Post on 28-Jul-2019
PhD thesis
Patrick Reijnst
Functional analysis of Candida albicans genes
encoding SH3-domain containing proteins
Carlsberg Laboratory
and
Department of Biology, University of Copenhagen
i
PREFACE
This thesis ”Functional analysis of Candida albicans genes encoding SH3-domain
containing proteins” presents the results of my Ph. D. project carried out at the
Carlsberg Laboratory under the supervision of Professor Dr. Jürgen Wendland, and
Professor Dr. Steen Holmberg at the Department of Biology, University of
Copenhagen.
Part I
This is a general introduction to the fungal human pathogen Candida albicans, the
endocytosis machinery in Saccharomyces cerevisiae and the known function of the
homologs, in other fungal species, to the genes described in this work. It covers the
literature of the function of several genes coding for SH3 domains from several
organisms.
Part II
This describes the main objective of the Ph. D. project.
Part III
This describes a summary of the results of the Ph. D. project.
Part IV
This is a paper describing the functional analysis of nine genes that code for SH3
domain proteins in C. albicans.
Reijnst, P. Walther, A. and Wendland, J. (2010). Functional analysis of Candida
albicans genes encoding SH3-domain containing proteins. FEMS Yeast Res 10:452-
461.
ii
Part V
This is a paper describing the functional analysis of the genes CYK3, NBP2 and
SLA1 C. albicans.
Reijnst, P. Jorde, S. and Wendland, J. (2010). Candida albicans SH3-domain proteins
involved in hyphal growth, cytokinesis, and vacuolar morphology. Curr Genet 56:309-
319.
Part VI
This is a paper describing the functional analysis of Vrp1 in C. albicans and its
interaction with other genes involved in endocytosis.
Borth, N., Walther, A., Reijnst, P., Jorde, S., Schaub, Y. and Wendland, J. (2010)
Candida albicans Vrp1 is required for polarized morphogenesis and interacts with
Wal1 and Myo5. Microbiology, in press.
Part VII
This is a paper describing the functional analysis of PIL1 and LSP1 in C. albicans
and their localization in comparison to several markers for endocytosis.
Reijnst, P. Walther, A. and Wendland, J. (2010). Actin dependent endocytosis is not
linked to eisosomes. Manuscript, submitted.
Part VIII
This is a final discussion of my work and some comments for future experiments
involving eisosomes.
iii
ACKNOWLEDGEMENTS
This is a list of persons to whom I wish to thank for their help during my Ph.D.
work and during the preparation of this thesis. My warm thanks to:
Jürgen Wendland for giving me the opportunity to work in his lab and for all the
help and support during my stay.
Andrea for helping me in any problems in my practical work, teaching me how to
use the microscope, and always being available for all my questions.
Sidsel for preparing media, plates, buffers, etc. which greatly helped me in my
work, and for some short but valuable lessons in Danish.
Elsebeth, Annette, Bo and Inge for your help in all sorts of issues, both
administrative and personal.
Steen for consultation, advice and helping me fulfill the requirements needed for a
degree.
Jure for letting me teach his students, which was a valuable lesson, and for taking
the time to help me with any issues that I had.
Judita and Uffe for many nice discussions and advice, whether it was on the train,
in the corridor or in the bus during my very first day.
Alex and Janine for introducing me to the lab and for your good advice. You left
pretty soon but we had some great times going out and during our movie nights.
Sia for creating a nice atmosphere in the office and the group. We often fought to
use the microscope but also helped each other during most of our Ph.D. work.
All Ph.D. students, Post Docs and PIs in the Penelope consortium for making
every workshop and meeting interesting and truly enjoyable.
All the people at Carlsberg research center whom I have not mention. You have
all made it a wonderful place to work in.
And last but not least Anke. I have truly enjoyed spending all this time with you
and it’s no understatement that you made my days. Your kindness and knowledge are
inspiring and I wish you the best for the future.
iv
TABLE OF CONTENTS
PREFACE i
ACKNOWLEDGEMENTS iii
TABLE OF CONTENTS iv
ABBREVIATIONS vi
ENGLISH SUMMARY vii
DANISH SUMMARY ix
PART I – A GENERAL INTRODUCTION 1
The fungal kingdom 1
The Candida species 1
Candida albicans 2
Morphogenesis in Candida albicans 2
Genetics of Candida albicans 3
The actin cytoskeleton in fungi 5
Endocytosis 7
Model for actin-mediated endocytosis in Saccharomyces cerevisiae 7
The Src homology 3 domain (SH3 domain) 9
Orthologs of the analyzed genes coding for SH3 domains 12
Proteins involved in polarity 12
Proteins involved in endocytosis 13
Proteins involved in cell wall or plasma membrane 13
Proteins with miscellaneous functions 14
Eisosomes in Saccharomyces cerevisiae 14
v
PART II – MAIN OBJECTIVE OF THE Ph.D. PROJECT 16
PART III – RESULTS 18
PART IV – Functional analysis of Candida albicans genes encoding
SH3-domain containing proteins 22
PART V – Candida albicans SH3-domain proteins involved in hyphal
growth, cytokinesis, and vacuolar morphology 23
PART VI – Candida albicans Vrp1 is required for filamentous growth
and interacts with Sla2 24
PART VII – Actin dependent endocytosis is not linked to eisosomes 45
PART VIII – FINAL DISCUSSION 59
Sla1 and Rvs167 in C. albicans are involved in actin patch morphogenesis 59
Boi2 and Nbp2 in C. albicans are required for vacuolar fusion 60
CaCYK3 is an essential gene required for cytokinesis 62
Eisosomes are not required for actin dependent endocytosis 62
Summary 64
PART IX – REFERENCE LIST 65
vi
ABBREVIATIONS
A. gossypii Ashbya gossypii
BAR domain Bin-Amphiphysin-Rvs
bp Basepairs
C. albicans Candida albicans
CSM Complete supplement medium
E. coli Escherichia coli
GFP Green Fluorescent Protein
HOG High osmolarity glycerol
Lat-A Latrunculin-A
ORF Open Reading Frame
PCR Polymerase Chain Reaction
MT Microtubule
MAP kinase Mitogen-activated protein kinase
RFP Red Fluorescent Protein
S. cerevisiae Saccharomyces cerevisiae
SD Synthetic defined
SH3 domain The Src homology 3
Sp Species
S. pombe Schizosaccharomyces pombe
yEmCherry yeast enhanced monomeric Cherry (RFP)
YPD Yeast Peptone Dextrose
YPM Yeast Peptone Maltose
vii
ENGLISH SUMMARY
Actin dependent endocytosis in fungi is an essential and well studied process
where a set of 20-30 highly conserved proteins coordinate rapid remodeling of the
plasma membrane to internalize extra-cellular material. Studies in Saccharomyces
cerevisiae have shown that many of the proteins involved in endocytosis bear SH3
domains. The human genome codes roughly 300 SH3 domains while fungal genomes
generally code between 25-30 domains. The role of SH3 domains is not fully
understood but they are thought to function as protein-protein interaction domains.
The dimorphic fungus Candida albicans is a model organism and one of the major
fungal human pathogens with increasing occurrence in immune-compromised patients.
An important virulence factor of C. albicans is the ability to switch between different
growth forms, which in turn is affected by endocytosis, membrane traffic and transport
of vesicles. Thus, the involvement of SH3 domains in endocytosis plays a potentially
important role in the virulence of C. albicans. Endocytosis in S. cerevisiae may occur
at distinct locations marked by a protein complex termed eisosomes, rather than
appearing at random locations. Eisosomes have so far only been described in
S. cerevisiae. Due to its dimorphic nature, the involvement of eisosomes in
endocytosis makes them an attractive target to study in C. albicans. The aim of this
project was to elucidate the role of 12 previously uncharacterized genes coding SH3-
domain proteins in C. albicans and to expand the knowledge of eisosomes from
S. cerevisiae to investigate their role in C. albicans, especially during filamentous
growth.
Deletion of both alleles of BBC1, BUD14, FUS1, HSE1, PIN3, RVS167-2, and
SHO1 in the diploid C. albicans reference strain did not affect the morphogenesis and
the strains behaved wild type-like during all growth conditions. Overexpression of the
SH3 domains from the corresponding genes did also not result in altered cell
morphologies.
Deletion of CYK3 was not possible, suggesting it is an essential gene. Promoter
shut-down experiments using a strain with CYK3 regulated by the inducible MET3
promoter showed severe cytokinesis defects and abnormal chitin localization when
viii
grown under repressive conditions. This is supported by the localization of Cyk3 at the
mother-bud neck during cell division.
Deletion of SLA1 and RVS167 resulted in an altered actin cytoskeleton
comparable with deletion mutants of the corresponding orthologs in S. cerevisiae. The
sla1 and rvs167 null mutants exhibit slower filamentous growth which is thought to be
a result of endocytosis defects. The three SH3 domains in Sla1 were found to be
essential for the function of the protein, especially SH3 domain #1 and #2. This is
different from S. cerevisiae where it is instead SH3 domain #3 that is important for
Sla1 function.
Deletion of BOI2 and NBP2 resulted in failure to fuse vesicles and forming a large
vacuole during filamentous growth. This is a novel function that has not been
described in other fungi. The filamentous growth of nbp2 mutants was affected but
boi2 mutants have a wild type phenotype despite lacking a large vacuole. This
indicates that fragmented vacuoles per se are not sufficient to abolish or even affect
hyphal growth.
Two major components of eisosomes are Pil1 and Lsp1. The C. albicans
homologs of these genes were tagged with different fluorescent proteins and
localization studies showed complete colocalization of these two proteins but
surprisingly showed no co-localization with several endocytosis markers. Thus,
contradictory to what has previously been described in S. cerevisiae, eisosomes may
not represent sites of actin-mediated endocytosis. Deletion of PIL1 could not be
achieved which suggests that PIL1 is an essential gene. This opens a new view on
eisosomes whose cellular function therefore needs to be investigated in more detail.
The results of the work presented in this Ph. D. thesis contribute to the general
understanding of how endocytosis is regulated in C. albicans, specifically with regard
to the effect of SH3 domains and eisosomes. The yeast-hyphal switch in C. albicans is
a major factor in its pathogenicity and this work describes several new factors
involved in this process.
ix
DANISH SUMMARY
Actin afhængig endocytose i svampe er en vigtig og grundigt studeret proces,
hvor et sæt på 20-30 stærkt konserverede proteiner koordinerer en hurtig omformering
af plasmamembranen for at internalisere ekstra-cellet materiale. Studier af
Saccharomyces cerevisiae har vist, at mange af de proteiner, som indgår i endocytose,
bærer SH3 domæner. Det menneskelige genom koder for rundt regnet 300 SH3
domæner, mens svampe-genomer generelt koder for mellem 25-30 domæner. SH3
domænens rolle er ikke fuldt klarlagt, men de menes at fungere som protein-protein
interaktion domæner. Den dimorfe svamp Candida albicans er en model organisme og
en af de største patogene human svampe med stigende forekomst hos immun-
kompromitterede patienter. En vigtig virulensfaktor hos C. albicans er evnen til at
skifte mellem forskellige vækstformer, som igen er påvirket af endocytose, membran
trafik og transport af vesikler. Tilstedeværelse af SH3 domæner i endocytose spiller
således en potentiel vigtig rolle i C. albicans virulens. Endocytose i S. cerevisiae kan
forekomme forskellige steder markeret af et proteinkompleks kaldet eisosomer,
snarere end at opstå tilfældige steder. Eisosomer har hidtil kun været beskrevet i
S. cerevisiae. På grund af deres dimorfe karakter, gør tilstedeværelsen af eisosomer i
endocytose dem til et attraktivt emne at studere i C. albicans. Formålet med dette
projekt var at belyse, hvilken rolle 12 ikke tidligere karakteriserede gener, der koder
for SH3-domæne proteiner i C. albicans, spiller samt at udvide kendskabet til
eisosomer fra S. cerevisiae og undersøge deres rolle i C. albicans, især i den
trådformede vækst.
Fjernelse af begge alleler af BBC1, BUD14, FUS1, HSE1, PIN3, RVS167-2 og
SHO1 i diploide C. albicans reference stammer påvirkede ikke morfogenesen, og
stammerne opførte sig vildtype-lignende under alle vækstbetingelser. Overekspression
af SH3 domænerne fra de tilsvarende gener resulterede heller ikke i ændret celle
morfologi.
Fjernelse af CYK3 var ikke mulig, hvilket tyder på, at det er et fundamentalt gen.
Promotor shut-down eksperimenter ved hjælp af en stamme med CYK3, som reguleres
af den inducerbare MET3 promotor, viste alvorlige cytokinese defekter og unormal
kitin lokalisering, når den dyrkes under repressive forhold. Dette underbygges af
x
lokaliseringen af Cyk3 på mother-bud neck ved celledeling. Fjernelse af SLA1 og
RVS167 resulterede i et ændret aktin cytoskelet sammenlignet med fjernelse af
mutanter af de tilsvarende orthologer i S. cerevisiae. Sla1 og rvs167 null mutanterne
udviser langsommere trådformet vækst, hvilket menes at være resultatet af endocytose
defekter. De tre SH3 domæner i Sla1 fandtes at være af afgørende betydning for
proteinets funktion, især SH3 domæne # 1 og # 2. Dette adskiller sig fra S. cerevisiae,
hvor det i stedet er SH3 domænet # 3, der er vigtig for Sla1 funktionen.
Fjernelse af BOI2 og NBP2 resulterede i manglende sammensmeltning af vesikler
og dannelse af en stor vakuole under trådformet vækst. Dette er en ny funktion, der
ikke er beskrevet i andre svampe. Den trådformede vækst af nbp2 mutanter blev
berørt, men boi2 mutanter har en vildtype fænotype trods manglen på en stor vakuole.
Dette indikerer, at fragmenterede vakuoler i sig selv ikke er tilstrækkelige til at
afskaffe eller endda påvirke svampetrådenes vækst.
To vigtige komponenter i eisosomer er Pil1 og Lsp1. C. albicans homologer af
disse gener blev mærket med forskellige fluorescerende proteiner, og undersøgelser af
lokalisering viste en komplet co-lokalisering af disse to proteiner, men viste
overraskende ingen co-lokalisering med flere endocytose markører. Dette er således i
modstrid med, hvad der tidligere har været beskrevet i S. cerevisiae, og eisosomer kan
ikke repræsentere lokaliteter af aktin-medieret endocytose. Fjernelse af PIL1 kunne
ikke udføres, hvilket tyder på, at PIL1 er et fundamentalt gen. Dette åbner et nyt syn
på eisosomer, hvis cellefunktion derfor skal undersøges nærmere.
Resultaterne af arbejdet, som præsenteres i denne Ph.D.-afhandling bidrager til
den generelle forståelse af, hvordan endocytose er reguleret i C. albicans, specielt med
hensyn til effekten af SH3 domæner og eisosomer. Gærsvampetrådenes skift i
C. albicans er en vigtig faktor i patogenicitet, og dette arbejde beskriver en række nye
faktorer, der er indgår i denne proces.
1
PART I - A GENERAL INTRODUCTION
The fungal kingdom
The fungi constitute a highly diverse and successful group of organisms that
include well-known species such as yeasts, molds and mushrooms, and are classified
as a biological kingdom of eukaryotic organisms distinct from animals and plants.
Most fungi are unnoticed because of their small size and growth in soil, where they
play an essential part in decomposing organic material. But there are some fungi that
have made a great impact in human history; yeasts (Saccharomyces sp.) that are used
worldwide in the production of alcoholic beverages and in baking, fungi (e.g.
Penicillium sp., Acremonium sp. and Aspergillus sp.) that are used to produce
antibiotics and enzymes, and some fungi (e.g. Candida sp., Fusarium sp. and Ustilago
sp.) that may cause disease to humans and to crops, the latter with potentially great
economic impacts. Regardless of their classification, fungi proliferate mainly by two
distinct forms; filamentous growth and yeast growth. Filamentous fungi grow as
tubular elongated cells called hyphae. Yeast-like fungi on the other hand grow as
single cells, where new cells separate or bud from the mother cell. Most fungi are
limited to one of these forms of growth, but some fungi are able to switch between
yeast- and filamentous growth - these fungi are termed dimorphic.
The Candida species
The genus Candida belongs to the phylum Ascomycota and contains about 150
species. The best known and most important one by far is Candida albicans, but other
clinically important species include C. glabrata, C. dublienensis, C. parapsilosis and
C. krusei. Many Candida species occur as commensals on the skin, gastro-intestinal
tract and genitor-urinary tract. However, some Candida species have the potential to
cause disease in humans and the increase of immunocompromised patients during the
last decades has seen a raise in infections caused by Candida, again most notably
C. albicans.
2
Candida albicans
C. albicans is the most common fungal pathogen in humans, able to cause various
infections (Candidiasis) that may be severe enough to kill the host if the infection is
systemic. Two important factors that affect the pathogenicity of C. albicans are the
ability to switch between yeast growth and filamentous growth, i.e. the hyphal switch,
and the ability to form biofilms which enables C. albicans to adhere to the surface of
substrates. In biofilms cells show an increased resistance to the immune system and to
antifungal drugs (Naglik et al., 2003; Whiteway and Oberholzer, 2004).
Morphogenesis in Candida albicans
Candida albicans is able to grow in at least three different morphological states:
yeast, hyphal and pseudohyphal growth, depending on its growing conditions (See
figure 1). Furthermore, C. albicans can also exist in an additional form called opaque
cells, which is its mating competent form (Sudbery et al., 2004). When grown at
30 °C, C. albicans grows as unicellular budding yeast similar to diploid
Saccharomyces cerevisiae. It exhibits dipolar budding. Phenotypic switching to hyphal
growth is usually induced by growth at 37 °C and pH ~ 7.0 with the addition of
external stimuli such as serum, N-acetylglucosamine or sugar starvation. Hyphae grow
from yeast cells by extending the apex and form septa along the hyphae to separate the
compartments. The third growth form is called pseudohyphal growth, in which cells
exhibit a variety of forms between the yeast and hyphal growth. In pseudohyphal
growth cells may elongate to such extremes that they may be hard to distinguish from
true hypha, but a crucial difference is the constriction at the site of junction.
Figure 1. Morphogenesis in Candida albicans. The panels show microscopic images of C. albicans
growing as a yeast, pseudohyphae, hyphae and opaque cells. Image of opaque cells is modified from
Srikantha et al., 2006. Scale bars represent 5 μm.
3
Most dimorphic fungi that are human pathogens grow as filamentous fungi in
their external habitat but grow as budding yeast into diseased tissues, e.g.
Cryptococcus neoformans, Histoplasma capsulatum and Blastomyces dermatitidis
(Gow et al., 2002). In contrast, the filamentous growth form of C. albicans is
important for virulence because strains without the ability to undergo hyphal switch
are avirulent (Lo et al., 1997). However, disruption of the hyphal repressors Nrg1 and
Tup1 in C. albicans leads to constitutive filamentous growth, and this results in
reduced virulence (Saville et al., 2003). It may therefore be the ability to switch
between the various growth forms that is essential for the virulence of C. albicans,
rather than a single growth form. Hyphae and pseudohyphae are able to growth
invasively in agar, and one idea suggests this would promote invasive growth into
tissues during the early infection and also colonization of all inner organs. The yeast
growth could instead be more advantageous for rapid spread in the bloodstream (Gow
et al., 2002). C. albicans is also able to form a heterogeneous architecture called
biofilm, which consists of yeast- and filamentous cells enveloped by a matrix of
polysaccharides and proteins. This structure is highly resistant to the immune system
and antifungal agents, and is usually involved in chronic infections of C. albicans
(Hawser et al., 1998).
Genetics of Candida albicans
C. albicans is an obligate diploid (Olaiya and Sogin, 1979). It was long thought
that C. albicans was an asexual fungus, but following the full sequencing of the
genome it was shown that the C. albicans genome contains a Mating Type Like (MTL)
locus MTLa/α. The heterozygous MTL locus in C. albicans contains one MTLa and
one MTLα allele (Hull and Johnson, 1999). In a heterozygous wild type strain, a1 and
α2 form a complex that suppresses the expression of the transcriptional regulator
WOR1 (Zordan et al., 2006; Huang et al., 2006; Srikantha et al., 2006). In order for
C. albicans to undergo mating, cells must complete two steps. The first requirement is
the generation of a homozygous MTLa or MTLα strain (Hull et al., 2000; Magee and
Magee, 2000). This leads to the expression of WOR1 which is the “master regulator“
of the white-opaque phenotype switching. This is necessary because opaque cells are
the mating competent form in C. albicans and are able to mate with a frequency of 106
higher compared to white cells (Miller and Johnson, 2002; Lockhart et al., 2002).
4
Figure 2. A model for the genetic regulation of the white-opaque switch in C. albicans. a1 and α2 form
a complex that inhibit expression of WOR1, the master regulator of white-opaque switching. Red likes
represent the control of Wor1 on each gene. Blue lines represent relationships. Yellow and white boxes
represent gene products enriched in opaque- and white cells, respectively (Zordan et al., 2007).
The parasexual life cycle in C. albicans shares many features with the sexual life
cycle in S. cerevisiae. Opaque cells of different mating type form shmoos and fuse,
thus producing a tetraploid daughter cell (Tzung et al., 2001). While S. cerevisiae
thereafter undergoes meiosis and spore formation, C. albicans differs in that meiosis –
if it occurs at all – has not yet been demonstrated. Instead, tetraploid daughter cells
return to a diploid state by chromosome loss (Forche et al., 2008).
The genetic analysis of C. albicans is complicated by mainly two factors; the lack
of a haploid state and due to the lack of a complete sexual cycle the inability to
perform genetic crosses which is used in other fungi. Furthermore, gene function
analysis may also require more effort than in the model yeast S. cerevisiae due to the
extensive chromosome polymorphism, resulting in deletions, translocations and
amplifications of particular chromosomes in C. albicans. These chromosomal
alterations are largely due to major repeat sequences (MRS) specific for C. albicans
(Iwaguchi et al., 2004, Lephart et al., 2005, Lephart and Magee, 2006). The analysis
of a gene thus requires the subsequent deletion of both alleles as well as the
5
verification of the absence of a third copy. A common strategy for site directed
mutagenesis is to transform C. albicans with a selectable marker flanked by app.
100 bp of sequence homology to the region of interest (Gola et al., 2003). Popular
methods for gene deletion include the “URA3-blaster” (Fonzi and Irwin, 1993),
“URA3-flipper cassette” (Morschhäuser et al., 1999) and PCR based gene targeting
(Walther and Wendland, 2008). It may be important taking into account that several
Candida species including C. albicans translate the CUG codon to Serine rather than
Leucine as by most organisms (Ohama et al., 1993), so genetics tools used in other
fungi must sometimes be codon-optimized for the use in C. albicans. The two most
commonly used laboratory strains are BWP17 (Wilson et al., 1999) and SN148 (Noble
and Johnson, 2005), which are auxotrophs for the synthesis of histidine, arginine and
uracil (BWP17), and leucine, histidine, arginine and uracil (SN148). There are also
dominant markers that can be used for selection of C. albicans mutants: MPAR, a gene
coding for mycophenolic acid resistance (Wirsching et al., 2000), and SAT1, a gene
coding for resistance against nourseothricin/streptothricin (ClonNAT) (Reuss et al.,
2000). All the mutants generated in this study are derived from SN148 using only the
auxotrophic markers.
The actin cytoskeleton in fungi
Critical processes such as endocytosis, cytokinesis, cell polarity and cell
morphogenesis require the coordinated activity of 20-30 highly conserved actin
associated proteins, in addition to many cell-specific actin associated proteins and
numerous upstream signaling molecules. Cells during different stages of the cell cycle
contain three different actin structures (Figure 3): patches, cables and rings, which in
C. albicans can be visualized by staining fixed cells with e.g. Rhodamine phalloidin
(Mosley and Goode, 2006). In S. cerevisiae, actin is expressed from the single and
highly conserved essential gene ACT1 (Shortle et al., 1982).
The distribution of actin patches changes during the cell cycle. Stationary cells
contain several patches located at the cell cortex in a random distribution. When a cell
produces a bud, the majority of the patches will localize to the emerging bud - a
concentration of actin patches in an unbudded cell is a good indicator for the next site
of bud emergence.
6
(A) (B)
Figure 3. Organization of the actin cytoskeleton during different growth stages in C. albicans. (A) In
yeast cells, actin patches and cables can be seen during most growth phases while the actin ring can be
visualized only shortly before and during cytokinesis. Shown from left to right are cells with an
emerging bud, small bud, large bud and bud separation. (B) During filamentous growth, actin patches
accumulate near the tip of the hyphae. Shown from top to bottom are cells after 1h, 2h, and 3h of
growth in hyphae inducing media. All cells were chemically fixed and stained with the dye Rhodamine
phalloidin to visualize filamentous actin structures. Scale bars represent 5 μm.
The distribution of actin patches becomes more homogenous as the bud grows,
eventually containing almost all actin patches in the daughter cell. Prior to cytokinesis,
the actin patch distribution changes to both the mother and daughter cell (Kilmartin
and Adams, 1984; Adams and Pringle, 1984). During the filamentous growth of
C. albicans, actin patches also accumulate at the site of polarized growth, just before
the very tip of the hyphae (Anderson and Soll, 1986). Actin patches are also present
along the hyphae. Studies in S. cerevisiae have shown that actin patches are mediators
of endocytosis and their formation relies on nucleation by the Arp2/3 complex (Winter
et al., 1997; Evangelista et al., 2002).
Fungi use actin-mediated transport to maintain polarity and to separate organelles
during cell division (Bretscher, 2003). During yeast growth of C. albicans, cables are
assembled at the bud tip and neck to serve as polarized tracks for cargo delivery to the
site of polarized growth (Moseley and Goode, 2006). The majority of hyphae during
filamentous growth have actin fibers emanating from the hyphal tip directed to the
apex (Anderson and Soll, 1986). Actin cables are essential for filamentous growth in
C. albicans, as disruption of actin cables in hyphal cells leads to a switch to isotropic
growth (Ushinsky et al., 2002). In contrast to actin patches, actin cables in
S. cerevisiae are assembled by the formins Bni1 and Bnr1 (Evangelista et al., 2002;
Sagot et al., 2002). CaBni1 localizes to the bud tip and hyphal tip (Crampin et al.,
2005; Martin et al., 2005), while CaBnr1 localizes to the bud neck (Dünkler and
Wendland, 2007). The importance of actin cable organization is evident as a
Δbni1/Δbnr1 mutant is lethal in C. albicans (Li et al., 2005). Cables provide active
transport routs to the hyphal tip mediated by myosin, and passive transport of
7
endocytotic vesicles in a retrograde flow, i.e. from bud to mother (Huckaba et al.,
2004).
Almost all animals and fungi use an actin ring to separate the two cells after
cytokinesis (Field et al., 1999). The actin contractile ring is normally only present in a
subset of cells because they only appear very briefly before and during cytokinesis, but
they can be easily visualized by using a synchronized cell population. Cytokinesis in
S. cerevisiae is mediated by two mechanisms. First is the constriction of an actin ring,
which is promoted by Myo1, and second, the formation of a septum which is achieved
by transportation of membrane and cell wall synthesis. The relative position of the
contractile ring is important as it marks the delivery endpoint (Bi et al., 1998;
Lippincott and Li, 1998).
Endocytosis
Endocytosis is the process in which cells internalize molecules from outside the
cell by engulfing them with the cell membrane. There are several pathways for
internalization of extracellular substrates and molecules; phagocytosis,
macropinocytosis, caveolae-mediated endocytosis and clathrin-mediated endocytosis.
Phagocytosis involves the engulfment of particles such as bacteria (Dramsi and
Cossart, 1998). Macropinocytosis involves the engulfment of extracellular fluid
(Swanson and Watts, 1995). Caveolae-mediated endocytosis is not so well understood,
but it appears to be important in the internalization of cholesterol, recycling of
glycosyl-phosphatidylinositol(GPI)-anchored proteins and also uptake of viruses and
certain strains of E. coli (Razani and Lisanti, 2001). The clathrin mediated endocytosis
is a major pathway for endocytosis in animal cells, and it is clear this is also conserved
in fungi (Newpher et al., 2005).
Model for actin mediated endocytosis in Saccharomyces cerevisiae
There are two models describing the early recruiting process of the endocytotic
machinery. First is the activation of membrane receptors, possibly by kinases and
ubiquitin ligases, which then associate with the endocytotic machinery (Tan et al.,
1996; Hicke, 1999; Roth and Davis, 2000; Shih et al., 2000; Howard et al., 2002). The
second theory involves static complexes termed “eisosomes” that already contain
some of the early endocytotic machinery and continue to recruit membrane receptors
8
(Walther et al., 2006). Endocytic internalization begins with the initiation of the
endocytic site, continues with the invagination and scission of the membrane, and ends
with the release of the vesicle (Kaksonen et al., 2006). An overview of the different
steps in endocytosis is shown in figure 4.
Figure 4. Model for actin/clathrin mediated endocytosis in yeast. Endocytosis begins with a clathrin
coat at the endocytic side (blue line), followed by Las17 (yellow dot). This complex recruits Sla1, Pan1,
Sla2, and End3 (green line). Next, after recruiting Bbc1, Myo5 (blue dot) and the actin nucleation
machinery (red line), the cell surface is invaginated (slow movement) by actin polymerization. This is
visualized as an actin patch. Finally, the Amphiphysin orthologs Rvs161 and Rvs167 (brown line)
release the vesicle in a fast process (Modified from Kaksonen et al. 2005).
Through an unknown function, clathrin appears at virtually every endocytic site
before all known components of the endocytotic machinery (Kaksonen et al., 2005).
The role of clathrin however, is not essential, as clathrin mutants show only a ~50%
reduction in uptake of α factor (Chu et al., 1996; Payne et al., 1988). Las17 (Human
WASP homolog) is the earliest protein to arrive at the endocytotic site. It remains
immotile at the cell surface and is joined by Sla1, End3, Pan1 (Human Eps15
homolog) and Sla2 (Human Hip1R homolog) which appear shortly after (Kaksonen et
al., 2003).
As a next step, the actin nucleation machinery consisting of the Arp2/3 complex,
Abp1, Myo3 and Myo5 localizes to the endocytotic site. While Las17 remains
localized to the cell surface the remaining proteins move inwards together (Kaksonen
et al., 2003). This movement likely corresponds with the membrane invagination. The
9
slow motility of the protein complex is thought to be driven by actin polymerization
because filamentous actin can be detected, and also because this movement is sensitive
to latrunculin-A (Lat-A), an actin monomer-sequestering and thus actin
depolymerizing agent (Kaksonen et al., 2003; Martin et al., 2005).
Prior to actin nucleation, Bbc1 is recruited and interacts with Las17, Myo3 and
Myo5. It is thought that Bbc1 has a regulatory function in the internalization of the
membrane (Rodal et al., 2003). The increasing invagination of the membrane is
followed by additional actin filaments attaching to the growing endosome, which can
be visualized as a cortical actin patch. Rvs161 and Rvs167 (Yeast amphiphysin)
colocalize briefly with sites of endocytosis after actin polymerization. Localization
studies of Rvs161 and Rvs167 together with data on deletion mutants indicate that
these proteins are involved in the scission and release of the vesicle (Kaksonen et al.,
2005). Once released, the actin-covered vesicles become attached to actin cables by an
unknown mechanism and move passively in an actin cable retrograde flow (bud to
mother) (Moseley and Goode, 2006).
The Src homology 3 domain (SH3 domain)
The Src homology 3 (SH3) domain is a small protein domain of about 60 amino
acid residues first identified as a conserved sequence in the viral adaptor protein
p47gag-crk
and the non-catalytic part of several cytoplasmic tyrosine kinases, e.g. Lck,
Src and Abl. (Mayer et al., 1988). Src (abbreviation for sarcoma) is a family of proto-
oncogenic tyrosine kinases. Since then, it has also been identified in a great variety of
other protein families such as CDC25, Ras GTPase activating protein and PI3 Kinase
(Mayer and Baltimore, 1993). The SH3 domain has a characteristic beta-barrel fold
which consists of five or six β-strands arranged as two tightly packed anti-parallel
β sheets (figure 5). The linker regions may contain short helices (Kuriyana and
Cowburna, 1993).
10
Figure 5. Ribbon diagram of the SH3 domain, alpha spectrin, from chicken (Gallus gallus) (PDB
accession code 1BK2). SH3 domains have a characteristic fold with 5-6 β-strands that form two anti-
parallel beta sheets (β-strands blue and brown anti-parallel to β-strands yellow, green and cyan). The
function of SH3 domains is not well understood, but they are thought to mediate the assembly of
specific protein complexes by binding proline-rich peptides (Morton and Campbell 1994).
The function of SH3 domains is not well understood. The current consensus is
that SH3 domains bind to proline-rich peptides and thereby mediate the assembly of
specific protein complexes (Morton and Campbell 1994). There are roughly 300 SH3
domains encoded in the human genome (Kärkkäinen et al., 2006). The genome of
C. albicans encodes a total of 29 SH3 domains in 24 genes and the genome of
S. cerevisiae encodes a total of 28 SH3 domains dispersed in 24 genes. SH3 domains
are mostly found in 1 copy in a given protein, but there are many proteins with 2 SH3
domains, and some with 3 or 4 copies. There seems to be a limited evolution of the
SH3 domains in yeast-like ascomycetes. For example, Abp1 in S. cerevisiae contains 1
SH3 domain while Abp1 in C. albicans contains 2 SH3 domains. Yet, deletion of
CaABP1 does not affect yeast and hyphal morphogenesis (Martin et al., 2007). An
alignment of the 14 SH3 domains from the 12 genes that were functionally analyzed in
this work is shown in figure 6, and their relative position is shown in figure 7.
11
Figure 6. Alignment of all SH3 domains. The 14 SH3 domains from the 12 genes that were functionally
analyzed in this work using the MegAlign tool from DNAStar). Identical residues are shaded in black
and consensus sites are shaded in gray.
Figure 7. Position of SH3 domains. The position of the SH3 domain vary within the proteins. For
reference, the complete protein length is drawn to scale. The SH3 domains were found using the
SMART tool at (http://smart.embl.de). Note that Sla1 has several repeats at its C-terminus.
- - - - - S K A K A L Y D Y A A Q E D - - D E L S F K E G D K I Y V I E I - - - V D - D D - - WMajority
- - - - - MK V K A I F D Y K S D Y D - - E D L S F D A G T I I NI I S V - - - E N- D E - - W 35Bbc1- MD G G D T Y I C I K Q F NA R L G - - D E L S L K I G D K I Q V L A D D R E Y N- D G - - W 42Boi2- - - - - D K L Y G L Y D F S G P D P - - S HC T L L V D E P V Y L I ND - - - E D - NY - - W 35Bud14- - - - - F K V K T I V S WA G E E E - - G D L G F ME NE I V Q V F S I - - - V D - E S - - W 35Cyk3- - - E Q S L Y T V I R S Y NK S L G - - D E L NI E V G D K A V I L E K - - - HS - D G - - W 37Fus1T V A T V S K V R A L Y D L V S Y E P - - D E L S F R K G D V I T V I E S - - - V Y - R D - - W 40Hse1- - - - - C K A R A I F D F S A E ND - - NE I S L I E G Q I I WI S Y R - - - HG - Q G - - W 35Nbp2- - - - - G Y C I A T Y D Y K A Q Q A - - G D L D L S K G D K L A V V E H- - - L S - E D - - W 35Pin3- - - - - P T C T A L Y D Y T A Q A Q - - G D L T F P A G A V I E I I Q R - - - T E - D A NG W 37Rvs167- - - - - S Y C Y A L HD F A G Q E E - - L D L R F S K G D K I K I L V G - - - NG - T - - - W 34Rvs167-2- - - - - Y K A K A L Y S Y D A NP D D I NE I S F V K D E I L E V D D I - - - D G - K - - - W 36Sho1- - - - - G V Y K A L Y D Y A A Q A E - - E E L NI K Q ND L L Y L L E K - - - S D I D D - - W 36Sla1 #1- - - - - K T A T A L Y D Y D K Q T E - - E E L S F NE ND K F NV F D L - - - ND - P D - - W 35Sla1 #2- - - - - K I G R L L Y D F E V Q G D - - D E L D C K E G D E V Y I I D Q - - - K K S K D - - W 36Sla1 #3
WK G - - - - - - - - - - K L - - NG - - - - - - - - - K - - - - - I G L V P S NY V E L I -Majority
Y S G - - - - - - - - - - E Y - - D G - - - - - - - - - K - - - - - Q G MF P K NF V E E L K 56Bbc1Y - - - - - - - - - - - - - - - - MG K N- - - - L L T G E - - - - A G L Y P K T F T Q L I T 65Boi2WL I R K L T K L E R L K R MR L NG Q E F Q I D I E S D E E D G K I G F V P A E C L E T H 81Bud14WS G - - - - - - - - - - K L R R NG - - - - - - - - - A - - - - - E G I F P K D Y V T I L E 58Cyk3C K I - - - - - - - - - - R L V R MG K D Y Y NHQ L S L D - - - - I G L V P K MC L Q K I 69Fus1WR G - - - - - - - - - - S L P - S G - - - - - - - - - K - - - - - I G I F P L NY V T P I V 62Hse1L V A - - - - - - - - - E D P - I L G - - - - - - - - - E - - - - - NG L V P E E Y V E I MQ 58Nbp2WK G - - - - - - - - - Y K S - - D S S P - - - - - - E K - - - - - T G V F P S NY V K I I S 60Pin3WT G - - - - - - - - - - K Y - - NG - - - - - - - - - Q - - - - - T G V F P G NY V Q L 56Rvs167WE R - - - - - - - - - - Q L - - NG - - - - - - - - - K - - - - - I G Q F P S NY V Q L I 54Rvs167-2WQ A - - - - - - - - - R R - - A NG - - - - - - - - - Q - - - - - V G I C P S NY V K L L D 58Sho1WK V - - - - - - - - - K K R V V A T G E E - - - I V D E P - - - - S G L V P S T Y I E E A P 67Sla1 #1I L V - - - - - - - - - G D - - L A K - - - - - - - - E K - - - - - F G F V P S NY I Q L D S 58Sla1 #2WMV - - - - - - - - - E N- - I A T - - - - - - - - R R - - - - - Q G V V P S T Y I E I I S 59Sla1 #3
Pin3
Nbp2
Fus1
Rvs167-2
Sho1
Rvs167
Hse1
Bud14
Bbc1
Cyk3
Boi2
Sla1
SH3-domain
12
Orthologs of the genes coding for SH3 domains that have been
analyzed in this work.
The genome of C. albicans contains 24 genes encoding SH3-domain proteins. 12
of these genes were selected for functional analysis both as part of the participation in
the Marie Curie project “Penelope” and because most of the other genes have already
been deleted and analyzed (Table 1). The function of the protein orthologs encoded by
the 12 genes encoding SH3-domain proteins analyzed in this work vary in the cell and
are summarized in figure 8.
Figure 8. Orthologs in S. cerevisiae. SH3-domain encoding proteins mediate protein-protein interactions
and are found in processes where protein complexes are required, such as cytokinesis, endocytosis and
cell polarity. The protein orthologs in S. cerevisiae encoded by the genes analyzed in this work have
been found to play a role in cytokinesis (Cyk3), establishment of cell polarity (Boi2, Bud14 and Fus1),
endocytosis (Sla1, Bbc1 and Rvs167), cell wall or plasma membrane integrity (Sho1 and Nbp2) or have
been described to play a role in other processes such as prion formation and sorting of ubiquitinated
proteins (Hse1 and Pin3).
Proteins involved in polarity
Boi2 is involved in polar growth in S. cerevisiae and A. gossypii. Boi2 localizes to
sites of polar growth and also to the neck in S. cerevisiae and to the hyphal tip and to
13
sites of septation in A. gossypii. Deletion of BOI2 in S. cerevisiae does not cause a
change in morphology while deletion of AgBOI2 results in spherical enlargements at
the hyphal tip (Hallett et al., 2002; Knechtle et al., 2006).
Bud14 in S. cerevisiae is involved in stabilizing microtubule interactions at sites
of polarized growth. Scbud14 null mutants are sensitive to mating factor, have
increased filamentous growth and hyperelongated shmoos. ScBud14 localizes to the
presumptive bud site in unbudded cells, the distal tip in growing buds and the bud
neck in large budded cells (Ni and Snyder, 2001; Cullen and Sprague, 2002; Knaus et
al., 2005).
Fus1 in S. cerevisiae is required for cell fusion. Deletion of FUS1 in S. cerevisiae
has no effect on the vegetative growth. ScFus1 localizes to the schmoo tip (Trueheart
et al., 1987).
Proteins involved in endocytosis
Bbc1 in S. cerevisiae is thought to be involved in regulating the actin
cytoskeleton. Scbbc1 mutants are wild type-like but synthetically lethal with Scsac6
and Scsla2. ScBbc1 localizes to patch-like structures at the bud cortex and cell
division site (Mochida et al., 2002).
Rvs167 in S. cerevisiae is involved in the scission of invaginated plasma
membrane during endocytosis. Deletion of ScRVS167 leads to a delocalization of actin
patches in all cell types (Bauer et al., 1993; Kaksonen et al., 2005).
ScSLA1 is required for actin patch structure and organization. Deletion of SLA1 in
S. cerevisiae leads to few, large depolarized actin patches. Scsla1 is synthetically
lethal with Scabp1. ScSla1 localizes to the cell cortex and co-localizes with a subset of
actin patches (Holtzman et al., 1993; Ayscough et al., 1999).
Proteins involved in cell wall or plasma membrane
ScNbp2 is involved in cell wall integrity. Deletion of NBP2 in S. cerevisiae leads
to sensitivity against calcofluor white. ScNBP2 is essential for mitotic growth at high
temperatures, i.e. 37 °C. ScNbp2 localizes to the cytoplasm (Ohkuni et al., 2003).
SHO1 in S. cerevisiae codes for a transmembrane protein that is part of the HOG
pathway. Scsho1 mutants are sensitive to high osmolarity. (Maeda et al., 1995).
14
Proteins with miscellaneous functions
ScHse1 is involved in sorting ubiquitinated membrane proteins that are destined
for degradation. ScHse1 localizes to dot-like structures across the cytosol. Deletion of
HSE1 in S. cerevisiae leads to failure in localizing Ste3 to the vacuole. ScSte3 is the α-
factor receptor and is rapidly degraded in the vacuole (Bilodeau et al. 2002).
PIN3 in S. cerevisiae encodes for a protein of unknown function. Overexpression
of a sequence containing the ScPIN3 ORF induced the appearance of [PIN+] prion
(Derkatch et al., 2001).
Cyk3 in S. cerevisiae localizes to the mother-bud neck and is involved in
cytokinesis and cell separation. Deletion of CYK3 in S. cerevisiae results in a mild
cytokinesis defect, while deletion of ScCYK3 together with ScHOF1 or ScMYO1 is
lethal (Korinek et al., 2000).
Table 1. Protein comparison of the genes analysed in this work from C. albicans (Ca) and the protein
length of the corresponding genes in S. cerevisiae (Sc).
Systematic name
Gene name
Sc protein length
Ca protein length
Sequence identity* (%)
Position of the SH3 domain in the Ca protein
orf19.2791 BBC1 1157 954 25.8 1-56 orf19.3230 BOI2 1040 1172 32.5 5-65 orf19.3555 BUD14 707 801 20.8 259-340 orf19.13620 CYK3 885 1020 29.4 11-68 orf19.1156 FUS1 512 384 25.1 318-383 orf19.3233 HSE1 452 498 39 215-271 orf19.6588 NBP2 236 342 27.5 127-184 orf19.5956 PIN3 215 285 54.9 104-163 orf19.1220 RVS167 482 440 62.5 419-474 orf19.4742 RVS167-2 354 313-366 orf19.4772 SHO1 367 387 38.9 334-391 orf19.1474 SLA1 1244 1257 36.9 7-73, 76-133, 399-457
*The sequence identity was calculated using the full length proteins.
Eisosomes in Saccharomyces cerevisiae
In S. cerevisiae, sites of endocytosis may be formed randomly or initiated at
specific locations. The second theory is supported by the co-localization of static
protein complexes with protein and lipid endocytosis. These structures are termed
eisosomes (from the Greek „eis‟, meaning “in to” or portal, and „soma‟, meaning
body) and are composed mainly of the two cytoplasmic proteins, Pil1 and Lsp1
(Walther et al., 2006).
15
Pil1 and Lsp1 are very similar, sharing 78.9% identity in C. albicans and 71.6%
identity in S. cerevisiae (MegAlign, DNAStar).
Eisosomes are static protein complexes that localize with Sur7 in a dot-like
manner beneath the plasma membrane. All uptake of FM4-64 occurs at eisosomes, but
not all eisosomes are involved in uptake of FM4-64. Deletion of LSP1 in S. cerevisiae
leads to reduced uptake of FM4-64 while deletion of PIL1 leads to clustering of Lsp1,
and redirection of endocytosis to these clusters (Walther et al., 2006). Deletion of
SUR7 in S. cerevisiae leads to reduced sporulation but otherwise wild type phenotype
(Young et al., 2002) while deletion of SUR7 in C. albicans leads to depolarized actin
patches, mislocalization of septins and intracellular growth of cell wall (Alvarez et al.,
2008). Pil1 is the main regulator of eisosomes, determining their size and localization
(Moreira et al., 2009). Expression of PIL1 and SUR7 in S. cerevisiae is cell cycle
regulated while expression of LSP1 is not (Spellman et al., 1998).
Pil1 and Lsp1 are thought to be negative regulators of heat stress resistance, Pkh1
along with its downstream targets, the Pkc1 MAP kinase cascade and the Ypk1
pathway. Deleting PIL1 or LSP1 was found to increase heat stress resistance and a
pil1/lsp1 double mutant is viable (Zhang et al., 2004). Eisosomes may be involved in
regulating the plasma membrane architecture, localize cell growth and contribute to
the establishment and maintenance of cell polarity. A failure in such regulation of the
plasma membrane may be the reason to why endocytosis is redirected to eisosome
clusters (i.e. Lsp1) in pil1 mutants (Walther et al., 2006). However, overexpression of
PIL1 does not affect cell polarity despite eisosomes present at the bud tip in growing
buds (Moreira et al., 2009). There may be a connection between eisosomes and lipids.
16
PART II - MAIN OBJECTIVE OF THE Ph. D.
PROJECT
C. albicans is a dimorphic fungal human pathogen, which can cause serious and
often lethal systemic infections in immunocompromised patients. There are several
reasons to why C. albicans can cause disease, of which the yeast-to hyphal switch has
long been regarded as one of the most important. Non-filamentous C. albicans mutants
are avirulent (Lo et al., 1997). The Wiskott-Aldrich Syndrome Protein (WASP)
homolog Wal1 is required for endocytosis and biogenesis of vacuoles. Deletion of
WAL1 generates non-filamentous mutant strains that are attenuated in virulence
(Walther and Wendland, 2004; Wendland et al., 2006). This shows that polarized
hyphal growth in C. albicans is not only dependent on secretion and the polarized
delivery of vesicle to the hyphal tip but also requires endocytosis and correct
membrane traffic.
A large number of S. cerevisiae proteins involved in endocytotic processes bear
SH3-domains, which serve as protein-protein interaction domains generating a
network of proteins at specific locations, e.g. at sites of cortical actin patches (Morton
and Campbell 1994). Hence, the previous contribution in functional analyses of
C. albicans genes and the link between endocytosis and polarized hyphal growth
served as an initial basis to elucidate the function of the SH3-domain proteins in
C. albicans. How endocytosis is initiated is not known, but one theory involves the
initiation at specific static receptors termed eisosomes. Eisosomes are large immobile
complexes consisting of the two proteins Pil1 and Lsp1, and have been reported to
mark future sites of endocytosis. The exact function of the eisosomes remains unclear
however, because actin patches (early endocytosis markers) can also form at sites
independent of eisosomes (Walther et al., 2006; Moreira et al., 2009). Eisosomes may
also have a role in lipid domains as sub-compartmentalization has been shown to
occur specifically with lipid rafts (Lingwood and Simons, 2010). By adding the
knowledge gained from our analysis of the SH3-domain coding genes that are
involved in endocytosis I intend to investigate the role of eisosomes in C. albicans.
Eisosomes that have so far only been reported in S. cerevisiae, and C. albicans make
an ideal model for determining the role of eisosomes in filamentous fungi. The
17
dimorphic growth of C. albicans will help us compare the function of eisosomes
during different growth forms.
18
PART III - Results
Generation of C. albicans mutant strains
All deletion strains in this thesis were generated using PCR based gene targeting
(Walther and Wendland, 2008). First I generated a heterozygous and subsequently a
homozygous mutant strain using different marker genes (Figure 9) and the correct
deletion could be demonstrated by PCR (Figure 10). For each of the targeted genes at
least two independent homozygous mutants were generated.
Fig 9. Transformation of C. albicans with functional analysis (FA)-constructs. (A) Design of chimeric
primers S1 and S2 bearing 100 bp of homology regions and annealing sites for marker cassette
amplification. Sequential disruption using these cassettes results in a homozygous mutant strain.
Specific diagnostic PCR primers are positioned outside the homology region (G1 and G4) and within
the marker cassette (H2 and H3 for Marker 1 and U2 and U3 for Marker 2). To verify no additional
copy of the gene is present in the genome, a negative control is done using primers positioned to
amplify an internal part of the gene (I1 and I2). (B) Image of an ethidium bromide-stained gel showing
the result of a diagnostic PCR of a homozygous mutant strain, as described in (A). Lane C: An internal
19
fragment of the gene from a wild type strain. Lane I: An internal fragment of the gene from the deletion
strain, no band ensures that the gene of interest has been deleted. Lanes 5’ and 3’: The 5’ and 3’ flanks
of the marker cassettes that has been integrated at a defined location. The well defined bands in the
ladder are of the size 5000 bp (top band), 1500 bp (middle band) and 500 bp (bottom band).
A
B
C
Figure 10. Verification of all deletion mutants in this thesis. Lane C: Internal band of the corresponding
gene in a wild type strain. Lane I: An internal fragment of the gene from the deletion strain, no band
ensures that the gene of interest has been deleted. Lanes 5’ and 3’: The 5’ and 3’ flanks of the marker
cassettes that have been integrated at the location of the target ORF. The white arrow points to a well
defined band representing 500 bp. (A) Images of ethidium bromide-stained gels showing the result of a
diagnostic PCR of all homozygous deletion mutants in PART IV. (B) Images of ethidium bromide-
stained gels showing the result of a diagnostic PCR of all homozygous deletion mutants in PART V. (C)
Images of an ethidium bromide-stained gel showing the result of a diagnostic PCR of the lsp1
homozygous deletion mutant in PART VII.
20
Functional analysis of the mutant strains
The generated mutant strains were characterized to reveal growth defects under
standard growth conditions, their ability to undergo hyphal switch, actin cytoskeleton
organization and vacuolar morphology (See Part IV, Part V and Part VII). The results
of this study therefore add to the repository of functional analysis information for
genes encoding SH3 domain proteins in C. albicans. A summary of the function of the
proteins encoded by these genes in S. cerevisiae and C. albicans is listed in table 2,
which includes new information that is presented in this work.
Table 2. Comparison of all 24 known SH3 encoding genes from S. cerevisiae and C. albicans.
Described are the systematic names in their respective organisms as well as a summary of the known
function of the proteins. The SH3 domains were identified using the SMART database at
http://smart.embl.de and information of the protein function was obtained from the Saccharomyces
genome database at http://www.yeastgenome.org/ and the Candida genome database at
http://www.candidagenome.org.
Gene S. cerevisiae C. albicans
ABP1 YCR088W
Actin cytoskeleton organization
orf19.2699
Actin cytoskeleton organization BBC1 YJL021C
Assembly of actin patches
orf19.2791
Unknown function §
BEM1 YBR200W
Cell polarity and morphogenesis
orf19.4645
Wild-type budding, hyphal growth BEM1-like orf19.177
Unknown function BOI1 YBL085W
Polar growth
BOI2 YER114C
Polar growth
orf19.3230
Vacuolar fusion §
BUD14 YAR014C
Selection of bud site
orf19.3555
Unknown function §
BZZ1 YHR114W
Regulation of actin polymerization
orf19.1699
Regulation of actin polymerization CDC25 YLR310C
Guanine nucleotide exchange factor
orf19.6926
Guanine nucleotide exchange factor CDC25-
like
orf19.1842
Unknown function CYK3 YDL117W
Cytokinesis
orf19.13620
Cytokinesis * FUS1 YCL027W
Cell fusion
orf19.1156
Unknown function §
HOF1 YMR032W
Cytokinesis
orf19.5664
Unknown function HSE1 YHL002W
Sorting ubiquitinated proteins
orf19.3233
Unknown function §
LSB1 YGR136W
Actin cytoskeleton organization
LSB3 YFR024C-A
Actin cytoskeleton organization
orf19.4127
Unknown function LSB4 YHR016C
Actin cytoskeleton organization
21
MYO3 YKL129C
Actin cytoskeleton organization
MYO5 YMR109W
Actin cytoskeleton organization
orf19.738
Actin cytoskeleton organization NBP2 YDR162C
HOG pathway
orf19.6588
Vacuolar fusion * PEX13 YLR191W
Peroxisomal protein import
orf19.7282
Peroxisomal protein import PIN3 YPR154W
Involved in prion formation
orf19.5956
Unknown function §
RVS167 YDR388W
Actin cytoskeleton organization
orf19.1220
Actin cytoskeleton organization §
RVS167-2 orf19.4742
Unknown function §
SDC25 YLL016W
Guanine nucleotide exchange factor
SHO1 YER118C
HOG pathway
orf19.4772
Unknown function §
SLA1 YBL007C
Actin cytoskeleton organization
orf19.1474
Actin cytoskeleton organization * Q59U90 orf19.1861
Unknown function Q5AAN3 orf19.6277
Unknown function
§ Deletion of the genes in C. albicans is described in Part IV.
* Deletion of the genes in C. albicans is described in Part V.
22
PART IV
R E S E A R C H A R T I C L E
Functional analysis ofCandidaalbicansgenesencodingSH3-domain-containing proteinsPatrick Reijnst, Andrea Walther & Jurgen Wendland
Carlsberg Laboratory, Yeast Biology, Valby, Denmark
Correspondence: Jurgen Wendland,
Carlsberg Laboratory, Yeast Biology, Gamle
Carlsberg Vej 10, DK-2000 Valby,
Copenhagen, Denmark. Tel.: 145 3327
5230; fax: 145 3327 4708; e-mail: jww
@crc.dk
Received 30 November 2009; revised 25
February 2010; accepted 7 March 2010.
Final version published online 12 April 2010.
DOI:10.1111/j.1567-1364.2010.00624.x
Editor: Richard Calderone
Keywords
Candida albicans; human pathogen; PCR; pFA
plasmids; actin cytoskeleton.
Abstract
Postgenomic gene-function analyses with Candida albicans are hindered by its
constitutive diploidy and the lack of a sexual cycle. Rapid generation of mutant
strains can be achieved using PCR-based techniques for directed gene alterations.
Here, we report the analyses of nine C. albicans genes that encode Src Homology
3-domain proteins. Phenotypic analyses included the potential of the mutants to
form hyphal filaments, maintain a polarized actin cytoskeleton or the ability to
generate large vacuoles in the germ cells and in subapical compartments. The
C. albicans homologs of the Saccharomyces cerevisiae BBC1, BOI2, BUD14, FUS1,
HSE1, PIN3, RVS167, RVS167-2 and SHO1 were all found to be nonessential.
Deletion of RVS167 resulted in a strain with a decreased ability to form hyphal
filaments. The number of cortical actin patches was increased in Drvs167 strains
and their distribution was depolarized in both mother and daughter yeast cells and
along the hyphae during filamentous growth stages. Polarization of patches could
be restored upon reintroduction of the wild-type gene. Deletion of BOI2 was
found to generate a defect in vacuolar fusion in hyphae. In contrast to a deletion in
the Dwal1 gene, Dboi2 cells formed abundant hyphae, indicating that fragmented
vacuoles do not inhibit filamentation. Placing BOI2 under control of the MAL2-
promoter allowed the regulation of this phenotype depending on the growth
conditions.
Introduction
Candida albicans is considered to be a normal commensal
organism in the gastrointestinal tract of humans and warm-
blooded animals. Among nosocomial infections, urinary
tract infections are most common, particularly in cases
where indwelling catheters are involved (Jain et al., 2007),
other superficial mucosal infections occur on oral and
vaginal tissues. Life-threatening systemic infections of inner
organs may occur in severely immunocompromised pa-
tients, which makes C. albicans one of the major fungal
pathogens (Eggimann et al., 2003; Gudlaugsson et al., 2003).
Several attributes enable C. albicans to cause disease.
These virulence factors include genes that participate in the
processes of adhesion, colonization and penetration of host
tissues, biofilm formation as well as morphological changes
from yeast to hyphal growth (Sundstrom, 2002; Sudbery
et al., 2004; Whiteway & Oberholzer, 2004; Kumamoto &
Vinces, 2005; Schaller et al., 2005; Nobile et al., 2008).
Recent analysis of the C. albicans WASP, WAL1, indicated
that endocytosis is also required for polarized hyphal growth
because wal1 mutants showed delayed endocytosis, vacuolar
fragmentation and were afilamentous. However, it could not
be clarified whether vacuolar fragmentation itself contribu-
ted to the filamentation defect (Walther & Wendland, 2004).
Other C. albicans mutants with defects in vacuolar function,
for example in vac1 or vps11 strains, are also crippled in their
ability to form filaments (Palmer et al., 2003; Franke et al.,
2006). Characteristically, large vacuoles are found in the
germ cell and in subapical parts of the hyphae, whereas
hyphal tips contain endosomes and small vacuoles. This
pattern of vacuolar distribution influences the branching
frequency during filamentous growth (Barelle et al., 2006;
Veses et al., 2009a). Recently, ABG1 was shown to encode an
essential C. albicans vacuolar protein, which is involved in
branching and endocytosis (Veses et al., 2005, 2009b).
With the onset of postgenomics in C. albicans, it has
become an important task to identify gene functions for the
FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
YEA
ST R
ESEA
RC
H
many as yet uncharacterized genes. Several methods have
become available to delete both alleles of a single gene in the
diploid genome of C. albicans, for example using the site-
specific FLP recombinase or the ‘URA3-blaster’ technique
(Morschhauser et al., 1999; Enloe et al., 2000; Berman &
Sudbery, 2002; Reuss et al., 2004). PCR-based methods of
gene disruption similar to those used in Saccharomyces
cerevisiae were also introduced in C. albicans (Walther &
Wendland, 2008).
Src Homology 3 (SH3) domains are small peptide recogni-
tion modules (approximately 80 amino acids) that mediate
protein–protein interaction and thus promote complex for-
mation (Tong et al., 2002; Li, 2005). There is a limited set of
SH3-domain-containing genes in the C. albicans genome.
Most of the genes have homologs in S. cerevisiae. The majority
of these S. cerevisiae homologs are either involved in the
organization of the cortical actin cytoskeleton/endocytosis
(e.g. Myo3/5, Abp1) or signal transduction (e.g. Bem1, Boi1/
2, Cdc25); a few others such as Fus1 or Pex13 are involved in
mating or peroxisome biogenesis, respectively. To contribute
to the functional analysis of these genes in C. albicans, we
undertook a deletion approach of nine SH3-domain-encoding
genes using PCR-based gene targeting technology.
Materials and methods
Strains and media
The Candida albicans strains used and generated in this
study are listed in Table 1. Strains were grown either in rich
yeast extract–peptone–dextrose (YPD; 1% yeast extract, 2%
peptone, 2% dextrose) or in minimal media [complete
supplement mixture (CSM) 6.7 g L�1 yeast–nitrogen base
(YNB) with ammonium sulfate and without amino acids,
0.69 g L�1 CSM; 20 g L�1 glucose] or SD (6.7 g L�1 YNB with
ammonium sulfate and without amino acids, 20 g L�1 glu-
cose) with the addition of the required amino acids and
uridine. Promoter shutdown of MAL2-promoter-controlled
gene expression was performed as follows: cells were grown
overnight in YPD and then diluted in either fresh YPM (1%
yeast extract, 2% peptone, 2% maltose) or YPD. Subse-
quently, 10% serum was added to these cultures, followed by
an incubation of 4 h at 37 1C. Yeast cells were generally
grown at 30 1C; hyphal induction of C. albicans cells was
carried out at 37 1C in the presence of 10% serum in the
growth medium. Escherichia coli strain DH5a was used for
pFA plasmid propagation.
Transformation of C. albicans
Homozygous mutant strains were constructed starting from
C. albicans strain SN148 (Noble & Johnson, 2005). To delete
both alleles of a gene, sequential transformation of SN148 and
the resulting heterozygous strains was required. All the PCR
products used in transformation of C. albicans were amplified
from pFA vectors (Table 2) using S1 and S2 primers as
described (Walther & Wendland, 2008). Primers were ob-
tained from biomers.net GmbH (Ulm, Germany). S1 and S2
primers contain 100 nt of the target homology at their 50 ends.
Shorter primers were used for diagnostic PCR to verify
the integration of the cassettes. The primer sequences are
shown in Table 3. Transformation was carried out either by the
lithium-acetate procedure or by electroporation (Kohler et al.,
Table 1. Candida albicans strains used in this study
Strain� Genotype Source
SC5314 C. albicans wild type Gillum et al.
(1984)
SN148 arg4/arg4, leu2/leu2, his1/his1 Noble &
Johnson
(2005)
ura3<imm434/ura3<imm434, iro1<imm434/
iro1<imm434
CAS002 BBC1/bbc1<CdHIS1, leu2, ura3, arg4 This study
CAP002 bbc1<CdHIS1/bbc<URA3, leu2, arg4 This study
CAP027 boi2<ARG4/boi2<URA3, his1, leu2 This study
CAP034 BOI2/boi2<CdHIS1, leu2, ura3, arg4 This study
CAP003 boi2<CdHIS1/boi2<URA3, leu2, arg4 This study
CAP032 boi2<CdHIS1/MAL2p-BOI2:URA3, leu2, arg4 This study
CAP036 BUD14/bud14<CdHIS1, leu2, ura3, arg4 This study
CAP005 bud14<CdHIS1/bud14<URA3, leu2, arg4 This study
CAP041 FUS1/fus1<CdHIS1, leu2, ura3, arg4 This study
CAP010 fus1<CdHIS1/fus1<URA3, leu2, arg4 This study
CAP043 HSE1/hse1<CdHIS1, leu2, ura3, arg4 This study
CAP012 hse1<CdHIS1/hse1<URA3, leu2, arg4 This study
CAP045 PIN3/pin3<CdHIS1, leu2, ura3, arg4 This study
CAP014 pin3<CdHIS1/pin3<URA3, leu2, arg4 This study
CAP049 RVS167/rvs167<CdHIS1, leu2, ura3, arg4 This study
CAP018 rvs167<CdHIS1/rvs167<URA3, leu2, arg4 This study
CAP194 rvs167<CdHIS1/rvs167<URA3, BUD3/
bud3<RVS167-CmLEU2, arg4
This study
CAP052 RVS167-2/rvs167-2<CdHIS1, leu2, ura3,
arg4
This study
CAP020 rvs167-2<CdHIS1/rvs167-2<URA3, leu2,
arg4
This study
CAP053 SHO1/sho1<CdHIS1, leu2, ura3, arg4 This study
CAP022 sho1<CdHIS1/sho1<URA3, leu2, arg4 This study
�All CAxxxx strains are derivates of SN148.
Table 2. Plasmids used in this study
Plasmid Description Source
200 pFA-URA3 Gola et al. (2003)
230 pFA-URA3-MAL2p Gola et al. (2003)
627 pFA-CdHIS1 Schaub et al. (2006)
873 pRS-CaBUD3-CmLEU2 Wendland
C486 pDrive-CaRVS167 This study
C504 pRS-CaBUD3-CaRVS167-CmLEU2 This study
CAGG402 BOI2-UAU1-cassette Mitchell
FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
453Candida albicans functional analysis
Table 3. Primers used in this study
Genes� Primer names and sequencesw
CaBBC1 #3593: S1-CaBBC1: CTTTACGTAGTTCTTTTGTTACCCCCAATTGATTGCTCGATTATCCGACACTTCAAAACTCCACAATTATT
AATAATTATCTTTTCCTGTTTTCAAATTACgaagcttcgtacgctgcaggtc
CaBBC1 #3311: S2-CaBBC1: GAAATAATAAATGTGGTGATCTTCTTTCTCTCATCACCCCACACACTCAAAGAGTTTAACAATGATGGTT
ACGTTTAAAACAATACTTCTTCTTCGTTAAtctgatatcatcgatgaattcgag
CaBBC1 #4018: G1-CaBBC1: GTTAGGTTAGGAGGCACGTC
CaBBC1 #3217: G4-CaBBC1: ATGGCGAATACTCTGGAC
CaBBC1 #3259: I1-CaBBC1: GGTAATTGAAGTTGCTTACGACG
CaBBC1 #3260: I2-CaBBC1: CCAACCAACAAATTGTCTTCC
CaBOI1 #3591: S1-CaBOI1: GTTATTATTATTATTATTACTATTATCTAAAGTATAGTATTACATTCATTTAGTTTCATCACGAATACTCCCT
TACTCCCTACTCCCCATTATTCACAGTTGgaagcttcgtacgctgcaggtc
CaBOI1 #3684: S2-CaBOI1: CAATGCTTCTTCACGTCTAACTTAACTAATACACAACAGAAATCTTTTTTATTTTTCAAAATTT
ATAAAGATTAATTATTAGATTTTATTTATAGATACAtctgatatcatcgatgaattcgag
CaBOI1 #4017: S2-MALp-CaBOI1: CGTCAGCCAATACTTGAATTTTGTCGCCAATTTTAAGA
CTCAATTCATCGCCTAATCTGGCATTAAATTGTTTTATACATATATAAGTATCGCCACCATCcattgtagttgattattagttaaaccac
CaBOI1 #3559: G1-CaBOI1: GGTACACGCACTAGCACACAC
CaBOI1 #3741: G2-CaBOI1: AGGATTTAaagcttttaCACGGGAGTAGTGGTGTCCT
CaBOI1 #3219: G4-CaBOI1: GGTGGGAGATATGGCGAC
CaBOI1 #3249: I1-CaBOI1: CGAAGTTTAACAGGGTCGAAG
CaBOI1 #3250: I2-CaBOI1: GCTGAAGTTGCTGCTACTG
CaBUD14 #3548: S1-CaBUD14: CACACACAGACCACTTATTTTTAACAACACACACTTCAACACAGTACACCCTTC
CCCCCTTCCCAATACCAATCTATCCACATCTACCTAATTTGAACAGCgaagcttcgtacgctgcaggtc
CaBUD14 #3549: S2-CaBUD14: ATTTACACAATTTTACACTACCAAATACTTTCCACTATCATTATTAACAGATTCGTATTA
TCCTTTATTATAAAATTTATGAATTATTATTAATACAAATtctgatatcatcgatgaattcgag
CaBUD14 #3553: G1-CaBUD14: CAACCACTACTACCATTAAC
CaBUD14 #3221: G4-CaBUD14: CTTGCGGATCAGGTGTCC
CaBUD14 #3271: I1-CaBUD14: CACAACTGATTGATCAGCACG
CaBUD14 #3272: I2-CaBUD14: GCCAACTTTTCAGCAAGTTCATC
CaFUS1 #3595: S1-CaFUS1: GAATAATGTAGAATTACAGATCGTTGTCTTATAGCTGCAAAATGCAGGTGA
AAAATAACAAACTTAAAACACAACTGCATCACGAATGTTTATAGTTTATTGgaagcttcgtacgctgcaggtc
CaFUS1 #3573: S2-CaFUS1: ATTTTTCCATACAATACCTGAGAAATTTGTGGGTTT
ACTATGTGGTCTATTTGTTCCTATAGTATTAAAGTATATTAAATAAAATATGATTTAGAACAATtctgatatcatcgatgaattcgag
CaFUS1 #3554: G1-CaFUS1: CCGAAACCTTAACTGAACTG
CaFUS1 #3308: G4-CaFUS1: GTGGAGTATGGACTGACC
CaFUS1 #3261: I1-CaFUS1: GCTGATAAAAGAGATGACGGTG
CaFUS1 #3262: I2-CaFUS1: CTGGGCTTGTAGTACTTTTC
CaHSE1 #3596: S1-CaHSE1: GTACAATATTGGTAGATAGATGATTGTATCCTTACGAGTCTCT
TGCCTTACACCTCAACAGACTATCAAAATCCTGCATATACATTTATCGCACCTTTGCCgaagcttcgtacgctgcaggtc
CaHSE1 #3575: S2-CaHSE1: TGTAACTAATCCTGTTTGAATAGAAAAAAAAAAGAAATTAC
CATTTTATATGTTTTTAAAGTTGACTACCTGCAATTTGGCAAAATGACTACAGCTTTATAtctgatatcatcgatgaattcgag
CaHSE1 #3555: G1-CaHSE1: CCTCTGCTTATTCCAATTAG
CaHSE1 #3227: G4-CaHSE1: CGAACGTGATGCTAATGC
CaHSE1 #3265: I1-CaHSE1: CGGATAAGAAATTGCACGCCAC
CaHSE1 #3266: I2-CaHSE1: CCACTAGGTAATGATCCTCTCC
CaPIN3 #3588: S1-CaPIN3: GAAATTGTGGACTAAGGTCAACGCCAGTGTTTAATA
ATCGGAATGTTGTAAATCTTTGCCTTGACAACAATTTACCTCTT
AACACGCAAGAATTACCGCATTGGgaagcttcgtacgctgcaggtc
CaPIN3 #3577: S2-CaPIN3: CTTAGTAAAAAACTCATTTCATCTCAGATAATTGTACACCAAGAAATTCAAATGCCTTTTGGCTATAC
AACATTACTCCCATATATATGTATATTAAATTtctgatatcatcgatgaattcgag
CaPIN3 #3556: G1-CaPIN3: CGGTGTGTGTGGCCACTAATG
CaPIN3 #3229: G4-CaPIN3: CTTGGCTCCGCGTATGTC
CaPIN3 #3253: I1-CaPIN3: GTCAGCTGCCGATGTATTAG
CaPIN3 #3254: I2-CaPIN3: CTACCTATCAGCGCACCAGC
CaRVS167 #3590: S1-CaRVS167: GTGATATTCGCAAGTACTTCTCCTCCAATGAGTAGCAATTT
GAAATTAAAAGATTTAGGTGTTGCTTAAGAGCTACCATGTGTCAGATTGCTTGGTCGTGgaagcttcgtacgctgcaggtc
CaRVS167 #3581: S2-CaRVS167: AATAAGTTATTTGAAATAAAATAAGAAACCATATAAAAGAA
TAGAATACATTGGGTTACGTGGGGCTAAAATATGTATACAGAATTATAACCCAAGCTTTtctgatatcatcgatgaattcgag
CaRVS167 #3558: G1-CaRVS167: CGTATTGTTTAGCCATGGTG
FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
454 P. Reijnst et al.
1997; Walther & Wendland, 2003). Incubation periods after
transformation varied between 3 and 5 days to identify
transformants. For each target gene, at least two independent
homozygous mutants were generated from different hetero-
zygous strains. Reconstitution of the Drvs167 strain was
carried out by reintegration of the wild-type gene at the
BUD3 locus. To this end, the RVS167 gene was amplified
using the primers #3558: G1-CaRVS167 and #3233: G4-
CaRVS167 and ligated in pDrive, generating plasmid #C486.
The insert was cloned into plasmid #873, which provides the
CaBUD3 homology region and the Candida maltosa LEU2
selectable marker, using BamHI and XhoI restriction sites.
This generated plasmid #C504. The Drvs167 homozygous
mutant strain CAP018 was transformed by #C504 linearized
with SpeI, generating strain CAP194.
Replacement of the BOI2 promoter with the MAL2
promoter was carried out by PCR-based gene targeting.
Initially, BOI2 was disrupted using a gene-specific UAU1
cassette kindly provided by Aaron Mitchell. Transformation
with the BOI2 cassette on plasmid CAGG402 required
linearization of the plasmid using NotI, transformation of
Table 3. Continued.
Genes� Primer names and sequencesw
CaRVS167 #3233: G4-CaRVS167: GTGGTCCGTTAGAGACAG
CaRVS167 #4197: A1-CaRVS167: CTTCTCCTCCAATGAGTAGC
CaRVS167 #4198: A4-CaRVS167: CATTGGGTTACGTGGGGC
CaRVS167 #3255: I1-CaRVS167: GCTGTCAATGGGATGTTAG
CaRVS167 #3256: I2-CaRVS167: CGGTTTGTTCCTCAATGTTC
CaRVS167-2 #4022: S1-CaRVS167-2: GGTTTCTGGTTTATTGACCTGTACTGTGTTATCATTAGACATTTG
AAACTGGTTTGGGTAGATTGTTAACT
AAAGTGACTGAGAATACCTGGGTTGCAAAgaagcttcgtacgctgcaggtc
CaRVS167-2 #3321: S2-CaRVS167-2: AGAGAATCAATATACATATTCATTCTATTTTTCACTCCTGTA
GTACTTTTAATGCATTTAACAAACCTGATAAAGAG
TGTAAAACAATGGAATATCCTTGtctgatatcatcgatgaattcgag
CaRVS167-2 #4023: G1-CaRVS167-2: CAACTCACAGGTTTCTGCAG
CaRVS167-2 #3323: G4-CaRVS167-2: GATAGCTGAGTCATTACCACG
CaRVS167-2 #3267: I1-CaRVS167-2: GAATCAAGTATTGTCCAACTCCG
CaRVS167-2 #3268: I2-CaRVS167-2: GATTCTGCTTGGTGTGACG
CaSHO1 #3316: S1-CaSHO1: CAGTGTATCGATCTCCAATAGATTAGTGTTTATTGATAA
ACTTCCCAACACTACTACTACTATAGACAGAGATAAACTGTATTAAAATATTAAAGATTGAGgaagcttcgtacgctgcaggtc
CaSHO1 #3317: S2-CaSHO1: CAAATCAAATTAACTCTTCATTTGGGGAAATATAATAATAGT
GATAATAATAGTGATAATAAACAGTAACAAATAACAAATAACATCAAACCAAAATATACtctgatatcatcgatgaattcgag
CaSHO1 #3318: G1-CaSHO1: CTTCCTTCCTTCTATATCG
CaSHO1 #3319: G4-CaSHO1: GAATTCAATCAAGTGGAGG
CaSHO1 #3651: I1-CaSHO1: GAGGTCAAGGTCATGAAC
CaSHO1 #3677: I2-CaSHO1: GCTGGTCCTCCTCCACTACC
CaURA3 #600: U2: GTGTTACGAATCAATGGCACTACAGC
CaURA3 #599: U3: GGAGTTGGATTAGATGATAAAGGTGATGG
CdHIS1 #1432: H2: TCTAAACTGTATATCGGCACCGCTC
CdHIS1 #1433: H3: GCTGGCGCAACAGATATATTGGTGC
�Ca, C. albicans; Cm, C. maltosa; Cd, C. dubliniensis.wIn long primers upper case sequences correspond to DNA sequences used as homology regions for recombination whereas lower case sequences
correspond to 30-terminal annealing regions for the amplification of pFA cassettes. Short primers were used for verification purposes. All sequences are
written from 50 to 30.
Table 4. Protein comparison
Systematic
name
Gene
name
S. cere-
visiae
protein
length
C. albi-
cans
protein
length
Sequence
identity�
(%)
Position of the
SH3 domain in
the C. albicans
proteinw
orf19.2791 BBC1 1157 954 25.8 1–56
orf19.3230 BOI2 1040 1172 32.5 5–65
BOI1 980 31.5 –
orf19.3555 BUD14 707 801 20.8 259–340
orf19.1156 FUS1 512 384 25.1 318–383
orf19.3233 HSE1 452 498 39 215–271
orf19.5956 PIN3 215 285 54.9 104–163
orf19.1220 RVS167 482 440 62.5
419–474
orf19.4742 RVS167-2 – 354 23.1
313–366
orf19.4772 SHO1 367 387 38.9 334–391
�Amino acid sequence identities across the whole proteins are indicated.wThe SH3 domains were identified using the SMART database at http://
smart.embl.de/
FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
455Candida albicans functional analysis
C. albicans with a first selection on �Arg media and
restreaking of the primary transformants on �Arg and
�Ura media to select for recombinants in which both alleles
have been disrupted (Nobile & Mitchell, 2009).
Microscopy and staining procedures
Microscopic analyses were performed using an Axio-Imager
microscope (Zeiss, Jena and Gottingen, Germany) with the
aid of METAMORPH software tools (Molecular Devices Corp.,
Downington, PA) and a MicroMax1024 CCD-camera (Prin-
ceton Instruments, Trenton, NJ). Fluorescence microscopy
was performed using the appropriate filter combinations for
FM4-64-imaging and actin staining as described (Martin
et al., 2005). Samples were analyzed by generating either
single images or stacks of 5–20 images that were processed
into single plane projections using METAMORPH software.
Results and discussion
Sequence comparisons
The set of SH3-domain-containing proteins in C. albicans
was identified based on homology to S. cerevisiae. Several of
Fig. 1. Alignment of SH3 domains. The nine genes that were functionally analyzed in this study each have one SH3 domain. For the exact position of
the SH3 domain, see Table 4. The SH3 domains were identified using the SMART tool at http://smart.embl.de/ and the alignment was generated using CLC
Genomics Workbench 3.6.1. A consensus sequence and the degree of conservation are shown at the bottom of the alignment highlighting three
conserved amino acid residues, W at position 45, G at position 81 and P at position 84.
SC5314 Δbbc1 Δboi2 Δbud14 Δfus1 Δhse1 Δpin3 Δrvs167 Δrvs167-2 Δsho1
Fig. 2. Characterization of growth phenotypes of the nine mutant strains. The indicated strains were grown overnight in liquid culture and then
spotted on minimal medium (upper row) or on minimal medium supplemented with 10% serum (middle row) and then incubated for 3 days at 30 or
37 1C, respectively, before photography. Hyphal induction in liquid medium containing 10% serum was carried out for 3 h before microscopy. Scale
bar = 10 mm. Note the short germ tube in the Drvs167 strain and the absence of a central vacuole in the Dboi2 germ cell.
FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
456 P. Reijnst et al.
these genes have been studied already including for example
BEM1, MYO5 and ABP1 (Oberholzer et al., 2002; Bassilana
et al., 2003; Martin et al., 2007). Therefore, we concentrated
on a set of nine genes (Table 4). The amino acid sequence
identity between the C. albicans and the S. cerevisiae full-
length proteins varies between 20% and 62%. The SH3
domains were identified using the SMART tool at http://smart.
embl.de/. In general, SH3 domains can be identified based
on several highly conserved amino acid residues (Fig. 1).
The position of the SH3 domain varies in each gene: it is
found at the N-terminus in Bbc1 and Boi2; in the central
part of the protein in Bud14, Hse1 and Pin3; and at the
C-terminus in Fus1, Rvs167, Rvs167-2 and Sho1. Because
orf19.4742 was most similar to Rvs167, we renamed the
corresponding uncharacterized ORF RVS167-2.
Generation of C. albicans mutant strains
PCR-based gene targeting in C. albicans has become a fast
and reliable tool for the functional analysis of novel genes
(Walther & Wendland, 2008). In this functional analysis
report, we have used two strategies for gene function
analysis relying on different pFA vectors. Initially, we gener-
ated two heterozygous and subsequently two homozygous
mutant strains thereof using the C. albicans URA3 and the
Candida dubliniensis HIS1 marker genes. Secondly, to verify
mutant phenotypes, we used promoter shutdown or reinte-
gration experiments. For BOI2, we also used a single
transformation protocol based on the UAU1 cassette.
Analysis of the growth morphology of mutantstrains
The set of homozygous mutant strains – as well as their
heterozygous predecessors (not shown) – was initially
characterized to reveal any potential defects under standard
growth conditions. Growth of the null mutants on CSM
minimal medium showed no strong defects during the yeast
growth phase. Inducing yeast cells to form hyphae either on
solid media or in liquid culture was performed using serum
as an inducing agent (Fig. 2). All strains showed the ability
to form germ tubes and colonies had wrinkled appearances
in their centers, suggesting that single mutations in these
genes did not abolish filamentation in C. albicans. Two
mutant strains, Drvs167 and Dboi2, showed observable
phenotypes that were studied in more detail.
The Drvs167 strain showed a strong delay in germ tube
formation evident by much shorter germ tubes compared
SC5314 �rvs167
1h
2h
3hFig. 3. Comparison of germ tube formation
between wild type and Drvs167. Both strains were
grown overnight in YPD, diluted in fresh YPD that
contained 10% serum, followed by an incubation
at 37 1C. Samples were taken at the indicated time
points and used for microscopy.
FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
457Candida albicans functional analysis
with the wild type. This was monitored in a time series of
hyphal induction (Fig. 3). During a 3-h time course, wild-
type cells developed very long germ tubes, whereas the
Drvs167 mutant germ cells had not formed filaments or only
very short germ tubes. The actin cytoskeleton plays a major
role in polarized growth. Therefore, we analyzed the dis-
tribution of the actin cytoskeleton during different growth
stages in the Drvs167 strain and compared it with the wild
type (Fig. 4). In SC5314 cells, actin patches cluster in the
bud and the cortical actin cytoskeleton is highly polarized to
the hyphal tip during filamentous growth stages. In Drvs167
cells, actin patches are apparently randomly localized to
both mother and daughter cells. In Drvs167 filaments, actin
patches are more abundant and their distribution is rather
even both in apical and in subapical compartments. This
increase in actin patch formation and nonpolarized distri-
bution can be restored upon reintegration of the wild-type
RVS167 gene (Fig. 4).
The second observation was with regard to the Dboi2
deletion strain. Initially, we had constructed a strain with a
disrupted Dboi2 based on use of the UAU1 cassette (Enloe
et al., 2000). This strain showed a lack of a large vacuole in
the germ cell after induction of hyphal morphogenesis. The
UAU1 insertion was determined to be in the central part of
the gene downstream of the SH3 domain, but within the
Pleckstrin homology-domain-encoding region. Using a
1h 2h 3h
(a)
(b)
SC5314
Δrvs167
SC5314
Δrvs167
BUD3/bud3::RVS167
Δrvs167
Fig. 4. Deletion of RVS167 leads to the
formation of abundant cortical actin patches.
Strains were grown under yeast- or germ
tube-inducing conditions for 4 h before fixation
and rhodamine–phalloidin staining. Bright-field
and fluorescence images of wild type (SC5314)
and the Drvs167 strain at different stages of
growth as well as the reconstituted strain are
shown. Scale bar = 10 mm.
FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
458 P. Reijnst et al.
PCR-based gene targeting approach, we generated complete
ORF deletion strains of BOI2, which were phenotypically
identical to the UAU1 strain. Analysis of the distribution of
vacuoles in wild type and Dboi2 cells was performed by
fluorescence microscopy using the vacuolar dye FM4-64
(Fig. 5). During yeast growth, vacuolar morphology was
similar to that observed in the wild type. A central large
vacuole was visible after 1 h of incubation, with the dye
indicating uptake and delivery of the dye to the vacuolar
compartment. Staining of germlings revealed fragmented
vacuoles both in the UAU1 strain of Dboi2 and in the
complete ORF deletion strain. To demonstrate that this
phenotype was specific for the Dboi2 deletion, we generated
a MAL2-promoter-controlled BOI2 strain. With this strain,
fragmented vacuoles could only be observed under condi-
tions that turned off the expression of BOI2 (Fig. 5). In
S. cerevisiae, there are two BOI genes. Deletion of BOI1 and
BOI2 results in morphogenesis defects (Bender et al., 1996).
Deletion of the sole BOI1 gene in Ashbya gossypii results in
temperature-sensitive growth and depolarized growth at the
hyphal tip (Knechtle et al., 2006). Defects in vacuolar fusion,
however, have not been reported so far.
Conclusion
In this study, we have generated C. albicans mutant strains
for nine genes using PCR-based methodologies and a UAU1
cassette. We focused on genes that encode SH3-domain-
containing genes because their S. cerevisiae homologs were
shown to be involved in signal transduction or actin
cytoskeleton organization. Initial characterization of the
genes indicated that all except two mutants showed no
discernible phenotype, suggesting some plasticity in the
complexes the corresponding proteins are involved. FUS1
as a probable ortholog of S. cerevisiae Fus1p, which is a
membrane protein required for mating, may actually be
(a)
(b) SC5314 Δboi2/MAL2p-BOI2YPM YPD YPM YPD
SC5314 Δboi2::UAU1 Δboi2
Fig. 5. Deletion of BOI2 leads to a vacuolar fusion
defect. Strains were grown under
yeast- or germ tube-inducing conditions for 4 h,
and then FM4-64 (0.2 mg mL�1) was added and
samples were processed for microscopy after 1 h
to allow uptake of the dye. (a) Bright-field and
fluorescence images of the wild type (SC5314)
and the Dboi2 strains that were generated either
using a UAU1 cassette or by complete ORF dele-
tion using PCR-based gene targeting.
(b) Regulated expression of BOI2 under the
control of the MAL2 promoter led to vacuolar
fragmentation under repressive conditions in YPD,
whereas under inducing conditions in YPM, a wild-
type vacuolar morphology appeared. Scale
bar = 10 mm.
FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
459Candida albicans functional analysis
important for cell fusion during mating, which we did not
analyze.
The Drvs167 mutant strain showed the increased presence
of cortical actin patches during yeast and filamentous
growth stages. This may implicate Rvs167p in regulating
the distribution of cortical actin patches in C. albicans. In
S. cerevisiae, it was shown that Rvs167p colocalizes with
actin patches and may be important for the correct distribu-
tion of the cortical actin complex (Balguerie et al., 1999).
The S. cerevisiae Drvs167 strain was isolated as being reduced
in viability upon starvation. During the preparation of this
manuscript, another study on the C. albicans Rvs167
and Rvs161 was published that indicated that Drvs167 cells
show some sensitivity to H2O2 and cell wall-disturbing
agents such as calcofluor and Congo red (Douglas et al.,
2009). Our results on Drvs167 focus on the altered abun-
dance and distribution of the cortical actin patches that
were not reported previously. With the ability to switch
between different growth forms, C. albicans may be an ideal
model to study the role of Rvs167 in actin cytoskeleton
organization during highly polarized hyphal growth in more
detail.
Deletion of BOI2 in C. albicans resulted in a defect of
vacuolar fusion, leading to fragmented vacuoles. This phe-
notype is somewhat similar to that observed in Dwal1 cells
(Walther & Wendland, 2004). Yet, Dboi2 cells are able to
form true hyphae, indicating that fragmented vacuoles are
not sufficient to abolish filamentation in C. albicans. There-
fore, defects in filamentation of the Dwal1 strain should be
separable from the vacuolar fragmentation defect. To this
end, we are currently performing functional analyses of the
C. albicans Wal1 domains.
Because of the diploidy of C. albicans, gene function
analyses still require much more effort to produce the
correct deletion strains. Using PCR-based gene targeting
methods, larger scale approaches can also be undertaken in
C. albicans (Noble & Johnson, 2005). A complementary
approach may be the overexpression of genes or domains.
However, use of TEF-promoter-controlled expression of
core SH3 domains of the genes described in this study did
not result in any obvious phenotypes. Our study of nine
C. albicans genes thus adds to the repository of functional
analysis information for this human fungal pathogen.
Acknowledgements
We thank Alexander Johnson, Suzanne Noble and Aaron
Mitchell for generously providing the reagents used in this
study; Sidsel Ehlers for providing technical assistance; and
Sigyn Jorde for generating the CAS002 strain. We are
indebted to the EU-Penelope consortium for providing
assistance with gene nomenclature and SH3-domain identi-
fication. This study was funded by the EU-Marie Curie
Research Training Network ‘Penelope’.
References
Balguerie A, Sivadon P, Bonneu M & Aigle M (1999) Rvs167p, the
budding yeast homolog of amphiphysin, colocalizes with actin
patches. J Cell Sci 112: 2529–2537.
Barelle CJ, Richard ML, Gaillardin C, Gow NA & Brown AJ
(2006) Candida albicans VAC8 is required for vacuolar
inheritance and normal hyphal branching. Eukaryot Cell 5:
359–367.
Bassilana M, Blyth J & Arkowitz RA (2003) Cdc24, the GDP–GTP
exchange factor for Cdc42, is required for invasive hyphal
growth of Candida albicans. Eukaryot Cell 2: 9–18.
Bender L, Lo HS, Lee H, Kokojan V, Peterson V & Bender A
(1996) Associations among PH and SH3 domain-containing
proteins and Rho-type GTPases in yeast. J Cell Biol 133:
879–894.
Berman J & Sudbery PE (2002) Candida albicans: a molecular
revolution built on lessons from budding yeast. Nat Rev Genet
3: 918–930.
Douglas LM, Martin SW & Konopka JB (2009) BAR domain
proteins Rvs161 and Rvs167 contribute to Candida albicans
endocytosis, morphogenesis, and virulence. Infect Immun 77:
4150–4160.
Eggimann P, Garbino J & Pittet D (2003) Management of
Candida species infections in critically ill patients. Lancet Infect
Dis 3: 772–785.
Enloe B, Diamond A & Mitchell AP (2000) A single-
transformation gene function test in diploid Candida albicans.
J Bacteriol 182: 5730–5736.
Franke K, Nguyen M, Hartl A et al. (2006) The vesicle transport
protein Vac1p is required for virulence of Candida albicans.
Microbiology 152: 3111–3121.
Gillum AM, Tsay EY & Kirsch DR (1984) Isolation of the Candida
albicans gene for orotidine-50-phosphate decarboxylase by
complementation of S. cerevisiae ura3 and E. coli pyrF
mutations. Mol Gen Genet 198: 179–182.
Gola S, Martin R, Walther A, Dunkler A & Wendland J (2003)
New modules for PCR-based gene targeting in Candida
albicans: rapid and efficient gene targeting using 100 bp of
flanking homology region. Yeast 20: 1339–1347.
Gudlaugsson O, Gillespie S, Lee K et al. (2003) Attributable
mortality of nosocomial candidemia, revisited. Clin Infect Dis
37: 1172–1177.
Jain N, Kohli R, Cook E, Gialanella P, Chang T & Fries BC (2007)
Biofilm formation by and antifungal susceptibility of Candida
isolates from urine. Appl Environ Microb 73: 1697–1703.
Knechtle P, Wendland J & Philippsen P (2006) The SH3/PH
domain protein AgBoi1/2 collaborates with the Rho-type
GTPase AgRho3 to prevent nonpolar growth at hyphal tips of
Ashbya gossypii. Eukaryot Cell 5: 1635–1647.
Kohler GA, White TC & Agabian N (1997) Overexpression of a
cloned IMP dehydrogenase gene of Candida albicans confers
FEMS Yeast Res 10 (2010) 452–461c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
460 P. Reijnst et al.
resistance to the specific inhibitor mycophenolic acid.
J Bacteriol 179: 2331–2338.
Kumamoto CA & Vinces MD (2005) Contributions of hyphae
and hypha-co-regulated genes to Candida albicans virulence.
Cell Microbiol 7: 1546–1554.
Li SS (2005) Specificity and versatility of SH3 and other proline-
recognition domains: structural basis and implications for
cellular signal transduction. Biochem J 390: 641–653.
Martin R, Walther A & Wendland J (2005) Ras1-induced hyphal
development in Candida albicans requires the Formin Bni1.
Eukaryot Cell 4: 1712–1724.
Martin R, Hellwig D, Schaub Y, Bauer J, Walther A & Wendland J
(2007) Functional analysis of Candida albicans genes whose
Saccharomyces cerevisiae homologues are involved in
endocytosis. Yeast 24: 511–522.
Morschhauser J, Michel S & Staib P (1999) Sequential gene
disruption in Candida albicans by FLP-mediated site-specific
recombination. Mol Microbiol 32: 547–556.
Nobile CJ & Mitchell AP (2009) Large-scale gene disruption
using the UAU1 cassette. Methods Mol Biol 499: 175–194.
Nobile CJ, Schneider HA, Nett JE, Sheppard DC, Filler SG, Andes
DR & Mitchell AP (2008) Complementary adhesin function in
C. albicans biofilm formation. Curr Biol 18: 1017–1024.
Noble SM & Johnson AD (2005) Strains and strategies for large-
scale gene deletion studies of the diploid human fungal
pathogen Candida albicans. Eukaryot Cell 4: 298–309.
Oberholzer U, Marcil A, Leberer E, Thomas DY & Whiteway M
(2002) Myosin I is required for hypha formation in Candida
albicans. Eukaryot Cell 1: 213–228.
Palmer GE, Cashmore A & Sturtevant J (2003) Candida albicans
VPS11 is required for vacuole biogenesis and germ tube
formation. Eukaryot Cell 2: 411–421.
Reuss O, Vik A, Kolter R & Morschhauser J (2004) The SAT1
flipper, an optimized tool for gene disruption in Candida
albicans. Gene 341: 119–127.
Schaller M, Borelli C, Korting HC & Hube B (2005) Hydrolytic
enzymes as virulence factors of Candida albicans. Mycoses 48:
365–377.
Schaub Y, Dunkler A, Walther A & Wendland J (2006) New pFA-
cassettes for PCR-based gene manipulation in Candida
albicans. J Basic Microbiol 46: 417–430.
Sudbery P, Gow N & Berman J (2004) The distinct morphogenic
states of Candida albicans. Trends Microbiol 12: 317–324.
Sundstrom P (2002) Adhesion in Candida spp. Cell Microbiol 4:
461–469.
Tong AH, Drees B, Nardelli G et al. (2002) A combined
experimental and computational strategy to define protein
interaction networks for peptide recognition modules. Science
295: 321–324.
Veses V, Casanova M, Murgui A, Dominguez A, Gow NA &
Martinez JP (2005) ABG1, a novel and essential Candida
albicans gene encoding a vacuolar protein involved in
cytokinesis and hyphal branching. Eukaryot Cell 4: 1088–
1101.
Veses V, Richards A & Gow NA (2009a) Vacuole inheritance
regulates cell size and branching frequency of Candida albicans
hyphae. Mol Microbiol 71: 505–519.
Veses V, Casanova M, Murgui A, Gow NA & Martinez JP (2009b)
Candida albicans ABG1 gene is involved in endocytosis. FEMS
Yeast Res 9: 293–300.
Walther A & Wendland J (2003) An improved transformation
protocol for the human fungal pathogen Candida albicans.
Curr Genet 42: 339–343.
Walther A & Wendland J (2004) Polarized hyphal growth in
Candida albicans requires the Wiskott–Aldrich Syndrome
protein homolog Wal1p. Eukaryot Cell 3: 471–482.
Walther A & Wendland J (2008) PCR-based gene targeting in
Candida albicans. Nat Protoc 3: 1414–1421.
Whiteway M & Oberholzer U (2004) Candida morphogenesis
and host–pathogen interactions. Curr Opin Microbiol 7:
350–357.
FEMS Yeast Res 10 (2010) 452–461 c� 2010 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
461Candida albicans functional analysis
23
PART V
Curr Genet (2010) 56:309–319
DOI 10.1007/s00294-010-0301-7RESEARCH ARTICLE
Candida albicans SH3-domain proteins involved in hyphal growth, cytokinesis, and vacuolar morphology
Patrick Reijnst · Sigyn Jorde · Jürgen Wendland
Received: 23 December 2009 / Revised: 22 March 2010 / Accepted: 29 March 2010 / Published online: 11 April 2010© Springer-Verlag 2010
Abstract This report describes the analyses of threeCandida albicans genes that encode Src Homology 3(SH3)-domain proteins. Homologs in Saccharomyces cere-visiae are encoded by the SLA1, NBP2, and CYK3 genes.Deletion of CYK3 in C. albicans was not feasible, suggest-ing it is essential. Promoter shutdown experiments ofCaCYK3 revealed cytokinesis defects, which are in linewith the localization of GFP-tagged Cyk3 at septal sites.Deletion of SLA1 resulted in strains with decreased abilityto form hyphal Wlaments. The number of cortical actinpatches was strongly reduced in �sla1 strains during allgrowth stages. Sla1-GFP localizes in patches that are foundconcentrated at the hyphal tip. Deletion of the Wrst twoSH3-domains of Sla1 still resulted in cortical localizationof the truncated protein. However, the actin cytoskeleton inthis strain was aberrant like in the �sla1 deletion mutantindicating a function of these SH3 domains to recruit actinnucleation to sites of endocytosis. Deletion of NBP2resulted in a defect in vacuolar fusion in hyphae. Germcells of �nbp2 strains lacked a large vacuole but initiatedseveral germ tubes. The mutant phenotypes of �nbp2 and�sla1 could be corrected by reintegration of the wild-typegenes.
Keywords Candida albicans · PCR-based gene targeting · pFA-plasmids · Actin cytoskeleton · FM4-64
Introduction
Candida albicans is one of the most important human fun-gal pathogens. It occurs as a commensal on epithelial sur-faces in oropharyngeal tissue, the gastro-intestinal tract,and in the vagina. Particularly, vaginitis and urinary tractinfections caused by C. albicans are frequent in otherwisehealthy individuals. Immuno-compromised patients mayadditionally develop life-threatening systemic infections ofinner organs (Odds 1994; Calderone and Fonzi 2001).
The morphological transition of C. albicans from yeastto hyphal growth has been recognized as an important viru-lence attribute amongst others (Sudbery et al. 2004;Kumamoto and Vinces 2005). Filamenting germ cellscharacteristically generate large vacuoles. This compart-mentalizes the germ tube in an apical region that containsendosomes and small vacuoles, and subapical regionswhich harbor large vacuoles at the expense of cytoplasm.Septation in hyphal Wlaments further promotes this com-partmentalization. The unequal distribution of vacuolar vol-ume inXuences the branching frequency during Wlamentousgrowth (Barelle et al. 2006; Veses et al. 2009). The actincytoskeleton is polarized at sites of polarized growth andcortical actin patches cluster in the hyphal tips. Defects inthe polarization of the actin cytoskeleton, e.g. interferingwith the function of several Rho-type GTPases generallylead to growth defects (Wendland 2001; Court and Sudbery2007; Zheng et al. 2007). Actin ring formation promotedvia Iqg1 at sites of septation is required for septum forma-tion (Epp and Chant 1997; Wendland and Philippsen 2002).In S. cerevisiae, CYK3 can act as a multicopy suppressor ofan IQG deletion (Korinek et al. 2000). Processes like polar-ized hyphal growth, endocytosis, and cytokinesis requireprotein networks and timely regulation within the cellcycle. SH3-domain encoding proteins are well suited to
Communicated by C. D'Enfert.
P. Reijnst · S. Jorde · J. Wendland (&)Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, 2500 Valby, Copenhagen, Denmarke-mail: jww@crc.dk
123
310 Curr Genet (2010) 56:309–319
play important roles in these processes since they can medi-ate protein–protein interactions via their SH3-domains (amBusch et al. 2009). Several C. albicans SH3-protein encod-ing genes have already been characterized including MYO5,BEM1, and CDC25 (Enloe et al. 2000; Michel et al. 2002;Oberholzer et al. 2002; Bassilana et al. 2003). BEM1 wasfound to be essential, while MYO5 plays an important roleduring endocytosis. Both Myo5 and Cdc25 are required forWlamentation under speciWc conditions. Therefore, otherSH3-domain encoding genes may also play important mor-phogenetic roles.
Establishing the genome sequence of C. albicans hasopened the way for the functional analysis of the C. albi-cans gene set as has been elegantly achieved in S. cerevi-siae (Winzeler et al. 1999). PCR-based gene targetingapproaches similar to those used in S. cerevisiae have beenestablished to generate homozygous mutant strains aftertwo successive rounds of transformation (Berman and Sud-bery 2002; Walther and Wendland 2008).
To contribute further to the functional analysis ofC. albicans genes, we have functionally analyzed theC. albicans homologs of the S. cerevisiae SH3-domainencoding genes SLA1, NBP2, and CYK3.
Materials and methods
Strains and media
The C. albicans strains used and generated in this study arelisted in Table 1. Generally, at least two independent
transformants were generated for each desired geneticmanipulation. Strains were grown either in yeast extract–peptone–dextrose (YPD; 1% yeast extract, 2% peptone,2% dextrose) or in deWned minimal media [CSM; com-plete supplement mixture; 6.7 g/l yeast nitrogen base(YNB) with ammonium sulfate and without amino acids;0.69 g/l CSM; 20 g/l glucose] with the addition ofrequired amino acids and uridine. Promoter shut down ofMET3-promoter or MAL2-promoter controlled geneexpression was done as described previously (Bauer andWendland 2007).
Strains were generally grown at 30°C to keep them inthe yeast phase; hyphal induction of C. albicans cells wasdone at 37°C with the addition of 10% serum to the growthmedium. Escherichia coli strain DH5� was used for pFA-plasmid propagation.
Transformation of C. albicans
Completely independent C. albicans homozygous com-plete ORF-deletion strains were constructed startingfrom C. albicans strain SN148 (Noble and Johnson2005). PCR-generated disruption cassettes were used totarget both alleles of a gene, which were deleted bysequential transformation of Wrst SN148 and then theresulting heterozygous strains. PCR-products for trans-formation of C. albicans were ampliWed from pFA-vec-tors (Table 2) using S1- and S2-primers as described(Walther and Wendland 2008). Primers were purchasedfrom biomers.net GmbH (Ulm, Germany). S1- and S2-prim-ers (see Table 3) harbor 100 nt of target homology at their
Table 1 C. albicans strains used in this study
Straina Genotype Source
SC5314 C. albicans wild type Gillum et al. 1984
SN148 arg4/arg4, leu2/leu2, his1/his1ura3::imm434/ura3::imm434, iro1::imm434/iro1::imm434
Noble and Johnson 2005
CAP046 NBP2/nbp2::CdHIS1, leu2, ura3, arg4 This study
CAP015 nbp2::CdHIS1/nbp2::URA3, leu2, arg4 This study
CAP191 nbp2::CdHIS1/nbp2::URA3, BUD3/bud3::NBP2-CmLEU2, arg4 This study
CAP147 CYK3/cyk3::CdHIS1, leu2, ura3, arg4 This study
CAP007 URA3-MET3p-CYK/cyk3::CdHIS1, arg4, leu2 This study
CAP054 SLA1/sla1::CdHIS1, leu2, ura3, arg4 This study
CAP024 sla1::CdHIS1/sla1::URA3, leu2, arg4 This study
CAP204 sla1::CdHIS1/sla1::URA3, BUD3/bud3::SLA1-CmLEU2, arg4 This study
CAP025 sla1::ARG4isla1::URA3, his1, leu2 This study
CAP026 sla1::ARG4/sla1::URA3, his1, leu2 This study
CAS024 SLA1/sla1::CdHIS1, leu2, ura3, arg4 This study
CAP206 URA3-MAL2p-sla1�SH3#1,2/sla1::CdHIS1, leu2, arg4 This study
CAP221 URA3-MAL2p-sla1�SH3#1,2-GFP-CmLEU2/sla1::CdHIS1, arg4 This study
CAS027 SLA1-GFP-CmLEU2/sla1::CdHIS1 This study
CAS030 CYK3-GFP-CmLEU2/cyk3::CdHIS1, ura3, arg4 This study
Cm C. maltosa, Cd C. dubliniensisa All CAxxxx strains are derivates of SN148
123
Curr Genet (2010) 56:309–319 311
5�-ends. Shorter primers were used for diagnostic PCR toverify the integration of the cassettes and absence of the tar-get gene in homozygous mutants. Transformation was doneas described (Walther and Wendland 2003).
SLA1 was also disrupted using two gene-speciWcUAU1 cassettes kindly provided by Aaron Mitchell.Transformation with the SLA1 cassettes on plasmidsCAGFY04 and CAGO130 required linearization of theplasmid using NotI and transformation of C. albicanswith a Wrst selection on ¡Arg media. Restreaking of theprimary transformants on ¡Arg and ¡Ura media wasdone to select for recombinants in which both alleleshave been disrupted (see Nobile and Mitchell 2009 forfurther details).
Reintegration of SLA1 and NBP2
Reconstitution of the �sla1 and �nbp2 strains was done byreintegration of the wild-type gene at the BUD3 locus. Tothis end, SLA1 was ampliWed using primers #3562 and#3237 and cloned into pDrive (C508). From there SLA1was cloned as an XhoI/BamHI fragment into plasmid #873to yield plasmid C553. The �sla1 strain CAP024 was trans-formed with SpeI-linearized plasmid C553. Similarly,NBP2 was ampliWed using primers #3557 and #4196 andcloned into pDrive generating plasmid C527. NBP2 wasthen cloned as a XhoI/BamHI fragment into #873 generat-
ing plasmid C530. Plasmid C530 was transformed aftercleavage with SpeI to generate strain CAP191.
Construction of SLA1-GFP and CYK3-GFP
To generate chromosomally GFP-tagged strains, the fol-lowing procedure was applied. The 3�-ends of SLA1 andCYK3 were ampliWed using primer pairs #3236/#3237 and#3222/#3223, respectively, and cloned into pDrive (plas-mids C182 and C196). The fragments were recloned intopRS417, which is based on pRS415 but carries a GEN3marker instead of LEU2. This generated plasmids C200 andC201, which were used for in vivo recombination in S.cerevisiae to add the GFP-CmLEU2 cassettes ampliWedusing the primer pairs #3314/#3315 for SLA1 and #3312/#3313 for CYK3, respectively. The resulting plasmids C256and C257 were cleaved by XhoI/BamHI and SacII/XhoI,respectively, to release the targeting cassettes used fortransformation of C. albicans. Correct fusion was veriWedby sequencing and correct integration of the cassettes wasveriWed by diagnostic PCR.
Construction of sla1�SH3#1,2-GFP
To generate a SLA1-allele which is expressed from the reg-ulatable MAL2-promoter and lacks the Wrst two SH3-domains, a PCR-based gene targeting approach was used.The URA3-MAL2p-cassette was ampliWed from a pFAvector using primers #3594 and #4265. This cassette wastransformed into strain CAS023 (SLA1/sla1::CdHIS1).This generated strain CAP206 bearing a deletion of oneSLA1 allele and converting the remaining allele tosla1�SH3#1,2. To be able to record the localization of thetruncated protein in living cells, this SLA1 allele was taggedwith GFP. To this end, the SLA1-GFP-tagging cassette wasused and CAP206 was transformed with SpeI/SacIIdigested C256 (pRS417-3�-SLA1-GFP). This resulted inthe addition of GFP to the C-terminus of sla1�SH3#1,2.
Microscopy and staining procedures
Fluorescence microscopy was done with an Axio-Imagermicroscope (Zeiss, Jena and Göttingen, Germany) usingMetamorph software tools (Molecular Devices Corp.,Downington, PA, USA) and a MicroMax1024 CCD-cam-era (Princeton Instruments, Trenton, NJ, USA). Imagingwas performed using the appropriate Wlter combinations forFM4-64-imaging, GFP-localization, and actin-staining asdescribed (Walther and Wendland 2004a, b). Quinacrinestaining was done according to (Weisman et al. 1987). Tothis end, strains were grown overnight in YPD, and thendiluted in YPD + Serum and grown for an additional 4 h.Quinacrine was added to a Wnal concentration of 200 �M.
Table 2 Plasmids used in this study
Ca C. albicans, Cm C. maltosa, Cd C. dubliniensis
Plasmid Description Source
200 pFA-URA3 Gola et al. 2003
230 pFA-URA3-MAL2p Gola et al. 2003
627 pFA-CdHIS1 Schaub et al. 2006
697 pFA-GFP-CmLEU2 Schaub et al. 2006
873 pRS-CaBUD3-CmLEU2 Wendland
C508 pDrive-SLA1 This study
C553 pRS-BUD3-SLA1-CmLEU2 This study
C527 pDrive-NBP2 This study
C530 pRS-BUD3-NBP2-CmLEU2 This study
C177 pRS417 (GEN3) This study
C196 pDRIVE-3�-CYK3 This study
C200 pRS417-3�-CYK3 This study
C257 pRS417-3�-CYK3-GFP This study
C182 pGEM-3�-SLA1 This study
C201 pRS417-3�-SLA1 This study
C256 pRS417-3�-SLA1-GFP This study
CAGFY04 SLA1-UAU1-cassette Mitchell
CAGO130 SLA1-UAU1-cassette Mitchell
123
312 Curr Genet (2010) 56:309–319
Cells were incubated at 37°C for 5 min, collected by centri-fugation and resuspended in 200 �l YPD + Serum with50 mM NaH2PO4. Visualization was done with the GFPWlter. Samples were analyzed by generating either singleimages or stacks of 5–20 images that were processed intosingle plane projections using Metamorph software.
Results
Sequence comparisons
The C. albicans Sla1, Nbp2, and Cyk3 proteins share onefeature in the possession of SH3-domains, which were
Table 3 Primers used in this study
Ca C. albicans, Cm C. maltosa, Cd C. dubliniensisa Upper case sequences correspond to C. albicans DNA sequences and lower case sequences correspond to 3�-terminal annealing regions for theampliWcation of pFA-cassettes. All sequences are written from 5� to 3�
Genes Primer names and sequencesa
CaCYK3 #4019: S1-CaCYK3: CCTTTCATTAATTACAAAGAAAAAAATAAGAACATCAACTATCTTTTCACTCTTTTT GAACAAATTTGTATCATACTAAAAGAATTAAATAATAAATAATgaagcttcgtacgctgcaggtc
CaCYK3 #3313: S2-CaCYK3: AATGTACAAATGGCAAAAAGAAGTAGTAGCAGAAGAGGTAATCTATAAAGAATTTAAAACTAAATAATACCCACTCTGTTTCCCTCTTTATATATATATAtctgatatcatcgatgaattcgag
CaCYK3 #4020: G1-CaCYK3: GCACACTTGATGATTTCATC
CaCYK3 #3222: G3-CaCYK3: GCTAAGATCAAGGCAGTG
CaCYK3 #3223: G4-CaCYK3: GCAACTGCTGCAGTAGAC
CaCYK3 #3312: S1-GFP-CaCYK3: TATGTTTTCGCTCAGTGGGAGTGCATAGGTAGCACAGTTGCAAATggtgctggcgcaggtgcttc
CaCYK3 #3539: G1-CaCYK3-GFP: GACTGCAAGGGCAACCAC
CaCYK3 #3747: G2-CaCYK3: AGGATTTAaagcttttaCCCAAGTGGGGTTGTTCCAGC
CaNBP2 #3589: S1-CaNBP2: GTCTTGTTTGTCCTGTGTGTGTGTGTGTGTGTGTTGATAAATCACCTGAAACATATACTATTTAATCATTTGTTATTCATCATTATTGTCCATTTTGAATAGgaagcttcgtacgctgcaggtc
CaNBP2 #3579: S2-CaNBP2: CACATACACTCTGTTGGTATGAAAGTATAAAAACATTTGATAAAATTCGTAATCAACATT AATATAACTTAATTGTCCCTATAAGCTGGCTAATATTGGAtctgatatcatcgatgaattcgag
CaNBP2 #3557: G1-CaNBP2: GGTGTTTCACATTATTCTCCG
CaNBP2 #3309: G4-CaNBP2: TGGCCGAACCCTTCCTGG
CaNBP2 #3245: I1-CaNBP2: GACAAGTCATTTCCCACC
CaNBP2 #3246: I2-CaNBP2: CTTCAGCAACTAACCAACCTTG
CaNBP2 #4196: A4-CaNBP2: CACATACACTCTGTTGGTATG
CaSLA1 #3594: S1-CaSLA1: CAACTCCTATGTTAGAGCTAGTCGTGCTCAACACAAAACCTGATGTGAAACAATGAA ACTTTCGACGATTCTACAAAAGTGCGGAAATTGCTTGAAATCAAAGgaagcttcgtacgctgcaggtc
CaSLA1 #3315: S2-CaSLA1: AGCATTACAAACTATGAAAGGAATAAGAAATAATGAATAATATTTTGTTTGATATACAATTA TAAAATAAAAGAGTTAATAAAGGTTCAAAATGCACTTTtctgatatcatcgatgaattcgag
CaSLA1 #3562: G1-CaSLA1: CGGTAGAGATGATGTTGTG
CaSLA1 #3765: G2-SLA1: AGGATTTAaagcttttaAGGTGGTGCAGGGAAATCCG
CaSLA1 #3236: G3-CaSLA1: TGGTGGAGCACCACAGAC
CaSLA1 #3237: G4-CaSLA1: CGGCTTTGCAACATCAAGAC
CaSLA1 #3241: I1-CaSLA1: CATAGGGATAGATCACCAG
CaSLA1 #3242: I2-CaSLA1: CTTCTCTCAAACCATGGGC
CaSLA1 #3243: I3-CaSLA1: CACAACAACAACCGCCACC
CaSLA1 #3244: I4-CaSLA1: CCATACCAGTTGGTTGTGAC
CaSLA1 #3314: S1-GFP-CaSLA1: AGAGCTAATCTACAAGCAGCAACACCAGATAATCCCTTTGGATTCggtgctggcgcaggtgcttc
CaSLA1 #4265: S2-MALp-SLA1�SH3#1-2: GAATCTGAGTCTGTTGCTGTGGAATAGCCTGCTGTTGTTGTGGTGGTGGTTGGAAAACCTGTTGTGGTTGTTGCTGTTGATGCTGTGCTGGCTCTGCTGTcattgtagttgattattagttaaaccac
CaURA3 #600: U2: GTGTTACGAATCAATGGCACTACAGC
CaURA3 #599: U3: GGAGTTGGATTAGATGATAAAGGTGATGG
CdHIS1 #1432: H2: TCTAAACTGTATATCGGCACCGCTC
CdHIS1 #1433: H3: GCTGGCGCAACAGATATATTGGTGC
CmLEU2 #1743: L3: GCTGAAGCTTTAGAAGAAGCCGTG
CaMAL2 #4269: G3-CaMALp: GTACAACTAAACTGGGTGATG
123
Curr Genet (2010) 56:309–319 313
identiWed using the SMART tool at http://smart.embl.de/.An SH3-domain is composed of app. 70 amino acids andseveral conserved residues can be found (Fig. 1a). Theposition of a SH3-domain within a protein may vary andthere are also proteins like Sla1 that contain more than oneSH3-domain (Fig. 1b). Amino acid sequence identitiesbetween the C. albicans and, for example, Saccharomycescerevisiae proteins are overall not very high and rangebetween 27 and 37%. The C. albicans proteins are largerthan the S. cerevisiae homologs: Sla1 by only 13aa, Cyk3by 135aa, and Nbp2 by one-third (342aa compared to236aa). The characterizations of the yeast genes revealedthat SLA1 plays a role in actin cytoskeleton assembly andendocytosis; Nbp2 is required for mitotic growth at hightemperatures and for cell wall integrity and Cyk3 isinvolved in cytokinesis (Korinek et al. 2000; Warren et al.2002; Ohkuni et al. 2003).
Generation of C. albicans mutant strains
In this report, we have employed several strategies forgene function analysis relying on diVerent pFA-vectorsand also used a single transformation approach relyingon UAU1-cassettes as described below. Initially, we usedthe pFA-series to generate complete ORF-deletion strainsin the three genes. From two heterozygous mutantstrains, we went onto obtain two independent homozy-gous mutant strains thereof using the C. albicans URA3and the Candida dubliniensis HIS1 marker genes. In
order to characterize SLA1 in more detail, we used inser-tional disruption cassettes based on SLA1-UAU1-cas-settes. Since deletion of CYK3 was not feasible, we useda promoter shutdown approach to analyze the conse-quences of Cyk3 depletion. Mutant phenotypes could beobtained with the homozygous mutants of sla1 and nbp2,which in both cases could be complemented by the rein-tegration of the wild-type gene at the BUD3 locus. Local-ization of Sla1 and Cyk3 was done by Xuorescencemicroscopy of GFP-tagged strains. Using this array oftools, we were able to achieve an initial characterizationof gene function for these genes, which will be describedin the following sections.
Deletion of SLA1 and NBP2 results in hyphal growth phenotypes
Homozygous mutant strains of sla1 and nbp2 were charac-terized to reveal their growth potential under diVerentgrowth conditions. When grown on minimal media, nostrong defects during yeast growth were observable.Hyphal growth was monitored by inducing yeast cellseither on solid media or in liquid culture (Fig. 2). The wildtype strongly Wlaments after addition of serum or in spidermedium. Mutants in sla1 or nbp2 were also able to induceWlament formation. Hyphae of these mutant strains, how-ever, were shorter than the wild type after several hours ofinduction. Interestingly, the nbp2 mutant showed frequentreinitiating of germ tube formation from the germ cell.
Fig. 1 Alignment and position of SH3-domains. a The Wve SH3-do-mains of the three genes that were functionally analyzed in this studywere aligned using the MegAlign tool of the DNASTAR software (ht-tp://www.dnastar.com). Consensus sites are shaded in gray while iden-tical sites in all Wve domains are shaded in black. b The positions of theSH3-domain vary within the proteins and are for Nbp2 at amino acids
127–184, for Cyk3 at position 11–68 and for Sla1 at positions 7–73,76–133, and 399–457. For reference, the complete protein length isdrawn to scale. No other domains were found using the SMART toolat (http://smart.embl.de/) also Sla1 has several repeats at its C-termi-nus. Deletion of the N-terminal SH3-domains results in a sla1 alleletermed Sla1�SH3#1,2
A
Cyk3
Nbp2B
CAP026CAP025
Sla1
Sla1 SH3#1-2 MAL2-prom
SH3-domain
123
314 Curr Genet (2010) 56:309–319
Thus, after 3 h, most of the germ cells had formed two orthree germ tubes (Fig. 2).
SLA1-deletion leads to defects in actin patch assembly and distribution
The actin cytoskeleton plays a major role in polarizedgrowth. During hyphal growth, actin cables in C. albicansare formed by the tip-localized polarisome and actinpatches localize to the hyphal tip at sites of endocytosis (forreview see Pruyne and Bretscher 2000a, b). To analyze thegrowth defects of sla1 in detail, we used Xuorescencemicroscopy of rhodamine stained germ tubes. We analyzedthree diVerent sla1 mutant strains: two bearing UAU1 cas-settes, CAP025 and CAP026, and a complete ORF-deletionstrain. In this way, we could analyze the eVect of truncatingSLA1 at positions that potentially leave all three SH3-domainsintact, truncate the protein after the Wrst two SH3-domainsor entirely delete SLA1 (see also Fig. 1). The two UAU1insertions in SLA1 already showed diVerent phenotypes.The CAP026 strain basically showed no defect, grew likewild type and accumulated actin patches in the hyphal tips.The CAP025 strain in which the UAU1 insertion truncatesSLA1 downstream of the region coding for the second SH3-domain, shows decreased hyphal lengths when comparedwith the wild type. The number of actin patches in thismutant is decreased and the patches do not accumulate inthe tips of hyphae (Fig. 3a). This phenotype is even morepronounced in the complete ORF-deletion strain. Thisstrain has a more drastic growth defect and even fewer cor-tical actin patches. This demonstrates that Sla1 is involvedin the assembly and polarization of cortical actin patches inC. albicans. The assembly of actin cables in the hyphal Wla-ments was not impaired (Fig. 3b). The growth defect of thenull mutant could be complemented by reintegration of thewild-type SLA1 gene at the BUD3 locus. The assembly ofcortical actin patches and their polarized localization wasalso restored in both yeast and hyphal cells (Fig. 3b).
To visualize the localization of Sla1 in vivo, a chromo-somally tagged SLA1-GFP strain was constructed based ona heterozygous mutant. Sla1 shows a patch-like localizationin yeast cells and hyphae (Fig. 3b). An increased number ofSla1-GFP patches can be found at sites of polarized growth,
Fig. 2 Characterization of growth phenotypes of the sla1 and nbp2mutants. The strains were grown overnight in liquid culture and theninoculated on minimal medium (a), on serum containing plates or inliquid medium supplemented with 10% serum (b), or on spider platesand in spider liquid medium (c). Plates were incubated for 3 days at
30°C (a) or 37°C (b, c) prior to photography. Hyphal induction in liq-uid media was done for 3 h prior to microscopy. Bar 10 �m. Note theshort germ tube in the sla1 strain (middle row) and the multiple germtubes in the nbp2 mutant (bottom row)
sla1
nbp2
A B C
WT
Fig. 3 Deletion of SLA1 leads to defects in cortical actin patch assem-bly. Strains were grown overnight in YPD, diluted in new medium andgrown for 4 h at 30°C for yeast cell growth or at 37°C in the presenceof 10% serum to induce Wlament formation. Cells were then Wxed andstained with rhodamine-phalloidin. Bright-Weld and Xuorescence im-ages showing the actin cytoskeleton of the indicated strains are shown.a DiVerential eVect on cortical actin patch assembly of SLA1-UAU1insertions compared to the wild type. b Reintegration of SLA1 comple-ments the actin patch defect of the sla1 complete ORF-deletion mutant.In vivo localization of Sla1-GFP was done without Wxation. Bars 5 �m
SC5314 sla1::UAU1-CAP025 sla1::UAU1-CAP026 A
B SC5314 sla1 sla1,
BUD3/bud3::SLA1 SLA1-GFP/sla1
123
Curr Genet (2010) 56:309–319 315
e.g. the hyphal tip. This localization pattern resembles, forexample, that of C. albicans Abp1 and other proteinsinvolved in actin patch assembly or endocytosis (Martinet al. 2007).
The N-terminal SH3-domains of Sla1 are important for actin cytoskeleton assembly but not for localization of Sla1
To demonstrate that the two N-terminally located SH3-domains of Sla1 contribute to the function of Sla1, we gen-erated a truncated allele, sla1�SH3#1,2. This allele was placedunder control of the regulatable MAL2-promoter using aPCR-based gene targeting approach, which at the sametime eliminated the Wrst two SH3-domains. Furthermore, tobe able to localize the truncated protein, a C-terminal tagwas added to sla1�SH3#1,2. This strain was then used to visu-alize both the localization of Sla1�SH3#1,2-GFP and the orga-nization of actin cytoskeleton in yeast and hyphal cells(Fig. 4). When grown in glucose, sla1�SH3#1,2 expressionwas turned down and the protein could not be detected.Actin organization resembled that of a sla1 mutant strain(compare Figs. 3, 4). Growth in maltose medium inducedthe expression of sla1�SH3#1,2-GFP. Hence Sla1�SH3#1,2-GFP could be detected as cortical patches in yeast andhyphal cells. Sla1�SH3#1,2-GFP was also found enriched inthe hyphal tips. Thus, Sla1�SH3#1,2-GFP localizes in a similarmanner as full length Sla1-GFP indicating that the N-terminalSH3 domains do not play a role in Sla1-targeting to thecortex. However, under inducing conditions the actin cyto-skeleton assembly in the strain expressing Sla1�SH3#1,2-GFPwas still aberrant. Cortical actin patches that did not
localize to the hyphal tip were reduced in number and thusresembled the situation in the sla1 deletion strain. Thisindicates that the N-terminal SH3 domains of Sla1 do playan important role in organization of the actin cytoskeletonat sites of endocytosis (Fig. 4).
NBP2-deletion leads to multiple germ tube formation
Deletion of NBP2 did not reveal any defects during theyeast growth phase. Yet, under hyphal inducing conditions,we observed that all germ cells developed multiple germtubes after 4 h and the length of the primary germ tube wasdecreased in nbp2 compared to that of the wild type(Figs. 2, 5). Previously, it was shown in C. albicans andAshbya gossypii that in hyphae large vacuoles are formed insubapical compartments (Walther and Wendland 2004a;Veses and Gow 2008). This inXuences the ratio of cyto-plasm versus vacuole and inXuences the branching fre-quency (Veses et al. 2009). Therefore, we analyzed thevacuolar compartments in FM4-64 stained yeast cells andhyphae of the wild type and the nbp2 mutant (Fig. 5). Dur-ing yeast growth, both strains accumulated a larger vacuolein mother cells and showed no observable diVerence. How-ever, staining of germlings revealed the inability of nbp2germ cells to generate large vacuolar compartments. Frag-mented vacuoles were found throughout nbp2 hyphae.Thus, the altered ratio of cytoplasm versus vacuolar spacemay be the causal link to increased branching of germ cellsin the nbp2 mutant. To corroborate that the defect in vacuo-lar fusion was speciWc for the nbp2 deletion strain, we rein-tegrated the NBP2 gene at the BUD3-locus. As expected,
Fig. 4 The two amino terminal SH3-domains of Sla1 are re-quired for the organization of the actin cytoskeleton. CAP221 was grown overnight in YPD for a full SLA1 shut-down. Then cells were diluted in either YPD (re-pressed) or YPM (induced) with or without serum and grown for 4 h. Afterwards, cells were Wxed and stained with rhodamine-phalloidin prior to GFP and actin Xuorescence microscopy. Bar 5 �m
DIC DIC DIC DICGFP actin GFP actin
MAL2p-sla1 SH3#1,2-GFP repressed MAL2p-sla1 SH3#1,2-GFP induced
123
316 Curr Genet (2010) 56:309–319
the reintegrant showed wild type vacuolar phenotype. Wealso generated a chromosomally encoded NBP2-GFP,which, however, did not yield a Xuorescent signal. To ana-lyze vacuolar acidiWcation in the nbp2 strain, we used quin-acrine staining and Xuorescence microscopy (Fig. 6).Quinacrine diVuses through membranes and accumulates inacidic compartments like the vacuole (Weisman et al.1987). The accumulation of the dye and staining of vacu-oles of nbp2 hyphae indicated that vacuolar fusion but notthe function of the vacuoles was aVected in the nbp2 strain(Fig. 6, 7).
Depletion of Cyk3 results in cytokinesis defects
We were unable to generate homozygous cyk3 strains frominitial heterozygous mutants, without also generating sometriplication event that left a wild-type copy of the gene inthe genome. Thus, we conclude that CYK3 is an essentialgene. In S. cerevisiae, CYK3 is involved in cytokinesis andlocalizes to the bud neck in large budded cells (Korineket al. 2000). Cyk3 localization in C. albicans was deter-mined by producing a fusion between the chromosomalCYK3 gene with GFP in a heterozygous mutant. In C. albi-cans, CYK3 was found to localize at the bud neck in largebudded cells similar to Cyk3 in S. cerevisiae (Fig. 5a).
In S. cerevisiae, deletion of CYK3 results in only mildcytokinesis defects, which contrasts the situation inC. albicans. To assess a phenotype upon depletion of CYK3transcript, we produced a strain which expressed CYK3 from
the regulatable C. albicans MET3 promoter (Care et al.1999). Shutdown of CYK3 expression resulted in a severecytokinesis defect. CYK3-depleted cells were elongated ormisshapen and showed abnormal chitin deposition (Fig. 5b).
Discussion
In this study, we have generated C. albicans mutant strainsfor three SH3-domain encoding genes using PCR-basedgene targeting methodologies and a single-step transforma-tion protocol with UAU1 cassettes (Walther and Wendland2008; Nobile and Mitchell 2009). SH3-domains are smallprotein domains that promote protein–protein interactions,particularly by binding to proline-rich ligands with a PxxPmotif (Mayer 2001). The binding aYnity and binding spec-iWcity are inherently rather low. This may pose some diY-culties when trying to establish protein interactions usingthe yeast two-hybrid system. Sla1, on the other hand, con-tains three SH3 domains, which may help to increase spe-ciWc binding of target proteins.
Given the strong potential of SH3-domains to promotesignaling and morphogenesis, a large variety of SH3-domain
Fig. 5 Deletion of NBP2 results in vacuolar fragmentation in hyphae.Strains were grown under yeast or germ tube inducing conditions for4 h. FM4-64 (0.2 �g/ml) was added and samples were processed forbrightWeld and Xuorescence microscopy after 1 h to allow uptake of thedye. Bars 5 �m
SC5314 nbp2
nbp2,BUD3/bud3::NBP2
Fig. 6 Vacuoles of an nbp2 mutant strain are acidic. Strains weregrown under yeast or germ tube inducing conditions for 4 h. Quina-crine staining reveals acidiWed and functional vacuoles
123
Curr Genet (2010) 56:309–319 317
proteins can be found in eukaryotic genomes ranging from20–30 in yeast-like ascomycetes to over 300 in humans(Karkkainen et al. 2006). In yeast-like ascomycetes, thereseems to be limited evolution of SH3-domain encodinggenes. For example, in S. cerevisiae, Abp1 contains oneSH3-domain, while in C. albicans, the Abp1 homolog hastwo adjacent SH3-domains, yet deletion of CaABP1showed no discernible phenotype (Martin et al. 2007).
Deletion of the C. albicans SLA1 resulted in similar actinassembly defects compared to a SLA1 deletion in S. cerevi-siae. The severe reduction in actin patches, however, didnot abolish the ability to generate germ tubes in the C. albi-cans sla1 mutants although a decreased polarized growthrate could be observed. A similar phenotype was observedin a Camyo5(S366D) allele, which mimics a phosphory-lated serine. A strain bearing this allele was found to Wla-ment, yet shows a largely delocalized actin cytoskeleton(Oberholzer et al. 2002). In this paper, we identiWed theN-terminal region of C. albicans Sla1 containing two SH3-domains to be required for correct organization of the actincytoskeleton. In S. cerevisiae, Sla1 localizes to the cortexvia an interaction of the Sla1 C-terminal repeat region withEnd3 (Tang et al. 2000; Warren et al. 2002). Furthermore,Sla1 interacts with Las17 and Abp1 as shown by immuno-precipitation (Warren et al. 2002). The elimination of twoSH3 domains from Sla1 resulted in profound disorganizationof the actin cytoskeleton indentifying Sla1 as a major
player linking early events of endocytosis with the actincytoskeleton. Nevertheless, sla1 mutants were able to gen-erate, albeit short, hyphae.
Surprisingly, sla1 did not show a defect in the formationof large subapical vacuoles (see also Fig. 2). This, on theother hand, was observed for the nbp2 mutant. In S. cerevi-siae, nbp2 mutants are temperature sensitive and also sensi-tive to cell wall stress (Ohkuni et al. 2003). Our C. albicansnbp2 mutants were not temperature sensitive and grew wellat 40°C even with the addition of 1 M sorbitol or 1.5 MNaCl (data not shown). The transformation frequency,which requires a heat shock, was also not aVected in nbp2cells. Thus, our results indicate some novel vacuolar func-tions for NBP2 which are more pronounced during hyphalgrowth stages and not apparent in yeast cells. Germ tubeformation in the nbp2 strain was altered in a way that germcells quickly generated multiple hyphae rather than onedominant germ tube as in the wild type. Thus, such a phe-notype could be useful in larger scale screenings of aC. albicans mutant collection once available.
SH3-domain proteins in C. albicans are taking part in avariety of processes. In this study, we identiWed a key roleof the Wrst two Sla1 SH3-domains for the polarized assem-bly of the actin cytoskeleton, which had not previouslybeen identiWed in other studies. We also revealed theinvolvement of Nbp2 in vacuolar fusion, and of Cyk3 incytokinesis. The promoter shutdown experiment using
Fig. 7 CYK3 localization and depletion after promoter shut-down. a Cyk3-GFP Xuorescence in large budded yeast cells was observed at the bud neck. b Cells in which CYK3 expression is controlled by the regulatable MET3-promoter were grown overnight in YPD at 30°C with (repressed) or without (induced) the addition of 3.5 mM methio-nine and cysteine. Prior to microscopy, calcoXuor was add-ed to the medium to stain chitin rich regions. Bar 10 �m
A
BMET3p-CYK3
inducedMET3p-CYK3
repressed
123
318 Curr Genet (2010) 56:309–319
MET-promoter controlled CYK3 did not result in growtharrest. This may be due to the leakiness of the promoter.However, cells were found to be deWcient in cell separationproviding evidence that also in C. albicans Cyk3 isinvolved in this process. Our GFP-localization data ofCyk3-GFP provide further evidence for that. Similar toS. cerevisiae, C. albicans Cyk3 may, therefore, act at thelevel of actin ring formation or constriction.
Due to the diploidy of C. albicans, gene function analy-ses still require much more eVort to produce the correctdeletion strains. Using PCR-based gene targeting methods,detailed structure–function analyses are possible andreduce the time required to construct the desired strains.Thus, larger scale approaches can be undertaken also inC. albicans (Noble and Johnson 2005). Our study of threepreviously uncharacterized C. albicans genes, therefore,adds to the repository of functional analysis information forthis human fungal pathogen.
Acknowledgments We thank Alexander Johnson, Suzanne Noble,and Aaron Mitchell for generously providing reagents used in thisstudy; Sidsel Ehlers for providing technical assistance and AndreaWalther for support on microscopy. This study was funded by the EU-Marie Curie Research Training Network “Penelope” and we thankmembers of this consortium for discussions.
References
am Busch MS, Mignon D, Simonson T (2009) Computational proteindesign as a tool for fold recognition. Proteins 77:139–158
Barelle CJ, Richard ML, Gaillardin C, Gow NA, Brown AJ (2006)Candida albicans VAC8 is required for vacuolar inheritance andnormal hyphal branching. Eukaryot Cell 5:359–367
Bassilana M, Blyth J, Arkowitz RA (2003) Cdc24, the GDP-GTP ex-change factor for Cdc42, is required for invasive hyphal growthof Candida albicans. Eukaryot Cell 2:9–18
Bauer J, Wendland J (2007) Candida albicans SX1 suppresses Xoccu-lation and Wlamentation. Eukaryot Cell 6:1736–1744
Berman J, Sudbery PE (2002) Candida albicans: a molecular revolutionbuilt on lessons from budding yeast. Nat Rev Genet 3:918–930
Calderone RA, Fonzi WA (2001) Virulence factors of Candida albi-cans. Trends Microbiol 9:327–335
Care RS, Trevethick J, Binley KM, Sudbery PE (1999) The MET3 pro-moter: a new tool for Candida albicans molecular genetics. MolMicrobiol 34:792–798
Court H, Sudbery P (2007) Regulation of Cdc42 GTPase activity in theformation of hyphae in Candida albicans. Mol Biol Cell 18:265–281
Enloe B, Diamond A, Mitchell AP (2000) A single-transformationgene function test in diploid Candida albicans. J Bacteriol182:5730–5736
Epp JA, Chant J (1997) An IQGAP-related protein controls actin-ringformation and cytokinesis in yeast. Curr Biol 7:921–929
Gillum AM, Tsay EY, Kirsch DR (1984) Isolation of the Candida albi-cans gene for orotidine-5�-phosphate decarboxylase by comple-mentation of S. cerevisiae ura3 and E. coli pyrF mutations. MolGen Genet 198:179–182
Gola S, Martin R, Walther A, Dunkler A, Wendland J (2003) Newmodules for PCR-based gene targeting in Candida albicans: rapid
and eYcient gene targeting using 100 bp of Xanking homology re-gion. Yeast 20:1339–1347
Karkkainen S, Hiipakka M, Wang JH, Kleino I, Vaha-Jaakkola M,Renkema GH, Liss M, Wagner R, Saksela K (2006) IdentiWcationof preferred protein interactions by phage-display of the humanSrc homology-3 proteome. EMBO Rep 7:186–191
Korinek WS, Bi E, Epp JA, Wang L, Ho J, Chant J (2000) Cyk3, a nov-el SH3-domain protein, aVects cytokinesis in yeast. Curr Biol10:947–950
Kumamoto CA, Vinces MD (2005) Contributions of hyphae and hy-pha-co-regulated genes to Candida albicans virulence. CellMicrobiol 7:1546–1554
Martin R, Hellwig D, Schaub Y, Bauer J, Walther A, Wendland J(2007) Functional analysis of Candida albicans genes whose Sac-charomyces cerevisiae homologues are involved in endocytosis.Yeast 24:511–522
Mayer BJ (2001) SH3 domains: complexity in moderation. J Cell Sci114:1253–1263
Michel S, Ushinsky S, Klebl B, Leberer E, Thomas D, Whiteway M,Morschhauser J (2002) Generation of conditional lethal Candidaalbicans mutants by inducible deletion of essential genes. MolMicrobiol 46:269–280
Nobile CJ, Mitchell AP (2009) Large-scale gene disruption using theUAU1 cassette. Methods Mol Biol 499:175–194
Noble SM, Johnson AD (2005) Strains and strategies for large-scalegene deletion studies of the diploid human fungal pathogen Can-dida albicans. Eukaryot Cell 4:298–309
Oberholzer U, Marcil A, Leberer E, Thomas DY, Whiteway M (2002)Myosin I is required for hypha formation in Candida albicans.Eukaryot Cell 1:213–228
Odds FC (1994) Pathogenesis of Candida infections. J Am Acad Der-matol 31:S2–S5
Ohkuni K, Okuda A, Kikuchi A (2003) Yeast Nap1-binding proteinNbp2p is required for mitotic growth at high temperatures and forcell wall integrity. Genetics 165:517–529
Pruyne D, Bretscher A (2000a) Polarization of cell growth in yeast.J Cell Sci 113:571–585
Pruyne D, Bretscher A (2000b) Polarization of cell growth in yeast. I.Establishment and maintenance of polarity states. J Cell Sci113:365–375
Schaub Y, Dunkler A, Walther A, Wendland J (2006) New pFA-cas-settes for PCR-based gene manipulation in Candida albicans.J Basic Microbiol 46:416–429
Sudbery P, Gow N, Berman J (2004) The distinct morphogenic statesof Candida albicans. Trends Microbiol 12:317–324
Tang HY, Xu J, Cai M (2000) Pan1p, End3p, and S1a1p, three yeastproteins required for normal cortical actin cytoskeleton organiza-tion, associate with each other and play essential roles in cell wallmorphogenesis. Mol Cell Biol 20:12–25
Veses V, Gow NA (2008) Vacuolar dynamics during the morphoge-netic transition in Candida albicans. FEMS Yeast Res 8:1339–1348
Veses V, Richards A, Gow NA (2009) Vacuole inheritance regulatescell size and branching frequency of Candida albicans hyphae.Mol Microbiol 71:505–519
Walther A, Wendland J (2003) An improved transformation protocolfor the human fungal pathogen Candida albicans. Curr Genet42:339–343
Walther A, Wendland J (2004a) Apical localization of actin patchesand vacuolar dynamics in Ashbya gossypii depend on the WASPhomolog Wal1p. J Cell Sci 117:4947–4958
Walther A, Wendland J (2004b) Polarized hyphal growth in Candidaalbicans requires the Wiskott–Aldrich Syndrome protein homo-log Wal1p. Eukaryot Cell 3:471–482
Walther A, Wendland J (2008) PCR-based gene targeting in Candidaalbicans. Nat Protoc 3:1414–1421
123
Curr Genet (2010) 56:309–319 319
Warren DT, Andrews PD, Gourlay CW, Ayscough KR (2002) Sla1pcouples the yeast endocytic machinery to proteins regulating actindynamics. J Cell Sci 115:1703–1715
Weisman LS, Bacallao R, Wickner W (1987) Multiple methods ofvisualizing the yeast vacuole permit evaluation of its morphologyand inheritance during the cell cycle. J Cell Biol 105:1539–1547
Wendland J (2001) Comparison of morphogenetic networks of Wla-mentous fungi and yeast. Fungal Genet Biol 34:63–82
Wendland J, Philippsen P (2002) An IQGAP-related protein, encodedby AgCYK1, is required for septation in the Wlamentous fungusAshbya gossypii. Fungal Genet Biol 37:81–88
Winzeler EA, Shoemaker DD, AstromoV A, Liang H, Anderson K,Andre B, Bangham R, Benito R, Boeke JD, Bussey H, Chu AM,
Connelly C, Davis K, Dietrich F, Dow SW, El Bakkoury M,Foury F, Friend SH, Gentalen E, Giaever G, Hegemann JH, JonesT, Laub M, Liao H, Liebundguth N, Lockhart DJ, Lucau-Danila A,Lussier M, M’Rabet N, Menard P, Mittmann M, Pai C,Rebischung C, Revuelta JL, Riles L, Roberts CJ, Ross-MacDonald P,Scherens B, Snyder M, Sookhai-Mahadeo S, Storms RK, VeronneauS, Voet M, Volckaert G, Ward TR, Wysocki R, Yen GS, Yu K,Zimmermann K, Philippsen P, Johnston M, Davis RW (1999)Functional characterization of the S. cerevisiae genome by genedeletion and parallel analysis. Science 285:901–906
Zheng XD, Lee RT, Wang YM, Lin QS, Wang Y (2007) Phosphoryla-tion of Rga2, a Cdc42 GAP, by CDK/Hgc1 is crucial for Candidaalbicans hyphal growth. EMBO J 26:3760–3769
123
24
PART VI
25
PART VI –
Candida albicans Vrp1 is required for polarized
morphogenesis and interacts with Wal1 and Myo5
Nicole Borth1, 2, §
, Andrea Walther1, 2
, Patrick Reijnst1; Sigyn Jorde
1,
Yvonne Schaub2, $
, and Jürgen Wendland1, 2, *
1Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, DK-2500 Valby, Denmark
2Junior Research Group: Growth Control of Fungal Pathogens, Leibniz Institute for Natural Product
Research and Infection Biology - Hans-Knöll Institute and Department of Microbiology, Friedrich-
Schiller University, D-07745 Jena, Germany *Corresponding author: Jürgen Wendland, Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej
10, DK-2000 Valby, Copenhagen, Denmark
Email: jww@crc.dk ; Phone: +45/3327 5230; Fax: +45/3327 4708 § present address: Cell and Molecular Biology; Leibniz Institute for Natural Product Research and
Infection Biology - Hans-Knöll Institute, D-07745 Jena, Germany $ present address: Leibniz Institute for Age Research - Fritz Lipmann Institute; D-07745 Jena, Germany
Running title: C. albicans VRP1
Key words: endocytosis, polarized hyphal growth, PCR, pFA-plasmids, actin
cytoskeleton
Abstract
Recently, a link between endocytosis and hyphal morphogenesis has been
established in C. albicans via the Wiskott-Aldrich Syndrome homolog WAL1. To get a
more detailed mechanistic understanding of this link we have investigated a
potentially conserved interaction between Wal1 and the C. albicans WASP-interacting
protein (WIP)-homolog encoded by VRP1. Deletion of both alleles of VRP1 results in
strong hyphal growth defects under serum inducing conditions but filamentation can
be observed on spider medium. Mutant vrp1 cells show a delay in endocytosis -
measured as the uptake and delivery of the lipophilic dye FM4-64 to the vacuole -
compared to the wild type. Vacuolar morphology was found to be fragmented in
subset of cells and the cortical actin cytoskeleton was depolarized in vrp1 daughter
cells. The morphology of the vrp1 null mutant could be complemented by
reintegration of the wild type VRP1 gene at the BUD3-locus. Using the yeast two-
hybrid system we could demonstrate an interaction of the C-terminal part of Vrp1 with
the N- terminal part of Wal1, which contains the WH1-domain. Furthermore, we
26
found that Myo5 has several potential interaction sites on Vrp1. This establishes an
important role of the Wal1-Vrp1-Myo5 complex in endocytosis and polarized
localization of the cortical actin cytoskeleton to promote polarized hyphal growth in
C. albicans.
Introduction
Candida albicans is a pathogenic yeast that can respond to environmental cues by
forming hyphal filaments. This morphogenetic switch is regarded as one of several
attributes, which enable C. albicans to cause disease (Sudbery et al., 2004; Whiteway
and Oberholzer, 2004; Whiteway and Bachewich, 2007). Hyphal growth is an extreme
form of polarized morphogenesis that requires constant delivery of vesicles to support
tip growth and remodelling of the cell wall at the tip. The actin cytoskeleton plays an
important role both by providing tracks for delivery of vesicles to the tip along actin
cables and via actin patches at sites of endocytosis (Pruyne and Bretscher, 2000;
Kaksonen et al., 2005). Balanced secretion and endocytosis are also important for the
maintenance of polarized morphogenesis, although a mechanistic link has not been
established so far (Aghamohammadzadeh and Ayscough, 2009). Two genes that play
a crucial role for endocytosis in C. albicans are the myosin I, encoded by CaMYO5,
and the Wiskott-Aldrich syndrome homolog, CaWAL1 (Oberholzer et al., 2004;
Walther and Wendland, 2004). In S. cerevisiae their corresponding homologs,
ScMYO3/5 and LAS17 have been shown to activate the Arp2/3-complex to promote
actin polarization at sites of endocytosis (Evangelista et al., 2000; Machesky, 2000;
D‟Agostino and Goode, 2005). Deletion of CaMYO5 leads to viable mutant strains
that cannot undergo hyphal development. Yeast cells of Camyo5 show depolarization
of the actin cytoskeleton, which also affects budding pattern (Oberholzer et al., 2002,
2004). Similarly, deletion of CaWAL1 results in mutant strains that are unable to
generate hyphal filaments. During yeast growth depolarization of the actin
cytoskeleton leads to the formation of round cells that show an increase in random
budding. Additionally, loss of CaWAL1 leads to defects in the endocytosis of the
lipophilic dye FM4-64 as well as defects in vacuolar fusion. Fragmented vacuoles
have been observed in other mutant strains, e.g. in vac1 or vps11. These strains were
also shown to be defective in hyphal morphogenesis (Palmer et al., 2003, Franke et al.,
2006). Characteristically, during hyphal growth large vacuoles are formed in the germ
27
cell and in the rear parts of hyphal filaments. The unequal distribution of vacuoles was
also shown to influence the timing of branch-emergence (Veses et al., 2008).
Fragmented vacuoles, per se, however, do not abolish polarized morphogenesis, which
was recently also shown in a Caboi2 mutant (Reijnst et al.,2010).
The functional overlap of C. albicans Myo5 and Wal1 and their rather similar
mutant phenotypes suggest that both proteins can function in a complex in C. albicans.
In mammalian cells WASP was shown to interact with the Wasp-interacting protein,
WIP (Ramesh et al., 1997; Thrasher and Burns, 2010). WIP suppresses growth defects
of the S. cerevisiae end5/vrp1 mutant (Vaduva et al., 1999). ScEnd5/Vrp1 is a very
proline-rich protein which is involved in cytoskeletal organization and can interact
with both Las17 and Myo5 (Anderson et al., 1998; Evangelista et al., 2000; Munn and
Thanabalu, 2009). The temperature sensitivity and loss of viability of an end5-1/vrp1
mutant can be suppressed by overexpression of ScLAS17 (Naqvi et al., 1998). Loss of
End5/Vrp1 results in severe defects in cytokinesis and Hof1 cannot be recruited to the
bud neck (Ren et al., 2005).
Here we describe the analysis of the C. albicans VRP1 homolog. The mutant
strain shows defects in hyphal growth, endocytosis, organization of the actin
cytoskeleton, and budding pattern similarly to - but less pronounced than – the wal1
and myo5 mutant strains. Using two-hybrid studies in S. cerevisiae we could show that
Vrp1 interacts strongly with the N-terminal domain of Wal1 and provides multiple
docking sites for Myo5. This data provides evidence for a Wal1-Vrp1-Myo5 complex
required for endocytosis and polarized morphogenesis in C. albicans.
Material and methods
Strains and media
C. albicans strain SN148 (Noble and Johnson, 2005) was used to generate the
vrp1 heterozygous and homozygous mutant strains. For the yeast two-hybrid
experiment the following strains were used: PJ69-4a: trp1-901; leu2-3,112; ura3-52;
his3-200; gal4 ; gal80 ; lys2::GAL1-HIS3; GAL2p-ADE2; met2::GAL7-lacZ and
PJ69-4alpha: trp1-901; leu2-3,112; ura3-52; his3-200; gal4 ; gal80 ; lys2::GAL1-
HIS3; GAL2p-ADE2; met2::GAL7-lacZ. Strains were grown either in yeast
extract/peptone/dextrose (YPD; 1 % yeast extract, 2 % peptone, 2 % dextrose) or in
28
minimal media (CSM; complete supplement mixture; 6.7 g/l yeast nitrogen base
(YNB) with ammonium sulphate and without amino acids, 0.69 g/l CSM; 20 g/l
glucose) or SD (6.7 g/l YNB with ammonium sulphate and without amino acids, 20 g/l
glucose) with the addition of required amino acids and uridine. Hyphal formation was
induced with 10 % serum at 37°C or upon incubation on Spider medium. Escherichia
coli strain DH5 served as a host for plasmid propagation.
Transformation and strain construction
S. cerevisiae and C. albicans were transformed using the lithium acetate
procedure (Walther and Wendland, 2003; Gietz and Schiestl, 2007). Independent
homozygous mutant strains were constructed using the PCR-based gene targeting
method (Walther and Wendland, 2008). To delete both ORFs of VRP1 by sequential
transformation of SN148 resulted in the heterozygous strains CAB9
(VRP1/vrp1::ARG4) and CAB10 (VRP1/vrp1::URA3) and then in the homozygous
strains CAB12 (vrp1::ARG4/vrp1::CdHIS1) and CAB13
(vrp1::URA3/vrp1::CdHIS1). To complement the Δvrp1 phenotype, VRP1 was
amplified from genomic DNA and ligated in pDrive, generating #C597. The insert was
cloned in #C873, which contains the BUD3 locus for integration and CmLEU2 as
selectable marker using SalI and BamHI restriction sites. This generated #C598. The
Δvrp1 homozygous mutant strain CAB13 was transformed with SpeI linearized
#C598, generating CAP225.
Strain CAT41 was generated by targeting a GFP-HIS1 cassette to the C. albicans
TEF1-locus. Standard PCR-based gene targeting and verification procedures as well as
pFA-plasmids for cassette generation were used as described (Walther and Wendland,
2008). Primers were obtained from biomers.net GmbH (Ulm, Germany) and
sequences will be made available upon request.
Plasmid constructs
For the yeast two-hybrid experiments freely replicating plasmids were generated
using pGAD424 and pGBT9 (Clontech) as backbones. These plasmids contain the
Gal4 transcription factor activation domain or the Gal4-DNA-binding domain,
respectively. Restriction fragments of WAL1, VRP1, and the region encompassing
29
SH3-domain of MYO5 were amplified from genomic DNA or plasmid clones and
cloned into the corresponding restriction sites of pGAD424/pGBT9. Primers used for
amplification and cloning will be made available upon request. Correct cloning was
verified by sequencing (Eurofins MWG Operon, Ebersberg, Germany).
Microscopy and staining procedures
Microscopic analyses were done with an Axio-Imager microscope (Zeiss, Jena
and Göttingen, Germany) using Metamorph 7 software tools (Molecular Devices
Corp., Downington, PA, USA) to drive the automated image acquisition procedures.
Images were acquired on a MicroMax1024 CCD-camera (Princeton Instruments,
Trenton NJ, USA). Fluorescence microscopy was performed using the appropriate
filter combinations for FM4-64-imaging and actin-staining as described previously
(Walther and Wendland, 2004; Martin et al., 2005). Samples were analyzed by
generating either single images or Z-stacks of up to 20 images that were processed into
single plane projections using Metamorph software.
Yeast two-hybrid analysis
S. cerevisiae was transformed with two plasmids expressing constructs fused to
either the Gal4-DNA-binding domain based on plasmid pGBT9 or the Gal4-activation
domain based on plasmid pGAD424. Transformants were grown on media selecting
for the maintenance of both plasmids (-Trp; -Leu). White colonies reveal an
interaction of the two expressed fusion proteins, which results in the expression of the
ADE2 reporter gene, whereas red colonies appear when the ADE2-reporter could not
be activated. For quantitative analysis liquid culture ß-galactosidase assays were
performed. To this end, strains were incubated over night at 30°C. Cells were
harvested by centrifugation, protein extracts were prepared using a liquid nitrogen-
glass-bead method and the conversion of ONPG (ortho-nitrophenyl-β-D-
galactopyranoside) was measured photometrically (Rose and Botstein, 1983).
30
Results
Sequence comparisons
The C. albicans homolog of S. cerevisiae END5/VRP1 has been identified as
orf19.2190. C. albicans VRP1 encodes a very proline-rich protein of 664 amino acids,
of which 154 residues are proline. Sequence comparisons with other fungal homologs
were done using the clustal W alignment tools (Fig. 1). The N-terminal region of
CaVrp1p contains a proline stretch present in most fungi, only annotated to be absent
in Ashbya gossypii. Reinspection of the VRP1-locus in A. gossypii, however, indicates
that there is a polyproline region upstream of the annotated start codon. Furthermore, a
Vrp1 homolog in the closely related Eremothecium cymbalariae also contains this
polyproline region at the N-terminus of EcVrp1 (our unpublished results).
Downstream of the polyproline region in Vrp1 two putative Wasp Homology 2
(WH2)-domains are located. Here, the filamentous ascomycete Neurospora crassa
lacks the second putative WH2-domain. In S. cerevisiae a short region after the second
WH2-domain has been characterized as a docking site for Hof1 (Ren et al., 2005).
This Hof1-trap (HOT)-domain seems to be rather specific for S. cerevisiae as it is not
found in the other fungal species analyzed (Fig. 1A). The central part of Vrp1
orthologs exhibits only a low degree of amino acid sequence conservation not
regarding the many proline-rich stretches. Whereas the C-terminal regions in fungal
Vrp1 proteins show better conservation. This domain has been characterized as the
Las17p-binding domain (Naqvi et al., 1998; Madania et al., 1999; Fig. 1B).
Generation of C. albicans vrp1 mutant strains
To delete both alleles of C. albicans VRP1 a PCR-based gene targeting approach
was applied (Walther and Wendland, 2008). Initially, independent heterozygous
mutant strains were generated in which the ORF of one allele of VRP1 was deleted by
either the C. albicans ARG4 or URA3 marker gene. To generate homozygous mutant
strains based on these heterozygous strains, the remaining copy of VRP1 was deleted
using the Candida dubliniensis HIS1 gene. Verification of correct gene targeting and
the absence of the VRP1-ORF in the homozygous mutant strains CAB11 and CAB13
was done by diagnostic PCR (Fig. 2).
31
Phenotypic assay of growth morphology of mutant strains
The heterozygous and homozygous VRP1-deletion strains were compared to the
SC5314 wild type, the SN148 strain used as a host for transformation, and a wal1
mutant strain deleted for the C. albicans homolog of the human Wiskott-Aldrich
Syndrome protein, described previously (Walther and Wendland, 2004). Hyphal
induction was tested on Spider medium, which uses mannitol as the primary carbon
source. The wild type showed strong filamentation at the edge of the colony, whereas
the wal1 strain was afilamentous. The SN148 precursor strain also showed a strong
increase in colony wrinkling, which was also found in the heterozygous VRP1/vrp1
strain. The homozygous vrp1 strain did not show this colony wrinkling phenotype.
Yet, the colony edges of the mutant vrp1 strain showed invasive filamentous growth
(Fig. 3A). Hyphal induction in liquid media was done using serum as an inducing cue.
Here the wild type showed abundant filamentation. SN148 was slightly weaker in
filamentation (due to the ura3 deletion) and wal1 again showed no hyphal formation.
The VRP1/vrp1 strain filamented basically like the wild type, whereas the vrp1 mutant
strain did not filament well and produced instead a large number of pseudohyphal cells
and yeast cells (Fig. 3A). The distribution of cell types after hyphal induction in the
various strains used was quantified counting >100 cells for each strain (Fig. 3B).
These analyses indicated a strong defect in hyphal formation of the vrp1 mutant,
which was however, slightly less severe than in the wal1 mutant. This is in line with
the filamentation assay on Spider medium. To demonstrate that these filamentation
defects are solely due to the deletion of the VRP1 gene, we reintegrated the VRP1 gene
at the BUD3-locus in a vrp1/vrp1 mutant strain (see Materials and methods). This
reintegrant was phenotypically like wild type, e.g. when assayed for germ tube
production (Fig. 3C).
Analysis of the actin cytoskeleton in the vrp1 mutant
Hyphal growth defects may be associated with an altered organization of the actin
cytoskeleton. Therefore we used rhodamine-phalloidin staining of fixed cells to
analyze the distribution and polarization of the cortical actin cytoskeleton. Wild type
cells show a polarization of cortical actin in the emerging bud and at the hyphal tip.
The actin cytoskeleton of the wal1 mutant has been shown to be largely depolarized
during all growth stages. In the vrp1 mutant such a depolarization could also be
32
observed in yeast and pseudohyphal cells. Remarkably, in both yeast and hyphal
stages the apical growth region showed more intense staining indicating an
accumulation of actin at sites of polarized growth (Fig. 4A). Analysis of the budding
pattern via fluorescence microscopy of the bud scars showed that the vrp1 mutant is
able to generate a bipolar budding pattern as found in the wild type (Fig. 4B).
Vrp1 mutants show defects in vacuolar fusion and endocytosis
Altered polarization of the actin cytoskeleton may also impact endocytosis. To
study vacuolar morphology and endocytosis we employed the lipophilic dye FM4-64.
In a time-lapse movie we compared at the same time uptake of FM4-64 between the
vrp1 mutant and a wild-type strain expressing a GFP, which localizes to the
cytoplasm. Within 20min the dye had been taken up via endocytosis and delivered to
the vacuole in the wild type. This staining of wild type vacuoles further increased over
time. Compared to that the vrp1 mutant showed a delayed uptake and only after more
than an hour smaller vacuoles became stained (Fig. 5). A quantitative analysis on the
number of vacuoles in vrp1 and wild type cells showed a slight increase in the number
of vacuoles in the vrp1 mutant compared to the wild type. This vrp1 phenotype is thus
somewhat intermediate between the wal1 mutant and the wild type (Fig. 6).
Two hybrid analyses reveal a myosin I- Vrp1-Wal1 complex
In S. cerevisiae Vrp1 was shown to interact with the Src homology domain 3
(SH3) of the yeast type I myosin, Myo5p, and the WASP homlog Las17 (Evangelista
et al., 2000). To analyze if such a Las17-Vrp1-Myo5 complex also exists in
C. albicans we performed yeast two-hybrid analyses (Fig. 7). In this assay we found
that the C-terminal part of Vrp1 interacts strongly with the N-terminal part of Wal1
containing the WH1-B domains. Interaction of Vrp1 with full-length Wal1 protein was
somewhat weaker. Highest ß-galactosidase activity was obtained with a Wal1
fragment in which the central part of WAL1 encoding several proline-rich regions was
removed for the assay. To assay the interaction of the myosin I SH3 domain with Vrp1
we used two fragments containing the N- and C-termini of Vrp1, respectively, and a
fragment containing only the SH3-domain of Myo5. Here, the Myo5 SH3-domain
interacted strongly with at least the C-terminal part of Vrp1 (Fig. 7).
33
Discussion
In this report we have characterized the function of the C. albicans VRP1 gene for
polarized morphogenesis and endocytosis in this dimorphic human pathogen. Cell
polarization in C. albicans is important for budding, filamentation and mating. Cell
polarity establishment occurs either based on intrinsic factors (during budding) or in
response to environmental stimuli (during filamentation and mating) (Whiteway and
Bachewich, 2007). One output of polarity establishment is the polarized organization
of the actin cytoskeleton, which results in the apical positioning of cortical actin
patches and the generation of actin cables emanating from the cell apex (Smith et al.,
2001). Generation of actin cables from the emerging bud or the tip of the hypha has
been fairly well characterized. A cascade from locally activated Rho-type GTPases,
most notably Cdc42, triggers downstream effector genes, e.g. the formin Bni1, which
nucleates actin filaments (Evangelista et al., 2002; Sagot et al., 2002). Bni1 is part of a
complex termed polarisome, which in S. cerevisiae also contains Pea2, Spa2 and Bud6
(Sheu et al., 1998).
Clustered assembly of actin patches occurs at sites of polarized growth. Mutants
in S. cerevisiae and C. albicans that affect the position of actin patches, e.g. in the
LAS17/WAL1 or MYO3/5 genes, show defects in polarized growth (Li, 1997; Lechler
et al., 2000; Oberholzer et al., 2002, Walther and Wendland, 2004). Las17 and Myo3/5
have been shown to stimulate actin filament formation via the Arp2/3 complex
(Lechler et al., 2000). Mutants in these genes show defects in the assembly and
organization of the actin cytoskeleton and since the actin cytoskeleton is essential for
endocytosis in S. cerevisiae these mutants also show defects in clathrin-mediated
endocytosis (Munn, 2001; Kaksonen et al., 2003). Most of the proteins known to be
involved in endocytosis colocalize with actin patches. Thus actin patches are sites of
endocytosis (Kaksonen et al., 2005).
Deletion of S. cerevisiae VRP1 results in temperature sensitivity and
depolarization of actin patches. Specifically, actin patches do not cluster in emerging
buds (Lambert et al., 2007). We also have observed a depolarization of actin patches
to both mother and daughter cells in the C. albicans vrp1 mutant. Particularly, hyphal
morphogenesis in the vrp1 strains was inhibited - although not abolished as in wal1
cells.
34
Our two-hybrid analysis reveals that a Wal1-Vrp1-Myo5 complex may be formed in
C. albicans similarly to that identified in S. cerevisiae (Evangelista et al., 2000). This
provides a mechanistic explanation for the similar phenotypes of the wal1 and myo5
mutants observed previously. Both of these genes are activators of the Arp2/3
complex, and loss of either of these genes may be more detrimental to cells than loss
of VRP1. Consequently, the observed defects in endocytosis and vacuole formation
were less severe in the vrp1 strains compared to wal1. Interestingly, S. cerevisiae Vrp1
contains a region characterized as Hof1-trap domain, which is essential for binding the
Hof1-SH3-domain (Ren et al., 2005). A Hof1-trap domain could not be identified in
C. albicans Vrp1. Our attempts to identify a two-hybrid interaction of the C. albicans
SH3-domain of Hof1 with Vrp1 were unsuccessful, which may suggest that this
interaction is occurring either with low affinity or not at all (our unpublished results).
On the other hand, it was shown that the SH3-domain of S. cerevisiae Hof1 also
interacts with formins Bnr1 and Bni1, which could provide an alternative route for
localization of Vrp1 to sites of polarized growth and septation (Evangelista et al.,
2003). Formins and Vrp1 may share another feature: binding of profilin. Bni1 binds
via its FH1 domain to profilin. This domain includes a poly-proline stretch similar to
that found at the very N-terminus of Vrp1 homologs, which may explain
mechanistically how Vrp1 contributes to F-actin formation.
Thus our analysis contributes to our understanding of the mechanistic link of
Wal1 and Myo5 in C. albicans. With the defects in hyphal morphogenesis and
endocytosis of the vrp1 mutant strain we have identified another player partaking in
the yeast-to-hyphal switch in C. albicans.
Acknowledgement
We thank Alexander Johnson and Suzanne Noble for generously providing
reagents used in this study. This study was funded by the EU-Marie Curie Research
Training Network “Penelope”.
35
References
Aghamohammadzadeh, S. & Ayscough, K. R. (2009). Differential requirements for
actinduring yeast and mammalian endocytosis. Nat Cell Biol 11, 1039-1042.
Anderson, B. L., Boldogh, I., Evangelista, M., Boone, C., Greene, L. A. & Pon, L.
A. (1998). The Src homology domain 3 (SH3) of a yeast type I myosin, Myo5p, binds
to verprolin and is required for targeting to sites of actin polarization. J Cell Biol 141,
1357-1370.
D'Agostino, J. L. & Goode, B. L. (2005). Dissection of Arp2/3 complex actin
nucleation mechanism and distinct roles for its nucleation-promoting factors in
Saccharomyces cerevisiae. Genetics 171, 35-47.
Evangelista, M., Klebl, B. M., Tong, A. H., Webb, B. A., Leeuw, T., Leberer, E.,
Whiteway, M., Thomas, D. Y. & Boone, C. (2000). A role for myosin-I in actin
assembly through interactions with Vrp1p, Bee1p, and the Arp2/3 complex. J Cell
Biol 148, 353-362.
Evangelista, M., Pruyne, D., Amberg, D. C., Boone, C. & Bretscher, A. (2002). Formins direct Arp2/3-independent actin filament assembly to polarize cell growth in
yeast. Nat Cell Biol 4, 32-41.
Evangelista, M., Zigmond, S. & Boone, C. (2003). Formins: signaling effectors for
assembly and polarization of actin filaments. J Cell Sci 116, 2603-2611.
Franke, K., Nguyen, M., Hartl, A., Dahse, H. M., Vogl, G., Wurzner, R., Zipfel, P.
F., Kunkel, W. & Eck, R. (2006). The vesicle transport protein Vac1p is required for
virulence of Candida albicans. Microbiology 152, 3111-3121.
Gietz, R. D. & Schiestl, R. H. (2007). High-efficiency yeast transformation using the
LiAc/SS carrier DNA/PEG method. Nat Protoc 2, 31-34.
Kaksonen, M., Sun, Y. & Drubin, D. G. (2003). A pathway for association of
receptors, adaptors, and actin during endocytic internalization. Cell 115, 475-487.
Kaksonen, M., Toret, C. P. & Drubin, D. G. (2005). A modular design for the
clathrin- and actin-mediated endocytosis machinery. Cell 123, 305-320.
Lambert, A. A., Perron, M. P., Lavoie, E. & Pallotta, D. (2007). The
Saccharomyces cerevisiae Arf3 protein is involved in actin cable and cortical patch
formation. FEMS Yeast Res 7, 782-795.
Lechler, T., Shevchenko, A. & Li, R. (2000). Direct involvement of yeast type I
myosins in Cdc42-dependent actin polymerization. J Cell Biol 148, 363-373.
Li, R. (1997). Bee1, a yeast protein with homology to Wiscott-Aldrich syndrome
protein, is critical for the assembly of cortical actin cytoskeleton. J Cell Biol 136, 649-
658.
36
Machesky, L. M. (2000). The tails of two myosins. J Cell Biol 148, 219-221.
Madania, A., Dumoulin, P., Grava, S., Kitamoto, H., Scharer-Brodbeck, C.,
Soulard, A., Moreau, V. & Winsor, B. (1999). The Saccharomyces cerevisiae
homologue of human Wiskott-Aldrich syndrome protein Las17p interacts with the
Arp2/3 complex. Mol Biol Cell 10, 3521-3538.
Martin, R., Walther, A. & Wendland, J. (2005). Ras1-induced hyphal development
in Candida albicans requires the formin Bni1. Eukaryot Cell 4, 1712-1724.
Munn, A. L. (2001). Molecular requirements for the internalisation step of
endocytosis: insights from yeast. Biochim Biophys Acta 1535, 236-257.
Munn, A. L. & Thanabalu, T. (2009). Verprolin: a cool set of actin-binding sites and
some very HOT prolines. IUBMB Life 61, 707-712.
Naqvi, S. N., Zahn, R., Mitchell, D. A., Stevenson, B. J. & Munn, A. L. (1998). The
WASp homologue Las17p functions with the WIP homologue End5p/verprolin and is
essential for endocytosis in yeast. Curr Biol 8, 959-962.
Noble, S. M. & Johnson, A. D. (2005). Strains and strategies for large-scale gene
deletion studies of the diploid human fungal pathogen Candida albicans. Eukaryot Cell
4, 298-309.
Oberholzer, U., Marcil, A., Leberer, E., Thomas, D. Y. & Whiteway, M. (2002). Myosin I is required for hypha formation in Candida albicans. Eukaryot Cell 1, 213-
228.
Oberholzer, U., Iouk, T. L., Thomas, D. Y. & Whiteway, M. (2004). Functional
characterization of myosin I tail regions in Candida albicans. Eukaryot Cell 3, 1272-
1286.
Palmer, G. E., Cashmore, A. & Sturtevant, J. (2003). Candida albicans VPS11 is
required for vacuole biogenesis and germ tube formation. Eukaryot Cell 2, 411-421.
Pruyne, D. & Bretscher, A. (2000). Polarization of cell growth in yeast. J Cell Sci
113 ( Pt 4), 571-585.
Ramesh, N., Anton, I. M., Hartwig, J. H. & Geha, R. S. (1997). WIP, a protein
associated with wiskott-aldrich syndrome protein, induces actin polymerization and
redistribution in lymphoid cells. Proc Natl Acad Sci U S A 94, 14671-14676.
Reijnst, P., Jorde, S. & Wendland, J. (2010). Candida albicans SH3-domain proteins
involved in hyphal growth, cytokinesis, and vacuolar morphology. Curr Genet. in
press PMID: 20383711.
37
Ren, G., Wang, J., Brinkworth, R., Winsor, B., Kobe, B. & Munn, A. L. (2005). Verprolin cytokinesis function mediated by the Hof one trap domain. Traffic 6, 575-
593.
Rose, M. & Botstein, D. (1983). Construction and use of gene fusions to lacZ (beta-
galactosidase) that are expressed in yeast. Methods Enzymol 101, 167-180.
Sagot, I., Rodal, A. A., Moseley, J., Goode, B. L. & Pellman, D. (2002). An actin
nucleation mechanism mediated by Bni1 and profilin. Nat Cell Biol 4, 626-631.
Sheu, Y. J., Santos, B., Fortin, N., Costigan, C. & Snyder, M. (1998). Spa2p
interacts with cell polarity proteins and signaling components involved in yeast cell
morphogenesis. Mol Cell Biol 18, 4053-4069.
Smith, M. G., Swamy, S. R. & Pon, L. A. (2001). The life cycle of actin patches in
mating yeast. J Cell Sci 114, 1505-1513.
Sudbery, P., Gow, N. & Berman, J. (2004). The distinct morphogenic states of
Candida albicans. Trends Microbiol 12, 317-324.
Thrasher, A. J. & Burns S. O. (2010). WASP: a key immunological multitasker. Nat
Rev Immunol 10, 182-192.
Vaduva, G., Martinez-Quiles, N., Anton, I. M., Martin, N. C., Geha, R. S.,
Hopper, A. K. & Ramesh, N. (1999). The human WASP-interacting protein, WIP,
activates the cell polarity pathway in yeast. J Biol Chem 274, 17103-17108.
Veses, V., Richards, A. & Gow, N. A. (2008). Vacuoles and fungal biology. Curr
Opin Microbiol 11, 503-510.
Walther, A. & Wendland, J. (2003). An improved transformation protocol for the
human fungal pathogen Candida albicans. Curr Genet 42, 339-343.
Walther, A. & Wendland, J. (2004). Polarized hyphal growth in Candida albicans
requires the Wiskott-Aldrich Syndrome protein homolog Wal1p. Eukaryot Cell 3, 471-
482.
Walther, A. & Wendland, J. (2008). PCR-based gene targeting in Candida albicans.
Nat Protoc 3, 1414-1421.
Whiteway, M. & Oberholzer, U. (2004). Candida morphogenesis and host-pathogen
interactions. Curr Opin Microbiol 7, 350-357.
Whiteway, M. & Bachewich, C. (2007). Morphogenesis in Candida albicans. Annu
Rev Microbiol 61, 529-553.
38
Figure legends
Fig. 1. Alignment of fungal Vrp1-homologs. Amino acid residues corresponding to
the majority of analysed sequences are shaded. (A) The N-terminal actin-binding
sequences are boxed in all Vrp1 proteins. S. cerevisiae Vrp1 harbors non-conserved
regions with the consensus sequence „PxPSS‟ (boxed) that were shown to interact with
ScHof1.(B) Alignment of the Vrp1 C-terminal regions harbouring the conserved
Las17-binding domain. Protein information was obtained from: the Ashbya Genome
Database (http://agd.vital-it.ch/index.html); C. albicans (http://www-
sequence.stanford.edu/group/candida/index.html); Kluyveromyces lactis Vrp1 -
XP_451805; Neurospora crassa Vrp1 - XP_963859; and S. cerevisiae - AAB67263.
Fig. 2. Generation and verification of C. albicans vrp1 mutant strains. (A)
Schematic overview on the use of PCR-based gene targeting. Selectable marker genes
were amplified using primers which carry 100 bases of homology region to the VRP1
target gene. Via homologous recombination a complete ORF deletion was generated.
Diagnostic PCR was done with gene specific (G1 and G4) and marker specific (X2
and X3) primers. (B; C) Result of verification PCR on strain CAB11
(vrp1::ARG4/vrp1::HIS1) and CAB13 (vrp1::URA3/vrp1::HIS1). Ethidium-bromide
stained gel images indicate the expected bands.
Fig. 3. Characterization of vrp1 growth defects. (A) The indicated strains were
grown on Spider plates for 5d at 37°C prior to photography (top row). Microscopic
images of the colony edges show the degree of filamentation (middle row). Hyphal
formation in liquid medium was induced by using 10% serum. Images were taken after
6h of induction (bottom row). (B) Cells induced by serum were counted after 6h and
classified according to their morphology. (C) Complementation of the vrp1
filamentation defect by reintegration of VRP1.
Fig. 4. Analysis of the actin cytoskeleton and budding pattern. (A) Strains were
grown in yeast and hyphal stages, fixed by formaldehyde and stained using
rhodamine-phalloidine. Bar, 10 µm. (B) Representative images of calcoflour stained
cells.
Fig. 5. Time-lapse analysis of endocytosis of the lipophilic dye FM4-64. Wild type
cells carrying a cytoplasmic GFP-label (on the right side of each panel) were mixed
with vrp1/vrp1 cells (on the left side of each panel). Microscopy slides with wells
were filled with 0.75 ml of 0.5x YPD and 0.75 ml of 3.4% agarose. To this mixture
1µl FM4-64 (200µg/ml in DMSO) was added. Image acquisition started 10 min after
preparation of the slide for the duration of 3h with 1 image/min. Selected frames are
shown at the indicated time points. Starting with a GFP image identifying the wild
type cells followed by a brightfield image of all cells. Bar, 10 µm.
Fig. 6. Analysis of vacuolar morphology. Strains were grown overnight and then
stained with FM4-64 for 2h prior to photography.
39
Fig. 7. Two hybrid analysis. PCR-fragments carrying different domains were
combined with the DNA-binding domain or the DNA-activation domain as indicated
in the upper panel. For CaMYO5 only the core SH3-domain was used (for details see
Materials and methods section). Plasmids carrying the BD/AD pairs were transformed
in S. cerevisae and selected on –Trp/-Leu plates (lower panel). Transformant colonies
were tested by X-gal overlay and the ß-galactosidase activity was tested in triplicate.
Figure 1
Figure 2
40
Figure 3
41
42
Figure 4
43
Figure 5
Figure 6
44
Figure 7
45
PART VII
46
PART VII –
Actin dependent endocytosis is not linked to eisosomes
Patrick Reijnst, Andrea Walther, and Jürgen Wendland,*
Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, DK-2500 Valby,
Denmark
* Corresponding author: Jürgen Wendland, Carlsberg Laboratory, Yeast Biology,
Gamle Carlsberg Vej 10, DK-2000 Valby, Copenhagen, Denmark
Email: jww @crc.dk ;
Phone: +45/3327 5230;
Fax: +45/3327 4708
running title: C. albicans eisosomes
key words: endocytosis, polarized hyphal growth, PCR, pFA-plasmids, actin cytoskeleton
Abstract
Endocytosis is a highly dynamic essential process in all eukaroytic cells and is
linked to the actin cytoskeleton. Eisosomes are immobile protein complexes,
containing Pil1 and Lsp1. We analyzed the distribution and co-localization of the
actin cytoskeleton and eisosomes in Candida albicans. Pil1 and Lsp1, tagged with
GFP/yEmCherry, strictly co-localize during all growth stages. Eisosomes,
however, localized at distinct positions, not overlapping with either cortical actin
patches or the endocytosis marker protein Abp1 in yeast or the Spitzenkörper in
hyphal cells. This suggests that eisosome may only have specialized functions, yet
not a general role for clathrin-mediated actin-dependent endocytosis.
Endocytosis is required for cell surface remodelling, uptake of nutrients, and cell-
signalling (Munn, 2001). Early genetic screens have identified a link between the actin
cytoskeleton and endocytosis. Using the actin-depolymerising drug Latrunculin-A
showed that loss of filamentous actin prevents endocytosis (Aghamohammadzadeh
and Ayscough, 2009). Live cell imaging of fluorescently labelled proteins revealed the
dynamics and the timing of events at sites of endocytosis (Kaksonen et al., 2005). It
thus has been established that actin, the Arp2/3 complex and its regulators as well as
several endocytic proteins co-localize at sites of clathrin-coated pits (Merrifield 2004;
47
Yarar et al., 2005). Therefore, cortical actin patches mark sites of endocytosis
(Engqvist-Goldstein and Drubin, 2003). The plasma membrane shows a complex
organisation of proteins and lipids. Sub-compartmentalization has been shown to
occur specifically with lipid rafts and eisosomes (Lingwood and Simons, 2010;
Walther et al., 2006). Eisosomes are mainly composed of the proteins Pil1 and Lsp1.
They were reported to mark static sites of endocytosis (Walther et al., 2006).
The highly dynamic nature of endocytosis is seemingly posing a discrepancy with the
static nature of eisosomes. We, therefore, used life-cell imaging to follow the
localization of eisosomes and endocytosis markers in C. albicans making use of both
yeast and hyphal stages in this human fungal pathogen. First we identified the PIL1
(orf19.778) and LSP1 (orf19.3149) genes in C. albicans. They encode highly similar
proteins of 308 and 317 amino acids, respectively that share 79% amino acids identity
(see Supplementary Information, Fig. S1 online). We tagged PIL1 with the red
fluorescent protein Cherry and LSP1 with GFP and monitored their distribution. Both
proteins completely co-localized in yeast and hyphal cells at punctate cortical spots
marking the eisosomes in C. albicans (Fig. 1). Using time-lapse fluorescence
microscopy we could show that the cortical localisation of eisosomes was very static
in C. albicans as has been observed in S. cerevisiae (see Supplementary Information,
Fig. S2 online). Deletion of LSP1 showed no phenotype, while deletion of PIL1 could
not be achieved, indicating that PIL1 is an essential gene.
During growth, eisosomes were not found at the tip of emerging buds or at the
hyphal tip in C. albicans and using time-lapse microscopy we could show that
eisosome-free membranes are populated in a rear-to-front manner as was also
described for S. cerevisiae (Moreira et al., 2009) (see Supplementary Information,
Fig. S2 online).
The hyphal tip is a growth region of a fungal hypha. Secretion is directed to the
tip using either the actin or the microtubule cytoskeleton. A vesicle supply center,
termed Spitzenkörper, acts as a hub integrating secretory vesicles and endocytic
recycling of early endosomes (Harris, 2009). We stained the Spitzenkörper in
C. albicans hyphae and found that it does not co-localize with eisosomes (Fig. 2A).
Next we stained the cortical actin cytoskeleton in a PIL1-GFP strain to determine the
degree of overlap of eisosomes with sites of endocytosis. As observed previously, the
hyphal tip harbors a cluster of actin patches corresponding with the large amount of
48
secretion/endocytosis found in this region. Eisosomes were not present in the growing
hyphal tip. Surprisingly, we did not find any co-localization of Pil1-GFP patches with
actin patches throughout the entire hyphae (Fig. 2B). During yeast growth, actin
patches accumulate in the emerging bud. At this stage the bud is free of eisosomes.
Thus, also during yeast growth eisosomes are separated from cortical actin patches
(Fig. 2B). Since actin staining requires cell fixation we used yEmCherry-tagged Abp1
as an in vivo marker of endocytic sites. Using a strain carrying both PIL1-GFP and
ABP1-Cherry we were then able to monitor the localization of sites of endocytosis and
eisosomes in living cells at the same time. Again, we could not observe any co-
localization of eisosomes with sites of endocytosis marked by Abp1 (Fig. 2C). During
our recent functional analyses of genes involved in endocytosis in C. albicans we
characterized RVS167 and found a role in restricting actin patches to sites of polarized
growth (Reijnst et al., 2010). Deletion of rvs167 increases and depolarizes the number
of cortical actin patches in yeast and hyphal cells. Yet, even when overpopulating the
cell membrane with actin patches localization of actin and eisosomes remained distinct
(Fig. 2D). Identical results and differential localization of eisosomes from
Spitzenkörper, actin and Abp1 were obtained using a LSP1-GFP strain (see
Supplementary Information, Fig. S3 online).
Filamentous fungi share the feature of polarized hyphal growth. Both secretion
and endocytosis are strongly polarized to the hyphal tip and these processes have been
intensely studied in a number of fungal model organisms. Mutants affecting
components in either one of these processes reduce the speed of polarized growth or
result in non-polarized morphogenesis. Our studies in C. albicans have shown,
however, that the hyphal tip and the emerging bud in yeast cells are devoid of
eisosomes. Similar results of a wave-like incorporation of eisosomes in new
membrane areas were reported from S. cerevisiae (Moreira et al., 2009). Thus our
observations strongly suggests that eisosomes may have distinct roles in organizing
the cell membrane or cell wall but may not provide a major contribution for actin-
dependent endocytosis. In line with these observations are previous studies that
suggested clathrin-coated pits initiate randomly but need to be stabilized to form a site
of endocytosis (Ehrlich et al., 2004). In this respect, static sites marked by eisosomes
may not match the highly dynamic process of endocytosis or polarized morphogenesis
as a response to environmental stimuli. Nevertheless, eisosomes do have a conserved
49
essential function since PIL1 is not only an essential gene in C. albicans but also in the
filamentous fungus A. gossypii (our unpublished results). Recent studies showed that
eisosome assembly is regulated by the protein kinases Pkh1 and Pkh2, which respond
to sphingolipid signalling. Furthermore, deletion of either PIL1 or LSP1 resulted in
strains that were more resistant to heat stress suggesting a function of eisosomes in cell
wall integrity (Walther et al., 2007; Luo et al., 2008).
Material and methods
Strains and media
The C. albicans strains used and generated in this study are listed in Table S1.
(see Supplementary Information, Tab. S1 online). Generally, at least two independent
transformants were generated for each desired genetic manipulation. Strains were
grown either in yeast extract–peptone–dextrose (YPD; 1% yeast extract, 2% peptone,
2% dextrose) or in defined minimal media [CSM; complete supplement mixture;
6.7g/l yeast nitrogen base (YNB) with ammonium sulphate and without amino acids;
0.69g/l CSM; 20g/l glucose] with the addition of required amino acids and uridine.
Strains were generally grown at 30°C to keep them in the yeast phase; hyphal
induction of C. albicans cells was done at 37°C with the addition of 10% serum to the
growth medium. Escherichia coli strain DH5α was used for pFA-plasmid propagation.
Transformation and strain construction
C. albicans was transformed by the lithium acetate procedure using standard
PCR-based gene targeting tools and pFA-plasmids (Walther and Wendland, 2003;
Gietz and Schiestl, 2007, Walther and Wendland, 2008). Primers were obtained from
biomers.net GmbH (Ulm, Germany) and primer sequences are listed in Table S2 (see
Supplementary Information, Tab. S2 online). For strains tagged with GFP or
yEmCherry the same results were observed whether the second untagged allele was
deleted or not (in otherwise wild-type strains).
50
Plasmid constructs
Plasmid pFA-yEmCherry-CaHIS1 was constructed by amplifying yEmCherry
from pRS316 GAP-yEmCherry (Keppler-Ross et al., 2008) using primers #4266 and
#4267 and replacing GFP by cloning the restricted yEMCherry PCR-fragment into the
BsiWI/AscI sites of pFA-GFP-CaHIS1.
Microscopy and staining procedures
Brightfield and epifluorescence microscopy was done as described previously
(Reijnst et al., 2010). Imaging of yEmCherry-localization was done using the same
filter as for FM4-64.
Acknowledgement
We thank Alexander Johnson and Suzanne Noble for generously providing
reagents used in this study. This study was funded by the EU-Marie Curie Research
Training Network “Penelope”.
References 1. Munn, A.L. Biochim Biophys Acta 1535, 236-257 (2001).
2. Aghamohammadzadeh, S. & Ayscough, K.R. Nat Cell Biol 11, 1039-1042 (2009).
3. Ehrlich, M. et al. Cell 118, 591-605 (2004).
4. Engqvist-Goldstein, A.E. & Drubin, D.G. Annu Rev Cell Dev Biol 19, 287-332 (2003).
5. Gietz, R.D. & Schiestl, R.H. Nat Protoc 2, 31-34 (2007).
6. Harris, S.D. Mol Microbiol 73, 733-736 (2009).
7. Kaksonen, M., Toret, C.P. & Drubin, D.G. Cell 123, 305-320 (2005).
8. Keppler-Ross, S., Noffz, C. & Dean, N. Genetics 179, 705-710 (2008).
9. Lingwood, D. & Simons, K. Science 327, 46-50 (2010).
10. Luo, G., Gruhler, A., Liu, Y., Jensen, O.N. & Dickson, R.C. J Biol Chem 283, 10433-
10444 (2008).
11. Merrifield, C.J. Trends Cell Biol 14, 352-358 (2004).
12. Moreira, K.E., Walther, T.C., Aguilar, P.S. & Walter, P. Mol Biol Cell 20, 809-818
(2009).
13. Noble, S.M. & Johnson, A.D. Eukaryot Cell 4, 298-309 (2005).
14. Reijnst, P., Walther, A. & Wendland, J. FEMS Yeast Res (2010).
15. Walther, A. & Wendland, J. Nat Protoc 3, 1414-1421 (2008).
16. Walther, A. & Wendland, J. Curr Genet 42, 339-343 (2003).
17. Walther, T.C. et al. EMBO J 26, 4946-4955 (2007).
18. Walther, T.C. et al. Nature 439, 998-1003 (2006).
19. Yarar, D., Waterman-Storer, C.M. & Schmid, S.L. Mol Biol Cell 16, 964-975 (2005).
51
Supplementary Information, Table 1: C. albicans strains used in this study
Strain a Genotype Source
SN148 arg4/arg4, leu2/leu2, his1/his1 ura3/ura3 Noble and
Johnson, 2005
CAP018 rvs167-1::CdHIS1/rvs167-1::URA3, arg4, leu2 Reijnst et al.,
2010
CAP169 PIL1/pil1::CdHIS1, leu2, ura3, arg4 This study
CAP170 PIL1/pil1::URA3, his1, leu2, arg4 This study
CAP171 LSP1/lsp1::CdHIS1, leu2, ura3, arg4 This study
CAP172 LSP1/lsp1::URA3, his1, leu2, arg4 This study
CAP174 PIL1-GFP-URA3/PIL1, his1, leu2, arg4 This study
CAP175 PIL1-GFP-HIS1/pil1::URA3, leu2, arg4 This study
CAP177 LSP1-GFP-URA3/LSP1, his1, leu2, arg4 This study
CAP178 LSP1-GFP-URA3, lsp1::CdHIS1, leu2, arg4 This study
CAP179 lsp1::CdHIS1/lsp1::URA3, leu2, arg4 This study
CAP180 lsp1::URA3/lsp1::CdHIS1, leu2, arg4 This study
CAP186 PIL1-GFP-HIS1/pil1::URA3,LSP1/lsp1::ARG4, leu2 This study
CAP197 PIL1-GFP-HIS1/pil1::URA3,
lsp1::ARG4/lsp1::CmLEU2
This study
CAP215 PIL1/PIL1-GFP-URA3,ABP1/ABP1-yEmCherry-HIS1,
leu2, arg4 This study
CAP216 LSP1/LSP1-GFP-URA3,
ABP1/ABP1-yEmCherry-HIS1, leu2, arg4
This study
CAP217 rvs167::CdHIS1/rvs167::URA3, LSP1/LSP1-MoGFP-
CmLEU2, arg4 This study
CAP219 PIL1-GFP-URA3/PIL1,LSP1-yEmCherry-HIS1/LSP1,
leu2, arg4 This study
CAP220 LSP1-GFP-URA3/LSP1, PIL1-yEmCherry-HIS1/PIL1,
leu2, arg4 This study
a All CAxxxx strains are derivates of SN148.
52
Supplementary Information, Table 2 Primers used in this study
Gene a Primer name and sequence
b
CaPIL1 #4145: S1-CaPIL1:
CCTTTTAGATGGAAAAAAAATAGCAATGATTAATTGAGATAA
TGGAGGAAAAATTTATTGATCAATCACAAAGTACACAACAGA
AAATAGCAACAGATTTgaagcttcgtacgctgcaggtc
CaPIL1 #4146: S2-CaPIL1:
GAAATTGAACGAAGACGAGGAGGATGGATGAATGAATCCACG
TAACTGGAATTAAAACAAAATCATACTAATGACAAAAATGAA
CAATCGAATAGAATCTtctgatatcatcgatgaattcgag
CaPIL1 #4147: G1-CaPIL1: CGGAAAGACTGGCCACATTTGC
CaPIL1 #4148: G4-CaPIL1: GTCCTTTCTTTCTTTCTTTCG
CaPIL1 #4149: I1-CaPIL1: GCCACTGGCCCAGAATTGTC
CaPIL1 #4150: I2-CaPIL1: GGCTTTACAGTAACCAGCAATC
CaPIL1 #4151: S1-CaPIL1-GFP:
TCAAGAATATGATGAAGATGAACTTGAACACGAACACGGTGA
AATTGATGATGCTGCTCAAGAAGAATTCAACAAACACGATGA
AAATGTTGAACACCAAggtgctggcgcaggtgcttc
CaPIL1 #4152: G1-CaPIL1-GFP: GATTGCTGGTTACTGTAAAGCC
CaLSP1 #4153: S1-CaLSP1:
GAGAGAGATTGGACGCCCCAATCAACCACTCCTGTTTCCTTCT
TCTTCTTCCCCCTCCTTCCTTCCTTTTTTTTTTTCTTTCTTTCTTC
TTCTTCTTCTTgaagcttcgtacgctgcaggtc
CaLSP1 #4154: S2-CaLSP1:
GCTATTAATGTTGCTGCTATCAACTGTTAAATATATATATATA
AAAAAAGGATAGACAAGTTAAGATAAGATAAGATAGATATGT
AAGAAAGCAAAAGATtctgatatcatcgatgaattcgag
CaLSP1 #4155: G1-CaLSP1: CGGGAACCACCCACTCTCAC
CaLSP1 #4156: G4-CaLSP1: GGCACTAACCAAAACCTCAG
CaLSP1 #4157: I1-CaLSP1: GATCAATTGAAATCACTTCTCG
CaLSP1 #4158: I2-CaLSP1: GCTTCATAACCGTCATAAGCTG
CaLSP1 #4159: S1-CaLSP1-GFP:
TTTAGAAGGTGCTTATGAAGATGATGAATTGGCTAATGAAGCT
53
GAAAATTTAAGAATTGCTGAAAAAGATTTTGATGAAGTTGAA
GCTAAAATTGCTGCTggtgctggcgcaggtgcttc
CaLSP1 #4160: G1-CaLSP1-GFP: CAGCTTATGACGGTTATGAAGC
CaABP1 #778: S2-CaABP1:
AAAACAGTAATCCCTGAAAGCTGGCTATAGCACCAATTTATCT
TTTCTTTGTATTTATATTATAGATTCATATAAAAAAAAAACGA
ATATTGTTTATACTAAATtctgatatcatcgatgaattcgag
CaABP1 #780: G4-CaABP1: GACAACATTGGTGTAGAGATCG
CaABP1 #835: S1-GFP-CaABP1:
TGTTGAAATCGAATTTGTTGACGATGATTGGTGGCAAGGAAA
ACATTCCAAGACAGGAGAAGTCGGATTGTTCCCTGCTAACTAT
GTTGTCTTGAATGAGggtgctggcgcaggtgcttc
yEmCherry #4266: 5' yEmCherry:
GATTACCAcgtacgctgcagGGTGCTGGCGCAGGTGCTTCTGTTTCA
AAAGGTGAAGAAG
yEmCherry #4267: 3' yEmCherry:
AGGATTTAggcgcgccTTATTTATATAATTCATCCA
CaURA3 #600: U2: GTGTTACGAATCAATGGCACTACAGC
CaURA3 #599: U3: GGAGTTGGATTAGATGATAAAGGTGATGG
CdHIS1 #1432: H2: TCTAAACTGTATATCGGCACCGCTC
CdHIS1 #1433: H3: GCTGGCGCAACAGATATATTGGTGC
CmLEU2 #1742: L2: GGTAAGGAGTGGCAGCTTCAATTGC
CmLEU2 #1743: L3: GCTGAAGCTTTAGAAGAAGCCGTG
CaARG4 #710: R2: AATGGATCAGTGGCACCGGTG
CaARG4 #874: R3: GGATATGTTGGCTACTGATTTAGC
54
Figure legends
Fig. 1. Co-localization of Pil1 and Lsp1 mark eisosomes in C. albicans. Cells of a
strain carrying yEmCherry-tagged Pil1 and GFP-tagged Lsp1 were grown in yeast and
hyphal stages. Fluorescent microscopy using distinct filter combinations to discern
either red or green fluorescence were used. In the overlay yellow colour indicates
overlapping signals from both proteins. DIC, brightfield image; bars represent 5µm.
Fig. 2. Eisosomes do not colocalize with the Spitzenkörper or markers for
endocytosis. Cells of a PIL1-GFP tagged strain were grown in yeast and hyphal
stages. Localization of Pil1-GFP was compared with the Spitzenkörper (A), the actin
cytoskeleton (B), Abp1-yEmCherry (C), and with the actin cytoskeleton in the rvs167
mutant background (D).
Fig. S1. Sequence comparison of eisosome proteins. (A) Alignment of fungal Pil1
and Lsp1 proteins. Pil1 and Lsp1 proteins (also using their systematic name as
identifier) were retrieved from public databases. Alignment was done using
DNASTAR Clustal W. Amino acids matching the majority of aligned sequences are
shaded. (B) Comparison of amino acids sequence identity of Pil1 and Lsp1 proteins.
Abbreviations used: Ca: Candida albicans; Sc: Saccharomyces cerevisiae; Ag:
Ashbya gossypii; Kl: Kluyveromyces lactis; Sp: Schizosaccharomyces pombe.
Fig. S2. In vivo analysis of eisosome distribution during budding growth . Cells of
strain CAP178 (LSP1-GFP-URA3/lsp1::CdHIS1) were used time lapse microscopy. A
series of images is shown capturing bud emergence and bud growth of C. albicans
yeast cells and the localization of eisosomes.
Fig. S3. Eisosomes do not colocalize with the Spitzenkörper or markers for
endocytosis. Cells of a LSP1-GFP tagged strain were grown in yeast and hyphal
stages. Localization of Lsp1-GFP was compared with the Spitzenkörper (A), the actin
cytoskeleton (B), and with the endocytosis marker protein Abp1-yEmCherry (C). For
actin-staining cells were fixed using formaldehyde.
55
Figure 1
Figure 2
56
57
Figure S1
Figure S2
58
Figure S3
59
PART VIII – Final Discussion
Sla1 and Rvs167 in C. albicans are involved in actin patch
morphogenesis
I chose to analyze 12 genes coding for SH3 domain-proteins in C. albicans that
were uncharacterized for their involvement in endocytosis. The function of many of
these proteins has been established in S. cerevisiae, but due to its lack of a true
filamentous growth form, studying these genes in filamentous fungi might reveal new
functions and interactions that are hard or impossible to see in S. cerevisiae. Sla1 and
Rvs167 are two proteins that have been described to be involved in actin-mediated
endocytosis. Sla1 is one of the first proteins to appear at sites of endocytosis and
recruits several other members of the complex that begins to internalize the future
endosome. Rvs167 on the other hand is one of the late acting components during the
internalization of the membrane, acting as a scissor protein which releases the actin-
coated vesicle for further transport along actin cables (Kaksonen et al., 2005).
Deletion of these two genes in S. cerevisiae results in two opposite phenotypes; Scsla1
mutants have only a few and large actin patches (Holtzman et al., 1993) while
Scrvs167 mutants show abundant and depolarized actin patches (Bauer et al., 1993).
Since actin patches are faithful markers of endocytosis, deleting these genes in
C. albicans could potentially result in reduced or abolished hyphal growth. Deleting
SLA1 and RVS167 in C. albicans resulted in similar defects in actin patch
morphogenesis compared to the deletion of SLA1 and RVS167 in S. cerevisiae. The
ability to form hyphae was not abolished by deleting either one of the genes, but the
ability to filament was reduced as seen by slower elongation of the germ tube. The
reduced growth was obvious when comparing the mutant strains with the wild type
after different time points during similar growth conditions.
CaSla1 contains 3 SH3 domains located at the N-terminus and CaRvs167 contains
one SH3 domain located at the C-terminus of the respective proteins. The SH3
domains of Sla1 in S. cerevisiae are essential for its function in organizing the actin
cytoskeleton, in particular domain #3. By reinserting different truncated versions of
ScSLA1 in the Scsla1 mutant, it could be shown that the third SH3 domain, together
with the region separating the first two SH3 domains from the third SH3 domain, are
60
essential for correct function of ScSla1 (Ayscough et al., 1999). Intriguingly, the
situation is reversed in C. albicans. A mutant with truncated CaSla1 lacking only the
first two SH3 domains (CaSla1ΔSH3#1-2
) shows a null mutant phenotype, while a
truncated CaSla1 containing only the first two SH3 domains is still able to retain
partial function.
The C-terminus of Sla1 in S. cerevisiae interacts with ScEnd3 and ScPan1 (Tang
et al., 2000) and is required for cortical localization of ScSla1 (Warren et al., 2002).
CaSla1ΔSH3#1-2
has a localization similar to wild type CaSla1, suggesting that the
C-terminus of CaSla1 interacts in the same manner as ScSla1. The role of the SH3
domain in CaRvs167 was not investigated. However, it is known that the SH3 domain
of ScRsv167 interacts with the proline rich region of ScLAS17 (Drees et al., 2001).
Furthermore, Rvs167 in S. cerevisiae likely binds to actin through its BAR domain
(Peter et al., 2004). Given the high similarity between CaRvs167 and ScRvs167
(62.5% identity, ClustalW) and the similar phenotype displayed by the deletion
mutants in each species, it is likely the BAR and SH3 domains in Rvs167 have a
conserved function in C. albicans. The SH3 domain in RVS167 is located at the
C terminus and one way to investigate the role of the SH3 domain would be to
generate a mutant expressing a truncated RVS167 lacking the SH3 domain. A
collaborating group is currently performing two-hybrid assays to determine the
binding partners of all SH3 domains in C. albicans, and this could then confirm an
interaction between RVS167 and the ScLAS17 homolog WAL1 in C. albicans.
Boi2 and Nbp2 in C. albicans are required for vacuolar fusion
Analysis in S. cerevisiae, A. gossypii and S. pombe has shown that Boi2 is
involved in cell polarity. Deleting BOI2 in A. gossypii shows the most severe
phenotype, with occasional swelling at the region of polarized growth, but the
importance of BOI2 is more evident in S. pombe where it is an essential gene (Bender
et al., 1996; Matsui et al., 1996; Knechtle et al., 2006; Toya et al., 1999). Intriguingly,
Boi2 appears to have a very different function in C. albicans. Caboi2 mutants are wild
type-like when grown at 30 °C, and show no altered filamentous growth when induced
at 37 °C with the addition of serum. However, staining the mutants with the lipophilic
dye FM4-64 reveals that no large vacuoles are present in the germ cell or in the
hyphae. In a wild type strain, a large vacuole is usually formed after 1 h during both
61
yeast and hyphal growth. It has been shown that mutants unable to form large vacuoles
are not able to form mature hyphae and that a correct vacuolar morphogenesis
pathway may be required for filamentous growth (Palmer et al., 2003; 2005).
C. albicans mutants with defects in vacuole inheritance have also been shown to have
defects in hyphal growth and branching (Veses et al., 2009). It is therefore very
interesting that hyphal formation in Caboi2 remains unaffected. What is more
fascinating is that this phenotype is only visible during filamentous growth as Caboi2
during yeast growth is wild type-like and is able to form a large vacuole. By using a
MAL2p-controlled BOI2 strain, fragmented vacuoles appear only when grown under
repressive conditions. These results show that BOI2 appears to have a novel function
in C. albicans different from its function in cell polarity as has been described in other
fungi. Equally surprising is that deleting NBP2 in C. albicans also resulted in
fragmented vacuoles. Similarly to Caboi2, Canbp2 mutants only show fragmented
vacuoles during filamentous growth. Thus, loss of BOI2 and NBP2 shows an apparent
phenotype only during filamentous growth and may be involved in the transport or
fusion of vacuoles. However, while Caboi2 forms hyphae indistinguishably from the
wild type, Canbp2 mutants clearly have a filamentous growth defect. Canbp2 mutants
exhibit a delayed germ tube formation compared to the wild type, and most cells will
have additionally 2 or more germ tubes emanating from the germ cell after 3 hours of
incubation. The elongation delay in the initial germ tube could thus be a result of
redirection of resources to 2-3 germ tubes instead of only one.
Based on the phenotype of the corresponding deletion strains, NBP2 and BOI2 in
C. albicans clearly have different functions coupled to vacuolar fusion and defects in
vacuolar morphology are not enough to abolish or retard filamentous growth as has
been previously suggested. Finally, Nbp2 in S. cerevisiae is involved in the HOG
pathway and Scnbp2 mutants are sensitive to growth at high temperatures and
sensitive to calcofluor white, but growth of Canbp2 mutants was unaffected when
tested for sensitivity against high temperature, salt- and sorbitol concentrations.
Localization studies of Boi2 and Nbp2 in C. albicans may help in further
understanding the function of these proteins.
62
CaCYK3 is an essential gene required for cytokinesis
Cytokinesis in S. cerevisiae is preceded by a ring of type II myosin (Myo1)
located at the budding site in late G1 phase, followed by recruitment of actin. Among
the last proteins to be recruited to the bud site before cytokinesis is Cyk3. The function
of Cyk3 in S. cerevisiae remains unknown. Deletion of CYK3 in S. cerevisiae only
causes a mild defect in cytokinesis. ScCYK3 is synthetically lethal with ScMYO1 and
ScHOF1. ScCYK3 may therefore promote cytokinesis through an actin-myosin-ring
independent pathway (Korinek et al., 2000). In contrast, CYK3 is an essential gene in
C. albicans. Similarly to ScCyk3, CaCyk3 localizes to the bud neck in large budding
cells prior to cytokinesis. To investigate the result of Cyk3 depletion in C. albicans,
CaCYK3 was put under the inducible promoter MET3p. When grown under repressive
conditions, MET3p-CYK3/cyk3 mutants showed severe defects in cytokinesis
terminating with large elongated cells, abnormal chitin deposition and possibly the
loss of cell wall integrity. It is not known whether HOF1 and MYO1 are essential
genes in C. albicans. Insertional mutagenesis using UAU1-cassettes in C. albicans
revealed that such a Cahof1 strain is viable. The two CaSLA1 insertion mutants
generated in this study showed different phenotypes depending on the site of
integration of the UAU1-cassette. Thus a complete deletion of the CaHOF1 ORF is
necessary to prove it is not essential. Perhaps C. albicans is less versatile than
S. cerevisiae by lacking a suggested actin-myosin-ring independent pathway.
Alternatively, deletion of CYK3 in C. albicans may not be readily complemented by
other genes as it appears to be the case in S. cerevisiae. Overall, the different genes
involved in cytokinesis have been much less well studied in C. albicans compared to
S. cerevisiae, and future research will probably unfold the key differences between
these organisms.
Eisosomes are not required for actin dependent endocytosis
Eisosomes have so far only been reported in S. cerevisiae and are described as
large immobile complexes that mark future sites of endocytosis (from the Greek „eis‟,
meaning into or portal, and „soma‟, meaning body). They mainly consist of Pil1 and
Lsp1 and co-localize with the membrane-bound protein Sur7 in a dot-like manner with
a ubiquitous distribution. Deletion of LSP1 in S. cerevisiae does not lead to a different
phenotype compared to the wild type, while deletion of PIL1 leads to clustering of
63
eisosome remnants and an aberrant cell membrane. Eisosomes were found to co-
localize with all FM4-64 uptake (Walther et al., 2006).
It is generally agreed on that the main site of endocytosis in growing hyphae is
located at the hyphal tip. A majority of the actin patches localize to the tip, just below
the Spitzenkörper, a structure which drives the hyphal extension. I originally intended
to investigate the role of eisosomes in C. albicans and how deletion strains of PIL1
and LSP1 would affect the localization and function of known proteins involved in
endocytosis, e. g. Abp1 and Sla1. Deletion of LSP1 in C. albicans did not result in a
phenotype different from the wild type during all growth stages; actin patch
distribution, vacuolar morphology and filamentous growth remained normal. Despite
several attempts to delete PIL1 in C. albicans a deletion mutant could not be generated
without also generating a triplication of the PIL1 gene. Thus CaPIL1 is likely
essential, and therefore Pil1 is probably also the main regulator of eisosomes in
C. albicans. The reason why CaPil1 is essential but not CaLsp1 is unknown. Pil1 and
Lsp1 share a high similarity (72% identity in S. cerevisiae and 79% identity in
C. albicans, ClustalW) where the C-terminus contains the most variation. To
investigate how a shut-down of PIL1 expression would affect the cell, mutants were
generated with one copy of PIL1 deleted and the remaining copy under the regulation
of the inducible promoters MET3p or MAL2p. Unfortunately none of the strains
generated were affected when grown under repressive conditions. Why none of the
promoter constructs worked was not investigated any further. It is possible that using
the TET (tetracycline) promoter to regulate the expression of CaPIL1 will give better
results. The TET promoter is highly specific to tetracycline and can be used to
efficiently shut-down gene expression, compared to the possible leakiness that can
occur when using the MAL2 promoter and MET3 promoter (Nakayama et al., 2000).
To further investigate the role of CaPil1 and CaLsp1, GFP and yEmCherry (a
form of RFP) were fused to the C-termini of both genes. To show that Pil1 and Lsp1 in
C. albicans together form the eisosome, Pil1-GFP and Lsp1- yEmCherry, and vice
versa, were visualized in the same strain and shown to fully co-localize in both yeast-
and hyphal growth. Pil1 and Lsp1 in C. albicans localize in a static dot-like pattern
across the cell membrane. The only two regions where eisosomes are not found are at
areas of growth, i.e. the bud tip/hyphal tip, and the septa in hyphae. Localization
studies showed that eisosomes do not co-localize with actin patches, Abp1 or the
64
Spitzenkörper in C. albicans. This discovery is very interesting because it contradicts
the current theory regarding the function of eisosomes. Eisosomes in S. cerevisiae co-
localize with all FM4-64 uptake yet in C. albicans they do not co-localize with three
well documented markers for endocytosis. Therefore, if eisosomes indeed are
endocytic portals they must mediate another type of endocytosis different from actin-
mediated endocytosis. Alternatively, eisosomes have a different unreported function.
Eisosomes are static complexes, so it is unlikely they are involved in the transport of
vesicles. The presence of eisosomes could inhibit actin-mediated endocytosis, thereby
directing it to the hyphal tip. If eisosomes block actin-mediated endocytosis, a hypha
devoid of eisosomes could potentially initiate endocytosis at random locations along
the hypha. Studies using a C. albicans mutant strain with eisosome clusters show that
actin is polarized to the hyphal tip, yet FM4-64 uptake occurs nearby the eisosome
clusters in the yeast growth (see section below). Though the role of eisosomes remains
unclear, its importance is obvious since PIL1 is essential in C. albicans.
The final conclusion is that the term “eisosome” is misleading as they are clearly
not portals for endocytosis. However, the phenotypes observed when the eisosomes
are disrupted indicate that they do have a role in endocytosis which is yet to be
revealed.
Summary
My analysis of genes coding for SH3 domain proteins support the current
evidence that the general processes during endocytosis are conserved between
C. albicans and S. cerevisiae and that SH3 domains are important for some of the
stages. CaBoi2 and CaNbp2 are involved in vacuolar fusion and thus have a novel
function. CaCyk3 was found to have a similar function compare to the ortholog in
S. cerevisiae but it essential. The function and interaction of CaSla1 and CaRvs167 are
likely conserved but the SH3 domains of CaSla1 show evolutionary divergence.
I have shown that Pil1 and Lsp1 form the eisosome in C. albicans. While CaLsp1
is dispensable for the function of eisosomes, CaPil1 in contrast is essential. Eisosomes
in C. albicans do not co-localize with several markers for endocytosis and this
contradicts published data claiming that eisosomes mark the site of endocytosis.
65
PART IX – REFERENCE LIST
Adams, A.E. and Pringle, J.R. (1984) Relationship of actin and tubulin distribution to bud growth in
wild-type and morphogenetic-mutant Saccharomyces cerevisiae. J Cell Biol 98:934-45.
Alvarez, F.J., Douglas, L.M., Rosebrock, A. and Konopka, J.B. (2008) The Sur7 protein regulates
plasma membrane organization and prevents intracellular cell wall growth in Candida albicans. Mol
Biol Cell 19:5214-25.
Anderson, J.M. and Soll D.R. (1986) Differences in Actin Localization during Bud and Hypha
Formation in the Yeast Candida albicans. J Gen Microbiol 132:2035-47.
Ayscough, K., Eby, J., Lila, T., Dewar, H., Kozminski, K. and Drubin, D. (1999) Sla1p is a functionally
modular component of the yeast cortical actin cytoskeleton required for correct localization of both
Rho1p-GTPase and Sla2p, a protein with talin homology. Mol Biol Cell 10:1061-1075.
Bauer, F., Urdaci, M., Aigle, M. and Crouzet, M. (1993) Alteration of a yeast SH3 protein leads to
conditional viability with defects in cytoskeletal and budding patterns Mol Cell Biol 13:5070-84.
Bi, E., Maddox, P., Lew, D.J., Salmon, E.D., McMillan, J.N., Yeh, E., Pringle, J.R. (1998) Involvement
of an Actomyosin Contractile Ring in Saccharomyces cerevisiae Cytokinesis. J Cell Biol 142:1301-12.
Bilodeau, P.S., Urbanowski, J.L., Winistorfer, S.C. and Piper, R.C. (2002) The Vps27p Hse1p complex
binds ubiquitin and mediates endosomal protein sorting. Nat Cell Biol 4:534-9.
Bretscher, A. (2003) Polarized growth and organelle segregation in yeast: the tracks, motors, and
receptors. J Cell Biol 160:811-6.
Chu, D.S., Pishvaee, B. and Payne, G.S. (1996) The light chain subunit is required for clathrin function
in Saccharomyces cerevisiae. J Biol Chem 271:33123-30.
Crampin, H., Finley, K., Gerami-Nejad, M., Court, H., Gale, C., Berman, J. and Sudbery, P. (2005)
Candida albicans hyphae have a Spitzenkörper that is distinct from the polarisome found in yeast and
pseudohyphae. J Cell Sci 118:2935-47.
Cullen,P.J. and Sprague, G.F. Jr. (2002) The Glc7p-interacting protein Bud14p attenuates polarized
growth, pheromone response, and filamentous growth in Saccharomyces cerevisiae. Eukaryot Cell
1:884-94.
Derkatch, I.L., Bradley, M.E., Hong, J.Y. and Liebman, S.W. (2001) Prions affect the appearance of
other prions: the story of [PIN(+)]. Cell 106:171-82
Dramsi, S. and Cossart, P. (1998) Intracellular pathogens and the actin cytoskeleton. Annu Rev Cell Dev
Biol 14:137-66.
Drees, B.L., Sundin, B., Brazeau, E., Caviston, J.P., Chen, G.C., Guo, W., Kozminski, K.G., Lau,
M.W., Moskow, J.J., Tong, A., Schenkman, L.R., McKenzie, A, 3rd, Brennwald, P., Longtine, M., Bi,
E., Chan, C., Novick, P., Boone, C., Pringle, J.R., Davis, T.N., Fields, S. and Drubin, D.G. (2001) A
protein interaction map for cell polarity development. J Cell Biol 154:549-71.
Dünkler, A. and Wendland, J. (2007) Candida albicans Rho-type GTPase-encoding genes required for
polarized cell growth and cell separation. Eukaryot Cell 6:844-54.
Evangelista, M., Pruyne, D., Amberg, D.C., Boone, C. and Bretscher, A. (2002) Formins direct Arp2/3-
independent actin filament assembly to polarize cell growth in yeast. Nat Cell Biol 4:32-41.
66
Field, C., Li, R. and Oegema, K. (1999) Cytokinesis in eukaryotes: a mechanistic comparison. Curr
Opin Cell Biol 11:68-80.
Forche, A., Alby, K., Schaefer, D., Johnson, A.D., Berman, J. and Bennett, R.J. (2008) The parasexual
cycle in Candida albicans provides an alternative pathway to meiosis for the formation of recombinant
strains. PLoS Biol 6:e110.
Fonzi, W.A. and Irwin, M.Y. (1993) Isogenic strain construction and gene mapping in Candida
albicans. Genetics 134:717-28.
Giardini, P.A., Fletcher, D.A. and Theriot, J.A. (2003) Compression forces generated by actin comet
tails on lipid vesicles. Proc Natl Acad Sci U S A 100:6493-8
Gola, S., Martin, R., Walther, A., Dünkler, A. and Wendland, J. (2003) New modules for PCR-based
gene targeting in Candida albicans: rapid and efficient gene targeting using 100 bp of flanking
homology region. Yeast 20:1339-47.
Gow, N.A., Brown, A.J. and Odds, F.C. (2002) Fungal morphogenesis and host invasion. Curr Opin
Microbiol 5:366-71.
Hallett, M.A., Lo, H.S. and Bender, A. (2002) Probing the importance and potential roles of the binding
of the PH-domain proteinBoi1 to acidic phospholipids. BMC Cell Biol 3:16.
Hawser, S.P., Baillie, G.S. and Douglas, L.J. (1998) Production of extracellular matrix by Candida
albicans biofilms. J Med Microbiol 47: 253-256.
Hicke, L. (1999) Gettin' down with ubiquitin: turning off cell-surface receptors, transporters and
channels. Trends Cell Biol 9:107-12.
Holtzman, D. A., Yang, S. and Drubin, D. G. (1993) Synthetic-lethal interactions identify two novel
genes, SLA1 and SLA2, that control membrane cytoskeleton assembly in Saccharomyces cerevisiae.
J Cell Biol 122: 635-644.
Howard, J.P., Hutton, J.L., Olson, J.M. and Payne, G.S. (2002) Sla1p serves as the targeting signal
recognition factor for NPFX(1,2)D-mediated endocytosis. J Cell Biol 157:315-26
Huang, G., Wang, H., Chou, S., Nie, X., Chen, J. and Liu, H. (2006) Bistable expression of WOR1, a
master regulator of white-opaque switching in Candida albicans. Proc Natl Acad Sci U S A. 103:12813-
8.
Huckaba, T.M., Gay, A.C., Pantalena, L.F., Yang, H.C. and Pon, L.A. (2004) Live cell imaging of the
assembly, disassembly, and actin cable-dependent movement of endosomes and actin patches in the
budding yeast, Saccharomyces cerevisiae. J Cell Biol 167:519-30.
Hull, C.M. and Johnson, A.D. (1999) Identification of a mating type-like locus in the asexual
pathogenic yeast Candida albicans. Science 20:1271-5.
Hull, C.M., Raisner, R.M. and Johnson, A.D. (2000) Evidence for mating of the "asexual" yeast
Candida albicans in a mammalian host. Science 14:307-10.
Iwaguchi, S., Suzuki, M., Sakai, N., Nakagawa, Y., Magee, P.T. and Suzuki, T. (2004) Chromosome
translocation induced by the insertion of the URA blaster into the major repeat sequence (MRS) in
Candida albicans. Yeast 21:619-34.
Kaksonen, M., Sun, Y. and Drubin, D.G. (2003) A pathway for association of receptors, adaptors, and
actin during endocytic internalization. Cell 115:475-87.
Kaksonen, M., Toret, C.P. and Drubin, D.G. (2005) A Modular Design for the Clathrin- and Actin-
Mediated Endocytosis Machinery. Cell 123:305-20.
67
Kaksonen, M., Toret, C.P. and Drubin, D.G. (2006) Harnessing actin dynamics for clathrin-mediated
endocytosis. Nat Rev Mol Cell Biol 7:404-14.
Kilmartin, J.V. and Adams, A.E. (1984) Structural rearrangements of tubulin and actin during the cell
cycle of the yeast Saccharomyces. J Cell Biol 98:922-33.
Knaus, M., Cameroni, E., Pedruzzi, I., Tatchell, K., De Virgilio, C. and Peter, M. (2005) The Bud14p-
Glc7p complex functions as a cortical regulator of dynein in budding yeast. EMBO J 24:3000-11.
Knechtle, P., Wendland, J. and Philippsen, P. (2006) The SH3-PH domain protein AgBoi1-2
collaborates with the Rho-type GTPase AgRho3 to prevent nonpolar growth at hyphal tips of Ashbya
gossypii. Eukaryot Cell 5, 1635-47.
Korinek, W.S., Bi, E., Epp, J.A., Wang, L., Ho, J. and Chant, J. (2000) Cyk3, a novel SH3-domain
protein, affects cytokinesis in yeast. Curr Biol 10:947-50.
Kuriyana, J. and Cowburna, D. (1993) Structures of SH2 and SH3 domains. Curr Opin Struct Biol
3:828-837.
Kärkkäinen, S., Hiipakka, M., Wang, J.H., Kleino, I., Vähä-Jaakkola, M., Renkema, G.H., Liss, M.,
Wagner, R. and Saksela, K. (2006) Identification of preferred protein interactions by phage-display of
the human Src homology-3 proteome. EMBO Rep 7:186-91.
Lephart, P.R. and Magee, P.T. (2006) Effect of the major repeat sequence on mitotic recombination in
Candida albicans. Genetics 174:1737-44.
Lephart, P.R., Chibana, H. and Magee, P.T. (2005) Effect of the major repeat sequence on chromosome
loss in Candida albicans. Eukaryot Cell 4:733-41.
Li, C.R., Wang, Y.M., De Zheng, X., Liang, H.Y., Tang, J.C. and Wang, Y. (2005) The formin family
protein CaBni1p has a role in cell polarity control during both yeast and hyphal growth in Candida
albicans. J Cell Sci 118:2637-48
Lingwood, D. and Simons, K. (2010) Lipid rafts as a membrane-organizing principle. Science 327:46-
50.
Lippincott, J. and Li, R. (1998) Sequential Assembly of Myosin II, an IQGAP-like Protein, and
Filamentous Actin to a Ring Structure Involved in Budding Yeast Cytokinesis. J Cell Biol 140:355-66.
Lo, H.J., Köhler, J.R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A. and Fink, G.R. (1997)
Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-49
Lockhart, S. R., Pujol, C., Daniels, K. J., Miller, M. G., Johnson, A. D., Pfaller, M. A. & Soll, D. R.
(2002) In Candida albicans, white-opaque switchers are homozygous for mating type. Genetics 162:
737-745.
Maeda, T., Takekawa, M. and Saito, H. (1995) Activation of yeast PBS2 MAPKK by MAPKKKs or by
binding of an SH3-containing osmosensor. Science 269:554-8.
Magee, B.B. and Magee, P.T. (2000) Induction of mating in Candida albicans by construction of MTLa
and MTLalpha strains. Science 14:310-3.
Martin, A.C., Xu, X.P., Rouiller, I., Kaksonen, M., Sun, Y., Belmont, L., Volkmann, N., Hanein, D.,
Welch, M. and Drubin, D.G. (2005) Effects of Arp2 and Arp3 nucleotide-binding pocket mutations on
Arp2/3 complex function. J Cell Biol 168:315-28.
Martin R, Walther A, Wendland J. (2005) Ras1-induced hyphal development in Candida albicans
requires the formin Bni1. Eukaryot Cell 4:1712-24.
68
Martin, R., Hellwig, D., Schaub, Y., Bauer, J., Walther, A. and Wendland, J. (2007) Functional analysis
of Candida albicans genes whose Saccharomyces cerevisiae homologues are involved in endocytosis.
Yeast 24:511-22.
Mayer, B.J., Hamaguchi, M. and Hanafusa, H. (1988) A novel viral oncogene with structural similarity
to phospholipase C. Nature 332:272-5.
Mayer, B.J. and Baltimore, D. (1993) Signalling through SH2 and SH3 domains. Trends Cell Biol 3:8-
13.
Miller, M.G. and Johnson, A.D. (2002) White-opaque switching in Candida albicans is controlled by
mating-type locus homeodomain proteins and allows efficient mating. Cell 110:293-302.
Mochida, J., Yamamoto, T., Fujimura-Kamada, K. and Tanaka, K. (2002) The novel adaptor protein,
Mti1p, and Vrp1p, a homolog of Wiskott-Aldrich syndrome protein-interacting protein (WIP), may
antagonistically regulate type I myosins in Saccharomyces cerevisiae. Genetics 160:923-34.
Moreira, K.E., Walther, T.C., Aguilar, P.S. and Walter, P. (2009) Pil1 controls eisosome biogenesis.
Mol Biol Cell 20:809-18.
Morschhäuser, J., Michel, S. and Staib, P. (1999) Sequential gene disruption in Candida albicans by
FLP-mediated site-specific recombination. Mol Microbiol 32:547-56.
Morton, C.J. and Campbell, I.D. (1994) SH3 domains. Molecular 'Velcro'. Curr Biol 4:615-7.
Moseley, J.B., Goode, B.L. (2006) The yeast actin cytoskeleton: from cellular function to biochemical
mechanism. Microbiol Mol Biol Rev 70:605-45.
Naglik, J.R., Challacombe, S.J. and Hube, B. (2003) Candida albicans secreted aspartyl proteinases in
virulence and pathogenesis. Microbiol Mol Biol Rev 67:400-428.
Nakayama, H., Mio, T., Nagahashi, S., Kokado, M., Arisawa, M. and Aoki, Y. (2000) Tetracycline-
regulatable system to tightly control gene expression in the pathogenic fungus Candida albicans. Infect
Immun 68:6712-9.
Ni, L. and Snyder, M. (2001) A genomic study of the bipolar bud site selection pattern in
Saccharomyces cerevisiae. Mol Biol Cell 12:2147-70.
Nobile, C.J., Bruno, V.M., Richard, M.L., Davis, D.A. and Mitchell, A.P. (2003) Genetic control of
chlamydospore formation in Candida albicans. Microbiology 149:3629-37.
Noble, S.M. and Johnson, A.D. (2005) Strains and strategies for large-scale gene deletion studies of the
diploid human fungal pathogen Candida albicans. Eukaryot Cell 4:298–309.
Ohama, T., Suzuki, T., Mori, M., Osawa, S., Ueda, T., Watanabe, K. and Nakase, T. (1993) Non-
universal decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res 21: 4039-
4045.
Ohkuni, K., Okuda, A. and Kikuchi, A. (2003) Yeast Nap1-binding protein Nbp2p is required for
mitotic growth at high temperatures and for cell wall integrity. Genetics 165:517-29.
Olaiya, A.F. and Sogin, S.J. (1979) Ploidy determination of Canadida albicans. J Bacteriol 140:1043-9.
Palmer, G.E., Cashmore, A. and Sturtevant, J. (2003) Candida albicans VPS11 is required for vacuole
biogenesis and germ tube formation. Eukaryot Cell 2:411-21.
Palmer, G.E., Kelly, M.N. and Sturtevant, J.E. (2005) The Candida albicans vacuole is required for
differentiation and efficient macrophage killing. Eukaryot Cell 4:1677-86.
69
Payne, G.S., Baker, D., van Tuinen, E. and Schekman, R. (1988) Protein transport to the vacuole and
receptor-mediated endocytosis by clathrin heavy chain-deficient yeast. J Cell Biol 106:1453-61.
Razani, B. and Lisanti, M.P. (2001) Caveolins and caveolae: molecular and functional relationships.
Exp Cell Res 271:36-44.
Reuss, O., Vik, A., Kolter, R. and Morschhäuser, J. (2004) The SAT1 flipper, an optimized tool for
gene disruption in Candida albicans. Gene 341:119-27.
Rodal, A.A., Manning, A.L., Goode, B.L. and Drubin, D.G. (2003) Negative regulation of yeast WASp
by two SH3 domain-containing proteins. Curr Biol 13:1000-8.
Roth, A.F. and Davis, N.G. (2000) Ubiquitination of the PEST-like endocytosis signal of the yeast a-
factor receptor. J Biol Chem 275:8143-53.
Sagot, I., Klee, S.K. and Pellman, D. (2002) Yeast formins regulate cell polarity by controlling the
assembly of actin cables. Nat Cell Biol 4:42-50.
Saville, S.P., Lazzell, A.L., Monteagudo, C. and Lopez-Ribot, J.L. (2003) Engineered control of cell
morphology in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during
infection. Eukaryot Cell 2:1053-60.
Schaub, Y., Dünkler, A., Walther, A. and Wendland, J. (2006) New pFA-cassettes for PCR-based gene
manipulation in Candida albicans. J Basic Microbiol 46:416-29.
Shih, S.C., Sloper-Mould, K.E. and Hicke, L. (2000) Monoubiquitin carries a novel internalization
signal that is appended to activated receptors. EMBO J 19:187-98.
Shortle, D., Haber, J.E. and Botstein, D. (1982) Lethal disruption of the yeast actin gene by integrative
DNA transformation. Science 217:371-3.
Spellman, P.T., Sherlock, G., Zhang, M.Q., Iyer, V.R., Anders, K., Eisen, M.B., Brown, P.O., Botstein,
D. and Futcher, B. (1998) Comprehensive identification of cell cycle-regulated genes of the yeast
Saccharomyces cerevisiae by microarray hybridization. Mol Biol Cell 9:3273-97.
Srikantha, T., Borneman, A.R., Daniels, K.J., Pujol, C., Wu, W., Seringhaus, M.R., Gerstein, M., Yi, S.,
Snyder, M. and Soll D.R. (2006) TOS9 regulates white-opaque switching in Candida albicans. Eukaryot
Cell 5:1674-87.
Sudbery, P., Gow, N. and Berman, J. (2004) The distinct morphogenic states of Candida albicans.
Trends Microbiol 12:317–324.
Swanson, J.A. and Watts, C. (1995) Macropinocytosis. Trends Cell Biol 5:424-8.
Tan, P.K., Howard, J.P. and Payne, G.S. (1996) The sequence NPFXD defines a new class of
endocytosis signal in Saccharomyces cerevisiae. J Cell Biol 135:1789-800.
Trueheart, J., Boeke, J.D. and Fink, G.R. Two genes required for cell fusion during yeast conjugation:
evidence for a pheromone-induced surface protein. Mol Cell Biol 7:2316-28.
Tzung, K.W., Williams, R.M., Scherer, S., Federspiel, N., Jones, T., Hansen, N., Bivolarevic, V.,
Huizar, L., Komp, C., Surzycki, R., Tamse, R., Davis, R.W. and Agabian, N. (2001) Genomic evidence
for a complete sexual cycle in Candida albicans. Proc Natl Acad Sci U S A 98:3249-53.
Ushinsky, S.C., Harcus, D., Ash, J., Dignard, D., Marcil, A., Morchhauser, J., Thomas, D.Y.,
Whiteway, M. and Leberer, E. (2002) CDC42 is required for polarized growth in human pathogen
Candida albicans. Eukaryot Cell 1:95-104
70
Veses, V., Richards, A. and Gow, N.A. (2009) Vacuole inheritance regulates cell size and branching
frequency of Candida albicans hyphae. Mol Microbiol 71:505-19.
Whiteway, M. and Oberholzer, U. (2004) Candida morphogenesis and host-pathogen interactions. Curr
Opin Microbiol 7:350-7.
Wilson, R.B., Davis, D. and Mitchell, A.P. (1999) Rapid hypothesis testing with Candida albicans
through gene disruption with short homology regions. J Bacteriol 181:1868–1874.
Winter, D., Podtelejnikov, A.V., Mann, M., Li, R. (1997) The complex containing actin-related proteins
Arp2 and Arp3 is required for the motility and integrity of yeast actin patches. Curr Biol 7:519-29.
Wirsching, S., Michel, S. and Morschhäuser, J. (2000) Targeted gene disruption in Candida albicans
wild-type strains: the role of the MDR1 gene in fluconazole resistance of clinical Candida albicans
isolates. Mol Microbiol. 36:856-65.
Walther, A. and Wendland, J. (2004) Polarized hyphal growth in Candida albicans requires the Wiskott-
Aldrich Syndrome protein homolog Wal1p. Eukaryot Cell 3:471-82.
Walther, A. and Wendland, J. (2008) PCR-based gene targeting in Candida albicans. Nat Protoc
3:1414-21.
Walther, T.C., Brickner, J.H., Aguilar, P.S., Bernales, S., Pantoja, C. and Walter, P. (2006) Eisosomes
mark static sites of endocytosis. Nature 439:998-1003.
Wendland, J., Hellwig, D., Walther, A., Sickinger, S., Shadkchan, Y., Martin, R., Bauer, J., Osherov,
N., Tretiakov, A. and Saluz, H.P. (2006) Use of the Porcine Intestinal Epithelium (PIE)-Assay to
analyze early stages of colonization by the human fungal pathogen Candida albicans. J Basic Microbiol
46:513-23.
Young, M.E., Karpova, T.S., Brügger, B., Moschenross, D.M., Wang, G.K., Schneiter, R., Wieland,
F.T. and Cooper, J.A. (2002) The Sur7p family defines novel cortical domains in Saccharomyces
cerevisiae, affects sphingolipid metabolism, and is involved in sporulation. Mol Cell Biol 22:927-34.
Zordan, R.E., Galgoczy, D.J. and Johnson, A.D. (2006) Epigenetic properties of white-opaque
switching in Candida albicans are based on a self-sustaining transcriptional feedback loop. Proc Natl
Acad Sci U S A. 103:12807-12.
Zordan, R.E., Miller, M.G., Galgoczy, D.J., Tuch, B.B. and Johnson, A.D. (2007) Interlocking
transcriptional feedback loops control white-opaque switching in Candida albicans. PLoS Biol 5:e256.