peptide citrocin. J. Biol. Chem. 294,
6822–6830 (2019).
114. Lear, S. et al. Total chemical synthesis of lassomycin and lassomycin-amide. Org. Biomol.
Chem. 14, 4534–4541 (2016).
115. Lee, H. & Suh, J.-W. Anti-tuberculosis lead molecules from natural products targeting
Mycobacterium tuberculosis ClpC1. J Ind Microbiol Biotechnol 43, 205–212 (2016).
116. Maksimov, M. O., Pelczer, I. & Link, A. J. Precursor-centric genome-mining approach for
lasso peptide discovery. Proc. Natl. Acad. Sci. 109, 15223–8 (2012).
117. Agrawal, P., Khater, S., Gupta, M., Sain, N. & Mohanty, D. RiPPMiner: a bioinformatics
resource for deciphering chemical structures of RiPPs based on prediction of cleavage and
cross-links. Nucleic Acids Res. 45, W80–W88 (2017).
59
118. van Heel, A. J. et al. BAGEL4: a user-friendly web server to thoroughly mine RiPPs and
bacteriocins. Nucleic Acids Res. (2018). doi:10.1093/nar/gky383
119. Skinnider, M. A., Merwin, N. J., Johnston, C. W. & Magarvey, N. A. PRISM 3: expanded
prediction of natural product chemical structures from microbial genomes. Nucleic Acids
Res. 45, W49–W54 (2017).
120. Santos-Aberturas, J. et al. Uncovering the unexplored diversity of thioamidated ribosomal
peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Res. 47,
4624–4637 (2019).
121. Martin-Gómez, H., Linne, U., Albericio, F., Tulla-Puche, J. & Hegemann, J. D.
Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-
Based Production System. J. Nat. Prod. 81, 2050-2056 (2018).
122. Schneemann, I. et al. Comprehensive investigation of marine Actinobacteria associated
with the sponge Halichondria panicea. Appl. Environ. Microbiol. 76, 3702–14 (2010).
123. Komatsu, M. et al. Engineered Streptomyces avermitilis host for heterologous expression
of biosynthetic gene cluster for secondary metabolites. ACS Synth. Biol. 2, 384–96 (2013).
124. Pablo Gomez-Escribano, J. & Bibb, M. J. Engineering Streptomyces coelicolor for
heterologous expression of secondary metabolite gene clusters. Microbial Biotechnology
4, 207-215 (2010).
125. Jani, C. et al. Streptomyces: a screening tool for bacterial cell division inhibitors. J.
Biomol. Screen. 20, 275–84 (2015).
126. Bibb, M. J., Janssen, G. R. & Ward, J. M. Cloning and analysis of the promoter region of
the erythromycin resistance gene (ermE) of Streptomyces erythraeus. Gene 38, 215–226
(1985).
127. Kieser T, Bibb MJ, Buttner MJ & Chater KF. Practical Streptomyces Genetics. 2nd ed.
(2000).
128. Jensen, P. R., Williams, P. G., Oh, D.-C., Zeigler, L. & Fenical, W. Species-specific
secondary metabolite production in marine actinomycetes of the genus Salinispora. Appl.
Environ. Microbiol. 73, 1146–52 (2007).
129. Koos, J. D. & Link, A. J. Heterologous and in Vitro Reconstitution of Fuscanodin, a Lasso
Peptide from Thermobifida fusca. J. Am. Chem. Soc. 141, 928–935 (2019).
130. Zhu, S. et al. The B1 Protein Guides the Biosynthesis of a Lasso Peptide. Sci. Rep. 6,
60
35604 (2016).
131. Rosano, G. L. & Ceccarelli, E. A. Recombinant protein expression in Escherichia coli:
advances and challenges. Front. Microbiol. 5, 172 (2014).
132. Garg, N., Tang, W., Goto, Y., Nair, S. K. & van der Donk, W. A. Lantibiotics from
Geobacillus thermodenitrificans. Proc. Natl. Acad. Sci. U. S. A. 109, 5241–6 (2012).
133. Schmidt, E. W. et al. Patellamide A and C biosynthesis by a microcin-like pathway in
Prochloron didemni, the cyanobacterial symbiont of Lissoclinum patella. Proc. Natl.
Acad. Sci. U. S. A. 102, 7315–20 (2005).
134. Shima, J., Hesketh, A., Okamoto, S., Kawamoto, S. & Ochi, K. Induction of actinorhodin
production by rpsL (encoding ribosomal protein S12) mutations that confer streptomycin
resistance in Streptomyces lividans and Streptomyces coelicolor A3(2). J. Bacteriol. 178,
7276–7284 (1996).
135. Hu, H., Zhang, Q. & Ochi, K. Activation of antibiotic biosynthesis by specified mutations
in the rpoB gene (encoding the RNA polymerase beta subunit) of Streptomyces lividans.
J. Bacteriol. 184, 3984–91 (2002).
136. Zaburannyi, N., Rabyk, M., Ostash, B., Fedorenko, V. & Luzhetskyy, A. Insights into
naturally minimised Streptomyces albus J1074 genome. BMC Genomics 15, 97 (2014).
137. Li, Y. et al. Characterization of Sviceucin from Streptomyces Provides Insight into
Enzyme Exchangeability and Disulfide Bond Formation in Lasso Peptides. ACS Chem.
Biol. 10, 2641–2649 (2015).
138. Koo, B.-M. et al. Construction and Analysis of Two Genome-Scale Deletion Libraries for
Bacillus subtilis. Cell Syst. 4, 291-305.e7 (2017).
139. Ling, L. L. et al. A new antibiotic kills pathogens without detectable resistance. Nature
517, 455–459 (2015).
140. Feling, R. H. et al. Salinosporamide A: A Highly Cytotoxic Proteasome Inhibitor from a
Novel Microbial Source, a Marine Bacterium of the New Genus Salinospora. Angew.
Chemie Int. Ed. 42, 355–357 (2003).
141. Kumar, S., Stecher, G. & Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis
Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33, 1870–1874 (2016).
142. Tanizawa, Y., Fujisawa, T. & Nakamura, Y. DFAST: a flexible prokaryotic genome
annotation pipeline for faster genome publication. Bioinformatics 34, 1037–1039 (2018).
61
143. Aziz, R. K. et al. The RAST Server: Rapid Annotations using Subsystems Technology.
BMC Genomics 9, 75 (2008).
144. Kim, M., Oh, H.-S., Park, S.-C. & Chun, J. Towards a taxonomic coherence between
average nucleotide identity and 16S rRNA gene sequence similarity for species
demarcation of prokaryotes. Int. J. Syst. Evol. Microbiol. 64, 346–351 (2014).
145. Stewart, E. J. Growing unculturable bacteria. J. Bacteriol. 194, 4151–60 (2012).
146. Ritchie, K. B. et al. Survey of Antibiotic-producing Bacteria Associated with the
Epidermal Mucus Layers of Rays and Skates. Front. Microbiol. 8, 1050 (2017).
147. Gärdes, A. et al. Complete genome sequence of Marinobacter adhaerens type strain
(HP15), a diatom-interacting marine microorganism. Stand. Genomic Sci. 3, 97–107
(2010).
148. Hollensteiner, J., Poehlein, A. & Daniel, R. Complete Genome Sequence of Marinobacter
sp. Strain JH2, Isolated from Seawater of the Kiel Fjord. Microbiol. Resour. Announc. 8,
(2019).
149. Martinez, J. S. & Butler, A. Marine amphiphilic siderophores: Marinobactin structure,
uptake, and microbial partitioning. J. Inorg. Biochem. 101, 1692–1698 (2007).
150. Robinson, S. L., Christenson, J. K. & Wackett, L. P. Biosynthesis and chemical diversity
of β-lactone natural products. Nat. Prod. Rep. 36, 458–475 (2019).
62
Appendix 1 Screen for novel bioactive natural products from marine bacteria
Appendix 1
5.1 Introduction
The discovery of antibiotics has resulted in substantial improvements in the outcome of
treatments for bacterial infections and has enabled certain medical procedures to occur. Natural
products remain extremely relevant in the discovery and development of novel antibiotics, even
in the years following the golden age of antibiotics (~1940-1960). In fact, over the past 35 years,
roughly 60% of approved antibiotics are derivatives of natural products.1
Due to the challenges such as high rediscovery rates of known compounds, interest in natural
product screening is not what it once was. However, since bacterial chemotype roughly follows
phylotype, in theory novel compounds can be discovered by screening uncharacterized
environmental isolates, thereby reducing rates of rediscovery128. An excellent example of this is
the discovery of the antibiotic teixobactin, which was discovered from the previously
uncharacterized microbe, Eleftheria terrae, using a unique culturing method139. A second
example of the discovery of novel natural products by studying uncharacterized microbes is the
discovery of salinosporamide A from Salinispora tropica140. S. tropica is an obligate species of
marine Actinobacteria, which produces the potent 20S proteasome inhibitor, salinosporamide A.
These examples demonstrate that bacteria are capable of producing substantial chemical
diversity, much of which has yet to be discovered. The aim of this project was to investigate the
ability of marine bacteria to produce antibacterial metabolites and to identify and characterize
novel antimicrobial compounds from the Nodwell Maritime Collection.
5.2 Methods
5.2.1 Bioactivity screen
5.2.1.1 Collection and Isolation of maritime strains
There are 42 strains that make up the Nodwell Maritime Collection (NMarC). These strains were
isolated from marine sediments collected at 5 locations in the maritime provinces of Canada
(Hopewell Rocks, New Brunswick; Brackley Beach, PEI; Cavendish Beach, PEI; Fisherman’s
63
Cove, NS; Crystal Crescent Beach, NS). Marine sediment samples were collected at a depth of 1-
2 metres by Dr. Sheila Elardo. Dr. Sheila Elardo isolated the marine strains by diluting the
sediment samples with sterile artificial seawater and plating them on four types of media: M1,
M2, ISP2 and M2216 medium, each supplemented with 25% artificial seawater (5.2.1.2). The
cultures were incubated at 30°C for up to 12 weeks and individual colonies were picked and re-
streaked on the four different media types.
5.2.1.2 Culture conditions
The growth of all maritime strains was tested on four agar media types: M1 medium (per L: 10g
soluble starch, 4g yeast extract, 2g peptone, 16g agar), M2 medium (per L: 6mL glycerol, 1g
arginine, 1g K2HPO4, 0.5g MgSO4, 16g agar), ISP2 medium (per L: 4g yeast extract, 10g malt
extract, 4g dextrose, 16g agar), and Difco Marine Agar 2216 medium (per L: 55.1g Difco Marine
Agar 2216), all of which were dissolved in artificial seawater (per L: 23.477 g NaCl, 10.64 g
MgCl2 hexahydrate, 3.917 g Na2SO4, 1.102 g CaCl2, 0.664 g KCl, 0.192 g NaHCO3, 0.096 g
KBr, 0.026 g H3BO3, 0.024 g SrCl2, 0.03 g NaF) with the exception of M2216 medium which
was dissolved in Milli-Q water. For metabolite extraction and bioactivity testing, all maritime
strains were grown for 5 days at 30°C prior to methanol extraction.
The test strains of M. luteus, B. subtilis JH642, E. coli BW25113 and E. coli BW25113 ∆tolC
∆bamB were grown in LB medium (per L Milli-Q water: 10g tryptone, 10g NaCl, 5g yeast
extract) at 37°C, while S. cerevisiae Y7092 was grown in YPD medium (per L Milli-Q water:
10g Yeast extract, 20g Peptone, 20g Dextrose). 16 g of agar per 1L of medium was used to make
solid media for disk diffusion assays.
5.2.1.3 Broth microtiter dilution and disk diffusion assay
The test organism was inoculated from an agar streak plate into a 5mL liquid culture of YPD
medium for S. cerevisiae or LB medium for all other test organisms. The liquid culture was
grown overnight at 30°C (for S. cerevisiae) or at 37°C for (all other organisms) and a 1:100
subculture was started in the morning. Each culture was grown to an OD of 0.4-0.6 and diluted
1:1000 with fresh media in a 96-well plate. The test compound or extract, resuspended in
DMSO, was added to each well and the plate was incubated overnight. The next morning, the
64
OD600 of each well was measured. When testing extracts, the extract was considered active if
inhibition of growth was greater than 50%. For the determination of MICs, the same protocol
was followed and antibiotics at twofold increasing concentrations were added to the 96 well plate
liquid cultures.
To perform the disk diffusion assay, the procedure indicated above was followed until the
subculture reached an OD of 0.4-0.6, at which point the culture was diluted 1:1000 in fresh
media. 100 μL of the diluted culture was spread across an agar plate of LB medium using sterile
glass beads. The plate was dried for 5 minutes and a maximum of five paper filter disks were
distributed across the plate. 2-10 μL of resuspended crude extracts were added to the filter disks
and plates were placed overnight in the incubator at 30°C (for S. cerevisiae) or at 37°C for (all
other organisms). After overnight incubation, the plates were imaged and the zone of inhibition
was measured.
5.2.2 Isolation of the Marinobacter sp. N33 bioactive metabolite(s)
5.2.2.1 Metabolite extraction
Metabolites were extracted from agar or liquid cultures with HPLC-grade methanol, using a
volume of methanol equivalent to the volume of the culture or 200-300 mL, whichever is less.
Samples were sonicated for 15 minutes and macerated overnight. In the morning, extracts were
dried using a Genevac EZ-2 Elite series evaporator (SP scientific) or a Hei-VAP Precision
Rotary Evaporator (Heidolph).
5.2.2.2 Flash chromatography and HPLC purification
Crude extracts were resuspended in 5% aqueous HPLC-grade methanol to a concentration of 100
mg/mL. After centrifugation and/or filtration, the resuspended crude extracts were further
purified on a Reveleris® X2 Flash chromatography system (Buchi Labortechnik). A 20g C18 40-
60um 100Å cartridge (Aegio Technologies) was used for the separation by flash
chromatography, with a linear gradient from 5 to 100% aqueous HPLC-grade methanol at a flow
rate of 10mL/min. 20mL fractions were collected, dried by Genevac or rotary evaporation and
tested for bioactivity by broth microtiter dilution assay (5.2.1.3). Fractions that were bioactive
were pooled, resuspended and further purified by HPLC.
65
Individual and pooled bioactive flash chromatography fractions were purified on a Waters
Alliance HPLC with a Phenomonex Luna C18 column (100 Å, 5 μm, 4.6x250mm). The
following 30-minute linear solvent gradient of water/0.1% formic acid (solvent A) and
acetonitrile/0.1% formic acid was used: hold at 5% B for 2 minutes, followed by linear increase
until 95% B at 20 minutes, hold at 95% B until 25 minutes, then return to 5% B until 30 minutes.
The collected peak fractions were dried by Genevac evaporator and tested for bioactivity.
5.2.3 Genomic studies
5.2.3.1 Genomic DNA extraction
For taxonomic identification, genomic DNA was extracted using the DNeasy Blood and Tissue
Kit (Qiagen). For genomic DNA extraction, each strain was grown in an overnight 5mL liquid
culture using the medium from which the strain was first originally isolated. Following the
overnight incubation, the cells were harvested, lysed and the genomic DNA was purified
according to the DNeasy Blood and Tissue Kit protocol for DNA extraction from Gram-positive
bacteria.
For Pacific Biosciences sequencing of Marinobacter sp. N33, genomic DNA was extracted using
the Genomic-tip 20/G Kit (Qiagen). 10mL liquid overnight cultures of Difco Marine Agar 2216
medium (5.2.1.2) were used for genomic DNA extraction. Following the overnight liquid culture
incubation, the cells were harvested and the DNA was extracted and purified according to the
Genomic-tip 20/G protocol for the extraction of DNA from Gram-negative bacteria. In order to
minimize DNA shearing, the sample was handled with care, the DNA vortexing steps were
skipped, and only wide-bore pipette tips were used. The genomic DNA was resuspended to a
concentration of in 10 mM Tris·Cl, pH 8.5 and was shipped on ice to Genome Quebec where the
sample was sequenced using a Pacific Biosciences RSII SMRT sequencer.
5.2.3.2 Phylogenetic analysis
Using the extracted genomic DNA, the 16S rRNA gene of each member of the maritime strain
collection was amplified by PCR using 27F and 1492R universal primers. The amplified
sequence was cloned into the pGEM-T Easy vector (Promega) and transformed in E. coli TOP10
for plasmid propagation. Plasmids were harvested and purified using the QIAprep Spin Miniprep
66
Kit (Qiagen) and were sequenced by Sanger sequencing. The 16S rRNA gene sequences were
then aligned using the ClustalW multiple sequence alignment. Phylogenetic trees were
constructed by maximum likelihood method using the MEGA 7 program141.
5.2.3.3 Whole genome sequencing of Marinobacter sp. N33
Whole genome sequencing of Marinobacter sp. N33 was performed using the long-read
sequencing technology PacBio SMRT sequencing using the RSII sequencer with one SMRT cell.
The Marinobacter sp. N33 genome was assembled by Genome Quebec using the Hierarchical
Genome Assembly Process 2.2.0. Genome annotation was performed using two annotation
pipelines: DDBJ Fast Annotation and Submission Tool (DFAST) and Rapid Annotation using
Subsystem Technology (RAST)142,143.
5.3 Results and discussion
5.3.1 Screen of marine bacteria
5.3.1.1 Phylogenetic analysis
Phylogenetic analysis was used a means to prioritize strains for further study for the discovery of
novel antibacterial metabolites. As Actinomycetes tend to be more prolific producers of
secondary metabolites, and bacterial chemotype tends to follow phylotype, I reasoned that
studying rare Actinomycetes would result in a higher discovery rate of novel antibacterial
metabolites128. Thus, the taxonomic identity of each Nodwell Maritime Collection strain was
determined using the PCR-amplified 16S gene sequences of each strain (Table 5.1). BLAST was
used to determine the top-hit taxon and strain, and the percent similarity of the 16S gene to that
of the top-hit taxon was recorded. The phylogenetic identity of fungal strains was not pursued.
Considering that 98.65% 16S similarity is commonly used as the cutoff for the definition of a
new species, among the Maritime Collection there were several strains in the collection that may
be potential novel species144. Of note, N31 had a 16S percent similarity of 96.2% to the top-hit
taxon of Pontibacter ummariensis, indicating that this strain is almost certainly a novel taxon.
Several other strains had 16S percent similarity values very close to the cut off and therefore
further chemical characterization is required to determine if the strain is a novel species.
67
Table 5.1. Identity and characteristics of maritime strains
NMarC Sediment Source Top-hit taxon name Top-hit strain % Identity
1 Brackley Beach, PEI Erythrobacter seohaensis SW-135(T) 100
2 Brackley Beach, PEI Celeribacter halophilus ZXM137(T) 99.93
3 Brackley Beach, PEI Streptomyces coelescens DSM 40421(T) 99.86
4 Brackley Beach, PEI Bacillus algicola KMM 3737(T) 99.66
5 Fisherman's Cove, NS Paracoccus seriniphilus DSM 14827(T) 98.05
6 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.86
7 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.93
8 Fisherman's Cove, NS Sphingomonas paucimobilis NBRC 13935(T) 99.79
9 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.86
10 Fisherman's Cove, NS Bacillus hwajinpoensis SW-72(T) 99.46
11 Fisherman's Cove, NS Cobetia marina DSM 4741(T) 99.93
12 Fisherman's Cove, NS Streptomyces gancidicus NBRC 15412(T) 99.86
13 Fisherman's Cove, NS Cobetia marina DSM 4741(T) 99.93
14 Crystal Crescent Beach,
NS Streptomyces coelescens DSM 40421(T) 99.65
15 Crystal Crescent Beach,
NS Bacillus tequilensis KCTC 13622(T) 99.73
16 Hopewell Rocks, NB Pseudoalteromonas rubra ATCC 29570(T) 98.66
17 Hopewell Rocks, NB Bacillus algicola KMM 3737(T) 100
18 Hopewell Rocks, NB Pseudoalteromonas rubra ATCC 29570(T) 98.73
19 Hopewell Rocks, NB Streptomyces venezuelae ATCC 10712(T) 99.65
20 Hopewell Rocks, NB Fungal
21 Hopewell Rocks, NB Altererythrobacter sp.*
22 Hopewell Rocks, NB Bacillus zhangzhouensis DW5-4(T) 99.66
23 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.86
24 Cavendish Beach, PEI Pseudoalteromonas rubra ATCC 29570(T) 98.8
25 Cavendish Beach, PEI Kribbella hippodromi S1.4(T) 98.78
26 Cavendish Beach, PEI Streptomyces venezuelae ATCC 10712(T) 99.93
27 Cavendish Beach, PEI Streptomyces gibsonii NRRL B-1335(T)
99.72
28 Cavendish Beach, PEI Microbacterium aquimaris JS54-2(T) 99.79
29 Hopewell Rocks, NB Altererythrobacter ishigakiensis ATCC BAA-
2084(T) 98.72
30 Brackley Beach, PEI Streptomyces gancidicus NBRC 15412(T) 99.58
31 Brackley Beach, PEI Pontibacter ummariensis NKM1(T) 96.19
68
32 Fisherman's Cove, NS Streptomyces venezuelae ATCC
10712(T) 99.72
33 Fisherman's Cove, NS Marinobacter litoralis SW-45(T) 99.86
34 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.93
35 Cavendish Beach, PEI Bacillus mesophilus SA4(T) 98.15
36 Cavendish Beach, PEI Streptomyces venezuelae ATCC 10712(T) 99.72
37 Brackley Beach, PEI Labrenzia alba CECT 5094(T) 98.93
38 Crystal Crescent Beach,
NS Fungal
39 Hopewell Rocks, NB Vibrio diabolicus HE800(T) 99.54
40 Crystal Crescent Beach,
NS Bacillus tequilensis KCTC 13622(T) 99.86
41 Brackley Beach, PEI Fungal
42 Fisherman's Cove, NS Streptomyces venezuelae ATCC 10712(T) 99.93
*Incomplete coverage of 16S rRNA gene sequence
To understand the composition of the Nodwell Maritime Collection, a phylogenetic tree was
constructed using the 16S rRNA gene sequences (Figure 5.1). Most NMarC strains were found
to be Actinobacteria or Proteobacteria (17 and 13 strains out of 42, respectively). This bias
towards Actinobacteria or Proteobacteria is likely reflective of the fact that many bacterial taxa
are unculturable or very difficult to culture under standard laboratory conditions which may lack
specific growth factors required for growth145.
Many of the strains were very closely related strains from the Streptomyces, which are not easily
differentiated based solely on the 16S rRNA gene sequence. Differentiation between strains of
Streptomyces often requires multi-locus sequence typing to provide sufficient resolution.
69
Figure 5.1. Phylogenetic tree of Nodwell Maritime Collection strains.
70
5.3.1.2 Bioactivity screening
The extracts of each Maritime strain, cultured on a four different media types, were screened for
antimicrobial activity against M. luteus, B. subtilis, E. coli and S. cerevisiae (Figure 5.3). This
screen was performed with the help of 5 other students: Jan Falguera, Jethro Prinston, Victoria
Riccio, Bilyana Ivanova and Brian Hicks. Nearly 500 conditions were screened, with each
condition representing a different NMarC strain, culture condition, or test strain. Conditions that
were considered hits were those that had OD values 50% lower than the culture controls. The
majority of conditions tested resulted in less than 50% increase or reduction in OD values with
respect to the controls (Figure 5.3). Some extracts appear to have enhanced growth of the test
organism, perhaps providing additional nutrients for growth. Many of the extracts that improved
growth of the test organism were tested against S. cerevisiae, suggesting that no antifungal
compounds were present in those extracts. In total, there were 69 hits among the conditions
screened, many of which were against M. luteus or B. subtilis.
Figure 5.2. Screen of Nodwell Maritime Collection strains. Hit conditions, highlighted in
blue, are those with Y values lower than -1, indicating a 50% reduction in optical density with
respect to the culture control.
71
Figure 5.3. Distribution of growth inhibition values.
When the hits are analyzed based on phylotype of the NMarC organism, as expected, most of the
hits are from actinobacterial extracts (Figure 5.4). There was one reproducible hit from a non-
actinobacterial strain: strain N33, for which the top-hit taxon is Marinobacter litoralis (Table
5.1). Marinobacter sp. N33 had antibacterial activity against M. luteus and B. subtilis when
grown on either ISP2 medium or M1 medium. Although some species of Marinobacter are
reported to have antibacterial activity, no antibacterial metabolites have thus far been isolated
from a Marinobacter species146. Therefore, I chose to purify and characterize the metabolite(s)
produced by Marinobacter sp. N33 that are responsible for the antibacterial activity of the strain,
in hopes that the metabolite(s) have not yet been reported.
72
Figure 5.4. Phylogenetic tree and antibacterial activity of Nodwell Maritime Collection
strains tested against B. subtilis. A 50% reduction of OD is considered a hit, depicted in red.
Extracts were also tested against M. luteus, E. coli, and S. cerevisiae (data included in Figure 5.2
and Figure 5.3).
5.3.2 Marinobacter sp. N33 extract testing
5.3.2.1 Bioactivity testing
The Marinobacter sp. N33 extracts was retested for antibacterial activity against B. subtilis and
M. luteus by disk diffusion assay (Figure 5.5). The antibacterial activity of Marinobacter sp.
N33 is substantially more pronounced when the organism is grown on ISP2 medium compared to
M1 medium. The extract also had antibacterial activity against M. luteus but not against E. coli,
consistent with the findings of the screen by broth microtiter dilution assay (5.3.2.1).
73
Figure 5.5. Disk diffusion assay of Marinobacter sp. N33 crude extract using B. subtilis
JH642. The extract of Marinobacter sp. N33 grown on ISP2 medium has a larger zone of
inhibition than when grown on M1 medium.
5.3.2.2 Genome sequencing and genome mining
To investigate the antibacterial activity of Marinobacter sp. N33, the genome was sequenced
using Pacific Biosciences Single-Molecule Real-Time sequencing (SMRT). SMRT sequencing
was chosen because this sequencing technology produces long reads which facilitates the
assembly of a complete genome. Since secondary metabolite gene clusters can be large or
contain repetitive DNA sequences, long-read sequencing aid the complete and accurate assembly
of gene clusters for secondary metabolite biosynthesis.
The Marinobacter sp. N33 DNA reads were assembled into a single 3.4 Mbp contig of 54% GC
content with an average read length of 12,600 bases and 204X coverage. The contig had
overlapping ends, resulting in a closed circular genome, which is in accordance with the
genomes of other species of Marinobacter147,148 (Figure 5.6). Although other contigs were
assembled from the sequence reads, it is likely that these remaining contigs are due to minor
DNA contamination as the read coverage was low and the contigs had low sequence similarity to
Marinobacter sequences. As a result, no plasmids were identified from the Pacific Biosciences
sequencing run.
N33 Extract
ISP2 Media
N33 Extract
M1 Media
DMSO
Neg Control
74
Figure 5.6. Circular representation of the Marinobacter sp. N33 genome. The circular tracks
from the outside inward are: Tracks 1 and 2 depict protein-coding genes on the forward and
reverse sequences, respectively; Track 3 depicts tRNA genes; Track 4 depicts rRNA genes;
Track 5 depicts GC content; Track 6 depicts GC skew [(G−C)/(G+C)].
The results from genome annotation using the RAST program were in highly similar to those
obtained using DFAST. Overall, the DFAST annotation program predicted 3184 genes, with a
mean length of 981 bp, similar to the genome statistics of close relatives (Table 5.2).
75
Table 5.2. Comparison of Marinobacter sp. N33 genome statistics to close relatives.
Marinobacter sp. N33 M. excellens HL-55 M. vinifirmus FB1
Length (Mbp) 3.4 4.0 3.8
GC Content (%) 54.1 56.3 58.0
# Genes 3184 3670 3522
Mean Gene Length
(bp) 981 995 986
BGCs
(AntiSMASH) 2 1 1
To investigate the ability of Marinobacter sp. N33 to produce antibacterial secondary
metabolites, I analyzed the complete genome sequence using several genome mining tools for
secondary metabolite detection (). Using AntiSMASH 4.0 and PRISM, only two secondary
metabolite gene clusters were identified in the Marinobacter sp. N33 genome: the gene cluster
for the synthesis of ectoine, an osmoprotectant and the cluster for the synthesis of a siderophore,
likely a marinobactin, a class of siderophores isolated from members of the Marinobacter
genus149. Neither ectoine nor a siderophore are expected to have antibacterial activity, suggesting
that AntiSMASH 4.0 and PRISM were not detecting the gene cluster of the antibacterial
metabolite. Recently, AntiSMASH 5.0 has been released and is able to detect more secondary
metabolite gene clusters46. Analyzing the Marinobacter sp. N33 genome sequence by
AntiSMASH 5.0 reveals the presence of two additional biosynthetic gene clusters not detected
by AntiSMASH 4.0. Both of these predicted clusters belong to the beta-lactones, a diverse class
of natural products which includes members with antibacterial activity150. It is possible that the
antibacterial metabolite(s) produced by Marinobacter sp. N33 are beta-lactones and went
undetected due to the detection limits of AntiSMASH 4.0. This would also explain the difficulty
in purifying the active metabolite(s) using formic acid (5.3.2.3), as beta-lactones are highly prone
to acid hydrolysis and thermal degradation150.
5.3.2.3 Bioactivity guided fractionation and purification
Unable to initially glean any information about the class of antibacterial secondary metabolite
from genome mining tools, I focused on purification and characterization of the bioactive
76
metabolite. Following initial preparative purification by flash chromatography, the bioactivity of
each collected fraction was assessed and the bioactive fractions 17, 18 and 19 were further
purified via HPLC (Figure 5.7). Several peaks were collected from each HPLC run, although
none of the collected peaks had antibacterial activity. This may be because the antibacterial
metabolite is unstable at high temperatures or in the presence of acid (which was added to each
solvent during the HPLC purification but not during the flash chromatography purification).
Figure 5.7. UV chromatogram of the purification of fraction 19 from flash chromatography
by HPLC. The baseline drift is due to the percent composition of acetonitrile increasing over
the course of the run. The displayed UV wavelength is 220nm.
77
Copyright Acknowledgements
Explicit copyright permission is not required for reproduction of the following articles in this
thesis:
Tan, S., Moore, G. & Nodwell, J. Put a Bow on It: Knotted Antibiotics Take Center Stage.
Antibiotics 8, 117 (2019).