Transcript of F tools of genetic engineering
- 1. TOOLS OF GENETIC ENGINEERING Pravin V Jadhav, PhD Assistant
Professor, Biotechnology Centre, Dr. PDKV, Akola
jpraveen26@yahoo.co.in
- 2. ONTARGET PART-I What is gene cloning? What are steps
involved in it? What are restriction enzymes? What they do?
Modifying enzymes: what functions they do have? What is DNA ligase
and polymerase? PART-II Cloning Vectors 1 2 3 4 5 1 2
- 3. ONTARGET Gene Cloning The process of inserting a piece of
DNA molecule of interest into a DNA carrier (vector) in order to
make multiple copies of the DNA of interest in a host cell such as
bacteria. Purposes of molecular cloning Separate a gene from the
other genes Amplification of modified forms of genetic materials
Manipulation of a piece of DNA for further experiments 3
- 4. ONTARGET 4 Strategy: DNA Cloning I. Recombinant DNA
Technology Restriction Enzyme DNA Ligase I. Polymerase Chain
Reaction
- 5. ONTARGET I. Recombinant DNA Technology Steps in gene cloning
Step 1 Isolation of gene Step 2 Cleave/cut Step 3 Insertion Step 4
Transformation and amplificationStep 5 Screening 5
- 6. ONTARGET Cloning 6 Requirement: Key enzymes for cutting and
joining of DNA fragments in to vector Cloning vehicles or vector
Bacterial transformation and selection of transformed cells
- 7. ONTARGET Cloning a Piece of DNA AvaI Cut plasmid vector with
AvaI AvaI AvaI 5 3 Excise DNA insert of interest from source using
Ava I Ligate the insert of interest into the cut plasmid
- 8. ONTARGET Performing the Restriction Digests You will need to
set up a restriction digest of your plasmid vector and your DNA of
interest Restriction enzymes all have specific conditions under
which they work best. Some of the conditions that must be
considered when performing restriction digest are: temperature,
salt concentration, and the purity of the DNA
- 9. ONTARGET Purify your DNA Fragments The insert of interest
that you want to clone into your plasmid needs to be separated from
the other DNA You can separate your fragment using Gel
Electrophoresis You can purify the DNA from the gel by cutting the
band out of the gel and then using a variety of techniques to
separate the DNA from the gel matrix
- 10. ONTARGET Ligation Ligation is the process of joining two
pieces of DNA from different sources together through the formation
of a covalent bond. DNA ligase is the enzyme used to catalyze this
reaction. DNA ligation requires ATP.
- 11. ONTARGET Transforming Bacteria After you create your new
plasmid construct that contains your insert of interest , you will
need to insert it into a bacterial host cell so that it can be
replicated. The process of introducing the foreign DNA into the
bacterial cell is called transformation.
- 12. ONTARGET Competent Host Cells Not every bacterial cell is
able to take up plasmid DNA. Bacterial cells that can take up DNA
from the environment are said to be competent. Can treat cells
(electrical current/divalent cations) to increase the likelihood
that DNA will be taken up Two methods for transforming: heat shock
and electroporation
- 13. ONTARGET Selecting for Transformants The transformed
bacteria cells are grown on selective media (containing antibiotic)
to select for cells that took up plasmid. For blue/white selection
to determine if the plasmid contains an insert, the transformants
are grown on plates containing X-Gal and IPTG. (See notes for slide
11.)
- 14. ONTARGET Recombinant DNA Technology Recombinant DNA (rDNA)
contains DNA from two or more different sources Requires: A vector
introduces rDNA into host cell Plasmids (small accessory rings of
DNA from bacteria) are common vectors Two enzymes are required to
introduce foreign DNA into vector DNA A restriction enzyme -
cleaves DNA, and A DNA ligase enzyme - seals DNA into an opening
created by the restriction enzyme 14
- 15. ONTARGET Drug Resistance Gene Transferred by Plasmid
Plasmid gets out and into the host cell Resistant Strain New
Resistance Strain Non-resistant Strain Plasmid Enzyme Hydrolyzing
Antibiotics Drug Resistant Gene mRNA Juang RH (2004) BCbasics
15
- 16. ONTARGET Target Genes Carried by Plasmid 1 plasmid 1 cell
Target Gene Recombination Restriction Enzyme Restriction Enzyme
ChromosomalDNA Target Genes DNA Recombination Transformation Host
Cells Juang RH (2004) BCbasics 16
- 17. ONTARGET Amplification and Screening of Target Gene 1 1
cell line, 1 colony X100 X1,000 Plasmid Duplication Bacteria
Duplication Plating Pick the colony containing target gene=100,000
Juang RH (2004) BCbasics 17
- 18. ONTARGET Key Enzyme : I. Restriction Enzyme Cuts DNA at
specific points. Cleaves vector (plasmid) and foreign (human) DNA.
Cleaving DNA makes DNA fragments ending in short single- stranded
segments with sticky ends. The sticky ends allow insertion of
foreign DNA into vector DNA. Copyright The McGraw-Hill Companies,
Inc. Permission required for reproduction or display. DNA duplex
"sticky ends" restriction enzyme A T A T A T A T A T C G C CG G C G
A T A T A T A T A T C G C CG G C G 18
- 19. ONTARGET 19
- 20. ONTARGET Key Enzyme : II. DNA Ligase Seals the foreign gene
into the vector DNA Treated cells (bacteria) take up plasmids
Bacteria and plasmids reproduce. Many copies of the plasmid and
many copies of the foreign gene. 20 Action: It acts on DNA
substrates with 5 terminal phosphate groups and form the
phosphodiester bond between two DNA sequences (vector and insert)
to join them together
- 21. ONTARGET 21
- 22. ONTARGET Animation 22
- 23. ONTARGET Amplifies a targeted sequence of DNA Create
millions of copies of a single gene or a specific piece of DNA in a
test tube Requires: DNA polymerase Withstands the temperature
necessary to separate double-stranded DNA. A supply of nucleotides
for the new, complementary strand DNA Cloning: Polymerase Chain
Reaction (PCR) 23
- 24. ONTARGET 24 PCR Copyright The McGraw-Hill Companies, Inc.
Permission required for reproduction or display. PCR cycles DNA
copies first 1 second 2 third 4 old old old strand new new new
strand DNA double strand fourth 8 fifth 16 and so forth
- 25. ONTARGET 25
- 26. ONTARGET 26
- 27. ONTARGET 27
- 28. ONTARGET Applications of PCR: Analyzing DNA Segments DNA
fingerprinting is the technique of using DNA fragment lengths Treat
DNA segment with restriction enzymes A unique collection of
different fragments is produced Gel electrophoresis separates the
fragments according to their charge/size Produces distinctive
banding pattern Usually used to measure number of repeats of short
sequences Used in paternity suits, rape cases, corpse ID, etc.
28
- 29. Restriction Endonucleases
- 30. ONTARGET What are restriction enzymes? Molecular scissors
that cut double stranded DNA molecules at specific points. Found
naturally in a wide variety of prokaryotes An important tool for
manipulating DNA. 30
- 31. ONTARGET Why Restriction Enzymes? Why would bacterial cells
contain proteins that cleave DNA at specific sequences? Generally
restriction enzymes are thought to protect bacterial cells from
phage (bacterial virus) infection. Bacterial cells that contain
restriction enzymes can cut up invasive viral DNA without damaging
their own DNA. 31
- 32. ONTARGET Discovery In 1962, Werner Arber, a Swiss
biochemist, provided the first evidence for the existence of
"molecular scissors" that could cut DNA. He showed that E. coli
bacteria have an enzymatic immune system that recognizes and
destroys foreign DNA, and modifies native DNA to prevent
self-destruction. In 1970 Smith and colleagues purified and
characterized the cleavage site of a Restriction Enzyme. Werner
Arbor, Hamilton Smith and Daniel Nathans shared the 1978 Nobel
prize for Medicine and Physiology for their discovery of
Restriction Enzymes. 32
- 33. ONTARGET Biological Role Most bacteria use Restriction
Enzymes as a defence against bacteriophages. Restriction enzymes
prevent the replication of the phage by cleaving its DNA at
specific sites. The host DNA is protected by Methylases which add
methyl groups to adenine or cytosine bases within the recognition
site thereby modifying the site and protecting the DNA. 33
Therefore, the restriction enzyme within a cell doesnt destroy its
own DNA. However the restriction enzyme can destroy foreign DNA
which enters the cell such as bacteriophage.
- 34. ONTARGET Types of Restriction Enzymes Cleavage site
Location of methylase Examples Type I Random, Recognition site is
of 15bp in length Methylate A* in rec site Cleavage site is around
1000bp away from recognition site Endonuclease and methylase
located on a single multifunctional protein molecule Require Mg++,
ATP and S- adenocyle methionine as cofactor EcoK I EcoA I CfrA I
Type II Specific palindromic sequences Within the recognition site
Simple enzymes of single polypeptide, Endonuclease and methylase
are separate entities Very stable and require only Mg+ + as
cofactor EcoR I BamH I Hind III Type III Random, non-palindromic
sequences 24-26 bp downstream of the recognition site Endonuclease
and methylase located on a single protein molecule Require Mg++
& ATP as cofactor EcoP I Hinf III EcoP15 I 34
- 35. ONTARGET Enzyme Activity
GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT Scanning
GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT Recognition
Sequence GGACGCTAGCTGATG CCTGCGATCGACTACTTAA Cleavage
AATTCGCATCGGATCCGAATCCGCTCTTTCAA GCGTAGCCTAGGCTTAGGCGAGAAAGTT
35
- 36. ONTARGET Diversity of Enzymes EcoRI Esherichia coli R
G/AATTC BamHI Baccilu amyloliquefaciens H G/GATCC HindIII
Haemophilus influenzae Rd A/AGCCT PstI Providencia stuartii CTGCA/G
PmeI Psuedomonas mendocina GTTT/AAAC 36
- 37. ONTARGET Recognition Sequences EcoRI G/AATTC BamHI G/GATCC
HindIII A/AGCCT PstI CTGCA/G PmeI GTTT/AAAC HincII GTY/RAC FunII
G/AATTC Features Palindromic Length 4 cutters, 6 cutters etc Site
of cleavage Sticky ends 3 overhang 5 overhang blunt end
Compatibility Multiple Recognition sequences Isoschisomers Type II
vs Type III RE 37
- 38. ONTARGET Restriction fragments can be blunt ended or sticky
ended 5 G A A T T C 3 5 G A T A T C 3 3 C T T A A G 5 3 C T A T A G
5 Sticky Ends Blunt Ends Sticky ends or blunt ends can be used to
join DNA fragments. Sticky ends are more cohesive compared to blunt
ends. 38
- 39. ONTARGET Recognition Sequences EcoRI G/AATTC BamHI G/GATCC
HindIII A/AGCCT PstI CTGCA/G PmeI GTTT/AAAC HincII GTY/RAC FunII
G/AATTC Features Palindromic Length 4 cutters, 6 cutters etc Site
of cleavage Sticky ends 3 overhang 5 overhang blunt end
Compatibility Multiple Recognition sequences Isoschisomers Type II
vs Type III RE 39
- 40. ONTARGET Mechanism of Action Restriction Endonuclease scan
the length of the DNA , binds to the DNA molecule when it
recognizes a specific sequence and makes one cut in each of the
sugar phosphate backbones of the double helix by hydrolyzing the
phoshphodiester bond. Specifically, the bond between the 3 O atom
and the P atom is broken. 40
- 41. ONTARGET Restriction Enzyme EcoRI Eco RI recognizes the
sequence 5.GAATTC.. A cut is made between the G and the A on each
strand. This restriction enzyme leaves the nucleotides 5AATT
overhanging. These are known as sticky ends because hydrogen bonds
are available to stick to a complimentary 3TTAA Note: Restriction
enzymes dont stop with one cut! They continue to cut at every
recognition sequence on a DNA strand. Restriction Enzyme Cut from
EcoRI 41
- 42. ONTARGET Direct hydrolysis by nucleophilic attack at the
phosphorous atom 3OH and 5 PO4 3- is produced. Mg2+ is required for
the catalytic activity of the enzyme. It holds the water molecule
in a position where it can attack the phosphoryl group and also
helps polarize the water molecule towards deprotonation . 42
- 43. ONTARGET MODIFYING ENZYMES 43
- 44. ONTARGET I. DNA polymerases III. Kinase and alkaline
phosphatase IV. Nucleases V. Topoisomerase *** Buffers and solution
conditions*** Enzymes for manipulating DNA 44
- 45. ONTARGET Enzymes used in molecular biology Alkaline
phosphatase Removes phosphate groups from 5' ends of DNA (prevents
unwanted re-ligation of cut DNA) DNA ligase Joins compatible ends
of DNA fragments (blunt/blunt or complementary cohesive ends). Uses
ATP DNA polymerase I Synthesises DNA complementary to a DNA
template in the 5'-to-3'direction. Starts from an oligonucleotide
primer with a 3' OH end Exonuclease III Digests nucleotides
progressiviely from a DNA strand in the 3' -to-5' direction
Polynucleotide kinase Adds a phosphate group to the 5' end of
double- or single- stranded DNA or RNA. Uses ATP RNase A Nuclease
which digests RNA, not DNA Taq DNA polymerase Heat-stable DNA
polymerase isolated from a thermostable microbe (Thermus aquaticus)
45
- 46. ONTARGET E. coli DNA polymerase I --the classic DNA
polymerase Moderately processive polymerase 3'->5' proof-reading
exonuclease 5'->3' strand-displacing (nick-translating)
exonuclease Used mostly for labelling DNA molecules by nick
translation. For other purposes, the Klenow fragment is usually
preferred DNA polymerases--making copies, adding labels, or fixing
DNA 46
- 47. ONTARGET Klenow fragment --the C-terminal 70% of E. coli
DNA polymerase I; originally prepared as a proteolytic fragment
(discovered by Klenow); now cloned Lacks the 5'->3' exonuclease
activity Uses include: Labeling DNA termini by filling in the
cohesive ends generated by certain restriction enzymes generation
of blunt ends DNA sequencing DNA polymerases 47
- 48. ONTARGET 48
- 49. ONTARGET A way of making blunt ended DNA (repair after
mechanical fragmentation) 49
- 50. ONTARGET A way of radiolabeling DNA 50
- 51. ONTARGET DNA polymerases Reverse transcriptase
RNA-dependent DNA polymerase Essential for making cDNA copies of
RNA transcripts Cloning intron-less genes Quantitation of RNA
51
- 52. ONTARGET DNA polymerases Native T7 DNA polymerase --highly
processive, with highly active 3'->5' exonuclease Useful for
extensive DNA synthesis on long, single-stranded (e.g. M13)
templates Useful for labeling DNA termini and for converting
protruding ends to blunt ends Modified T7 polymerase (Sequenase)
--lack of both 3'->5' exonuclease and 5'->3' exonuclease
Ideal for sequencing, due to high processivity Efficiently
incorporates dNTPs at low concentrations, making it ideal for
labeling DNA 52
- 53. ONTARGET Reverse transcriptase: The Km for dNTPs is very
high (relatively non-processive) Makes a DNA copy of RNA or DNA --
but -- The self-primed second strand synthesis is inefficient
Second-strand cDNA synthesis is usually done with DNA polymerase
and a primer 53
- 54. ONTARGET Terminal transferase template-independent DNA
polymerase Incorporates dNTPs onto the 3' ends of DNA chains Useful
for adding homopolymeric tails or single nucleotides (can be
labelled) to the 3' ends of DNA strands (make DNA fragments more
easily clonable) 54
- 55. ONTARGET T4 polynucleotide kinase Transfers gamma phosphate
of ATP to the 5 end of polynucleotides Useful for preparing DNA
fragments for ligation (if they lack 5 phosphates) Useful for
radiolabelling DNA fragments using gamma 32 P ATP as a phosphate
donor 55
- 56. ONTARGET Alkaline phosphatase Catalyzes removal of 5 (and
3) phosphates from polynucleotides Useful for treating restricted
vector DNA sequences prior to ligation reactions, prevents
religation of vector in the absence of insert DNA Lack of vector 5
phosphates may inhibit transformation efficiency? Use only when
absolutely necessary 56
- 57. ONTARGET Nucleases Exonucleases Remove nucleotides one at a
time from a DNA molecule Endonucleases Break phosphodiester bonds
within a DNA molecule Include restriction enzymes 57
- 58. ONTARGET Exonuclease III--double-stranded DNA 3-5
exonuclease activity 3 overhangs resistant to activity, can use
this property to generate nested deletions from one end of a piece
of DNA (use S1 nuclease to degrade other strand of DNA)
Exonucleases Bal 31 Double-stranded exonuclease, operates in a
time-dependent manner Degrades both 5 and 3 ends of DNA Useful for
generating deletion sets, get bigger deletions with longer
incubations 58
- 59. ONTARGET Exonuclease I 3-5 exonuclease Works only on
single-stranded DNA Useful for removing unextended primers from PCR
reactions or other primer extension reactions 59
- 60. ONTARGET Type I: multisubunit proteins that function as a
single protein complex, usually contain two R subunits,two M
subunits and one S subunit Type II: recognize specific DNA
sequences and cleave at constant positions at or close to that
sequence to produce 5-phosphates and 3-hydroxyls. Most useful in
cloning!! Type III: composed of two genes (mod and res) encoding
protein subunits that function either in DNA recognition and
modification (Mod) or restriction (Res) Endonucleases and its types
Type IV: one or two genes encoding proteins that cleave only
modified DNA, including methylated, hydroxymethylated and
glucosyl-hydroxymethylated bases 60
- 61. ONTARGET How often does REase cut my sequence? 1) Known
sequence: scan for sites by computer (eg. at www.rebase.neb.com) 2)
Unknown sequence: hypothetical calculations 4 cutter: site occurs
randomly every 44 (256) base pairs 6 cutter: every 46 (4096) bp 8
cutter: every 48 (65536) bp But sequences are not distributed
randomly Sequence context effects Some sites are preferred over
others by enzyme 61
- 62. ONTARGET Biological function of ligases: Lagging strand DNA
synthesis genetic recombination DNA repair The ligation reaction 62
Action: It acts on DNA substrates with 5 terminal phosphate groups
and form the phosphodiester bond between two DNA sequences (vector
and insert) to join them together
- 63. ONTARGET CLONING VECTORS 63
- 64. ONTARGET Different types of cloning vectors are used for
different types of cloning experiments. Plasmid, phagemids, cosmid,
YAC,BAC, PAC, shuttle vectors etc. The vector is chosen according
to the size and type of DNA to be cloned 64 Cloning vectors
- 65. ONTARGET Features of suitable vector Features It must
contain a replicon that enables it to replicate in host cell It
should have several marker genes, which help to different the
transformed cells from non- transformed cells, which contain
recombinant DNA molecules eg. Genes for ampicillin and tetracycline
resistance Features It should have a unique cleavage site within
one of the marker gene so that the insertion of foreign DNA into
the marker gene leads to its inactivation and identification of
recombinant DNA molecule For the expression of the cloned DNA, the
vector DNA should have contained suitable control elements i.e.
promoter, terminator and ribosome binding sites Plasmid, phagemids,
cosmid, YAC, BAC, PAC, shuttle vectors etc.
- 66. ONTARGET Plasmid vectors Plasmid vectors are used to clone
DNA ranging in size from several base pairs to several thousands of
base pairs (100bp -10kb). ColE1 based, pUC vehicles commercially
available ones, eg pGEM3, pBlueScript 66
- 67. ONTARGET Why Plasmids are Good Cloning Vectors small size
(easy to manipulate and isolate) circular (more stable) replication
independent of host cell several copies may be present (facilitates
replication) frequently have antibody resistance (detection easy)
67
- 68. ONTARGET Disadvantages using plasmids Cannot accept large
fragments Sizes range from 0- 10 kb Standard methods of
transformation are inefficient 68
- 69. ONTARGET BACTERIOPHAGE LAMBDA Phage lambda is a
bacteriophage or phage, i.e. bacterial virus, that uses E. coli as
host. Its structure is that of a typical phage: head, tail, tail
fibres. Lambda viral genome: 48.5 kb linear DNA with a 12 base
ssDNA "sticky end" at both ends; these ends are complementary in
sequence and can hybridize to each other (this is the cos site:
cohesive ends). Infection: lambda tail fibres adsorb to a cell
surface receptor, the tail contracts, and the DNA is injected. The
DNA circularizes at the cos site, and lambda begins its life cycle
in the E. coli host. 69
- 70. ONTARGET 70
- 71. ONTARGET BACTERIOPHAGE LAMBDA 71
- 72. ONTARGET Purpose: 1. Clone large inserts of DNA: size ~ 45
kb Features: Cosmids are Plasmids with one or two Lambda Cos sites.
Presence of the Cos site permits in vitro packaging of cosmid DNA
into Lambda particles Cosmid vector 72
- 73. ONTARGET Thus, have some advantages of Lambda as Cloning
Vehicle: Strong selection for cloning of large inserts Infection
process rather than transformation for entry of chimeric DNA into
E. coli host Maintain Cosmids as phage particles in solution But
Cosmids are Plasmids: Thus do NOT form plaques but rather cloning
proceeds via E. coli colony formation Cosmid vector 73
- 74. ONTARGET Yeast Artificial Chromosomes 74
- 75. ONTARGET Yeast Artificial Chromosomes Purpose: Cloning
vehicles that propogate in eukaryotic cell hosts as eukaryotic
Chromosomes Clone very large inserts of DNA: 100 kb - 10 Mb
Features: YAC cloning vehicles are plasmids Final chimeric DNA is a
linear DNA molecule with telomeric ends: Artificial Chromosome
75
- 76. ONTARGET Yeast Artificial Chromosomes Additional features:
Often have a selection for an insert YAC cloning vehicles often
have a bacterial origin of DNA replication (ori) and a selection
marker for propogation of the YAC through bacteria. The YAC can use
both yeast and bacteria as a host 76
- 77. ONTARGET PACs - P1-derived Artificial Chromosomes E. coli
bacteriophage P1 is similar to phage lambda in that it can exist in
E. coli in a prophage state. Exists in the E. coli cell as a
plasmid, NOT integrated into the E. coli chromosome. P1 cloning
vehicles have been constructed that permit cloning of large DNA
fragments- few hundred kb of DNA Cloning and propogation of the
chimeric DNA as a P1 plasmid inside E. coli cells BACs - Bacterial
Artificial Chromosomes These chimeric DNA molecules use a
naturally-occurring low-copy number bacterial plasmid origin of
replication, such as that of F-plasmid in E. coli. Can be cloned as
a plasmid in a bacterial host, and its natural stability generally
permits cloning of large pieces of insert DNA, i.e. up to a few
hundred kb of DNA. PACs and BACs 77
- 78. ONTARGET Shuttle vectors Shuttle vectors can replicate in
two different organisms, e.g. bacteria and yeast, or mammalian
cells and bacteria. They have the appropriate origins of
replication. Hence one can clone a gene in bacteria, maybe modify
it or mutate it in bacteria, and test its function by introducing
it into yeast or animal cells. 78
- 79. ONTARGET Thank You! 79