Elements of Molecular Biology All living things are made of cells All living things are made of...

Post on 25-Dec-2015

221 views 2 download

Tags:

Transcript of Elements of Molecular Biology All living things are made of cells All living things are made of...

Elements of Molecular Biology

All living things are made of cells Prokaryote, Eukaryote

Cells

Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, …

Human genome is around 3 billions base pair long

Almost every cell in human body contains same set of genes

But not all genes are used or expressed by those cells

Terminology Genome is an organism’s complete set

of DNA. a bacteria contains ~ 600,000 DNA base pairs human and mouse genomes have some 3 billion.

Chromosomes Human genome has 23 distinct pairs of chromosomes

(22 pairs of autosomes and one pair of sex chromosomes).

Each chromosome contains many genes.

Gene basic physical and functional units of heredity. specific sequences of DNA bases that encode

instructions on how to make proteins. Genotype: Genetic makeup of an organism Phenotype: Physical expressed traits of an

organism

Elements of Molecular Biology

All Life depends on 3 critical molecules DNA

Hold information on how cell works

RNA Act to transfer short pieces of information to

different parts of cell Provide templates to synthesize into protein

Proteins Form enzymes that send signals to other cells and

regulate gene activity Form body’s major components (e.g. hair, skin, etc.)

Central dogma

the national health museum

OC

DNADNA

DNA is composed of four nucleotides or "bases": A,T,C,G

3rd C

5th C

Note that A pairs with T; and C pairs with G.

Four types of nucleotides of DNA

DNA Structure

3’5’

RNARNA composed of four

bases: A,C,G,U (T transcribed as U)

ProteinsAmino Acid

Proteins are composed of amino acids

Basic Amino AcidStructure: The side chain, R,

varies for each ofthe 20 amino acids

C

R

C

H

NO

OHH

H

Aminogroup

Carboxylgroup

Side chain

Protein

Central Dogma of Molecular BiologyCentral Dogma of Molecular Biology

DNA RNA protein

Sequence structure function

Central Dogma

DNA RNA protein

transcription translation

A string of the alphabet {A,C,G,T} Ex. CCTAAGA

A string of the alphabet{A,C,G,U} Ex. CCUAAGA

A string of the alphabet {20 amino acids} Ex. TGFIKYL

Gene expression

DNA to RNA to Protein

A gene is expressed in two steps: Transcription: RNA synthesis; Translation: Protein synthesis

Transcription

TranslationTranslation

conversion from RNA to protein is by codon: 3 bases = 1 amino acid

translation done by ribosome and tRNA

translation efficiency controlled by mRNA copy number (turnover) and ribosome binding efficiency

translation affected by mRNA tertiary structure

More on Translati

on

the national health museum

Start: AUGStop: UAA, UAG, UGA

Exercise Translate the following DNA to a

protein:…ctatgcccaagctgaaaaatgagcgtaatgaggtcatcat… -3’

…gatacgggttcgactttttactcgcattactccagtagta… -5’

template

The Human Genome Project

The human genome sequence is complete - - approximately 3 billion base pairs.

Whole genome sequencing has

now become routine

How does the human genome stack up?

OrganismGenome Size (Bases)

Estimated Genes

Human (Homo sapiens) 3.2 billion 25,000

Laboratory mouse (M. musculus) 2.6 billion 25,000

Mustard weed (A. thaliana) 100 million 27,000

Rice (Oryza sativa) 430 million 50,000

Roundworm (C. elegans) 97 million 19,000

Fruit fly (D. melanogaster) 137 million 13,000

Yeast (S. cerevisiae) 12.1 million 6,000

Bacterium (E. coli) 4.6 million 3,200

Human immunodeficiency virus (HIV) 9700 9

H1N1 13500 8

U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003

The Path Forward How does DNA impact health?

Identify and understand the difference in DNA sequence among human populations

What do all the genes do? Discover the functions of human genes by

experimentation and by finding genes with similar funcs in the model organisms

What are the functions of nongene areas? Identify important elements in the nongene

regions of DNA How does info in the genome enable life?

Explore life at the ultimate level of the whole organism instead of single genes/proteins.

U.S. Department of Energy, 2005

Diverse applications Medicine – customized treatments, … Microbes for energy and the

environment – generate clean energy source, clean up toxic wastes,…

Bioanthropology – human lineage Agriculture, livestock breeding,

Bioprocessing – crops&animals more resistant to diseases, efficient industrial processes,…

DNA identification – implicate people accused of crimes, identify contaminants in air, water, …

U.S. Department of Energy, 2005

Homework - Quiz on Wednesday

Terminology: genome, genes, proteins, Nucleic acid, amino acids, DNA, RNA, mRNA, tRNA, rRNA, mutation, chromosomes, genotype, phenotype, codon, …

DNA structures, RNA structures, direction of DNA sequence, DNA replication

Central dogma of molecular biology, transcription, translation