Post on 29-Jul-2020
UNIVERSITÀ DEGLI STUDI DI TRIESTE
XXVIII CICLO DEL DOTTORATO DI RICERCA IN
NANOTECNOLOGIA
Effects of nanomaterials on biological barriers, fetal
and post-natal, and evaluation of epigenetic toxicity
Settore scientifico-disciplinare: BIO/ 14
DOTTORANDA
Francesca Cammisuli
COORDINATORE
Prof.ssa Lucia Pasquato
SUPERVISORE DI TESI
Dott.ssa Lorella Pascolo
ANNO ACCADEMICO 2014 / 2015
TABLE OF CONTENTS
ABSTRACT (En).............................................................................................................6
ABSTRACT (It)...............................................................................................................8
ACKNOWLEDGEMENTS..........................................................................................11
CHAPTER 1 – GENERAL INTRODUCTION..........................................................13
1.1 Nanotoxicology: the dark side of Nanotechnology................................................13
1.1.1 The impact of physico-chemical properties of nanomaterials on biological
system.......................................................................................................................15
1.1.2 The predominant routes of nanomaterial exposure.........................................17
1.1.2.1 Pleura and placenta barriers.....................................................................18
1.1.3 The impact of nanotoxicity on more susceptible populations.........................22
1.2 Pharmacological and Toxicological studies of nanomaterial exposure.................24
1.3 Asbestos and Carbon nanotubes: a comparison.....................................................25
1.3.1 Mesothelioma: do carbon nanotubes determine the same health risk of
asbestos?..................................................................................................................30
1.3.2 Disorders of iron metabolism in nanomaterial toxicity..................................31
1.3.3 New approaches for Nanotoxicology: imaging and elemental analysis by
Synchrotron-based X-ray Fluorescence...................................................................32
1.3.4 Asbestos as inductor of carcinogenesis microenvironment: Do carbon
nanotubes behave like asbestos?.............................................................................34
1.4 Role of genetic predisposition in cancer development during nanomaterial
exposure: BAP1, a promising candidate gene in susceptibility to mesothelioma.......37
1.5 Conclusions...........................................................................................................41
1.6 Aims of the research..............................................................................................42
References...................................................................................................................43
CHAPTER 2 – Biochemical and microscopic methods in the study of intracellular
iron alteration after nanomaterial exposure..............................................................61
2.1 Material and methods............................................................................................61
2.1.1 Carbon nanotubes...........................................................................................61
2.1.2 Crocidolite......................................................................................................62
2.1.3 Nanofibre suspensions....................................................................................62
2.1.4 Iron sulphate (FeSO4).....................................................................................62
2.1.5 Cell culture and treatments.............................................................................62
2.1.6 Evaluation of citotoxicity...............................................................................63
2.1.7 Ferritin assay...................................................................................................63
2.1.8 Synchrotron-based X-ray analysis..................................................................64
2.1.9 Atomic force microscope analysis..................................................................65
2.2 RESULTS I: Iron related toxicity of single-walled carbon nanotubes and
crocidolite in mesothelial cells (MeT5A) investigated by synchrotron XRF
microscopy..................................................................................................................66
2.2.1 State of the art in in vitro tests of mesothelial cell line..................................66
2.2.2 Results of viability test...................................................................................67
2.2.3 Results of elemental mapping with XRF microscopy....................................68
2.2.4 Results of ferritin assay..................................................................................78
2.3 RESULTS II: Toxicity effects of single-walled carbon nanotubes and crocidolite
in human placental cells (BeWo) investigated by Synchrotron XRF microscopy and
AFM microscope.........................................................................................................80
2.3.1 State of the art in in vitro tests of placental cell line......................................80
2.3.2 Results of viability test...................................................................................82
2.3.3 Results of elemental mapping with XRF and AFM microscopy....................83
2.3.4 Results of ferritin assay..................................................................................90
2.4 Conclusions and comparison between pleura and placenta cell responses...........91
References...................................................................................................................92
CHAPTER 3 - A “nanotoxicogenomic” study: the role of BAP1 in mesothelioma
development...................................................................................................................96
3.1 Material and Methods............................................................................................98
3.1.1 Patients and tissue samples.............................................................................98
3.1.2 Nucleic acid extraction and PCR amplification..............................................99
3.1.3 Sanger sequencing and mutation data handling...........................................100
3.1.4 Multiplex ligation-dependent probe amplification.......................................101
3.2 Results.................................................................................................................102
3.3 Discussion and conclusions.................................................................................104
References.................................................................................................................107
CHAPTER 4 - UV resonant Raman spectroscopy for investigation of oxidative
DNA damage induced by carbon nanotubes............................................................111
4.1 Material and Methods..........................................................................................112
4.1.1 UV Resonant Raman spectroscopy..............................................................112
4.1.2 Computational simulations: Gaussian-03 software......................................114
4.1.3 Oxidative DNA damage...............................................................................114
4.2 Results and discussion.........................................................................................115
4.2.1 dNTPs Raman analysis before Fenton’s reaction.........................................115
4.2.2 dNTPs Raman analysis after Fenton’s reaction............................................119
4.2.3 Plasmid DNA Raman analysis......................................................................123
4.3 Conclusions..........................................................................................................125
References.................................................................................................................126
CHAPTER 5 – GENERAL CONCLUSION AND OUTLOOK............................129
Appendix A..................................................................................................................132
Appendix B..................................................................................................................134
Abbreviation list..........................................................................................................138
6
ABSTRACT (En)
Beyond the merits and the substantial opportunities offered by nanotechnology research,
there is a great need of understanding the possible harmful effects of general exposure
to nanomaterials.
My PhD project aimed to contribute to this topic by focusing on the interaction and the
induction of possible toxic effects of fibrous nanomaterials at two critical internal
biological barriers: the pleura and the placenta. Different physico-chemical properties
may determine the toxicity of nanomaterials, and among them this work was mainly
intended to investigate the impact of iron presence in old and new nanofibres: asbestos
and carbon nanotubes. It was worth noting that it has been recently demonstrated that
the fibrous structure of nanotubes might cause asbestos-like pathology.
The work was carried out by using advanced, synchrotron-based X-ray microscopy and
fluorescence (µXRM and XRF), together with more standard imaging techniques such
as SEM and AFM, conventional molecular analysis (PCR and Sanger sequencing) and
advanced spectroscopic measurements (UV-Raman).
We conducted biochemical studies by using XRM and XRF techniques, operated at two
synchrotron facilities, the ID21 and TwinMic beamlines, respectively at the European
Synchrotron Radiation Facility (ESRF, located in Grenoble, France) and Elettra
Synchrotron (Trieste, Italy). The aim was to reveal mechanisms of toxicity in human
mesothelial (MeT5A) and placental (BeWo) cell lines exposed to carbon nanotubes
(raw-SWCNTs, purified- and highly purified-SWCNTs) or asbestos (crocidolite fibres).
Other state-of-the-art imaging techniques microscopes were performed in some
experiments, to gather complementary data about the morphology and the cell-nanofiber
interactions.
The results obtained with the combination of these microscopic techniques allowed to
understand toxic mechanisms in the two internal barriers. The cells treated with raw-
SWCNTs and crocidolite fibres compared to the control showed a severe alteration of
iron metabolism, which was maximal in the pleural cells and was clearly related to the
presence of iron into the fibre. This study also found that highly purified nanotubes did
not altered iron metabolism. X-ray microscopy images (absorption and phase contrast
imaging) confirmed that the toxicity of nanomaterials was characterized by membrane
damage with vesicle secretion and filipodia formation.
7
While X-ray fluorescence analysis clearly revealed a homogeneous intracellular iron
increase in pleural cells after fibre exposure, the same technique showed that the iron
changes inside placental cells were restricted to small intracellular regions, thought to
be just in contact with the exogenous fibre.
In relation to this complex, and still unknown toxic mechanism, we evaluated the
presence of intracellular ferritin in treated cells. The results demonstrated that
crocidolite and “raw” carbon nanotubes increased the amount of intracellular ferritin in
both cell models, while highly purified carbon nanotubes gave values comparable to
control. The stimulation was clearly lower in placental cells and clearly linked to a
different uptake of fibres in these cells, suggesting that this barrier is less vulnerable
than the pleura.
In my thesis, I was also interested in investigating genetic effects to toxicity of
nanomaterials (nanotoxicogenomic). Since we have to learn from asbestos, one study
investigated the possible genetic predisposition to develop mesothelioma after asbestos
exposure by looking for BAP1 gene mutations in 29 cases of mesothelioma. BAP1 is
located on the short arm of chromosome 3 (3p21) and belongs to the ubiquitin C-
terminal hydrolase subfamily of deubiquitinating enzymes, involved in the removal of
ubiquitin from proteins. In addition, BAP1 is also involved in regulation of
transcription, regulation of cell cycle and growth, response to DNA damage and
chromatin dynamics (epigenetic mechanisms).
Sanger sequencing of BAP1 gene in the 29 patients identified one non-synonymous
variant and two intronic variants: patient 9 carried in heterozygous a missense variant
(c.T1028C; p.L343P) at exon 11; patient 4 carried in heterozygous a known intronic
variation 8 bases downstream of the exon 13 (c.1729+8T>C); in patient 15 carried a
heterozygous intronic variation 8 bases upstream of the exon 10 (c.784-8G>A). Sanger
sequencing of cDNA revealed no alternative splicing due to the nucleotide change for
each mutations. In silico mutation analysis was performed in a predicted protein
structure of BAP1 protein without any significant possible effect of the amino acid
change about exonic mutations of patient 9. Finally, MLPA (Multiplex ligation-
dependent probe amplification) analysis revealed no significant copy number variations
at exonic level in all samples.
The last aim of molecular studies was to test the feasibility of UV-Raman (IUVS
beamline, Elettra Synchrotron of Trieste) spectroscopy to reveal epigenetic changes at
DNA level after nanomaterial exposure. An oxidative environment was created in vitro
8
by using carbon nanotubes (raw-SWCNT), which contain some impurity in metal traces
(iron), and free radicals OH• (derived from H2O2). In this condition the elements of
DNA, in particular the nucleotides (dATP, dCTP, dGTP and dTTP), were resulted in
increased susceptibility to oxidative damage. The results demonstrated that UV-Raman
spectroscopy is useful to reveal the chemical changes that affect the nitrogenous bases
after nanomaterials exposure, providing a “fingerprint” of the oxidative DNA damage.
ABSTRACT (It)
Oltre ai meriti e alle notevoli opportunità offerte dalla ricerca per le nanotecnologie, c’è
un maggiore bisogno di studi volti a capire il possibile effetto dannoso della generale
esposizione ai nanomateriali.
Il mio progetto di dottorato si è proposto di essere parte di questa valutazione,
focalizzando l’attenzione sull’interazione e l’induzione di possibili effetti tossici dei
nanomateriali fibrosi a livello di due cruciali barriere biologiche interne: la pleura e la
placenta. Le diverse proprietà fisico-chimiche potrebbero determinare la tossicità dei
nanomateriali, e tra queste il progetto è stato maggiormente interessato ad investigare
l’impatto della presenza di ferro in un vecchio e nuovo nanomateriale: l’amianto e i
nanotubi di carbonio, rispettivamente. E’ interessante notare che è stato recentemente
dimostrato che la struttura fibrosa dei nanotubi di carbonio potrebbe causare un
meccanismo di patogenicità simile a quello dell’amianto.
Il lavoro è stato svolto usando avanzate microscopie basate sulla radiazione di
sincrotrone (µXRM and XRF) ed altre microscopie (SEM e AFM), oltre ad analisi
molecolari convenzionali (PCR e sequenziamento Sanger) e analisi spettroscopiche
avanzate (UV-Raman).
Gli studi biochimici hanno previsto l’uso di microscopia avanzata e fluorescenza a raggi
X (µXRM and XRF), operata in due diversi sincrotroni - Beamline ID21, Sincrotrone
Europeo in Francia (ESRF), e Beamline TwinMic, Sincrotrone di Trieste in Italia
(ELETTRA) - al fine di rilevare meccanismi di tossicità in cellule umane di mesotelio
pleurico (MeT5A) e di placenta (BeWo), esposte a nanotubi di carbonio (raw-SWCNT,
purificati- e altamente purificati-SWCNT) ed amianto (fibre di crocidolite). Altre
microscopie (AFM, microscopio a forza atomica e SEM, microscopio a scansione
9
elettronica) sono state aggiunte in qualche esperimento, per meglio investigare sulla
morfologia della cellula e sulla sua interazione con i nanomateriali.
I risultati ottenuti con la combinazione di queste tecniche microscopiche hanno
permesso di rivelare la presenza di simili e diversi meccanismi di tossicità nelle due
barriere biologiche interne. Le cellule trattate con i raw-SWCNT e le fibre di crocidolite
rispetto al controllo hanno mostrano una severa alterazione del metabolismo del ferro,
che era massimale nella cellule del mesotelio pleurico ed era chiaramente legato alla
presenza di ferro nelle fibre. Infatti, i nanotubi di carbonio altamente purificati non
alteravano il metabolismo del ferro. Le immagini ottenute con la microscopia a raggi X
(in assorbimento e contrasto di fase) hanno confermato che la tossicità dei nanomateriali
è caratterizzata anche dal danno di membrana con la secrezione di vescicole e la
formazione di filipodi.
La barriera placentare ha mostrato una differenza nella risposta cellulare e
nell’alterazione del metabolismo del ferro. Infatti, mentre nelle cellule di mesotelio
pleurico le analisi ottenute dalla fluorescenza a raggi X hanno rivelato un aumento del
ferro intracellulare omogeneo dopo l’esposizione ai nanomateriali, la stessa tecnica ha
mostrato che nelle cellule di placenta i cambiamenti del ferro sono ristretti a piccole
regioni intracellulari laddove c’è stata un’interazione con le nanofibre o i nanotubi.
In relazione a questo meccanismo abbastanza complesso e ancora sconosciuto abbiamo
valutato la presenza di ferritina intracellulare. I risultati hanno dimostrato che la
crocidolite e i nanotubi di carbonio “raw” aumentavano la quantità di ferritina
intracellulare in entrambi i modelli cellulari, mentre i nanotubi altamente purificati
davano valori paragonabili a quelli controllo. La stimolazione era chiaramente più bassa
nelle cellule di placenta, e chiaramente legata a un differente o comunque più basso up-
take delle fibre in queste cellule, suggerendo che la barriera placentare è meno
venerabile di quella pleurica.
Nella mia tesi, mi sono interessata dello studio degli effetti genetici in relazione alla
tossicità dei nanomateriali (nanotossicogenomica). Poiché abbiamo da imparare
dall’amianto, lo studio ha indagato sulla possibile predisposizione genetica a sviluppare
il mesotelioma dopo esposizione all’amianto, osservando mutazioni nel gene BAP1 in
29 casi di mesotelioma. BAP1 è localizzato sul cromosoma 3 (3p21.1) ed appartiene
alla sottofamiglia degli enzimi ubiquitina C-terminale idrolasi che sono coinvolti nella
rimozione di ubiquitina dalle proteine. Inoltre, BAP1 è anche coinvolto nella
regolazione della trascrizione, regolazione del ciclo e della crescita cellulare, nella
10
risposta al danno al DNA e quindi alle dinamiche della cromatina (meccanismi
epigenetici). Il sequenziamento Sanger dell’intero gene BAP1 nei 29 soggetti esposti ha
permesso di identificare una mutazione non senso e due mutazioni introniche in tre
diversi pazienti: il paziente 9 portava una mutazione non senso in eterozigosi sull’esone
11 (c.T1028C; p.L343P), il paziente 4 portava una mutazione intronica in eterozigosi ad
otto basi a valle dall’esone 13 (c.1729+8T>C), il paziente 15 portava un’altra mutazione
intronica in eterozigosi ad otto basi a monte dall’esone 10 (c.784-8G>A). Per quanto
riguarda queste mutazioni introniche è stato studiato lo splicing alternativo, eseguendo
il sequenziamento Sanger del cDNA: i risultati hanno dimostrato che sono assenti forme
alternative di splicing. Per valutare se la mutazione esonica del paziente 9 avesse effetti
sulla struttura proteica è stata fatta un’analisi in silico: i risultati hanno predetto che non
si ha un significativo effetto sul cambiamento amminoacidico e quindi sulla struttura
della proteina. Infine, l’analisi molecolare MLPA (Multiplex ligation-dependent probe
amplification) per ricercare delezioni-duplicazioni (copy number variations) non ha
rivelato a livello esonico variazioni significative in tutti i campioni.
L’ultimo obiettivo dello studio molecolare è stato di testare la fattibilità della
spettroscopia UV-Raman (Beamline IUVS, Sincrotrone di Trieste) per valutare possibili
cambiamenti epigenetici a livello del DNA dopo trattamento con nanomateriali. E’ stato
ricreato in vitro un ambiente ossidativo in presenza nanotubi di carbonio “raw”, che
contengono delle impurità in metalli tra cui anche ferro, e radicali liberi OH•(derivati da
H2O2). In questa condizione i componenti del DNA, in particolare i nucleotidi (dATP,
dCTP, dGTP e dTTP), sono risultati essere suscettibili al danno ossidativo. I risultati
hanno dimostrato che la spettroscopia UV-Raman è utile per studiare i cambiamenti
chimici che interessano le basi azotate del DNA in seguito all’esposizione ai
nanomateriali, ottenendo rapidamente un “fingerprint” del danno ossidativo al DNA.
11
ACKNOWLEDGMENTS
This PhD work has been supported by “Institute for Maternal and
Child Health - IRCCS Burlo Garofolo, Trieste” and
“Istituto nazionale per l'assicurazione contro gli infortuni sul
lavoro - INAIL; provincial seat in Trieste”.
Before anything else, I would like to thank my supervisor, Lorella Pascolo, for allowing
me to continue my academic experience. During these three years of doctoral she was
an excellent guide in my research activity, giving me the opportunity to develop my
knowledge and enriching my professional and human growth.
I would like to acknowledge Professor Mauro Melato (Institute of Child Health IRCCS
Burlo Garofolo, Trieste), Dr Clara Rizzardi (University of Trieste) and Dr Vincenzo
Canzonieri (Oncological Referral Center, Aviano) for their helpful teaching and
research support.
My gratitude goes to Giammaria Severini, Bortot Barbara and De Martino Eleonora for
the way they accepted me in their laboratory at the IRCCS Burlo Garofolo Institute
during three years of doctoral.
This research work was carried out in collaboration with several institutions and I would
like to acknowledge all participants which supported me.
Thanks to Alessandra Gianoncelli, Matteo Altissimo and Diana Bedolla, which
supporting me in the TwinMic beamtimes at Elettra-Sincrotrone (Trieste) carried out
during this PhD project. And particularly gratitude goes to Alessandra Gianoncelli and
Matteo Altissimo which helped me and my supervisor during the beamtimes at ESRF
(European Synchrotron Radiation Facility in Grenoble, France). I would like to thank
all scientists which supported me at ESRF: Salome Murielle and Marine Cotte (ID21
beamline), Yohan Fuchs and Fabio Comin (AFM Service). Thanks to Damiano Cassese
(TASC-INFM National Laboratory, Trieste) and Francesca Vita (University of Trieste)
for contributing to obtain AFM and SEM images shown in Appendix A. All these
participants allowed the biochemical study discussed in Chapter two of the PhD thesis.
12
Thanks to Emmanouil Athanasakis (Institute of Child Health IRCCS Burlo Garofolo),
Simeone Dal Monego and Danilo Licastro (Cluster in Biomedicine, Trieste) which
helped me in the BAP1 study discussed in Chapter three of the PhD thesis.
I would like to thank Francesco D’amico, Claudio Masciovecchio and Alessandro
Gessini (IUVS beamline at Elettra-Sincrotrone, Trieste) which supported the molecular
study already published and discussed in Chapter four of the PhD thesis.
Moreover, thanks to Silvia Giordani (Istituto Italiano di Tecnologia, Genova) who
provided me carbon nanotubes used in this PhD work.
To conclude, I would like to thank my family and friends.
Grazie mamma, grazie papà, senza il vostro amore tutto questo non sarebbe stato
possibile. Non posso che ringraziarvi esprimendo l’ amore incondizionato che nutro per
voi sin dal primo respiro. Grazie anche al mio fratellone ed alla sua famiglia, facendomi
dono di due fantastici nipotini che anche se lontani riempiono di gioia la mia vita. Un
grazie speciale al mio ragazzo che ha la capacità di farmi sorridere anche quando sono
triste, e grazie anche alla sua famiglia meravigliosa che mi ha accolto come una figlia.
Grazie alla mia adorata e preziosa amica Giorgia che trovo sempre dalla mia parte anche
a distanza di anni e di chilometri.
Grazie alle amiche ed anche colleghe, Eleonora, Alessandra e Vanessa, che mi hanno
accompagnato in questi tre anni di dottorato.
Infinite thanks to all of you!
13
CHAPTER 1 – GENERAL INTRODUCTION
1.1 Nanotoxicology: the dark side of Nanotechnology
Nanotechnology is often described as a set of new technologies, but is not a newly field;
it is only recently that discoveries have advanced so far as to assure their impact upon
the world revolutionizing our lives to common problems [1].
The concept was formulated for the first time by Richard Feynman, 1965 Nobel Prize
Laureate in physics. During the 1959 American Physical Society meeting at Caltech, he
presented a lecture titled “There’s Plenty of Room at the Bottom”, introducing the
concept of manipulating matter at the atomic and molecular level to build devices of
various type. This novel idea demonstrated new ways of thinking so much that
Feynman is considered the father of modern nanotechnology [2].
Fifteen years after Feynman’s lecture, Norio Taniguchi, a Japanese scientist, was the
first to use the term “nanotechnology” to describe semiconductor processes that
occurred on the scale order of a nanometer. He suggested that nanotechnology could be
considered as the processing, separating, consolidating, and deforming materials atom
by atom or molecule by molecule [3].
The golden age of nanotechnology began in the 1980s when Kim Eric Drexler used
term nanotechnology in his 1986 book titled, “Engines of Creation: The Coming Era of
Nanotechnology”, delineating the possible consequences of an emerging field called
“molecular nanotechnology” [2].
The term has been defined by various players over the decades and, despite of the desire
for the adoption of a single definition for nanotechnology, to date, there are several
accepted ones. For example, the Royal Society and Royal Academy of Engineering
(UK) gives the following definition: “Nanotechnologies are the design,
characterisation, production and application of structures, devices and systems by
controlling shape and size at nanometre scale”. In USA, the National Nanotechnology
Initiative (NNI) defines nanotechnology as: “... the understanding and control of matter
at dimensions of roughly 1 to 100 nanometers, where unique phenomena enable novel
applications... At this level, the physical, chemical, and biological properties of
14
materials differ in fundamental and valuable ways from the properties of individual
atoms and molecules or bulk matter” [4].
Nanotechnology is not a unique technology, but the term encloses several other
technologies as indicated by the definitions above. Some of the most well-known
technologies and methods include lithography, chemical vapor deposition, atomic force
microscopy and scanning probe- and tunnelling microscopy but according to a recent
standard on the terminology for nanofabrication and nanomaterials (NMs) from the
British Standard Institute (BSI) the number of methods, processes and techniques easily
exceeds 30 [5].
Tipically, nanotechnology is classified into two main approaches: (a) the “top-down”
approach, in which a bulk materials are reduced to the nanoscale size while maintaining
their original properties and (b) the “bottom-up” approach, in which materials from the
nanoscopic scale, such as molecules and atoms are engineered to form larger structures
through a process of assembly or self-assembly [6].
In nanotechnology fabrication, the physical chemical characteristics of solid material
processed into small pieces can be very different from those of the same material in
bulk form [7].
Nanotechnology is one of the leading scientific fields today combining knowledge from
Physics, Chemistry, Biology, Medicine, Informatics, and Engineering. Today and in the
near future, the application and use of nanostructure materials in electronic and
mechanical devices, in optical and magnetic components, in quantum computing, in
tissue engineering, and other biotechnologies, will constitute the most important
contribution of the nanotechnology in the marketplace [8-9].
Nanomaterials are actually being used in an extremely large number of applications
(medical imaging, drug delivery, cosmetic, electronic, etc.) and contain various NMs,
including nanotubes, metal oxides, and quantum dots [10].
It is interesting to note that, because of extensive human exposure to nanomaterials,
there is a significant and growing concern about the potential adverse health and
environmental risks associated with the use of nanostructured materials, their disposal
and their dispersion in the environment. These concerns led to the emergence of a new
scientific discipline: nanotoxicology. Its field of application is the study of potential
adverse health effects of nanomaterials investigating on the relationships between their
toxicity in relation to their dose levels and physicochemical properties (i.e., size, shape,
reactivity and material composition) [11].
15
Many of these concerns have been raised about the potential adverse health risks of
associated with nanotechnology and nanomaterials derive from the analogies with
ambient ultrafine particles in general, and asbestos in particular. It has been shown that
they produce a number of adverse health reactions after inhalation, including
inflammation, genotoxicity, and carcinogenesis [12-13].
Given these considerations, this PhD work focused on the study of the possible similar
toxic effects induced by two types of nanomaterials, asbestos and carbon nanotubes,
during fetal and post natal life.
1.1.1 The impact of physico-chemical properties of nanomaterials
on biological system
The advances in nanotoxicology research have shown that the interactions between
nanomaterials and cells, animals, humans, and the environment are very complex; this
complexity derives from ability of nanomaterials to bind and interact with biological
matter and then modify their surface characteristics [14]. The physical, chemical, and
biological properties of nanomaterials often differ from individual atoms, molecules,
and from bulk matter, making them attractive for commercial development and
application. However, these properties of nanomaterials may exert negative effects into
the body, such as an increased rate of pulmonary deposition, the ability to penetrate in
systemic circulation, and a high inflammatory potential [14].
Nanomaterial toxicity seems to originate from the nanomaterial’s size and surface area,
composition, and shape [15].
Nanomaterials come in varied shapes and can be divided into main groups:
nanoparticles, (i.e., rings, spheres), and nanofibres (i.e., tubes, rod). The wide variety of
nanomaterial’s shapes influences the in vivo membrane wrapping processes, either
during endocytosis or phagocytosis. Non-spherical nanomaterials are more prone to
flow through the capillaries inducing inflammatory response and DNA damage [15-16].
For instance, it has been shown that rod shaped single-walled carbon nanotubes
(SWCNTs) can block potassium (K+) ion channels more efficiently than spherical
carbon fullerenes [15-17].
Nanomaterials can be also varied in the chemical composition, from completely
inorganic, such as metals (iron, nickel, zinc, titanium, gold, silver, palladium, iridium,
16
and platinum), and metal oxides (titanium oxide, zinc oxide, silica, iron oxide, etc.), to
entirely organic, suche as fullerenes, CNT, nanopolymers, and biomolecules [18].
Particle size and surface area play a major role in interaction of materials with
biological system: the small size may lead to the high surface to volume ratio, making
the nanomaterial’s surface more biologically reactive [15]. At the same time, it has been
reported that nanoparticles of lower dimensions are less toxic than bigger [19].
Moreover, it has been established that various biological mechanisms (i.e., endocytosis,
cellular uptake) also depend on size of the material [20].
The aspect ratio is an important feature of nanomaterials that establishes the surface to
volume ratio. Various types of nanomaterials (i.e., carbon nanotubes or asbestos fibres)
show a higher aspect ratio determining their toxic effects. For example, in the case of
asbestos induced toxicity, it has been revealed that the asbestos fibres longer than 10
microns cause lung carcinoma, while fibres >5 microns cause mesothelioma and fibres
>2 microns cause asbestosis [21]. Longer fibres will not be effectively cleared from the
respiratory tract since the macrophages are unable to fully phagocytize them [21-22]. At
the same way, long-aspect ratio of SWCNTs produce significantly higher pulmonary
toxicity respect to the spherical particles. It has also been reported that long multi-
walled carbon nanotubes (MWCNTs) cause inflammation responses after intra-
abdominal instillation, while no inflammatory response are observed in case of short
MWCNTs [22-23].
Surface charge is important to nanomaterial toxicity, affecting their interactions with
the biological systems. The plasma membrane is negatively charged, thus positively
charged nanomaterials show significant cellular uptake compared to negatively charged
or neutral ones. Additionally, DNA is negatively charged, thus cationic NMs are more
reactive with the genetic material [24]. Besides, many nanomaterials are functionalized
on the surface to increase the circulation time of them in blood and their
biocompatibility, such as for targeted therapy. Although the functionalization seems to
be very promising in many applications, functional groups added to the surface can
potentially interact with biological components, altering some biological functions and
allowing the passage of nanomaterials in certain cells. Nanomaterial purity is another
important aspect in determining their toxicity. Some nanomaterials contain
contaminants, such as residual metals catalysts (i.e. iron, cobalt, and nickel) that may be
responsible for toxicological responses and the quantity of which depends upon
particular synthetic route. However, where metals are present as impurities, iron is one
17
of the primary sources of biological damage as it induces oxidative stress through
Fenton or Haber-Weiss reactions [25].
1.1.2 The predominant routes of nanomaterial exposure
The number of humans exposed to nanomaterials, generated by both natural processes
and industrial activities, will increase over the next years. The main factors determining
the toxic effects of NMs in the body are the characteristics of the exposure (i.e.,
penetration route, duration, and concentration) and of the exposed organism (i.e.,
individual susceptibility, activity at time of exposure, and the particular route the NMs
follow in the body), and the intrinsic toxicity of NMs (i.e., catalytic activity,
composition, electronic structure, capacity to bind or coat surface species, surface area)
[14]. Nanomaterials have a small size similar to DNA (about 2.5 nm) and proteins (i.e.,
albumin 7.2 nm), which allows the migration of the nanomaterials through capillaries,
cell membranes and cell substructures.
The predominant routes of human exposure to NMs intended for industrial or
environmental applications include inhalation exposure, dermal uptake, and oral
ingestion with possible entering into systemic circulation by absorption or directly into
the brain (Figure 1) [26-27].
Figure 1. The predominant routes of NMs exposure and uptake, and potential routes of their
translocation.
18
Three anatomical primary barriers separate the deep tissues of the body from external
environment and are represented by the epithelia of the skin, the gastrointestinal tract
and the respiratory system.
The inhalation route has been of biggest concern since it is the most common route of
exposure to airborne particles, mainly in the workplace [28].
Particle uptake through the skin results from diffusion through its three constituting
layers: the epidermis, dermis and hypodermis. For example, prolonged dermal
application of microfine titania sunscreen seems to lead to its penetration into the
epidermis and dermis [29].
To date, little is known about oral and ocular exposure. Regarding to the oral exposure
nanomaterials seem to penetrate only in regions where the integrity of gastric epithelial
is disrupted [30]. While the ocular exposure may occur from cornea into the inner eye,
when accidently using cosmetics or transferring NMs from the hands to eyes [31].
When nanomaterials overcome the primary barriers (epithelia of the skin, the
gastrointestinal tract and the respiratory system), there are further biological barriers
protecting specific organs of human body. The secondary or internal barriers are
represented by the blood–brain barrier (BBB), protecting the neural tissue, the blood–
testis barrier (BTB), protecting the germ cells, and the placenta, protecting the fetus
[32]. In addition, pleura can be considered an additional internal barrier, involved in the
regulation of the passage of some substrates from lung to circulation (see 1.3 section).
1.1.2.1 Pleura and placenta barriers
My PhD work involved investigating two main biological barriers: the pleura and the
placenta internal barriers.
The choice was directed to two biological barriers because, particularly in accidental or
environmental exposure, the lung is considered to be the most important portal of entry
for nanomaterials into the human body, while little is known on biological interaction
and biodistribution of nanomaterials across the placenta.
The respiratory system acts as a barrier between the “outside” and the “inside”. The
respiratory tract consists of three structurally and functionally distinct areas, which are
depicted in Figure 2. The extrathoracic region which consists of the nasal cavity, the
mouth, the pharynx and the larynx. At the end of the extrathoracic zone, there is the
tracheobronchiolar region which includes the trachea, the main bronchi, the bronchi, the
19
bronchioles and the terminal bronchioles. The proximal part of the alveolar-interstitial
region is composed of the respiratory bronchioles with only a few adjacent alveoli [33].
Inhaled nanomaterials can be deposited in different parts of the respiratory system (i.e.,
nasal, tracheabronchial, and alveolar regions) in a manner dependent in large part on
particle size. They can enter into the systemic circulation crossing the epithelia of the
lung, especially the alveolar epithelium with its very large surface area and thin barrier
thickness [34].
Figure 2. The human respiratory tract.
However, the respiratory tract is protected from a series of structural and functional
defences [35]. A thin film of surfactant and an aqueous surface-lining layer with the
mucociliary escalator are the primary defence of respiratory system. The next lung
defence is composed of macrophages (professional phagocytes), the epithelial cellular
layer with tight junctions as well as adherens junctions between the cells, and a network
of dendritic cells inside and underneath the epithelium [36-37].
But, another important defences are the pleural cells that trigger cellular responses to
expel the harmful substances that after penetrating the lung parenchyma arrive at the
pleural space [38-39]. The pleura is a double monolayer of mesothelial cells that
surrounds the lung. The outer cell layer is called the visceral pleura, and the inner layer
is called the parietal pleura. In between of the two pleural layers there is the pleura
space with a serous liquid (Figure 2). A range of in vitro models have been developed to
20
investigate the mechanisms of cellular interaction and clearance of toxic substances
(i.e., MeT5A and H-MESO-1 human cell lines).
Nanomaterials are first inhaled and caught on mucus on the walls of the trachea,
bronchi, and larger bronchioles, which are lined with ciliated epithelial cells covered
with a thin layer of mucous. The mucous traps foreign material, while the ciliated
bodies act to move it towards the throat where it can be swallowed or expelled from the
body [40].
The immune defences in the upper respiratory system (nasal cavity, the mouth, the
pharynx and the larynx) cannot remove all nanomaterials and some of them can
penetrate in the deepest parts of the lung (terminal bronchioles and alveoli). The
terminal bronchioles and alveoli contain specialized cells called macrophages, which
find, digest, and assist in expelling foreign matter from deep in the lungs. Since
macrophages range in diameter from about 10 to 20 μm, shorter NMs (i.e. nanoparticles,
nanofibers and nanotubes) are more likely to be completely phagocytized by alveolar
macrophages than longer ones. This causes the incomplete or “frustrated” phagocytosis
of fibres longer than 20 μm, which is characterized by prolonged production of reactive
oxygen species (ROS); oxidative stress leads to inflammation with release of
inflammatory cytokines and cell death [41].
Nanomaterials that crossed the alveolar-capillary barrier after inhalation (or the gastro-
intestinal barrier after ingestion) end into circulation and may interact further with
internal barriers through passive diffusion (simple or facilitated), active transport and
endocytosis [32]. Endocytosis is an active cellular transport of large, polar molecules
that cannot pass through the cell’s hydrophobic membrane ending with invagination of
the hydrophobic membrane around the molecules deposited on the surface and their
inclusion into the cytoplasm. In passive diffusion, the crossing occurs through a
concentration gradient across the barrier. In the case of passive facilitated diffusion, the
passage of substances is always regulated by a concentration gradient without any
energy expenditure, while active transport is mediated by transporters, occurs against a
concentration gradient and involves an expenditure of energy [42]. While the
intervention of real transporter is unlikely, endocytosis and passive diffusion are the
most observed mechanisms for fibre uptake. Fibre passage through the pleural barrier
will be described in section 1.3.
The placenta is a fundamental barrier between the mother and the fetus to prevent or
greatly limit drug and toxic agent passage into fetal circulation. The placenta is an organ
21
of fetal origin, but shared with his mother, who is called multifunction because it
performs functions that in adult life are made by the liver, kidney, intestines, endocrine
and immune systems. At the level of the chorionic villi, the placenta has an important
barrier function, finely adjusting the bidirectional passage of gases and solutes, ions,
nutrients and metabolites and drugs. The functional unit through which vectorial
transport take place is syncytiotrophoblast, a highly polarized epithelial structure where
the fetal blood is in contact with the basolateral membrane, while the maternal blood
wets the apical side. The apical and the basolateral membranes not only are structurally
distinct, but also differ for the presence of specific transporters, enzymes and hormone
receptors. The concerted action of hundreds of maternal-fetal and vice versa transport
mechanisms ensure the effective removal of metabolites and toxic substances from
fetus, as well as proper procurement of nutrients and active substances.
It is the great selectivity of membrane transport systems that determines the
effectiveness of the placental barrier, which prevents the risk of fetal exposure to
elements and toxic agents. However, similarly to what happens in other body districts,
also the placenta seems to be partially permeable to nanomaterials, either accidentally
through exposure to these materials, or intentionally in the case of potential
nanomedical applications (therapeutic, diagnostic and imaging) [43].
To date, a variety of in vitro models have been developed to clarify the mechanisms of
cellular interaction and transport across the human placenta (i.e., BeWo and JEG-3 cell
lines) [44-45].
Figure 3. Structure of the placenta barrier in the first trimester and at term. At term, the placental barrier
is much thinner due to thinning of the syncytiotrophoblast (ST) and the spreading of the cytotrophoblastic
layer (CT). SOURCE: Buerki-Thurnherr T et al., Swiss Med Wkly (2012) [43].
22
The syncytiotrophoblast layer is thick in early pregnancy and becomes thinner during
gestation. This reduction in thickness and the increase of vascularization fetal enhances
the efficiency of maternal-fetal exchange during fetal growth. Consequently, the
possibility to cross the placenta is higher during the third trimester of pregnancy (Figure
3) [43].
1.1.3 The impact of nanotoxicity on susceptible populations
Although there are numerous benefits of nanotechnology applications (i.e. drug
delivery, all the modern electronics) it increases the need to define the risk assessment
of susceptible populations. In fact, very little is known on the health effects of
nanomaterials in susceptible populations. Recently, nanotoxicological studies are
mainly interesting on pregnant women, neonate, diseased and elderly population. The
susceptible populations are more sensitive to toxic mechanisms of nanomaterial (i.e.,
oxidative stress and inflammation), having alterations in physiological structures and
functions [46-47].
The susceptibility of pregnant women to nanomaterial exposure may depend mainly on
physiological changes in the neuroendocrine network and the placental uptake or
transfer of NMs. The alterations in the neuroendocrine system are important to initiating
and maintaining the pregnancy, fetal development and in the end parturition [48]. Some
research demonstrated that NMs can cross the placenta and enter the fetus [49].
Whereas the fetus is missing of protective mechanisms, it is more sensitive to foreign
substances that are taken up by mother both during and in some cases before gestation.
For example, a study has demonstrated that a single intranasal administration of
titanium dioxide nanoparticles causes a acute inflammation in pregnant BALB/c mice
[46,50]. In another study has found that intravenous injection of silica (70nm) and
titanium dioxide nanoparticles (35nm) in pregnant BALB/c mice decrease the gestional
success rate [46,51]. Moreover, nanomaterial exposure can cause structural and
functional abnormalities in the placenta and can lead to placental dysfunction (i.e.
oxidative stress). In addition, and in some cases, nanomaterials can enter the fetus
through placenta and yolk sac. For example, in pregnant mice, a single intravenous
injection of platinum nanoparticles and PEG-coated quantum dots can translocate after
exposure [52]. Also, in pregnant CD-1 mice, silver NPs (average diameter 50 nm) are
found in extra-embryonic tissues including the visceral yolk sac and endometrium after
23
intravenously injection [53]. In another study, after intravenous injection, silica (70 nm)
and titanium dioxide nanoparticles (35 nm) are found in the placenta, fetal liver, and
fetal brain [51].
Although the fetus is protected by the placenta barrier, these studies confirmed that the
fetus is more sensitive to nanomaterial exposure. Therefore, this uncontrolled exposure
may affect the health of the fetus, potentially leading to abnormal fetal development and
malfunctions (i.e. reproductive toxicity and neurotoxicity). Furthermore, maternal
exposure to NMs can induce the production of inflammatory cytokines that may enter
the fetus and induce alterations in gene expression and cause DNA damage [54].
In diseased population there is a higher risk of toxicity after nanomaterial exposure,
since most of the physiological functions are compromised. In more recent studies, the
toxicity of nanomaterials is investigated more thoroughly in subjects with
cardiovascular and respiratory diseases.
Studies have suggested that nanoparticle exposure causes vascular dysfunctions and
progression of atherosclerosis by enhancing oxidative stress, inflammation,
mitochondrial DNA damage in aortas, and damage to vessel endothelial cells
[55,56,57].
Subjects with chronic respiratory diseases, especially chronic obstructive pulmonary
diseases (COPD) and asthma, are more susceptible to allergens, such as airborne
particles. Asthmatic subjects show higher particulate matter deposition in the lung
compared with healthy ones [58]. A study in humans confirmed that inhaled ultrafine
carbon particles are retained for longer time period in the human lung of asthmatic
patients compared to healthy subjects [59]. Further, NMs deposited in respiratory tract
system of these subjects aggravate the pre-existing inflammation enhancing
hypersensitivity [46,60].
The elderly population is more sensitive to the potential effects of nanomaterials due to
their less effective physiological functions (i.e. protein degradation, regenerative
capability, and immune defences) than the young or adult population. Recent studies
using elderly animal models showed that animals are more susceptible to the harmful
effects of nanoparticles compared with young or adults. For example, the exposure to
SiO2 nanoparticles (24.1 mg/m3; 40 min/day) by inhalation for four weeks in 20-month-
old rats (equivalent to 60–80 years old in humans) causes cardiovascular dysfunctions
[46,61].
24
Therefore the future research in nanotoxicity field should include susceptible
populations in order to provide a comprehensive understanding of transport and
adsorption of NMs compared to healthy populations.
1.2 Pharmacological and Toxicological studies of nanomaterial exposure
Although a large number of research papers are published in recent years to better
understand the cellular uptake of nanomaterials, the underlying mechanisms are still
poorly understood both in vitro and in vivo. It is well recognized that physical and
chemical properties of materials can varied dramatically at nanoscale size, and the
increasing use of nanotechnologies requires further investigations to unravel unexpected
toxicities and biological interactions.
In general, three approaches can be used to study the effects of nanomaterial toxicity: in
vivo experiments on animals, ex vivo studies on biopsies and in vitro experiments using
more or less complex cell culture systems. Cells used for in vitro experiments can stem
either from a continuous cell line (secondary cultures) or freshly isolated tissues
(primary cultures). Mostly, of in vitro nanotoxicology studies are performed using
immortalized cell lines for their practicality.
The most widely used and best characterised in vitro models of the human alveolar and
bronchial epithelia are A549 and BEAS-2B cell lines, respectively. Senlin Lu et al.
[62] investigated on cellular toxicity of A549 cells induced by the different engineered
metal oxide NPs (ZnO, NiO, and CeO2) after exposure and tried to determine
differences in cytotoxicity induced by ambient ultrafine particles (UFPs). The study
demonstrated that metal nanoparticles oxides and UFPs at low concentration induce cell
damage. Interestingly, man-made metal oxide nanoparticles showed a lower toxicity as
compared to UFPs. Kim IS et al. [63] assessed and compared the toxicity of four
different oxide nanoparticles (Al2O3, CeO2, TiO2 and ZnO) to human lung epithelial
cells (A549), demonstrating that ZnO exhibit the highest cytotoxicity in terms of cell
proliferation, cell viability, membrane integrity and colony formation; however, TiO2
induce oxidative stress in a concentration- and time-dependent manner, CeO2 cause
membrane damage and inhibit colony formation in the long-term, and Al2O3 seem to be
less toxic than the other nanoparticles even after long time exposure.
Gurr JR et al. [64] showed that the exposure to ultrafine titanium dioxide particles
induce in BEAS-2B cells oxidative DNA damage, lipid peroxidation, increased H2O2
25
and nitric oxide production, decrease cell growth, and increase micronuclei formation
(indicating genetic toxicity). Davoren M. et al. [65] described the in vitro cytotoxicity
assessment of single-walled carbon nanotubes (SWCNTs) on A549 cells. The exposure
of A549 cells to a wide dose range of SWCNTs (1.56–800 µg/ml) for 24 h revealed that
the SWCNTs have low acute toxicity. TEM (Transmission Electron Microscopy)
studies confirmed that there is an increased number of surfactants storing lamellar
bodies as defensive response of these lung cells to SWCNT exposure. Jia G. et al. [66]
demonstrated the cytotoxicity of single-walled carbon nanotubes (SWCNTs), multi-wall
nanotubes (with diameters ranging from 10 to 20 nm, MWCNT10), and fullerene (C60)
in alveolar macrophage (AM), after a 6 h exposure in vitro. No significant toxicity are
observed for C60 at high dose. SWCNTs significantly impaired phagocytosis of AM at
the low dose. Whereas MWNT10 and C60 induce injury at the high dose and the
macrophages exposed show typical features of necrosis and degeneration.
In vivo studies using animal models have shown that pulmonary exposure to CNT can
led to an immediate macrophage-mediated inflammatory response characterized by a
rapid macrophage influx in the bronchoalveolar fluid and an internalization of the CNT
by the resident or attracted macrophages [67-68].
For pregnant women and their unborn children there are yet concerns about their
nanomaterial exposure. So far there is little coverage in the published literature about
placental uptake or transfer of NMs. A range of in vitro models are used to study
transplacental transfer of several drugs and compounds. Particularly, the human BeWo
cell line, representing a choriocarcinoma-derived placental cell line, is strongly similar
to the cytotrophoblastic cells.
The first study that confirmed the ability of nanosized materials to cross the placental
barrier comes from an in vivo study in pregnant rats where the gold NPs are transferred
to the embryos after intravenous administration [69]. In humans, it has been reported
that polystyrene nanoparticles can cross the placenta in a size-dependent manner [49],
while gold nanoparticles are shown to be retained inside the cells of trophoblastic layer
[70].
1.3 Asbestos and Carbon nanotubes: a comparison
Asbestos is the generic term of a variety of mineral silicates that in the 20th century
became widely used in industrial products, automotive parts, buildings, fabrics, and in a
26
huge array of other domestic and industrial products as a result of its fibrous nature. By
the last few decades of the 20th century asbestos is recognised as potentially harmful,
since it turned out that the exposure to asbestos caused pulmonary diseases (i.e.,
asbestosis, pleural effusions, and pleural plaques) and cancer (i.e., lung cancer and
mesothelioma) [71-72].
Figure 4. Two groups of asbestos: serpentines and amphiboles. Chrysotile is the only member of the
serpentine group. Actinolite, amosite, anthophyllite, crocidolite, and tremolite belong to the amphibole
group. SOURCE: http://www.nationaldryout.com.
Asbestos fibres can be divided into two groups: serpentines and amphiboles. Chrysolite
is the only member of the serpentine group. Actinolite, amosite, anthophyllite,
crocidolite, and tremolite belong to the amphibole group. All asbestos types are
hazardous to human health, but crocidolite is considered most dangerous (Figure 4).
After many years of study, the “fibre pathogenicity paradigm” (FPP) has been proposed
by Donaldson K. [73] to define the toxic characteristics of asbestos and other fibres.
The FPP recognises the geometry of fibres as their most important toxicological
characteristic, superior to the chemical composition. In particular, the paradigm argues
that the pathogenicity of fibres depends on a specific combination of length, thickness
and biopersistence (Figure 5). Fibres that cannot be cleared by physiological processes
are considered to be biopersistent. For instance, to be high hazardous in the body
following inhalation, a fibre must be thinner than 3 µm, longer than 10 to 20 µm, and
non-degradable [73].
27
Figure 5. Diagram illustrating the “pathogenicity fibre paradigm” of Donaldson K. The fibre are
pathogenic if they are thin, biopersisten and long.
The high aspect-ratio makes carbon nanotubes (CNTs) a useful technological material.
In fact, there is a growing development and use of CNTs in a wide range of applications
(industrial, electronics, medicine, etc.). But, their strong similarities to asbestos fibres
(i.e., shape, size, fibrous morphology and pathogenic potential) have raised concerns
about potential toxicity [74-75].
CNTs are manufactured into two main forms, SWCNT and MWCNT. Single-walled
carbon nanotubes are a single layer graphene sheet rolled up in a cylindrical shape with
a diameter of 0.4-2 nm and a length of 0.2-5 µm, while multi-walled carbon nanotubes
contain several layers of grapheme, are 2-100 nm in diameter of and tens of nanometers
to several microns in length (Figure 6) [76].
Figure 6. Carbon nanotubes: single-walled carbon nanotubes (SWCNTs) and multiwalled carbon
nanotubes (MWCNTs). SOURCE: S. Iijima,Physica B: Condensed Matter (2002).
The main risk for adverse effects is associated to the inhalation route both for asbestos
fibres and carbon nanotubes, because they may be deposited and retained in the lung.
The effects of carbon nanotubes are studied following in vivo exposure of rodents, and
in vitro cell culture models highlighting their pulmonary toxicity [77-78].
28
Poland et al. [79] reported that long fibres, either they are asbestos fibres or carbon
nanotubes, are able to evade complete phagocytosis by macrophages, leading to
frustrated phagocytosis and chronic inflammation (Figure 7).
Figure 7. The phagocytosis of short and long fibres. The macrophages can enclose and eliminate short
fibres, while they cannot enclose long fibres, resulting in incomplete or frustrated phagocytosis and
inflammation.
After deposition in the lung, the fibres may translocate to the pleura where they can be
retained depending on their length and biopersistence, leading to inflammation and
oxidative stress. In addition to fibre dimension, the chemical composition of asbestos
and CNTs can increase their stability and render them more biopersistence in the
respiratory system [80]. Highly biopersistent fibres may induce inflammation and
carcinogenesis [81-82].
Surface properties of fibres showed particular biological importance for their uptake by
the cell and cytotoxicity. When asbestos fibres reach the lung lining fluid or alveolar
macrophages can adsorb endogenous proteins, such as ferritin [83], leading to the
formation asbestos bodies [84]. The presence of endogenous molecules may determine
more easily interactions with biological systems.
Research studies showed that surface properties are also crucial to cellular uptake of
carbon nanotubes. Unfunctionalized carbon nanotubes are hydrophobic, but the wide
variety of surface functionalizations can increase their the potential to adsorb a wide
range of small molecules and macromolecules in biological environments. Therefore,
29
the type of functional groups may determine the hydrophilic/hydrophobic properties of
nanotubes, modifying the translocation, distribution and excretion of carbon nanotubes
from the organisms [85].
Considerable evidences suggested that reactive oxygen species (ROS) such as hydrogen
peroxide (H2O2), superoxide anion (O2ˉ) and the hydroxyl radical (HO·), and the
reactive nitrogen species (RNS) can be generated directly by the fibres themselves or
indirectly through interactions with inflammatory cells [86].
The presence of transition metals on the fibres and their ability to attract them is a
central process to explain carcinogenic effects of asbestos. The presence of both ferrous
(Fe2+
) and ferric (Fe3+
) forms, is considered to be responsible for the genotoxic and
cytotoxic responses after deposition of asbestos fibres [87]. Among commercially used
asbestos fibres, crocidolite and amosite asbestos are contain 20-30% iron by weight and
are considered the most carcinogenic. It has been reported that in cell-free systems the
iron mobilization can contribute to redox-cycling reactions leading to production of
hydroxyl radicals, DNA breaks, and formation of premutagenic DNA adduct such as 8-
OHdG (8-hydroxy-2-deoxyguanosine) [88].
Typically, metals (i.e., iron, nickel, cobalt and molybdenum) are used as catalyst in the
synthesis of CNTs to promote the CNTs growth. However, the purification is not
efficient to remove all of the metal contaminants, and often the purified samples are not
completely metal-free.
The presence of metals is known as a mediator of fibre toxicity and carcinogenicity in
diverse carbon nanotubes [89]. Similarly to iron toxic effect, it has been shown that
nickel may cause acute inflammation and pulmonary injury in rat models after
intrapleural injection [90]. Nickel toxicity is carried out by epigenetic mechanisms in
target cells. Alterated DNA methylation or protein acetylation may result in
transcriptional silencing of tumor suppressor genes [91]. Iron related toxicity could be
also epigenetic, and direct demonstration need to be provided.
A second mechanism by which fibres can activate oxidative stress was by the
recruitment of inflammatory cells to the site of fibre deposition. If fibres exceed 20 µm
in length, the macrophages are unable to remove them, leading to persistent macrophage
activation (frustrated phagocytosis) and chronic inflammation [92-93]. It has been
reported that macrophages recognize both asbestos and carbon nanotubes fibres through
the similar mechanism, i.e. via the class A scavenger receptor, and their uptake activates
the NLRP3 inflammasome [94].
30
1.3.1 Mesothelioma: do carbon nanotubes determine the same health
risk of asbestos?
Asbestos exposure can lead to a wide range of pleural pathologies including pleural
effusion which is an excessive build-up of fluid in the pleural space, pleural fibrosis and
pleural mesothelioma. The latter is a cancer of the lining of the pleural cavity caused by
the neoplastic transformation of mesothelial cells. It is aggressive and uniformly fatal
tumor and is seen as a hallmark disease of asbestos exposure. A report of the
International Agency for Research on Cancer (IARC) classified all types of asbestos as
carcinogenic to humans with sufficient evidence for different types of cancers [95].
Recently, a specific multi-walled carbon nanotube (MWCNT-7) has been classified as
possibly carcinogenic to humans [96].
In the years, the aim was to understand if carbon nanotubes may present a hazard to the
pleural district. The first observation derives from the study of Kane AB and co-
workers, in which demonstrated the failure to eliminate long fibres in peritoneal and
pleural cavity [97]. Viallat JR and co-workers [98] provided same hypothesis about
asbestos removal from the parietal pleura and the mesothelioma development.
Poland et al. [99] showed that introperitoneal injection of MWCNTs in mice induces
inflammation and granuloma formation on the mesothelial surface of the peritoneum.
These results demonstrated that only long samples of MWCNTs and amosite produce
inflammation and granuloma as compared with short fibres. Histological analyses
revealed the presence of frustrated phagocytosis by macrophages. Another study
performed by Takagi et al. [100] reported that mice with a deficiency in the p53 tumor
suppressor develop mesothelioma formation in the abdominal cavity after injection of
MWCNTs and crocidolite fibres used as positive control. Murphy et al. [101]
demonstrated that long carbon nanotubes are retained in the pleural space initiating
sustained mesothelial inflammation. The ability of carbon nanotubes to move into the
pleural space after inhalation has also been shown by Mercer et co-workers [102].
A more recent study demonstrated how MWCNT exposure can promote the growth and
neoplastic progression in B6C3F1 mice (a strain used by the National Toxicology
Program to evaluate chemicals for potential carcinogenicity) associated with the use of
a tumor initiator methylcholanthrene (MCA) [103].
31
All these findings suggested that some MWCNTs are likely to pose a carcinogenic risk
similar to asbestos fibres and lead to develop of mesothelioma.
There is significant correlation between the in vivo and in vitro pulmonary responses
studies after CNTs exposure. Some of these studies demonstrated that CNTs induce
ROS generation in mesothelial cells leading to activation of several signalling
pathways, such as AKT, mitogen-activated protein kinase (MAPK), nuclear factor-
kappa B (NF-κB), AP-1 and p53 [104-105]. These results may suggest that the
oxidative stress induced by CNTs is an important aspect of pulmonary toxicity of CNTs
[106]. In vitro studies of MWCNT and SWCNT treatments have revealed genotoxic
effects, such as DNA strand breakage, DNA base oxidation, chromosomal aberrations
and gene mutations [107-108].
1.3.2 Disorders of iron metabolism in nanomaterial toxicity
Iron is a trace element and has a crucial role in living cells, participating in a wide
variety of metabolic processes, such as oxygen transport, DNA synthesis and electron
transport. The disposition of iron in the human body is regulated by a complex
mechanism to maintain homeostasis [109]. Disorders of iron metabolism are among the
most prominent diseases of humans, such as Alzheimer’s and Parkinson’s diseases,
metabolic syndrome, diabetes, atherosclerosis and even cancer [110].
In general, fibre toxicity is also related to the chemical composition. Asbestos toxicity is
ascribed to its particular physico-chemical characteristics, and one of them is the
presence and ability to adsorb iron (Fe3+
and Fe2+
ions), which may cause an alteration
of iron homeostasis in the tissue [111-112]. When the asbestos fibres are deposited in
the lower tract of respiratory system, iron complexation by the fibre surface can cause
an accumulation of metal. But the coordination sites of metal can be incomplete
allowing its participation in metal-catalyzed oxidative stress [113].
Oxidative stress is one of the main epigenetic mechanisms that contributes to
development of carcinogenesis [114]: free radicals (H2O2, ·O2ˉ,
·HO) are capable of
causing DNA damage, protein oxidation and lipid peroxidation [115-116].
The lung defence is performed by alveolar macrophages, which are a type of
macrophages that protect lung tissue against oxidative damage, having the ability to
scavenge iron [111-117]. In fact, superoxide generated by these recruited inflammatory
cells reduces Fe3+
to Fe2+
, allowing metal carrier proteins (i.e., DMT1) to transport
32
metal across the cell membrane to intracellular sites where it can be detoxified [118-
119]. A second mechanism limits the capacity of iron to generate free radicals and is
played by ferritin the iron storage protein [120].
The presence of contaminating transition metals, catalysts used in the synthesis of
carbon nanotubes, is considered an important determinant of their toxicity [121]. Some
studies have reported that CNTs, like asbestos, are capable of inducing ROS generation
and oxidative stress [71,122,123]. For example, unpurified single-walled carbon
nanotubes with 30% of iron impurities showed to cause severe oxidative stress in
human keratinocytes and bronchial epithelial cells [71,124,125].
1.3.3 New approaches for Nanotoxicology: imaging and elemental
analysis by Synchrotron-based X-ray Fluorescence
Biologists and life scientists are enjoying a number of very interesting experimental
developments revolving around X-ray based probes [126]. This has been happening
largely due to third generation synchrotron light sources becoming operational, coupled
with advancements in the fabrication of X-ray optics [127,128,129,130]. Their
combination allows imaging of biological samples at a resolution that is reaching the 10
nm limit.
The scattering of X-rays by solid matter is governed by several interactions, which are
in turn used to gain information about the sample topography (in the case of imaging),
elemental composition (in the case of X-Ray Fluorescence, XRF), or chemical status (in
the case of X-ray Absorption Near Edge Spectroscopy, XANES).
In the course of this work, part of the synchrotron-based experiments involved imaging
and XRF analysis of tissues and cells. The two techniques are often present in the same
end-station, and experiments are often conducted in parallel. An X-ray beam, produced
by a suitable device in the storage ring of a third generation synchrotron light source, is
steered and monochromatized to the working energy by a set of conditioning optical
elements. A lens working on the basis of Fresnel diffraction (called Zone Plate, ZP)
then focuses the beam onto the sample, which is raster-scanned under the beam. A set of
further optical elements, namely a central stop and an Order Sorting Aperture (OSA),
reduce the contribution of unwanted diffraction orders, thereby increasing the signal-to-
noise ratio. A detector downstream the sample collects the transmitted photons,
allowing for a micro-radiography to be constructed onto a computer screen.
33
The primary beam impinging on the sample also excites the characteristics X-ray
fluorescence of the atoms constituting the specimen. When collected and analyzed,
these spectra allow determining the elemental composition of the area that has been
scanned (Figure 8).
Figure 8. Schematics of a typical X-ray fluorescence microscopy end-station.
This is a very valuable tool for the biologist, since it can reveal the variation of the
atomic composition of specimens treated in various ways.
Pascolo L. et al. [87] demonstrated the potential of the advanced synchrotron-based X-
ray imaging and microspectroscopy techniques for studying the response of the lung
tissue to the presence of asbestos fibres. The X-ray absorption and phase contrast
images and the simultaneously monitored XRF maps of tissue samples allowed to
reveal the location, distribution and elemental composition of asbestos bodies and
associated nanometric structures. Another work of Pascolo L. et al. [111] showed iron
mobilization features during asbestos permanence in lung tissue by combination of
advanced synchrotron-based X-ray imaging and micro-spectroscopic techniques. The
XRF elemental mapping allowed clear identification of asbestos fibre and asbestos body
shape, determined from silicon and iron distributions respectively, while phosphorus
and sulphur signals are used to recognise cell morphologies in unstained histological
sections.
34
Marmorato P. et al. [131] investigated the distribution of CoFe2O4 NPs in mouse
Balb/3T3 fibroblasts, exploring also possible chemical changes of the NPs once
penetrated inside the cells. The study demonstrated that the sensitivity of synchrotron-
based X-ray fluorescence is useful to reveal not only the spatial distribution of the NPs
in Balb/3T3 cells exposed to different NPs concentrations but also the possible changes
in the NPs composition as result of intracellular interactions.
1.3.4 Asbestos as inductor of carcinogenesis microenvironment: Do
carbon nanotubes behave like asbestos?
The mechanisms of nanotubes toxicity are not fully understood, but the points of
similarity with asbestos fibres are shown, as described above.
Both asbestos and carbon nanotubes have attracted a great deal of research to evaluate
their carcinogenic potential in human health. In fact, fibrous materials may have the
potential to transform normal cells into cancer cells by causing chromosomal
aberrations and/or gene mutations that can lead to invasion and destruction of the
surrounding tissue.
Figure 9. Long fibres interact with epithelial and mesothelial cells and trigger macrophage activation in
tissues, with chronic inflammation. Epithelial and mesothelial cells with fibres inside can become cancer
cells causing lung cancer and mesothelioma, respectively.
A study reported that fibrous material induces carcinogenesis in mesothelial cells or
epithelial cells, while macrophages are not affected [132]. After fibre exposure, some of
35
these cells undergo apoptosis or programmed necrosis. The cells with the long fibres
inside which are able to evade the killing mechanisms and can become cancer cells
(Figure 9).
Fibre carcinogenicity associated with development of lung cancer and mesothelioma is
well documented for asbestos fibres. Direct mechanisms of asbestos fiber
carcinogenesis include genotoxic and non-genotoxic (mitogenic and citotoxic) pathways
(Table 1) [133]. Asbestos fibres can promote carcinogenicity through iron-dependent
generation of reactive metabolites, such as superoxide, hydrogen peroxide, hydroxyl
radical, and nitric oxide [134]. ROS produced by asbestos can damage cellular
environment through lipid peroxidation and oxidative DNA damage (i.e., oxidative
DNA adducts, DNA single- and double-strand breaks, mutations and chromosomal
aberrations) [135]. Carbon nanomaterials may cause generation of ROS both directly, in
the presence of redox-active transition metals, and indirectly, as a result of ROS
production by target cells [71-124]. Preliminary evidence demonstrated that carbon
nanotubes may also be genotoxic [107-136].
The fibre interaction with the mitotic spindle can cause chromosomal abnormalities
inducing the genetic instability (i.e., micronuclei and chromosomal imbalances,
aneuploidy or polyploidy). Direct interference with the mitotic apparatus could lead to
aneuploidy or polyploidy, and these chromosomal alterations are reported in human
mesotheliomas [133,137,138]. It has been reported that carbon nanomaterials interfere
with mitosis and induce aneuploidy in hamster lung fibroblasts [107] and in a human
lung epithelial cell line [136].
It has also been showed that asbestos fibres induce the activation of downstream
mitogen-activated protein kinase (MAPK) signaling leading to chronic cellular
proliferation [139]. Recently, it has been demonstrated that carbon nanomaterials, like
asbestos fibers, may activate some of the same stress-response pathways; for example,
SWCNT-induced oxidative stress is associated with NF-κB activation via MAPK
signalling in human keratinocytes as well as in normal and malignant mesothelial cells
[140]. In human fibroblasts, exposure to MWCNTs activates genes involved in
p38/MAPK stress-signalling cascade [141].
36
Table 1. Direct and indirect mechanisms of fibre carcinogenesis. SOURCE: Bernstein et al. (2005) [142].
The mechanisms mentioned above are the direct mechanisms of fibre carcinogenesis.
Multiple indirect mechanisms may contribute to a synergistic interaction between fibres
and carcinogenesis, as shown in Table 1 [142]. Asbestos fibres may also exert their
carcinogenic effects by indirect mechanisms. Epidemiological studies suggested that
tobacco smoking can alter mucociliary functions and cause a reduced mucociliary
clearance from the bronchi and alveoli increasing the risk for lung cancer after asbestos
exposure [143-144]. The high surface area of asbestos fibres may facilitate adsorption
of polycyclic aromatic hydrocarbons (PAHs), transport them into the lungs, and
facilitate metabolic activation [133-145]. PAHs and asbestos fibres can be synergistic in
causing squamous metaplasia in vitro [134-146].
The combined effects of asbestos fibres and tobacco smoke on development of lung
cancer may be explained at a molecular level. Asbestos exposure can increase K-ras and
p53 gene mutations, enhancing chromosomal instability [147]. Some smokers may be
genetically predisposed to lung cancer as a result of mutations in DNA repair pathways
[128-142]. Alternatively, acquired mutations or deletions in key genes involved in DNA
repair may facilitate accumulation of additional genetic mutations induced by tobacco-
smoke carcinogens during early stages of development of lung cancer [133-149].
Epigenetic mechanisms (such as DNA methylation or histone modifications) play a role
in carcinogenesis and cellular functions, including the regulation of inflammatory gene
expression, DNA repair, and cell proliferation. For example, chronic inflammation and
37
generation of ROS are also associated with epigenetic gene silencing induced by
hypermethylation [150]. Epigenetic silencing of tumor suppressor genes are described
in human lung cancers [151] and in human malignant mesotheliomas [152].
SV40 (polyomavirus) may act as a cofactor in the pathogenesis of malignant
mesothelioma [153]. However, a role for SV40 as a carcinogen or co-carcinogen is
demonstrated in cellular and animal models on basis of molecular mechanisms of action
[154]. Human mesotheliomas containing SV40 viral sequences showed a significantly
higher index of gene methylation [133]. One of the most frequently methylated genes,
RASSF1A, is progressively methylated during passage of SV40-infected mesothelial
cells in vitro [155].
Persistent inflammation in response to biopersistent asbestos fibers may lead to
secondary genotoxicity caused by release of reactive oxygen and reactive nitrogen
species from activated macrophages [156]. It has been reported that ROS contribute to
alter DNA methylation [157]. Activated macrophages, recruited in the lungs, produce
chemokines, cytokines, proteases, and growth factors causing cell proliferation [158], as
well as adducts, oxidized bases, single- and double-strand breaks [145]. These lesions
can culminate in mutagenic events if they are not repaired. It has been demonstrated that
asbestos-induced TNF-α release is associated with upregulation of TNF-α receptor on
mesothelial cells, as well as NF-κB activation, suggesting that activation of prosurvival
pathways by inflammatory cytokines may prolong the exposure of mesothelial cells to
the genotoxic effects of asbestos fibers [159]. A recent work showed that mice deficient
in Vitamin E, a potent antioxidant, have an enhanced inflammatory and fibrotic
response after exposure to SWCNTs. These events are accompanied by increased
recruitment of inflammatory cells and enhanced production of proinflammatory (TNF-α
and interleukin-6) and profibrotic (TGF -β) cytokines [160].
1.4 Role of genetic predisposition in cancer development during
nanomaterial exposure: BAP1, a promising candidate gene in susceptibility
to mesothelioma.
Recent epidemiological studies have shown a strong correlation between NMs,
respiratory and cardiovascular diseases, various cancers, and mortality. The potential
adverse effects of nanomaterials on human health also involve individual factors, such
as genetics and existing disease. For example, diseases associated with inhaled
38
nanoparticles are asthma, bronchitis, emphysema, lung cancer, and neurodegenerative
diseases, such as Parkinson’s and Alzheimer’s diseases [161]. Nanoparticles that enter
the circulatory system are related to occurrence of arteriosclerosis, and blood clots,
arrhythmia, heart diseases, and ultimately cardiac death [161]. Exposure to some
nanoparticles is associated to the occurrence of autoimmune diseases, such as: systemic
lupus erythematosus, scleroderma, and rheumatoid arthritis [161].
Genetic polymorphisms, genotoxic changes, epigenetic profiles and host factors may
play an important role in the response of humans and their sensitivity to NMs exposure.
Recently, there is growing interest in the potential of epigenetic processes can
significantly modulate cellular behaviour and potentially complex disease risk including
cancer, especially in response to NMs exposure. In vitro animal and human studies have
allowed to identify air pollutants (particulate matter, black carbon, and benzene) which
are able to modify epigenetic processes [162,163]. Epigenetic mechanisms cause
heritable changes in gene expression without changes in DNA sequence. Several
epigenetic mechanisms (i.e., DNA methylation, histone tails modifications, and non-
coding RNA expression) can be modified by exogenous influence, including
nanomaterials, altering genome functions [164-165].
On the contrary, the role of genetic variants in genes, as determinants of susceptibility
to nanomaterials, has not been widely explored. Therefore, this topic merits further
investigations in order to define candidate genes useful as potential biomarkers of NMs
susceptibility. A new approach to understand the link between genetic variation and
susceptibility to nanomaterials is the “toxicogenomics”. It has become apparent that the
effects of exposures vary greatly depending on the genotype and genetic predisposition
of an individual and may result in significant differences from no effects to severe
effects upon exposure to same dose [166].
Asbestos is the principal risk factor in the etiology of malignant mesothelioma (MM).
Malignant mesothelioma is a rare, but aggressive neoplasm, which arises from the
mesothelial lining of the pleura, peritoneum, pericardium, and tunica vaginalis.
However, on average less than 10% of exposed subjects develop mesothelioma,
suggesting the possible involvement of other risk factors. One of these risk factor is
genetic predispositions [167].
Genetic susceptibility to mesothelioma was observed in the Cappadocian villages of
Tuzkoy, Karain, and “Old” Sarihidir [168]. Although mineralogical studies showed that
all the houses appear to contain similar amounts of erionite, mesothelioma is prevalent
39
in certain families but not in others. Pedigree studies showed that tumor seems to be
inherited in an autosomal dominant pattern. The results of mineralogical studies and
pedigree analysis indicate that the MM epidemic in Cappadocia is caused by fibres
exposure in genetically predisposed individuals [169]. Genetically predisposed family
members born and raised outside the MM villages do not seem to develop cancer,
supporting the observation that the combination of genetics and erionite exposure (gene
and environment) is involved in causing MM in these villages [169].
BRCA1-associated protein 1 (BAP1) is located on chromosome 3p21, a region, which
is frequently deleted in MM and other cancers, such as cutaneous and uveal melanoma
and cancers of the lung and breast. But, it has also been reported that BAP 1 germline
mutations predispose to the development of several tumours, such as lung
adenocarcinoma and meningioma [170], uveal and cutaneous melanoma as well as
atypical melanocytic tumours, which they call “melanocytic BAP1-mutated atypical
intradermal tumours” (MBAITs) [171]. Testa et al. [167] demonstrated that BAP1
germline mutations are associated with uveal melanoma and malignant mesothelioma.
This study suggested that individuals with uveal melanoma who carry germline BAP1
mutations have a high risk of developing mesothelioma when exposed to asbestos.
Figure 10. Schematic representation of BAP1 domains and predictive protein folding: UCH, nuclear
ubiquitin carboxy-terminal hydrolase domain; Ba, BARD1 binding domain; H, HCF-1 binding domain;
Br, BRCA1 binding domain; NLS, nuclear localization signal. Possible mechanisms of BAP1 function:
I) BAP1 had deubiquitinase activity, II) BAP1 regulates gene transcription via association with other
protein partners; III) BAP1 performs the epigenetic regulation with other members of the polycomb-
group proteins (PcG) of highly conserved transcriptional repressors.
40
BAP1 is a 729 residue, nuclear-localized deubiquitinating enzyme with an ubiquitin
carboxy-terminal hydrolase function (Figure 10) [172]. But, a nuclear protein BAP1
performs other several functions, including transcriptional regulation, chromatin
regulation, and forming part of multiprotein complexes that regulate cellular
differentiation, gluconeogenesis, cell cycle checkpoints, transcription and apoptosis
[173]. It has been suggested to be a tumour suppressor gene with a role in cell
proliferation and growth inhibition [174].
Only a few mutations common in malignant mesothelioma have been identified so far.
The recent findings of a study on peritoneal mesothelioma discovered two genes which
are associated with a shorter survival: CDKN2A and NF2 [175]. Molecular genetic
study has revealed frequent inactivation in CDKN2A and NF2 genes. The most
common genetic alterations are homozygous 9p21 deletions centered on CDKN2A
found in up to 72% of tumours and 80 % of MPM cell lines [176] and NF2, located on
chromosome 22q12, mutated in 50% of pleural mesotheliomas with corresponding loss
of the wild-type allele by deletion of either 22q or all of chromosome 22. Hemizygous
loss of NF2 is associated with increased mesothelioma proliferation, invasiveness,
spreading, and migration [177].
Carbone M. of the University of Hawaii Cancer Center and other researchers
demonstrated that mesothelioma patients with the BAP1 mutation live at least four
years longer than those without the genetic mutation: the five-year survival rate was to
about 47% for those with the mutation, respect to the relative survival rate of just 6.7%.
Therefore, it seems BAP1 increases the risk of developing mesothelioma, but it also
improves chances of long-term survival [178]. Based on these results, the BAP1 gene
could be used as a prognostic tumour factor. Moreover, the discovery of a genetic
predisposition could be useful to determine the high-risk versus low-risk groups of
asbestos-exposed individuals by using a novel non invasive biomarkers [179].
1.5 General conclusions
Nanotechnology is a fast growing field that will allow for development of materials
with new properties. The number of subjects exposed to NMs will increase over the
next few years, in a context in which the impact of NMs on occupational health and
safety is already difficult to predict. The main factors that determine the toxicological
effects of NMs in the body are the characteristics of the exposure (e.g. penetration route,
41
duration, and concentration), of the exposed organism (e.g. individual susceptibility,
activity at time of exposure, and the particular route the NMs follow in the body), and
the intrinsic toxicity of NMs (e.g. catalytic activity, composition, electronic structure,
capacity to bind or coat surface species, surface area). During the last decade, there
were many studies into the effects of nanomaterials on the respiratory tract and, via
systemic distribution, on the internal biological barriers (blood-brain, blood-testis and
the placenta barriers). It is therefore critically important to understand the nature of the
biological barriers and how NMs may cross them, or interact with their cellular
components.
Carbon nanotubes are promising product in industry and medicine, but there are several
concerns for human pulmonary exposure due to their similarities with asbestos, which
caused a pandemic disease in the 20th
century that continues into present. A growing
body of literature assesses the potential health risk to workers and others subjects (i.e.,
consumers and/or patients). Therefore, the evaluation through in vitro studies to
investigate inflammatory and genotoxicity effects of CNTs is becoming urgent.
In general, the penetration and deposition depth of inhaled fibres is determined by their
length, thickness and biopersistence, in accordance with the “fibre pathogenicity
paradigm”. However, in addition to size and geometry of fibers, the composition and
surface properties seem to play a major role in biological activities. Particularly, the
presence of transition metals (iron) onto the fiber surface is thought to be responsible
for the genotoxic and cytotoxic effects of asbestos fibres by generating oxygen reactive
species. Similarly the presence of metals as trace contaminants during CNT preparation,
in particular iron (Fe) impurities, plays an important role in cellular response. In fact,
iron content in CNTs is one of the primary sources of damage, with increased oxidative
stress and inflammatory responses.
A combination of advanced techniques could be useful in order to unravel the toxic
effects of nanomaterials. In our case, X-ray imaging and X-ray fluorescence microscopy
synchrotron-based techniques allowed to monitor and investigate at high spatial
resolution the presence of iron and other biological elements in cells exposed to
nanomaterials without artefacts (such as the pre-treatment of the sample in conventional
microscopies), and with correlated morphological information.
Although DNA is a stable and well-protected molecule, ROS generated by fibres can
interact with DNA and cause several types of chemical changes. Their main effects
include the oxidation of DNA nucleobases, de-purination and DNA strand breaks.
42
Raman spectroscopy is extensively used in biology field to characterize the chemical
structure of DNA and to reveal specific changes such as the formation of oxidative
products and chain breaks. Moreover, conventional molecular techniques are
indispensable to evaluate the genetic factors which are involved in susceptibility to
nanomaterial exposure.
Therefore, the goal of nanotoxicology should be to recognize the potential harmful risk
of nanomaterials. The multidisciplinary approach will help shedding light on the
mechanisms underlying NMs toxicity in cellular models.
1.6 Aims of the research
My Ph.D. work aimed to contribute in the field of nanotoxicology by unravelling the
possible toxic effects and the epigenetic changes induced by two types of nanomaterials
(NMs), namely asbestos and carbon nanotubes (CNTs), in two internal biological
barriers: the pleura and the placenta.
Appropriate cell line models allowed investigating the chemical properties and
reactivity of these nanomaterials, ultimately affecting total cell uptake and toxicity. My
project used a combination of advanced techniques, synchrotron-based X-ray
fluorescence (XRF) and X-ray microscopy (XRM), as well as more conventional
imaging tools, such as Scanning Electron Microscope, SEM, and Atomic Force
Microscope, AFM, to reveal unknown features of toxic effects of NMs in biological
systems.
Moreover, the attention has been given to a new important aspect of nanotoxicology,
toxicogenomic. In a 2011 study conducted by researchers at the University of Hawaii
Cancer Center and Fox Chase Cancer Center in Philadelphia, Pennsylvania, it was
discovered that people who carried a mutation in BAP1 were susceptible to developing
asbestos-related disease, such as mesothelioma. When these individuals were exposed
to asbestos or a similar mineral like erionite had a higher risk of developing cancer. To
better understand the relationship between environmental exposure and genetic factors
in development of masothelioma we had the opportunity to analyze twenty-nine
samples of lung tissues from asbestos-exposed patients.
The research also aimed to detect the ability of nanomaterials to exert long-term effects
that could lead to genotoxic damage. For this purpose, Raman spectroscopy was
employed, as it allowed evaluating the toxic mechanisms of NMs on DNA, by revealing
43
the chemical changes that alter the DNA following oxidative stress. In particular, the
advantage of this spectroscopic technique seems to be to quickly identify a “fingerprint”
of the oxidative chemical changes, which in turn can be specifically assigned to the
various nitrogen bases.
References
[1] Lynn Goldman and Christine Coussens, Editors, Roundtable on Environmental
Health Sciences, Research and Medicine. Implications of Nanotechnology for
Environmental Health Research. ISBN: 0-309-54835-7, 70 pages (2005).
[2] Hulla JE, Sahu SC, Hayes AW. Nanotechnology: History and future. Hum Exp
Toxicol. 2015 Dec;34(12):1318-21.Review.
[3] Taniguchi N. On the basic concept of „nano-technology‟ Proc Intl Conf Prod Eng
Tokyo, Part II, (1974) Japan Society of Precision Engineering, 5–10.10
[4] Borm PJ, Robbins D, Haubold S, Kuhlbusch T, Fissan H, Donaldson K, Schins R,
Stone V, Kreyling W, Lademann J, Krutmann J, Warheit D, Oberdorster E. The
potential risks of nanomaterials: a review carried out for ECETOC. Part Fibre
Toxicol. 2006 Aug 14;3:11.
[5] Hansen SF. Regulation and risk assessment of nanomaterials: too little, too late?
PhD thesis, (2009) Technical University of Denmark.
[6] Florence Sanchez , Konstantin Sobolev. Nanotechnology in concrete – A review.
Construction and Building Materials 24 (2010) 2060–2071.
[7] Vijaykumar B. Sutariya,Yashwant Pathak. Biointeractions of Nanomaterials. CRC
Press, Taylor & Francis Group (2014).
[8] Charles Lutz,Jeffery A. Steevens. Nanomaterials: Risks and Benefits. Springer
(2008).
[9] S. Logothetidis Editors. Nanostructured materials and their applications. Chapter 1.
Nanotechnology: Principles and Applications. ISBN 9783642222276, Springer
(2012).
[10] PEN 2011. The project on emerging nanotechnologies.www.nanotechproject.org
[11] Paur HR, Cassee FR, Teeguarden J, Fissan H, Diabate S, Aufderheide M, Kreyling
WG, et al. In-vitro cell exposure studies for the assessment of nanoparticle toxicity
in the lung−A dialog between aerosol science and biology. J Aerosol Sci 42:668-692
(2011).
44
[12] Foss Hansen S, Maynard A, Baun A, Tickner JA. Late lessons from early
warnings for nanotechnology. Nat Nanotechnol. 2008 Aug; 3(8):444-7. Epub 2008 Jul
20.
[13] Oberdörster G, Oberdörster E, Oberdörster J. Nanotoxicology: an emerging
discipline evolving from studies of ultrafine particles. Environ Health Perspect 2005,
113:823-839.
[14] Pedata P, Petrarca C, Garzillo EM, Di Gioacchino M. Immunotoxicological
impact of occupational and environmental nanoparticles exposure: The influence
of physical, chemical, and combined characteristics of the particles. Int J
Immunopathol Pharmacol (2015).
[15] Gatoo MA, Naseem S, Arfat MY, Dar AM, Qasim K, Zubair S. Physicochemical
properties of nanomaterials: implication in associated toxic manifestations. Biomed
Res Int. 2014;2014:498420.
[16] Kim ST, Chompoosor A, Yeh YC, Agasti SS, Solfiell DJ, Rotello VM.
Dendronized gold nanoparticles for siRNA delivery. Small. 2012 Nov 5; 8(21):3253-
6.
[17] K.H. Park, M. Chhowalla, Z. Iqbal, and F. Sesti. Single-walled carbon nanotubes
are a new class of ion channel blockers. Journal of Biological Chemistry, vol. 278, no.
50, pp. 50212–50216, 2003.
[18] Nancy A. Monteiro-Riviere, C. Lang Tran. Nanotoxicology. Characterization,
dosing and health effects.
[19] Kim TH, Kim M, Park HS, Shin US, Gong MS, Kim HW. Size-dependent
cellular toxicity of silver nanoparticles. J Biomed Mater Res A. 2012
Apr;100(4):1033-43.
[20] A. Verma and F. Stellacci. Effect of surface properties on nanoparticle-cell
interactions. Small, vol. 6, no. 1, pp. 12–21, 2010.
[21] M. Lippmann. Effects of fiber characteristics on lung deposition, retention, and
disease. Environmental Health Perspectives, vol. 88, pp. 311–317, 1990.
[22] C. A. Poland, R. Duffin, I. Kinloch et al. Carbon nanotubes introduced into the
abdominal cavity of mice show asbestoslike pathogenicity in a pilot study. Nature
Nanotechnology, vol. 3, no. 7, pp. 423–428, 2008.
[23] Jiang J, Oberdorster G and Biswas P. Characterization of size, surface charge
and agglomeration state of nanoparticle dispersions for toxicological studies.
Journal of Nanoparticle Research (2009) 11:77–89.
45
[24] Buzea C, Pacheco B and Robbie K. Nanomaterials and nanoparticles: Sources
and toxicity. (2007) Biointerphases 2: 17–71.
[25] Yokel RA, Macphail RC. Engineered nanomaterials: exposures, hazards, and
risk prevention. J Occup Med Toxicol. 2011 Mar 21;6:7.
[26] Harishchandra RK, Saleem M, Galla HJ. Nanoparticle interaction with model
lung surfactant monolayers. J Royal Soc, Interface 2010, 7:S15-S26.
[27] Oberdörster G, Sharp Z, Atudorei V, Elder A, Gelein R, Kreyling W, Cox C.
Translocation of inhaled ultrafine particles to the brain. Inhal Toxicol 2004, 16:437-
445.
[28] Meier R, Cascio WE, Danuser B, Riediker M. Exposure of highway maintenance
workers to fine particulate matter and noise. Ann Occup Hyg. 2013 Oct;57(8):992-
1004.
[29] Tan MH, Commens CA, Burnett L, Snitch PJ. A pilot study on the percutaneous
absorption of microfine titanium dioxide from sunscreens. Australasian J Dermatol
1996, 37:185-187.
[30] Yacobi NR, Fazllolahi F, Kim YH, Sipos A, Borok Z, Kim KJ, Crandall ED.
Nanomaterial interactions with and trafficking across the lung alveolar epithelial
barrier: implications for health effects of air-pollution particles. Air Qual Atmos
Health. 2011 Mar 1;4(1):65-78.
[31] Zimmer A, Kreuter J, Robinson JR. Studies on the transport pathway of PBCA
nanoparticles in ocular tissues. J Microencapsul 1991, 8:497-504.
[32] Pietroiusti A, Campagnolo L, Fadeel B. Interactions of engineered nanoparticles
with organs protected by internal biological barriers. Small. 2013 May 27;9(9-
10):1557-72.
[33] Ochs M, Weibel ER. Functional design of the human lung for gas exchange. In:
Fishman AP, Elias JA, Fishman JA, Grippi MA, Senior RM, Pack A, editors. Fishman’s
Pulmonary Diseases and Disorders. 4th edition ed. New York: McGrawHill; 2008.
[34] Jud C, Clift MJ, Petri-Fink A, Rothen-Rutishauser B. Nanomaterials and the
human lung: what is known and what must be deciphered to realise their potential
advantages? Swiss Med Wkly. 2013 Feb 27;143.
[35] Nicod LP. Lung defenses: an overview. Eur Respir Rev. 2005;95:45-50.
[36] Kilburn KH. A hypothesis for pulmonary clearance and its implications. Am
Rev Respir Dis. 1968;98(3):449-63.
46
[37] Wolfgang Luther, Axel Zweck. Safety Aspects of Engineered Nanomaterials.
Hardback 398 pages 2013-06-30. Chapter 6 – Uptake of nanoparticles by the lung.
[38] Hitesh Batra and Veena B. Antony. Pleural mesothelial cells in pleural and lung
diseases. J Thorac Dis. 2015 Jun; 7(6): 964–980.
[39] Owens MW, Grisham MB. Nitric oxide synthesis by rat pleural mesothelial
cells: induction by cytokines and lipopolysaccharide.Am J Physiol 1993;265:L110-6.
[40] Schurch S, Gehr P, Im Hof V, Geiser M, Green F. Surfactant displaces particles
toward the epithelium in airways and alveoli. Respir Physiol. 1990;80(1):17-32.
[41] Sweeney S, Grandolfo D, Ruenraroengsak P, Tetley TD. Functional
consequences for primary human alveolar macrophages following treatment with
long, but not short, multiwalled carbon nanotubes. Int J Nanomedicine. 2015 Apr
23;10:3115-29.
[42] Geiser M, Rothen-Rutishauser B, Kapp N, Schürch S, Kreyling W, Schulz H,
Semmler M, Im Hof V, Heyder J, Gehr P. Ultrafine particles cross cellular
membranes by nonphagocytic mechanisms in lungs and in cultured cells. Environ
Health Perspect. 2005 Nov;113(11):1555-60.
[43] Buerki-Thurnherr T, von Mandach U, Wick P. Knocking at the door of the
unborn child: engineered nanoparticles at the human placental barrier. Swiss Med
Wkly. 2012 Apr 5;142:w13559.
[44] Saunders M. Transplacental transport of nanomaterials. Wiley Interdiscip Rev
Nanomed Nanobiotechnol. 2009 Nov-Dec;1(6):671-84.
[45] Bode CJ, Jin H, Rytting E, Silverstein PS, Young AM, et al. In vitro models for
studying trophoblast transcellular transport. Methods Mol Med 2006, 122:225–239.
[46] Khanna P, Ong C, Bay BH, Baeg GH. Nanotoxicity: An Interplay of Oxidative
Stress, Inflammation and Cell Death. Nanomaterials 2015, 5, 1163-1180.
[47] Smith MJ, Brown JM, Zamboni WC, Walker NJ. From immunotoxicity to
nanotherapy: the effects of nanomaterials on the immune system. Toxicol Sci. 2014
Apr;138(2):249-55.
[48] Feldt–Rasmussen U, Mathiesen, ER. Endocrine disorders in pregnancy:
Physiological and hormonal aspects of pregnancy. Best Pract. Res. Clin. Endocrinol.
Metab. 2011, 25, 875–884.
[49] Wick P, et al. Barrier capacity of human placenta for nanosized materials.
Environ Health Perspect. 2010;118(3):432–6.
47
[50] Fedulov AV, Leme A, Yang Z, Dahl M, Lim R, Mariani TJ, Kobzik L. Pulmonary
exposure to particles during pregnancy causes increased neonatal asthma
susceptibility. Am. J. Respir. Cell Mol. Biol. 2008, 38, 57.
[51] Yamashita K, Yoshioka Y, Higashisaka K, Mimura K, Morishita Y, Nozaki M,
Yoshida T, Ogura T, Nabeshi H, Nagano K. Silica and titanium dioxide nanoparticles
cause pregnancy complications in mice. Nat. Nanotechnol. 2011, 6, 321–328.
[52] Park E.-J, Kim H, Kim Y, Park K. Effects of platinum nanoparticles on the
postnatal development of mouse pups by maternal exposure. Environ. Health
Toxicol. 2010, 25, 279–286.
[53] Austin CA, Umbreit TH, Brown KM, Barber DS, Dair BJ, Francke-Carroll S,
Feswick A, Saint-Louis MA, Hikawa H, Siebein KN, et al. Distribution of silver
nanoparticles in pregnant mice and developing embryos. Nanotoxicology 2012, 6,
912–922.
[54] Hougaard KS, Campagnolo L, Chavatte-Palmer P, Tarrade A, Rousseau-Ralliard
D, Valentino S, Park MV, de Jong WH, Wolterink G, Piersma AH, Ross BL, Hutchison
GR, Hansen JS, Vogel U, Jackson P, Slama R, Pietroiusti A, Cassee FR. A perspective
on the developmental toxicity of inhaled nanoparticles. Reprod Toxicol. 2015 Aug
15;56:118-40.
[55] Agmon Y, Khandheria BK, Meissner I, Schwartz GL, Petterson TM, O’Fallon
WM, Whisnant JP, Wiebers DO, Seward JB. Relation of coronary artery disease and
cerebrovascular disease with atherosclerosis of the thoracic aorta in the general
population. Am. J. Cardiol. 2002, 89, 262–267.
[56] Li Z, Hulderman T, Salmen R, Chapman R, Leonard SS, Young SH, Shvedova A,
Luster MI, Simeonova PP. Cardiovascular effects of pulmonary exposure to single-
wall carbon nanotubes. Environ. Health Perspect. 2007, 115, 377.
[57] Xu YY, Yang J, Shen T, Zhou F, Xia Y, Fu JY, Meng J, Zhang J, Zheng YF, Yang
J. Intravenous administration of multi-walled carbon nanotubes affects the
formation of atherosclerosis in sprague-dawley rats. J. Occup. Health 2012, 54, 361–
369.
[58] Kim CS, Kang TC. Comparative measurement of lung deposition of inhaled
fine particles in normal subjects and patients with obstructive airway disease. Am.
J. Respir. Crit. Care Med. 1997, 155, 899–905.
48
[59] Chalupa DC, Morrow PE, Oberdörster G, Utell MJ, Frampton MW. Ultrafine
particle deposition in subjects with asthma. Environ. Health Perspect. 2004, 112,
879.
[60]Fröhlich E. Value of phagocyte function screening for immunotoxicity of
nanoparticles in vivo. Int J Nanomedicine. 2015 May 26;10:3761-78.
[61] Chen Z, Meng H, Xing G, Yuan H, Zhao F, Liu R, Chang X, Gao X, Wang T, Jia
G. Age-related differences in pulmonary and cardiovascular responses to SiO2
nanoparticle inhalation: Nanotoxicity has susceptible population. Environ. Sci.
Technol. 2008, 42, 8985–8992.
[62] Lu S, Zhang W, Zhang R, Liu P, Wang Q, Shang Y, Wu M, Donaldson K, Wang
Q. Comparison of cellular toxicity caused by ambient ultrafine particles and
engineered metal oxide nanoparticles. Part Fibre Toxicol. 2015 Mar 19;12:5.
[63] Kim IS, Baek M, Choi SJ. Comparative cytotoxicity of Al2O3, CeO2, TiO2 and
ZnO nanoparticles to human lung cells. J Nanosci Nanotechnol. 2010
May;10(5):3453-8.
[64] Gurr JR, Wang AS, Chen CH, Jan KY. Ultrafine titanium dioxide particles in
the absence of photoactivation can induce oxidative damage to human bronchial
epithelial cells. Toxicology. 2005 Sep 15;213(1-2):66-73.
[65] Davoren M, Herzog E, Casey A, Cottineau B, Chambers G, Byrne HJ, Lyng FM.
In vitro toxicity evaluation of single walled carbon nanotubes on human A549 lung
cells. Toxicol In Vitro. 2007 Apr;21(3):438-48.
[66] Jia G, Wang H, Yan L, Wang X, Pei R, Yan T, Zhao Y, Guo X. Cytotoxicity of
carbon nanomaterials: single-wall nanotube, multi-wall nanotube, and fullerene.
Environ Sci Technol. 2005 Mar 1;39(5):1378-83.
[67] Murphy FA, Schinwald A, Poland CA, Donaldson K. The mechanism of pleural
inflammation by long carbon nanotubes: interaction of long fibres with
macrophages stimulates them to amplify pro-inflammatory responses in
mesothelial cells. Part Fibre Toxicol. 2012;9:8.
[68] Mercer RR, Scabilloni J, Wang L, Kisin E, Murray AR, Schwegler-Berry D,
Shvedova AA, Castranova V. Alteration of deposition pattern and pulmonary
response as a result of improved dispersion of aspirated single-walled carbon
nanotubes in a mouse model. Am J Physiol Lung Cell Mol Physiol. 2008;294:L87–
L97.
49
[69] Semmler-Behnke M, et al. Biodistribution of 1.4- and 18-nm gold particles in
rats. Small. 2008;4(12):2108–11.
[70] Myllynen PK, et al. Kinetics of gold nanoparticles in the human placenta.
Reprod Toxicol. 2008;26(2):130–7.
[71] Sanchez VC, Pietruska JR, Miselis NR, Hurt RH, Kane AB. Biopersistence and
potential adverse health impacts of fibrous nanomaterials: what have we learned
from asbestos? Wiley Interdiscip Rev Nanomed Nanobiotechnol (2009), 1:511-529.
[72] Kamp DW. Asbestos-induced lung diseases: an update. Transl Res 2009,
153:143-152.
[73] K. Donaldson. The inhalation toxicology of p-aramid fibrils. Crit. Rev. Toxicol.
39 (2009) 487–500.
[74] Kolosnjaj J, Szwarc H, Moussa F. Toxicity studies of carbon nanotubes. Adv
Exp Med Biol 2007, 620:181-204.
[75] Donaldson K, Aitken R, Tran L, Stone V, Duffin R, Forrest G, Alexander A.
Carbon nanotubes: A review of their properties in relation to pulmonary
toxicology and workplace safety. Toxicol Sci 2006, 92:5-22.
[76] Ju-Nam Y, Lead JR. Manufactured nanoparticles: An overview of their
chemistry, interactions and potential environmental implications. Sci Total Environ
2008, 400:396-414.
[77] J. Muller, F. Huaux, N. Moreau, P. Misson, J.F. Heilier, M. Delos, et al.
Respiratory toxicity of multi-wall carbon nanotubes. Toxicol. Appl. Pharmacol. 207
(2005) 221–231.
[78] A.A. Shvedova, E.R. Kisin, R. Mercer, A.R. Murray, V.J. Johnson, A.I.
Potapovich, et al. Unusual inflammatory and fibrogenic pulmonary responses to
single-walled carbon nanotubes in mice. Am. J. Physiol. Lung Cell. Mol. Physiol. 289
(2005) L698–L708.
[79] Poland CA, Duffin R, Kinloch I et al. Carbon nanotubes introduced into the
abdominal cavity of mice show asbestos-like pathogenicity in a pilot study. Nat
Nanotechnol 2008; 3: 423–8.
[80] Mutlu GM, Budinger GR, Green AA et al. Biocompatible nanoscale dispersion
of single-walled carbon nanotubes minimizes in vivo pulmonary toxicity. Nano Lett
2010; 10: 1664–70.
[81] Moolgavkar SH, Brown RC, Turim J. Biopersistence, fiber length, and cancer
risk assessment for inhaled fibers. Inhal Toxicol 2001;13(9):755–772.
50
[82] Hesterberg TW, Chase G, Axten C et al. Biopersistence of synthetic vitreous
fibers and amosite asbestos in the rat lung following inhalation. Toxicol Appl
Pharmacol 1998; 151: 262–75.
[83] Fubini B, Barcelo F, Otero Arean C. Ferritin adsorption on amosite fibers:
possible implications in the formation and toxicity of asbestos bodies. J Toxicol
Environ Health 1997;52(4):343–352.
[84] Ghio AJ, Stonehuerner J, Richards J, Devlin RB. Iron homeostasis in the lung
following asbestos exposure. Antioxid Redox Signal 2008;10(2):371–377.
[85] Nagai H, Toyokuni S. Differences and similarities between carbon nanotubes
and asbestos fibers during mesothelial carcinogenesis: shedding light on fiber
entry mechanism. Cancer Sci. 2012 Aug;103(8):1378-90.
[86] Donaldson K, Poland CA, Murphy FA, MacFarlane M, Chernova T, Schinwald A.
Pulmonary toxicity of carbon nanotubes and asbestos - similarities and differences.
Adv Drug Deliv Rev. 2013 Dec;65(15):2078-86.
[87] Pascolo L, Gianoncelli A, Kaulich B, Rizzardi C, Schneider M, Bottin C,
Polentarutti M, Kiskinova M, Longoni A, Melato M. Synchrotron soft X-ray imaging
and fluorescence microscopy reveal novel features of asbestos body morphology
and composition in human lung tissues. Part Fibre Toxicol. 2011 Feb 7;8(1):7
[88] Hardy J, Aust A. Iron in asbestos chemistry and carcinogenicity. Chem Rev
1995;95:97–118.
[89] Guo L, Morris D, Liu X, Vaslet C, Hurt R, et al. Iron bioavailability and redox
activity in diverse carbon nanotube samples. Chem Mater 2007;19:3472-3478.
[90] Pott F, Ziem U, Reiffer FJ, Huth F, Ernst H, et al. Carcinogenicity studies on
fibres, metal compounds, and some other dusts in rats. Exp Pathol 1987;32(3):129-
152.
[91] Lee YW, Klein CB, Kargacin B, Salnikow K, Kitahara J, et al. Carcinogenic
nickel silences gene expression by chromatin condensation and DNA methylation:
a new model for epigenetic carcinogens. Mol Cell Biol 1995;15(5):2547-2557.
[92] K. Hansen, B.T.Mossman, Generation of superoxide (O2ˉ·) from alveolar
macrophages exposed to asbestiform and nonfibrous particles. Cancer Res. 47
(1987) 1681–1686.
[93] D.M. Brown, I.A. Kinloch, U. Bangert, A. Windle, D.M. Walter, G.S. Walker, et
al. An in vitro study of the potential of carbon nanotubes and nanofibres to induce
inflammatory mediators and frustrated phagocytosis. Carbon 45 (2007) 1743–1756.
51
[94] Palomaki J, Valimaki E, Sund J et al. Long, needle-like carbon nanotubes and
asbestos activate the NLRP3 inflammasome through a similar mechanism. ACS
Nano 2011; 5: 6861–70.
[95] Straif K, Benbrahim-Tallaa L, Baan R, Grosse Y, Secretan B, El Ghissassi F,
Bouvard V, Guha N, Freeman C, Galichet L, Cogliano V; WHO International Agency
for Research on Cancer Monograph Working Group. A review of human carcinogens-
-part C: metals, arsenic, dusts, and fibres. Lancet Oncol 10, 453–454 (2009).
[96] Grosse Y., Loomis D., Guyton K.Z., Lauby-Secretan B., El Ghissassi F., Bouvard
V., Benbrahim-Tallaa L., Guha N., Scoccianti C., Mattock H., Straif K.; International
Agency for Research on Cancer Monograph Working Group. International Agency for
Research on Cancer. Fluoro-edenite, silicon carbide fibres and whiskers, and single-
walled and multi-walled carbon nanotubes Lancet Oncol. 2014 Dec;15(13):1427-8.
[97] Kane AB, Macdonald JL, Moalli PA. Acute injury and regeneration of
mesothelial cells produced by crocidolite asbestos fibers. American Review Of
Respiratory Disease 1986, 133: A198.
[98] Viallat JR, Raybuad F, Passarel M, Boutin C. Pleural migration of chrysotile
fibers after intratracheal injection in rats. Arch Environ Health 1986, 41: 282–286.
[99] Poland CA, Duffin R, Kinloch I, Maynard A, Wallace WA, Seaton A, Stone V,
Brown S, Macnee W, Donaldson K. Carbon nanotubes introduced into the
abdominal cavity of mice show asbestoslike pathogenicity in a pilot study. Nat
Nanotechnol 2008, 3:423-428.
[100] Takagi A, Hirose A, Nishimura T, Fukumori N, Ogata A, Ohashi N, Kitajima S,
Kanno J. Induction of mesothelioma in p53 +/- mouse by intraperitoneal
application of multi-wall carbon nanotube. J Toxicol Sci 2008, 33:105-116.
[101] Murphy FA, Poland CA, Duffin R, Al-Jamal KT, Ali-Boucetta H, Nunes A,
Byrne F, Prina-Mello A, Volkov Y, Li S, Mather SJ, Bianco A, Prato M, Macnee W,
Wallace WA, Kostarelos K, Donaldson K. Length-dependent retention of carbon
nanotubes in the pleural space of mice initiates sustained inflammation and
progressive fibrosis on the parietal pleura. Am J Pathol. 2011 Jun;178(6):2587-600.
[102] Robert R Mercer, James F Scabilloni, Ann F Hubbs, Liying Wang, Lori A
Battelli, Walter McKinney, Vincent Castranova and Dale W Porter. Extrapulmonary
transport of MWCNT following inhalation exposure. Particle and Fibre Toxicology
(2013) 10:38.
52
[103] Sargent LM1, Porter DW, Staska LM, Hubbs AF, Lowry DT, Battelli L, Siegrist
KJ, Kashon ML, Mercer RR, Bauer AK, Chen BT, Salisbury JL, Frazer D, McKinney
W, Andrew M, Tsuruoka S, Endo M, Fluharty KL, Castranova V, Reynolds SH.
Promotion of lung adenocarcinoma following inhalation exposure to multi-walled
carbon nanotubes. Part Fibre Toxicol. 2014 Jan 9;11:3.
[104] Shvedova AA, Pietroiusti A, Fadeel B, Kagan VE. Mechanisms of carbon
nanotube-induced toxicity: focus on oxidative stress. Toxicol Appl Pharmacol (2012)
261: 121-133.
[105] Pacurari M, Qian Y, Fu W. Cell permeability, migration, and reactive oxygen
species induced by multiwalled carbon nanotubes in human microvascular
endothelial cells. J Toxicol Environ Health (2012) Part A 75: 129–47.
[106] Manke A, Wang L, Rojanasakul Y. Pulmonary toxicity and fibrogenic
response of carbon nanotubes. Toxicol Mech Methods (2013) 23:196-206.
[107] Kisin ER, Murray AR, Keane MJ, Shi XC, Schwegler-Berry D, et al. Single-
walled carbon nanotubes: geno- and cytotoxic effects in lung fibroblast V79 cells. J
Toxicol Environ Health A (2007) 70: 2071-2079.
[108] Siegrist KJ, Reynolds SH, Kashon ML, Lowry DT, Dong C, et al. Genotoxicity
of multi-walled carbon nanotubes at occupationally relevant doses. Part Fibre
Toxicol (2014) 11:6.
[109] Gurzau ES, Neagu C, Gurzau AE. Essential metals--case study on iron.
Ecotoxicol Environ Saf. 2003 Sep;56(1):190-200.
[110] Kell, D. B. Towards a unifying, systems biology understanding of large-scale
cellular death and destruction caused by poorly liganded iron: Parkinson‟s,
Huntington‟s, Alzheimer‟s, prions, bactericides, chemical toxicology and others as
examples. Arch. Toxicol. 84, 825–889 (2010).
[111] Pascolo L, Gianoncelli A, Schneider G, Salome´M, Schneider M, Calligaro C,
Kiskinova M, Melato M, Rizzardi C. The interaction of asbestos and iron in lung
tissue revealed by synchrotronbased scanning X-ray microscopy. (2013) Scientific
Reports 3:1123.
[112] Fubini, B. & Mollo, L. Role of iron in the reactivity of mineral fibers. Toxicol.
Lett 82–83, 951–960 (1995).
[113] Wang X, Wu Y, Stonehuerner JD, Dailey LA, Richards JD, Jaspers I, Piantadosi
CA, and Ghio AJ. Oxidant generation promotes iron sequestration in BEAS-2B
cells exposed to asbestos. Am J Respir Cell Mol Biol 34: 286–292, 2006.
53
[114] Woo YT, Lai DY. Mechanism of action of chemical carcinogens and their role
in structure-activity relationship analysis and risk assessment. In Quantitative
Structure-Activity Relationship (QSAR) Models of Mutagens and Carcinogens (Ed.: R.
Benigni), CRC Press, Boca Raton, 2003, pp. 41–80.
[115] C. Riganti, E. Aldieri, L. Bergandi, I. Fenoglio, C. Costamagna, B. Fubini, A.
Bosia, D. Ghigo. Crocidolite asbestos inhibits pentose phosphate oxidative pathway
and glucose 6-phosphate dehydrogenase activity in human lung epithelial cells.
Free Radical Biol. Med. 2002, 32, 938-949.
[116] B. Fubini and C. Otero Areán. Chemical aspects of the toxicity of inhaled
mineral dusts. Chem. Soc. Rev. 1999, 28, 373 –381.
[117] Dorger, M. & Krombach, F. Interaction of alveolar macrophages with inhaled
mineral particulates. J. Aerosol Med. 13, 369–380 (2000).
[118] Ghio AJ, Pritchard RJ, Dittrich K, and Samet JM. Non-heme [Fe3+
] in the lung
increases with age in both the rat and man. J Lab Clin Med 129: 53–61, 1997.
[119] Cozzi A, Santambrogio P, Levi S, and Arosio P. Iron detoxifying activity of
ferritin. Effects of H and L human apoferritins on lipid peroxidation in vitro.
FEBS Lett 277: 119–122, 1990.
[120] Turi JL, Yang F, Garrick MD, Piantadosi CA, and Ghio AJ. The iron cycle and
oxidative stress in the lung. Free Radic Biol Med, 36: 850–857, 2004.
[121] C. L. Tran, S. M. Hankin, B. Ross, R. J. Aitken, A. D. Jones, K. Donaldson, V.
Stone, R. Tantra. An outline scoping study to determine whether or not high-aspect-
ratio nanoparticles (HARN) should raise the same concerns as do asbestos fibres.
Report on Project CD0406 [http://www.safenano.org/Uploads/HARN.pdf]. 2008,
Institute for Occupational Medicine, Edinburgh.
[122] Donaldson K, Aitken R, Tran L, Stone V, Duffin R, et al. Carbon nanotubes: a
review of their properties in relation to pulmonary toxicology and workplace
safety. Toxicol Sci 2006;92(1):5–22.
[123] Brown D, Kinloch I, Bangert U, Windle A, Walter D, et al. An in vitro study of
the potential of carbon nanotubes and nanofibres to induce inflammatory
mediators and frustrated phagocytosis. Carbon 2007;45:1743–1756.
[124] Shvedova A, Kisin E, Murray A, Schwegler-Berry D, Gandelsman V, et al.
Exposure of human bronchial cells to carbon nanotubes caused oxidative stress
and cytotoxicity. Proceedings of the Society for Free Radical Research Meeting,
European Section; Ioannina. June 26–29, 2003; p. 91-103.
54
[125] Manna S, Sarkar S, Barr J, Wise K, Barrera O, et al. Single-walled carbon
nanotube induces oxidative stress and activates nuclear transcription factor- K B
in human keratinocytes. Nano Lett 2005;5:1676–1684.
[126] Kirz, J, C Jacobsen, and M Howells. Soft X-Ray Microscopes and Their
Biological Applications. Quarterly Reviews of Biophysics 28 (1995): 33–33.
[127] D. Attwood. Soft x-rays and Extreme Ultraviolet Radiation Principles and
Applications. Cambridge University Press (1999).
[128] Sakdinawat, Anne, and David Attwood. Nanoscale X-Ray Imaging. Nature
Photonics 4, no. 12 (December 1, 2010): 840–48. doi:10.1038/nphoton.2010.267.
[129] E. Di Fabrizio, F. Romanato, M. Gentili, S. Cabrini, B. Kaulich, J. Susini, R.
Barrertt. High efficiency multilevel zone plates for keV X-rays. Nature 40, 895-898
(1999).
[130] Vila-Comamala, Joan, Sergey Gorelick, Elina Färm, Cameron M Kewish, Ana
Diaz, Ray Barrett, Vitaliy A Guzenko, Mikko Ritala, and Christian David. Ultra-High
Resolution Zone-Doubled Diffractive X-Ray Optics for the Multi-keV
Regime.Optics Express 19, no. 1 (January 3, 2011): 175–84.
[131] Marmorato P, Ceccone G, Gianoncelli A, Pascolo L, Ponti J, Rossi F, Salomé M,
Kaulich B, Kiskinova M.Cellular distribution and degradation of cobalt ferrite
nanoparticles in Balb/3T3 mouse fibroblasts. Toxicol Lett.2011 Nov 30;207(2):128-
36.
[132] Liu W, Ernst JD, Broaddus VC. Phagocytosis of crocidolite asbestos induces
oxidative stress, DNA damage, and apoptosis in mesothelial cells. Am J Respir Cell
Mol Biol 2000; 23: 371–8.
[133] Biological Aspects of Asbestos-Related Diseases, Chapter 5 In: Asbestos:
Selected Cancers.Institute of Medicine (US) Committee on Asbestos: Selected Health
Effects. Washington (DC): National Academies Press (US); 2006.
[134] Kamp D, Weitzman S. The molecular basis of asbestos induced lung injury.
Thorax 1999;54:638–652.
[135] Mossman B, Marsh J. Evidence supporting a role for active oxygen species in
asbestos-induced toxicity and lung disease. Environ Health Perspect 1989;81:91–94.
[136] Muller J, Decordier I, Hoet PH, Lombaert N, Thomassen L, et al. Clastogenic
and aneugenic effects of multi-wall carbon nanotubes in epithelial cells.
Carcinogenesis 2008;29(2):427–433.
55
[137] Kane AB. 1996. Mechanisms of mineral fibre carcinogenesis. IARC Scientific
Publications 140: 11-34.
[138] Murthy SS, Testa JR. 1997. Asbestos, chromosomal deletions, and tumor
suppressor gene alterations in human malignant mesothelioma. Journal of Cellular
Physiology 180(2): 150-157.
[139] Zanella C, Posada J, Tritton T, Mossman B. Asbestos causes stimulation of the
ERK-1 mitogenactivated protein kinase cascade after phosphorylation of the
epidermal growth factor receptor. Cancer Res 1996;56:5334–5338.
[140] Manna S, Sarkar S, Barr J, Wise K, Barrera O, et al. Single-walled carbon
nanotube induces oxidative stress and activates nuclear transcription factor- K B
in human keratinocytes. Nano Lett 2005;5:1676–1684.
[141] Ding L, Stilwell J, Zhang T, Elboudwarej O, Jiang H, et al. Molecular
characterization of the cytotoxic mechanism of multiwall carbon nanotubes and
nano-onions on human skin fibroblast. Nano Lett 2005;5(12):2448–2464.
[142] Bernstein D, Castranova V, Donaldson K, Fubini B, Hadley J, Hesterberg T, Kane
A, Lai D, McConnell EE, Muhle H, Oberdorster G, Olin S, Warheit DB. Testing of
fibrous particles: Short-term assays and strategies. Inhalation Toxicology, 2005.
17(10): 497-537.
[143] Churg A. Neoplastic asbestos-induced disease. In: Pathology of Occupational
Disease. 2nd edition (1998). Baltimore: Williams and Wilkins. Pp. 339-392.
[144] McFadden D, Wright JL, Wiggs B, Churg A. Smoking inhibits asbestos
clearance. American Reviews of Respiratory Diseases (1986). 133(3): 372-374.
[145] Kandaswami C, O’Brien PJ. Effect of chrysotile asbestos and silica on the
microsomal metabolism of benzo(a)pyrene. Environmental Health Perspectives,
1983. 51: 311-314.
[146] Mossman BT, Eastman A, Bresnick E. Asbestos and benzo[a]pyrene act
synergistically to induce squamous metaplasia and incorporation of [3H]thymidine
in hamster tracheal epithelium. Carcinogenesis, 1984. 5(11): 1401-1404.
[147] Nelson HH, Kelsey KT. The molecular epidemiology of asbestos and tobacco
in lung cancer. Oncogene, 2002. 21(48): 7284-7288.
[148] Hartwig A. Role of DNA repair in particle- and fiber-induced lung injury.
Inhalation Toxicology, 2002. 14(1): 91-100.
[149] Hollander MC, Philburn RT, Patterson AD, Velasco-Miguel S, Friedberg EC,
Linnoila RI, Fornace AJ Jr. Deletion of XPC leads to lung tumors in mice and is
56
associated with early events in human lung carcinogenesis. Proceedings of the
National Academy of Sciences of the United States of America, 2005. 102(37): 13200-
13205.
[150] Govindarajan B, Klafter R, Miller MS, Mansur C, Mizesko M, et al. Reactive
oxygen-induced carcinogenesis causes hypermethylation of p16(Ink4a) and
activation of MAP kinase. Mol Med 2002;8(1):1–8.
[151] Kim DH, Nelson HH, Wiencke JK, Zheng S, Christiani DC, Wain JC, Mark EJ,
Kelsey KT. p16(INK4a) and histology-specific methylation of CpG islands by
exposure to tobacco smoke in non-small cell lung cancer. Cancer Research, 2001.
61(8): 3419-3424.
[152] Hirao T, Bueno R, Chen CJ, Gordon GJ, Heilig E, Kelsey KT. Alterations of the
p16(INK4) locus in human malignant mesothelial tumors. Carcinogenesis, 2002.
23(7): 1127-1130.
[153] Gazdar AF, Butel JS, Carbone M. SV40 and human tumours: Myth,
association or causality? National Reviews of Cancer, 2002. 2(12): 957-964.
[154] Carbone M, Burck C, Rdzanek M, Rudzinski J, Cutrone R, Bocchetta M.
Different susceptibility of human mesothelial cells to polyomavirus infection and
malignant transformation. Cancer Research, 2003. 63(19): 6125-6129.
[155] Toyooka S, Carbone M, Toyooka KO, Bocchetta M, Shivapurkar N, Minna JD,
Gazdar AF. Progressive aberrant methylation of the RASSF1A gene in simian virus
40 infected human mesothelial cells. Oncogene, 2002. 21(27): 4340-4344.
[156] Vallyathan V, Shi X. The role of oxygen free radicals in occupational and
environmental lung diseases. Environmental Health Perspectives, 1997. 105
(Supplement 1): 165-177.
[157] Cerda S, Weitzman SA. Influence of oxygen radical injury on DNA
methylation. Mutation Research, 1997. 386(2): 141-152.
[158] Robledo RF, Buder-Hoffmann SA, Cummins AB, Walsh ES, Taatjes DJ,
Mossman BT. Increased phosphorylated extracellular signal-regulated kinase
immunoreactivity associated with proliferative and morphologic lung alterations
after chrysotile asbestos inhalation in mice. American Journal of Pathology, 2000.
156(4): 1307-1316.
[159] Yang H, Bocchetta M, Kroczynska B, Elmishad AG, Chen Y, et al. TNF-alpha
inhibits asbestosinduced cytotoxicity via a NF-kappaB-dependent pathway, a
57
possible mechanism for asbestosinduced oncogenesis. Proc Natl Acad Sci USA
2006;103(27):10397–10402.
[160] Shvedova AA, Kisin ER, Murray AR, Gorelik O, Arepalli S, et al. Vitamin E
deficiency enhances pulmonary inflammatory response and oxidative stress
induced by single-walled carbon nanotubes in C57BL/6 mice. Toxicol Appl
Pharmacol 2007;221(3):339–348.
[161] Buzea C, Pacheco II, Robbie K. Nanomaterials and nanoparticles: sources and
toxicity. Biointerphases, 2007 Dec;2(4):MR17-71.
[162] Brook RD, Rajagopalan S, Pope CA 3rd, Brook JR, Bhatnagar A, Diez-Roux AV,
Holguin F, Hong Y, Luepker RV, Mittleman MA, Peters A, Siscovick D, Smith SC Jr,
Whitsel L, Kaufman JD, American Heart Association Council on Epidemiology and
Prevention, Council on the Kidney in Cardiovascular Disease, and Council on Nutrition,
Physical Activity and Metabolism. Particulate matter air pollution and
cardiovascular disease: An update to the scientific statement from the American
Heart Association. Circulation. 2010 Jun 1;121(21):2331-78.
[163] Turner MC, Krewski D, Pope CA, Chen Y, Gapstur SM, Thun MJ. Long-term
ambient fine particulate matter air pollution and lung cancer in a large cohort of
never-smokers. Am J Respir Crit Care Med. 2011 Dec 15;184(12):1374-81.
[164] Cyr AR, Domann FE. The redox basis of epigenetic modifications: from
mechanisms to functional consequences. Antioxid Redox Signal. 2011 Jul
15;15(2):551-89.
[165] Singh N, Manshian B, Jenkins GJ, Griffiths SM, Williams PM, Maffeis TG,
Wright CJ, Doak SH. NanoGenotoxicology: the DNA damaging potential of
engineered nanomaterials. Biomaterials. 2009 Aug;30(23-24):3891-914.
[166] Costa PM, Fadeel B. Emerging systems biology approaches in nanotoxicology:
Towards a mechanism-based understanding of nanomaterial hazard and risk.
Toxicol Appl Pharmacol. 2015 Dec 22.
[167] Tunesi S, Ferrante D, Mirabelli D, Andorno S, Betti M, Fiorito G, Guarrera S5,
Casalone E, Neri M, Ugolini D, Bonassi S, Matullo G, Dianzani I, Magnani C. Gene-
asbestos interaction in malignant pleural mesothelioma susceptibility.
Carcinogenesis. 2015 Oct;36(10):1129-35
[167] Carbone M, Emri S, Dogan AU, et al. A mesothelioma epidemic in
Cappadocia: scientific developments and unexpected social outcomes. Nat Rev
Cancer 2007, 7:147–154.
58
[168] Testa JR, Cheung M, Pei J, Below JE, Tan Y, Sementino E, Cox NJ, Dogan AU,
Pass HI, Trusa S, Hesdorffer M, Nasu M, Powers A, Rivera Z, Comertpay S, Tanji M,
Gaudino G, Yang H, Carbone M (2011) Germline BAP1 mutations predispose to
malignant mesothelioma. Nat Genet 43(10):1022–1025.
[169] Yang H, Testa JR, Carbone M. Mesothelioma epidemiology, carcinogenesis,
and pathogenesis. Curr Treat Options Oncol. 2008 Jun;9(2-3):147-57.
[170] Abdel-Rahman MH, Pilarski R, Cebulla CM, Massengill JB, Christopher BN,
Boru G, Hovland P, Davidorf FH. Germline BAP1 mutation predisposes to uveal
melanoma, lung adenocarcinoma, meningioma, and other cancers. (2011) J Med
Genet 48(12):856–859.
[171] Carbone M, Korb Ferris L, Baumann F, Napolitano A, Lum CA, Flores EG,
Gaudino G, Powers A, Bryant-Greenwood P, Krausz T, Hyjek E, Tate R, Friedberg J,
Weigel T, Pass HI, Yang H. BAP1 cancer syndrome: malignant mesothelioma, uveal
and cutaneous melanoma, and MBAITs. (2012) J Transl Med 10(1):179.
[172] Jensen DE, Proctor M, Marquis ST, Gardner HP, Ha SI, Chodosh LA, Ishov AM,
Tommerup N, Vissing H, Sekido Y, Minna J, Borodovsky A, Schultz DC, Wilkinson
KD, Maul GG, Barlev N, Berger SL, Prendergast GC, Rauscher FJ. BAP1: a novel
ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances
BRCA1-mediated cell growth suppression. 3rd (1998) Oncogene 16(9):1097-1112.
[173] Carbone M, Yang H, Pass HI, et al. BAP1 and cancer. Nat Rev Cancer 2013; 13:
153–159.
[174] Ventii KH, Devi NS, Friedrich KL, Chernova TA, Tighiouart M, Van Meir EG,
Wilkinson KD. BRCA1-associated protein-1 is a tumor suppressor that requires
deubiquitinating activity and nuclear localization. (2008) Cancer Res 68(17):6953-
6962.
[175] Singhi AD, Krasinskas AM, Choudry HA, Bartlett DL, Pingpank JF, Zeh HJ,
Luvison A, Fuhrer K, Bahary N, Seethala RR, Dacic S. The prognostic significance of
BAP1, NF2, and CDKN2A in malignant peritoneal mesothelioma. Mod Pathol.
2016 Jan;29(1):14-24.
[176] Illei PB, Rusch VW, Zakowski MF, Ladanyi M. Homozygous deletion of
CDKN2A and codeletion of the methylthioadenosine phosphorylase gene in the
majority of pleural mesotheliomas. (2003) Clin Cancer Res 9(6):2108–2113.
59
[177] Thurneysen C, Opitz I, Kurtz S, Weder W, Stahel RA, Felley-Bosco E.
Functional inactivation of NF2/merlin in human mesothelioma. (2009) Lung Cancer
64(2):140–147.
[178] Baumann F, Flores E, Napolitano A, Kanodia S, Taioli E, Pass H, Yang H,
Carbone M. Mesothelioma patients with germline BAP1 mutations have 7-fold
improved long-term survival. Carcinogenesis. 2015 Jan;36(1):76-81.
[179] Roe OD, Stella GM. Malignant pleural mesothelioma: history, controversy
and future of a manmade epidemic. Eur Respir Rev. 2015 Mar;24(135):115-31.
60
CHAPTER 2 – BIOCHEMICAL AND
MICROSCOPIC METHODS IN THE STUDY
OF INTRACELLULAR IRON ALTERATION
AFTER NANOMATERIAL EXPOSURE
In light of the many considerations discussed in the introduction, and the techniques that
will explained in this chapter, I will compare a similar iron-related toxicity in human
mesothelial (MeT5A) and placental (BeWo) cell lines exposed to carbon nanotubes
(raw-SWCNT, purified- and highly purified-SCWCNT) or asbestos (crocidolite fibres).
I’ll present here the two study sets, in which the same material and methods have been
adopted (2.1 section). The results section is divided in two parts: Results I (2.2
paragraph), concerning the pleural cell model and Results II (2.3 paragraph), concerning
the placental cells.
2.1 Material and Methods
2.1.1 Carbon Nanotubes
SWCNTs were produced by the HiPCO process (HiPCO stands for high pressure
carbon monoxide), a Chemical Vapor Deposition (CVD) process using continuously
flowing carbon monoxide as the carbon feed-stock and a small amount of iron
pentacarbonyl as the iron-containing catalyst precursor at high pressure. Two types of
commercial carbon nanotubes and two types of manufactured carbon nanotube were
used in the experiments: raw-SWCNT (r-SWCNT) and purified-SWCNT (p-SWCNT),
which are commercial, purified short-SWCNT (s-SWCNT) and highly purified-
SWCNT (hp-SWCNT) which are manufactured [1-2]. The characteristics of two types
of commercial SWCNTs and highly purified-SWCNT are reported in Table 2. All types
of CNTs were provided by Silvia Giordani (ITT, Genova).
61
Table 2. The characteristics of single-walled carbon nanotubes are reported in detail.
.
2.1.2 Crocidolite
Crocidolite Asbestos UICC Standard fibres (SPI#02704-AB) were purchased from SPI
Supplies Division, Structure Probe, Inc. (West Chester, PA 19381-0656, USA) and
suspended in sterile phosphate buffered saline (PBS) at a concentration of 10 mg/ml [3].
2.1.3 Nanofibre suspensions
Just before use SWCNTs and crocidolite fibres were suspended in serum-free cell
culture medium at final concentration of 5 µg/ml. Nanomaterial suspensions were then
rotated for 30 seconds, sonicated for 15 minutes under temperature-controlled
conditions (+4°C), with 15 seconds interruption every 5 minutes for rotating steps.
2.1.4 Iron Sulphate (FeSO4)
FeSO4 heptahydrate was purchased from Sigma Aldrich (St. Louis, MO, USA). Ferrous
sulphate solution was prepared by dissolving the pure powder in sterile H2O at final
concentration of 80 µM.
2.1.5 Cell culture and treatments
Human mesothelial MeT5A and placental BeWo cells (ATCC) were maintained in
Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum
(FBS) (volume/volume [v/v]), L-glutamine 2mM, 100 U/ml penicillin and 100U/ml
streptomycin at 37° C in a 5% CO2 atmosphere. The cells were cultured in 75 cm2
Falcon flask for 2-3 days, then harvested by exposure to trypsin and transferred onto 24-
62
well plates for viability tests by trypan blue exclusion assay or cultured on silicon
nitride (Si3N4) membranes for SR-XRF analysis. After 24 h semi-confluent cells were
treated for 24 h with 500 µl of medium containing SWCNTs and crocidolite fibres to
obtain the final concentration of 5 µg/ml. Just before use the nanofibres were sonicated
in serum-free cell culture medium.
2.1.6 Evaluation of cytotoxicity
Potential toxicity of crocidolite and SWCNTs (raw, purified and highly purified) was
evaluated on cells by trypan blue exclusion dye test. The cytotoxicity of fibres was
tested for 24 at final concentration of 5 µg/ml. After completion of exposure time, the
cells were rinsed twice with sterile phosphate-buffered saline (0.1mM PBS, pH 7.4),
then detached from the well by 0.25% trypsin (Sigma-Aldrich) containing 0.03%
EDTA, pelleted (1200 rpm for 10 min) and resuspended in serum-free cell culture
medium. Then, 10 μl cellular suspension was mixed gently with 40 μl of trypan blue in
an Eppendorf tube and incubated for 5 min at room temperature. The samples were
loaded in a chamber slide and the number of viable cells was measured using the trypan
blue dye exclusion test.
2.1.7 Ferritin assay
The cells were grown in 24-well plates and exposed for 24 h to 5 µg/ml of SWCNTs
and crocidolite fibres, rinsed twice with sterile phosphate-buffered saline (0.1mM PBS,
pH 7.4), then detached from the well by 0.25% trypsin (Sigma-Aldrich) containing
0.03% EDTA and pelleted. The pellet was washed with PBS (0.1mM PBS, pH 7.4) and
transferred to a microcentrifuge tube. 200 µl of M-PER reagent (Mammalian Protein
Extraction Reagent, Thermo Scientific) was added to each samples and shaken gently
for 5 minute. After incubation, the lysates were collected and centrifugated at 14,000 x
g for 10 minutes at 4°C. The supernatants were transferred to a new tube for analysis.
The ferritin concentrations in the lysates was measured using a Roche Cobas® 6000
instrument.
63
2.1.8 Synchrotron-based X-Ray analysis
To perform in vitro treatment experiments with nanomaterials, cells were seeded at a
concentration of 9×104 cell/ml onto 100 nm thick silicon nitride (Si3N4) windows
(Silson Ltd., Northampton, United Kingdom) contained in 24 multiwell plates. The day
after seeding, the culture medium was replaced with fresh medium containing different
nanomaterials at a concentration of 5 µg/ml, and the cells were incubated at 37°C for 24
h. Another set of cells, not exposed to nanomaterials, were used as control sample.
After incubation, samples were fixed at room temperature with 4% paraformaldehyde
(Sigma Aldrich) in PBS pH 7.4, for 20 minutes. Then, samples were washed two times
with PBS and two times in Milli-Q water before the analysis.
In order to identify both the distribution of light and some heavy elements in the cells,
we performed the experiments using soft X-rays (1.15 KeV) at the TwinMic beamline
of Elettra synchrotron (Trieste, Italy) and harder X-rays (7.2 keV) at the ID21 beamline
of ESRF synchrotron (Grenoble, France). In both cases the microscopes were operated
in vacuum to allow the detection of light elements and reduce air absorption. In
particular the harder X-rays were required to excite the K fluorescent lines of Ca, S, P
and Fe, whereas soft X-ray microscopy provided higher quality absorption and phase
contrast images, together with the ability of mapping carbon. The X-ray absorption and
phase contrast images have outlined the morphological features of the sample at sub-
micrometer length scales, while the simultaneous acquisition of the XRF maps
correlated the elemental distribution to the morphology.
Most of the experiments were performed at the TwinMic beamline [4] of the Elettra
synchrotron facility (Elettra, Trieste, Italy, www.elettra.trieste.it/twinmic) using the
scanning X-ray microscopy (SXM) mode.
In the SXM configuration the sample is raster-scanned with respect to a microprobe
generated by a suitable focusing optics. On TwinMic, a configured CCD detector
system [5-6] collets absorption and phase contrast images, while the XRF emission is
detected by means of 8 Silicon drift detectors (SDDs) [7-8].
The experiments was carried out with a photon energy of 1.15 keV and a spot size of
450 nm, which was a good compromise for getting sufficient fluorescence signal for
light elements (C, N, O, Na) as well as for Fe.
SR-XRF data were also acquired at the ID21 X-ray Microscopy beamline [9] of the
ESRF synchrotron facility (Grenoble, France). The samples were prepared with the
64
protocol used described above. A Ni coated double mirror deflecting in the horizontal
plane ensured the harmonics rejection. A Si(111) double-crystal monochromator was
used to select energy of 7.2 keV, above the Fe K absorption edge. A zone plate (Zone
Plates Ltd, UK) focused the beam down to a micro-probe of 200 nm x 900 nm (V x H)
with a photon flux of 3.5 x 109 photons/s. The sample was raster scanned in the micro-
beam to collect 2D fluorescence maps. An SDD detector (Röntec, Germany) was used
to detect the fluorescence photons emitted by the sample. Analysis of the SR-XRF
images and spectra was carried out by using the multiplatform program (PyMCA)
developed by Sole V. and co-workers [10].
2.1.9 Atomic force microscope analysis
The cells were grown on 100 nm thick silicon nitrite (Si3N4) windows (Silson Ltd.,
Northampton, United Kingdom) at concentration of 9×104 cell/ml. The day after
seeding, the culture medium was replaced with fresh medium containing different
nanomaterials at a concentration of 5 µg/ml, and the cells were incubated at 37°C for 24
h. After incubation, samples were fixed at room temperature with 4% paraformaldehyde
(Sigma Aldrich) in PBS pH 7.4, for 20 minutes. Then, samples were washed two times
with PBS and two times in Milli-Q water before the analysis.
AFM images were taken by using Digital Instruments Dimension 3100 Atomic Force
Microscope (AFM Service, ESRF in Grenoble). A digital camera allowed to select the
scanning area, typically 100 × 100 μm. The measurements were carried out in contact
mode under ambient conditions, adjusting the parameters during scanning to prevent
damaging of the biological structures.
65
2.2 RESULTS I: Iron-related toxicity of single-walled carbon nanotubes
and crocidolite in human mesothelial cells (MeT5A) investigated by
Synchrotron XRF microscopy.a,b
a)Part of this study has been presented to the European conference On X-ray
Spectrometry EXRF (BOLOGNA 15-20 Joune 2014) as poster presentation: Altered
morphology and iron content in MeT5A mesothelial cells following exposure to carbon
nanotubes and crocidolite asbestos”. Cammisuli F., Gianoncelli A., Rizzardi C.,
Giordani S., Melato M. and Pascolo L. Abstract for European Conference on X-Ray
Spectrometry (EXRS), Bologna 15-20 Giugno 2014.
b)Results have been adapted from the manuscript in preparation: “Iron related toxicity
of single-walled carbon nanotubes and crocidolite fibers in human mesothelioma cells
(MeT5A) investigated by Synchrotron XRF microscopy”. Cammisuli F., Giordani S.,
Gianoncelli A., Rizzardi C., Radillo O., Da Ros T., Salome M., Melato M., Pascolo L.
2.2.1 State of the art in in vitro tests of mesothelial cell line
There has been little investigation on the toxicological effects of fibres in pleural
mesothelial cell lines. Mesothelial cells form double layer (mesothelium) lining the
serosal cavities (pleural, pericardial and peritoneal) and the organs contained within
these cavities [11]. The primary function of the mesothelium is to provide a protective
non-adhesive surface but also to transport solutes and cells across serosal cavities,
including antigen presentation, inflammation and tissue repair, coagulation and
fibrinolysis and tumour cell adhesion [11]. Particularly, during inflammation processes
mesothelial cells secrete a whole host of mediators including various cytokines such as
interleukins (IL) 1 and 6 as well as a range of chemokines (e.g. IL-8, MCP-1) [12].
A seminal study performed by Murphy A.F. et al. hypothesized that long fibres cause an
inflammatory response in the pleural cavity through frustrated phagocytosis. The
pleural-activated macrophages trigger an amplified pro-inflammatory cytokine response
from the adjacent pleural mesothelial cells (MeT5A), producing a pro-inflammatory
environment in the pleural space exposed to long CNT [12].
The study conducted by Tabet L. et al. [13] evaluated toxic effects of multi-walled
carbon nanotubes (MWCNTs) on a human epithelial cell line (A549) but also in
mesothelial cells (human MeT5A cell line). MWCNTs are compared to two types of
asbestos fibres (chrysotile and crocidolite) as well as to carbon black (CB)
nanoparticles. From the comparison it has been noted that MWCNTs appear as
66
agglomerates attached to cells, while asbestos fibres penetrate into the cells, and both
cause a decreased metabolic activity but not cell membrane permeability.
More recently a study has been performed to unravel the morphological changes of
mesothelial cells (MeT5A) after interaction with crocidolite fibres, by using a
combination of conventional atomic force microscopy (AFM) and scanning near-field
optical microscopy (SNOM) [3]. The results demonstrated that the crocidolite fibres
penetrate the plasma membrane and may reach also the nuclear compartment.
As already discussed in the introduction, even if the mechanism by which asbestos and
other mineral fibres cause cancer still remains largely unknown, iron associated to fibres
seems to play a crucial role in the pathogenic effects of asbestos. About this, a study
investigated the role of iron in the inactivation of epidermal growth factor receptor
(EGFR) after asbestos treatment of human lung epithelial (A549) cells, human pleural
mesothelial (MeT5A) cells [14]. The results confirmed that there is a dephosphorylation
and subsequent inactivation of epidermal growth factor receptor (EGFR) and iron seems
to be the responsible of this effect on the receptor following internalization fibres. In
fact, the inhibition of fibre endocytosis and iron removal from fibres by using
desferrioxamine B or phytic acid, prevents the decrease in EGFR phosphorylation and
therefore the inactivation of the receptor [14].
The inflammatory stimuli to mesothelial cells include microbes and environmental dust.
These cells are actively phagocytic cells and some reports from Ghio AJ (one of the
most important researcher on asbestos toxicity) indicated that mesothelial cells respond
to inflammatory stimuli with an increase in the ferritin production [15]. This was
demonstrated exposing MeT5A cells to asbestos fibres as well as to talc [15].
Here I reported the iron related response of MeT5A cells to crocidolite and CNTs at
different grades of purification (reducing the iron presence), by both checking ferritin
response and investigating other chemical changes.
2.2.2 Results of viability test
The results were expressed as percentage of dead cells as compared to a control, and are
shown in Figure 11. The results revealed that the cells treated with highly purified-
SWCNTs (hp-SWCNTs) were viable at 90%. While the cell viability was over 80% for
cells exposed to purified SWCNTs (p-SWCNTs). A reduction around 70% was
observed for cells treated with raw-SWCNTs (r-SWCNTs) and to about 65% for
67
treatments with crocidolite fibres and iron sulphate (FeSO4). Moreover, the results
revealed that after 48h of incubation there was an reduction of vitality of an additional
10-15% with respect to 24 h for each nanomaterial.
Based on these results the concentration of 5 µg/m and the incubation at 24 h for all
nanomaterials was selected for X-ray fluorescence and microscopy analyses and ferritin
assay.
Figure 11. Quantification of mesothelial cell viability during the treatments with nanomaterials (5 µg/ml)
for 24 h and 48 h.
2.2.3 Results of elemental mapping with XRF microscopy
After a selection under light microscopy, cells were raster scanned at the ID21 beamline
of the European Synchrotron Radiation Facility (ESRF) using 7.2 keV photon energy,
monitoring the XRF fluorescent signature of P, S, Ca, K and Fe.
The deconvolution of elemental maps was performed by using PyMCA software. The
interpretation of X-ray fluorescence maps was based on temperature colorimetric scale,
ranging from blue for low concentrations in the element of interest to red for high
concentrations.
Panel A (Figure 12) shows the elemental maps of a MeT5A control cell: phosphorus (P)
and sulfur (S) are constitutive elements of cells, and their distribution delineated the cell
shape. In particular the P-rich zone in the central part of the cell could be attributed to
68
the nucleus. The other elements potassium and calcium showed a rather homogeneous
distribution, while the counts for the iron fluorescent signal were low, indicating a very
low presence in healthy cells.
Panel B (Figure 12) shows the elemental maps of cells exposed to iron sulphate
(FeSO4). The iron (Fe) map revealed iron-rich regions, vesicles or aggregates, probably
most of them extracellular. In addition, there was a diffuse signal from intracellular iron
increase derived from the uptake into the cell.
Figure 12. X-ray fluorescence analysis of untreated and treated cells with iron sulphate. (A) Visible
light image of the control cell (a) and the corresponding P, S, Ca, K, Fe XRF maps (32µm x 42,5µm)
showing the distribution of different elements. (B) Visible light image of treated cell with FeSO4 (a) and
the corresponding P, S, Ca, K, Fe XRF maps (52µm x 60,5µm). The XRF maps were acquired at 7.2 keV
incident photon energy.
69
Figure 13 and Figure 14 show the elemental maps of cells exposed to crocidolite. The
iron (Fe) map revealed iron-rich segments that localize the crocidolite fibres, most of
them intracellular as perceived by comparison with the optical image.
Due to the extremely high abundance of iron in the asbestos fibres (about 30 wt%) the
Fe signal was reported on a logarithmic scale in order to highlight also its low
concentration presence in the cells. In fact, the logarithmic scale allowed revealing a
diffuse intracellular iron increase that could derive both from an iron dissolution from
the fibres and an increased iron uptake into the cells. Compared to control cells, some
cells exposed to asbestos showed a reduced K presence, compatible with a cell
sufferance condition.
Figure 13. µXRF and X-ray microscopy of treated cells with crocidolite fibres. Visible light image of
two cells exposed to crocidolite fibers (a) and the corresponding P, S, Ca, K, Fe XRF maps (56µm x
76.5µm) showing the distribution of different elements. Fe map is displayed using a logarithmic scale.
Below are shown the X-ray microscopy absorption (b) and phase contrast (c) images of the corresponding
XRF maps. The absorption and phase contrast images were measured at 0.9 KeV photon energy, whereas
the XRF maps were acquired at 7.2 keV.
70
Figure 13 and Figure 14 show the X-ray absorption (b) and phase contrast (c) images of
MeT5A treated cells with crocidolite fibres. The contrast of the X-ray images (c) clearly
indicated the different density between nucleus and other cell compartments (nucleolus
and cytoplasm). Moreover, X-ray microscopy allowed to precisely reveal the fibres not
only in absorption mode (b) (the fibres are more absorbing than the surrounding cellular
matter), but also in differential phase contrast (c). Indeed, most of the fibres could not
be seen in the optical image since they were internalized. The combination of
synchrotron X-ray fluorescence and soft X-ray microscopy allowed to study the fibres
uptake in mesothelial cells and to distinguish the intracellular fibres from extracellular
ones.
Furthermore, for their needle-like shape the fibres possess an enhanced capacity to
perforate the plasma membrane and only the smaller fibres are able to reach sub-cellular
components of the cells up to nuclear regions. In Figure 13 is clearly visible how
asbestos fibres perforate the plasma membrane as shown black arrow. In red circle was
highlighted a region of the plasma membrane in which was occurred the perforation and
the entry of a very small fibre: the plasma membrane appeared to be folded up like
during the invagination processes (i.e., endocytosis and exocytosis).
In our study, we applied other microscopic techniques, such as scanning electron
microscopy (SEM) and atomic force microscopy (AFM) - the results are shown in
appendix A - to investigate the interaction of these cells with asbestos fibres. It is
important to note that all microscopic techniques used in this study have the advantage
to allow to obtain image with high spatial resolution and without procedures of
labelling. The results reported in Figure A1 of Appendix A explain the promising
combination of X-ray microscopy with AFM. It was possible localize most of the
crocidolite fibres internalized into the cells (Figure A1, lane A and B), and short CNTs
deposited onto cellular surface (Figure A1, lane C). The SEM images showed in Figure
A2 of Appendix A explain the cell membrane penetration by asbestos fibres (E,G,H) or
their wrapping by the cell membrane (F). An aggregate of raw-SWCNTs is visible onto
the cell (L), while localization of short-SWCNTs (purified) was complicated since they
are very similar to cellular materials (O,P,Q,R). Moreover, SEM images allowed to
reveal the presence of plasma membrane blebs in mesothelial cells exposed to all
nanomaterials, probably it was a cellular response linked to sufferance state.
71
In addition, the optical image (Figure 13a) shows the presence of cell adhesion filament
which could be confused with a long asbestos fibre. But by the comparison with the
other microscopic images we had the certainly that it was not asbestos fibre.
In cell sample reported in Figure 14 there was a considerable morphological damage.
The cytoplasm is occupied by numerous membrane vesicles. Soft X-ray microscopy
allowed to investigate this alteration of the morphologic aspects of the surfaces of
mesothelial cells and to reveal in detail the increased numbers of filopodia and vesicles.
After a careful analysis we have noted that the iron-rich regions (shown in Fe map)
were in proximity but did not localize with these vesicles which, however, could be a
cellular response to nanomaterial toxicity.
Figure 14. µXRF and X-ray microscopy of treated cells with crocidolite fibres. Visible light image of
two cells exposed to crocidolite fibers (a) and the corresponding P, S, Ca, K, Fe XRF maps (56µm x
76.5µm) showing the distribution of different elements. Fe map is displayed using a logarithmic scale.
Below are shown the X-ray microscopy absorption (b) and phase contrast (c) images of the corresponding
XRF maps. The absorption and phase contrast images were measured at 0.9 KeV photon energy, whereas
the XRF maps were acquired at 7.2 keV.
72
These techniques do not need staining or metal-coating procedures, in fact MeT5A cells
were only fixed, therefore they can be considered non-invasive analyses, which allowed
to investigate the morphology of cells and to reveal the cellular localization of the
crocidolite fibres, by providing a better spatial resolution compared to the optical
images and therefore much more detailed information.
Figure 15 shows the elemental maps of cells exposed to raw-SWCNTs. Merging with
the cellular shape (P and sulphur S maps) the iron (Fe) map revealed several iron-rich
spots inside or surrounding the cells. Bases on their dimensions and intensities, these
iron-spots could be attributed to iron containing nanotubes or to aggregates of residual
iron particles detached from them [16]. Looking the potassium (K) map, it was
interesting to note that there was an homogeneous increase of its intracellular presence;
K increase can be linked to some alteration in the membrane potential mechanisms (i.e.,
sodium potassium pump alteration), but further investigations are necessary. In the case
of calcium (Ca) signal, there was no notable change compared to control cell.
The X-ray contrast and absorption images (b and c) clearly indicated the increased
density mainly due to the higher thickness in the samples. In this cell, raw carbon
nanotubes were not visible, as expected by the low dimensions and density. In addition,
they often were aggregated in the medium and hardly interacted with plasma membrane.
Moreover, from the absorption images (c) a notable observation was that the presence
of small vesicles near the nucleus, suggesting that the cell was in a serious status of
sufferance. Notably, in this case, although the XRF map did not showed any Fe increase
in clear correspondence with these vesicles, iron aggregates were concentrated in close
proximity.
In general, the toxicity of CNTs is attributed to their physico-chemical characteristics,
such as length, diameter, shape, purity, surface area and surface chemistry. In addition
to these properties, the CNT contamination by catalyst residues which occurs during
their production, has been demonstrated to affect the CNT safety.
In our study, the iron content raw-SWCNTs (non-purified carbon nanotubes) was
approximately 30% (wt % iron). The iron impurities can cause not only the reduction of
cellular viability (as shown in Figure 11), but also a clearly alteration of iron
metabolism, and this study was the first clear-cut evidence for it. Although a lot of the
iron nanoparticles seemed to be extracellular as confirmed by rich iron-spots in Fe map
(Figure 15 panel A and B), it was also possible to recognize a homogenous iron increase
73
inside the cell. The fluorescence signal levels were clearly higher than those of control
cells.
Figure 15. µXRF and X-ray microscopy of treated cells with raw-SWCNTs. (A) Visible light image
of cell exposed to raw carbon nanotubes (r-SWCNT) (a) and P, S, Ca, K, Fe XRF maps (54µm x
70,5µm). The X-ray microscopy phase contrast (b) and absorption (c) images of the corresponding cell
are reported to the side. Panel (B) shows the visible image of another treated cells (d) and the
corresponding P, S, Ca, K, Fe XRF maps (62µm x 50,5µm). Fe map is displayed using a logarithmic
scale. The absorption and phase contrast images were measured at 0.9KeV photon energy, whereas the
XRF maps were acquired at 7.2 keV.
In some case, we had the perception that small raw-SWCNTs were internalized by
mesothelial cells. Probably, most of them were aggregated in cytoplasm, while smaller
74
ones seemed to interact with the plasma membrane depositing along cellular edges (as
indicated by black arrow in Fe map of Figure 15 panel B).
Figure 16 (Panel A) shows the X-ray contrast (a) and absorption (b) images and the
corresponding XRF carbon maps of cells exposed to purified short-SWCNTs (s-
SWCNTs). Their iron content was less than 15% (wt%).
The X-ray contrast (a) and absorption (b) images showed the increased density, mainly
ascribable to the higher thickness in the samples, in particular in the regions of a clear s-
SWCNT internalization (indicated by black arrows). This carbon nanotube
internalization is also confirmed by C map, where there was an increase of carbon level
in correspondence of CNTs intracellular localization.
In this sample we had the certainty that was occurred the internalization of bundles of
purified carbon nanotubes. The results obtained by the different microscopic techniques
allowed to monitor the s-SWCNTs localization and their cellular internalization.
Therefore, it was demonstrated the powerful combination of the advanced microscopic
techniques, based on synchrotron radiation, in obtaining crucial details of cell-nanofibre
interactions and their cellular toxicity.
Figure 16 (Panel B) shows the phosphorus (P) and sulphur (S) maps that allowed to
identify the cellular shape, while the iron (Fe) map revealed several iron-rich spots
inside or surrounding the cells. Bases on dimensions and intensities, these iron-spots
could be attributed to iron containing nanotubes or to residual iron particles detached
from them [16]. The logarithmic scale allowed revealing a diffuse intracellular iron
increase that could derive also from Fe uptake of the cell.
Moreover, the zoom inset of panel B (Figure 16) shows the specific localization of
internalized s-SWCNT. Carbon and iron map confirmed the presence of s-SWCNT:
carbon is the constituent of this nanomaterial, while iron represents the impurities that
derive from their synthesis process. The notable spatial resolution of phase contrast
image (Panel B, a) highlighted the amazing opportunity to reveal the exact shape and
orientation of small carbon nanotubes. Besides, synchrotron X-ray fluorescence, in
association with soft X-ray microscopy, allowed simultaneous mapping of multi-
element distributions with high resolution. In this sample, the optical image (Panel A, c)
obtained in transmission mode, allowed to localize CNTs, even if the most of important
details are surely missing.
In addition, in this cells exposed to purified s-SWCNT, the iron-rich zones showed
colocalization with the highest P signal (Figure 16, panel A), suggesting a possible
75
SWCNT interaction with the nuclear or perinuclear region. Similar evidences have also
been reported by other studies [17-18]. The phosphorus alteration could be linked to
genotoxic effects exerted by carbon nanotubes [19].
Figure 16. µXRF and X-ray microscopy of treated cells with purified s-SWCNTs. (A) The X-ray
microscopy absorption (a) and phase contrast (b) and visible light (c) images of exposed cells to purified
short-SWCNT (s-SWCNT). The C map, collected at the TwinMic beamline with photon energy 1.15
keV, is shown to the side. P, S and Fe maps, obtained at ID21 beamline, are reported below (52µm x
73.5µm). Panel (B) shows phase contrast (a, b) images and corresponding C and Fe maps of zones
indicated with the black and red circle. Fe map is displayed using a logarithmic scale. Moreover, panel B
shows the specific localization of internalized s-SWCNT in a zoomed area of the absorption and phase
contrast images. C and Fe maps confirm intracellular localization of carbon nanotubes in the region with
the highest concentrations of both. The absorption and phase contrast images were measured at 0.9 KeV
photon energy, whereas the XRF maps were acquired at 7.2 keV.
Figure 17 (Panel A) shows the XRF maps of cell exposed to purified carbon nanotubes
(p-SWCNTs). Looking at the iron (Fe) map, it was interesting to note that there was an
76
inhomogeneous increase of its intracellular presence; again the iron-spots could be
linked to iron containing nanotubes (15 wt % iron) or to residual iron particles detached
from them.
Figure 17. µXRF and X-ray microscopy of treated cells with p-SWCNTs and hp-SWCNTs. (A)
Visible light image of cell exposed to purified carbon nanotubes (p-SWCNT) (a) and P, S, Ca, K, Fe XRF
maps (36µm x 46,5µm). The C map, collected at the TwinMic beamline, is shown to the side. P, S and Fe
maps, obtained at ID21 beamline, are reported below. Panel (B) shows visible light and absorption (a, b)
images of cell treated with higly purified carbon nanotubes (hp-SWCNT). The C map was obtained at
1.15 keV, while S, P and Fe maps were collected using a 7.2 keV excitation energy, and are also reported
in the panel. Fe map is displayed using a linear scale.
Figure 17 (Panel B) shows the phosphorus (P) and sulphur (S) maps that identified the
cellular shape, while the iron (Fe) map revealed several iron-rich spots inside the cell. In
these samples treated with highly purified carbon nanotubes (hp-SWCNTs) we
observed a marginal iron alteration, surely due to the higher purity grade of CNTs. The
C map seemed to reveal a thickening of cellular borders allowing to suppose the
77
internalization of carbon nanotubes, in some cases confirmed by iron spot. The
thickening was clearly visible in the absorption image (Panel B, b).
2.2.4 Results of ferritin assay
After X-ray fluorescence analyses we tried to understand if this iron increase was due to
release from nanomaterials or to a biochemical response of cells. Therefore, we
performed an assay in order to evaluate an intracellular ferritin level.
Ferritin is a protein that stores iron and releases it in a controlled amount in the body.
Ferritin has a spherical shape and iron is stored in the Fe(III) oxidation state inside the
sphere. When the body needs iron, it must be changed from the Fe(III) to the Fe(II)
oxidation state. Then, the iron leaves through channels in the spherical structure.
Figure 18. Intracellular concentrations of ferritin after in vitro exposure of mesothelial cells (MeT5A) to
all nanomaterials (5 µg/ml) for 24h and 48h. *Significantly increased is found in samples treated with
raw-SWCNTs, crocidolite and iron sulphate.
The results, displayed in Figure 18, highlighted a ferritin increase in the cells exposed to
crocidolite fibres and iron sulphate (FeSO4), as compared to ferritin concentration found
in control cells. Cells treated with raw-SWCNTs had a similar stimulation although less
evident than crocidolite fibres. The cells treated with purified-SWCNTs had lower
78
stimulation than cells treated with raw-SWCNTs, while cells treated with hp-SWCNTs
had a similar stimulation of control cells (as shown in Figure 18).
The results demonstrated that crocidolite fibres and raw carbon nanotubes gave a severe
stimulation of intracellular ferritin, while highly purified carbon nanotubes gave an
amount of intracellular ferritin comparable to control cells (at 24 h). This means that
raw carbon nanotubes and crocidolite fibres share a similar toxicity mechanism linked
to iron impurities (30% for crocidolite fibres and <30% for raw-SWCNTs). Moreover,
the results revealed that after 48h of incubation there was an increase of ferritin level of
an additional 5-20% with respect to 24 h for each nanomaterial (as shown in Figure 18).
Ghio AJ and co-workers [15] have performed in vitro study to test the disruption in iron
homeostasis after talc exposure of mesothelial cells. They found that there is a
significantly increased iron importation and concentrations of the storage protein
ferritin. Previously, the same author has examined the increased expression of ferritin
after exposure of alveolar macrophages to silica [20]. The findings confirmed that the
expression of ferritin, a storage protein, is controlled by a post-transcriptional
mechanism that is dependent on the concentration of available iron. Iron complexed to
the surface of silica can catalyze the generation of free radicals. The alveolar
macrophage, using superoxide, can mobilize the metal from the surface of a mineral
oxide by reducing it to the ferrous state [21]. When the metal is isolated in this storage
protein has a chemically less reactive state. Therefore, the sequestration of reactive iron
confers a protective effect in the macrophages and limits the iron toxicity.
Similarly, in our study the increased concentration of ferritin after nanomaterial
exposures could be a protective mechanism in order to prevent the oxidative damage.
The mesothelial cells (MeT5A), as well as alveolar macrophages, are able to control the
ferritin expression by iron-dependent manner.
Our study was the first to test this ability in the presence of carbon nanotubes.
79
2.3 RESULTS II: Toxicity effects of single-walled carbon nanotubes and
crocidolite in human placental cells (BeWo) investigated by Synchrotron
XRF microscopy and AFM microscopec
c) Results have been adapted from the manuscript in preparation: “Toxicity effects of
single-walled carbon nanotubes and crocidolite in human placental cells (BeWo)
investigated by Synchrotron XRF microscopy and AFM microscope”. Cammisuli F.,
Gianoncelli A., Altissimo M., Salome M., Rizzardi C., Giordani S., Radillo O., Melato
M. and Pascolo L.
2.3.1 State of the art in in vitro tests of placental cell line
It has been largely confirmed that the BeWo cells are a good in vitro model for
placental functions, also used to study the ability of nanoparticles (NPs) to translocate
across the placental barrier [22].
It has been reported that the uptake and transport of iron oxide and silica nanoparticles
can transfer extensively across the placental barrier model depending on physico-
chemical characteristics such as surface chemistry. The BeWo cell model can be used
efficiently to predict the capacity of NPs to reach the fetus [23].
A recently study investigated the safety of silica NPs by using this choriocarcinoma cell
line and showed a decreased in cell viability only when using concentrations higher than
100 µg/ml. The results showed a low transfer of silica NPs to the fetal compartment,
although the biocompatibility could limit the application of unmodified silica NPs in
biomedical imaging or therapy [24].
Another important study analyzed the transfer of PEGylated gold nanoparticles across
the perfused human placenta [25]. The PEGylated gold nanoparticles of the size 10-
30nm do not cross the perfused human placenta, and cannot be found in detectable
amounts in the fetal circulation within 6h. While during in vitro experiments, the gold
nanoparticles are taken up by BeWo choriocarcinoma cells and retained inside the cells
for an extended period of 48h [25].
These findings indicate that the ability of nanoparticles to cross the placental barrier
depends on their type, size and surface modification, causing complications of the
reproductive system and fetus. However, the mechanism of this process remains
unclear.
80
Moreover, it has been reported that asbestos fibres can pass through the walls of the
digestive tract and travel throughout the body. Another work has also indicated that
asbestos could cross the placenta [26].
An autopsy study was conducted to investigate whether there is transplacental transfer
of asbestos in humans. The study demonstrated the presence of short and thin asbestos
fibres in stillborn infants and their positive association with working mothers [27-28].
Another study showed that repeated administrations of CNTs cause reversible testicular
damage without compromising fertility in male mice [29]. Other researchers have
focused on the effects of CNTs on the female reproductive system. Similarly to
nanoparticles and asbestos, CNTs could cross the placental barrier and to damage both
placenta and fetus.
A further work has studied the mechanism by which oxidised MWCNTs (o-MWCNTs)
may cross the placental barrier and determine the abortion rates in mice with different
pregnancy times. It has also investigated the maternal and fetal toxicity of o-MWCNTs.
The results showed that o-MWCNTs are able to cross the placental barrier and reach the
fetus body, leading to placental dysfunctions and also fetal growth delay with
complications of fetal heart and brain. The abortion rates in pregnant mice depend on
pregnancy times [30].
In addition to direct effects of NMs on placental barrier, other studies have investigated
the indirect effects of NMs on fetus, after the inflammatory and oxidative stress
responses in the exposed mothers [31-32].
An interesting study put forward the hypothesis that pulmonary exposure to NMs during
gestation induces inflammation in the exposed mother and leads to secondary effects in
the fetus [33]. It has been used a toxicogenomics approach to investigate the hypothesis
that maternal exposure to nanosized particles (such as carbon black, CB) during
pregnancy affects the fetal development. In fact, the results have revealed that there is a
change in the expression of several genes and proteins associated with inflammation in
maternal lungs after carbon black (CB) exposure, while the newborns respond with
changes in metabolism-related genes which can also manifest later in life [33].
A more recent study has performed toxicological tests to investigate PEG-SWCNTs
effects in order to evaluate their possible use as biomedical carriers in pregnancy [34].
PEG-SWCNT are intravenously injected in CD1 pregnant mice at different doses and in
single or multiple administrations. The results showed no adverse effects on embryos up
81
to the dose of 10 μg/mouse, while at the dose of 30 μg/mouse, are detected teratogenic
effects, in association with placental damage [34].
From examining the literature, there are few studies about exposure of the human
placenta to asbestos fibres and carbon nanotubes: none, at the best of our knowledge,
comparing the two material classes.
Therefore, our aim was to explore asbestos and carbon nanotube toxicity, as well as iron
related responses, by using in vitro barrier model of the placenta (BeWo cell line).
2.3.2 Results of viability test
The results were expressed as % dead cells when compared with control as shown in
Figure 19. The results have revealed that after 24h of crocidolite (5 µg/ml) and iron
sulphate (80 µm) incubation the viability of cells was to around 65%. The cells exposed
to 5 µg/ml of raw-SWCNTs (r-SWCNTs) showed a decrease of vitality to about 70%,
while in the ones treated with purified-SWCNTs (p-SWCNTs) this was more than 80%.
The highly purified-SWCNTs exposure (hp-SWCNTs) gave a cellular vitality of about
90% (Figure 19).
Similarly to the conditions of MeT5A treatments, the concentration of 5 µg/ml and the
incubation at 24 h were selected for X-ray fluorescence and microscopy analyses and
ferritin assay.
Figure 19. Quantification of placental cells (BeWo) viability during the treatments with each
nanomaterial (5 µg/ml for 24 h).
82
2.3.3 Results of elemental mapping with XRF and AFM microscopy
After a selection under light microscopy, cells were raster scanned at the ID21 beamline
of the European Synchrotron Radiation Facility (ESRF) using 7.2 keV photon energy.
monitoring the characteristic X-ray emissions of P, S, Ca and Fe. Figure 20 shows the
XRF maps of control and treated BeWo cells with iron sulphate (FeSO4).
Figure 20. XRF maps of untreated and treated cells with iron sulphate. (A) Visible light image of the
control cell (a) and the corresponding P, S, Ca and Fe XRF maps (152 µm x 105 µm) showing the
distribution of different elements. (B) Visible light image of treated cell with FeSO4 (a) and the
corresponding P, S, and Fe XRF maps (56 µm x 62,5 µm). The XRF maps were acquired at 7.2 keV
excitation energy.
83
In panel A (Figure 20) the elemental maps of a group of control BeWo cells are
presented: phosphorus (P) and sulphur (S) are constitutive elements of cells, and their
distribution allowed to delineate the cell shape. In particular the maximally P-rich zones
in the central part of the cell could be attributed to the nucleoli. Calcium map (Ca)
showed a rather homogeneous distribution, while iron (Fe) appeared close to the
detection limit, suggesting a very low presence in healthy cells. Looking optical image
(a) and sulphur (S) map, we immediately noted the different morphology of placental
cells compared to mesothelial ones. In fact, BeWo cells are able to fuse and form
multinucleated syncytia.
Panel B (Figure 20) shows the elemental maps of cells exposed to iron sulphate
(FeSO4). The iron (Fe) map revealed iron-rich regions that localize the iron aggregates,
probably most of them probably extracellular. In addition, it seemed there was a diffuse
intracellular iron increase that could derive from Fe uptake of the cell.
Heaton SJ et al. [35], performed in vitro study by using placenta BeWo cells to
demonstrate that they are a valuable cell model for the study of iron transport in the
placenta. Their results suggested that free iron is likely to undergo paracellular diffusion
across the BeWo cell layer readily, while Fe complexed to transferrin protein (Fe-Tf) is
transported across the cell layer predominantly transcellular route.
Figure 21 shows the elemental maps of placental cells exposed to crocidolite. The iron
(Fe) map revealed iron-rich segments that localize the crocidolite fibres: those of small
dimension seemed to be intracellular, as perceived by comparison with phase contrast
(b) absorption (c) images. But they could be also attached onto cell surface. In addition,
the logarithmic scale of the iron map allowed revealing a diffuse intracellular iron
increase that could derive both from iron dissolution of fibres and by an increased Fe
uptake of the cell. Compared to control cells, cells exposed to asbestos showed an
increased Ca presence. This element tends to co-localize on extracellular parts of the
fibres, suggesting that the material attracts ions present in the culture media.
The phase contrast and absorption images (b, c) clearly indicate the different density
between nucleoli and cytoplasm. The technique allowed to precisely reveal all the fibres
which were internalized, in fact most of them were not observable from optical image
(a). In addition, it was possible to investigate the alteration of morphological aspects of
cellular surface revealing in detail the presence of vesicles which were localized in the
cytoplasmic compartment.
84
Figure 21. µXRF and X-ray microscopy of treated cells with crocidolite. Visible light image of a
group of cells exposed to crocidolite fibers (a) and the corresponding P, S, Ca, Fe XRF maps (129 µm x
136 µm) showing the distribution of different elements. Fe map is displayed using a logarithmic scale. On
the right side are showed the X-ray microscopy phase contrast (b) absorption (c) images of the
corresponding XRF maps. The absorption and phase contrast images were measured at 0.9 KeV photon
energy, whereas the XRF maps were acquired at 7.2 keV.
However, in BeWo cells there were some difficulties in interpreting the results due to
their morphology. Frequently, the syncytial form of the trophoblast-derived BeWo cells
did not allowed to easily localize the nanomaterials, especially CNTs. Therefore, we
performed AFM analysis in combination with X-ray fluorescence microscopy to better
monitor cell-nanomaterial interactions and particularly try to discriminate intracellular
from extracellular localizations.
In Figure 22 are reported XRF maps and AFM images (b,c) of treated cells with
crocidolite fibres. In particular, the bidimensional map of P/Fe colocalization was
analyzed in association with AFM images. The combination of X-ray fluorescence with
the AFM microscopy allowed to discriminate the cells that phagocytized the fibres, and
the others which were surely outside the cells, as confirmed from visible image (a).
Looking calcium (Ca) map it was observed an calcium deposition on external fibres,
85
while iron map seemed to confirm that there was an intracellular iron increase as well as
a dissociation of iron from crocidolite fibres. Again, the combination of XRF and AFM
provided a detailed morphological description about the interaction of crocidolite fibres
with the placental cells and allowed to discriminate between intra- and extracellular
asbestos fibres and to identify their interaction of with specific cellular compartments.
Figure 22. µXRF and AFM images of treated cells with crocidolite. Visible light image of a group of
cells exposed to crocidolite fibers (a) and the corresponding P, S, Ca, Fe XRF maps (80 µm x 56,5 µm)
showing the distribution of different elements. Fe map is displayed using a logarithmic scale. Below are
showed P/Fe XRF map and the corresponding AFM images (b,c).
86
Figure 23. µXRF and X-ray microscopy of treated cells with r-SWCNTs. P, S, Ca, Fe XRF maps
(152 µm x 97 µm) image of cell exposed to raw carbon nanotubes (r-SWCNT). Visible light image (a),
the X-ray microscopy absorption (b) and phase contrast (c) images of the corresponding cells are also
reported below. The absorption and phase contrast images were measured at 0.9 KeV photon energy,
whereas the XRF maps were acquired at 7.2 keV.
The elemental maps of cells exposed to raw-SWCNTs are displayed in Figure 23.
Merging with the cellular shape (P and sulphur S maps) the iron (Fe) map revealed
several iron-rich spots inside or surrounding the cells. Bases on their dimensions and
intensities, these iron-spots could be attributed to iron containing nanotubes or to
residual iron particles detached from them [16]. The X-ray absorption and contrast
images (b and c) revealed that raw carbon nanotubes were not easily visible. But from
comparison with iron map (Fe) and visible image (a) it was possible distinguish r-
SWCNTs deposited on the cell surface, which they correspond to more intense spots in
the X-ray absorption image (b). The contrast image (c) showed some spots that were
thicker than cellular material and may correspond to small raw-SWCNTs or iron
particles released from them. We supposed that some of these iron nanoparticles were
internalized from cells.
87
Figure 24. µXRF and AFM images of treated cells with p-SWCNTs. Visible light image of a group of
cells exposed to purified carbon nanotubes (p-SWCNT) (a) and the corresponding P, S, Ca, Fe XRF
maps (96 µm x 131 µm) images are reported, showing the distribution of different elements. Fe map is
displayed using a logarithmic scale. XRF maps were acquired at at 7.2 keV excitation energy. Below are
showed P/Fe XRF map and the corresponding AFM images (b,c).
Figure 24 shows the elemental maps and the corresponding AFM images of cells
exposed to purified carbon nanotubes (p-SWCNTs). The combination of AFM and the
overlapping signals of P and Fe (in green in the P/Fe panel) suggested the presence of
88
small vesicles with CNTs internalized. Further, the P/Fe overlapping signal in green
allowed to localize small SWCNTS or bundle of them. It was clearly difficult to
discriminate CNTs that were outside cells from those inside, also when combining
AFM. Most of CNTs seem to remain outside of the cells, and depositing onto the
surface. It was interesting that it may be perceived that there was a sort of release of
iron traces from nanotubes.
Figure 25. µXRF and X-ray microscopy of treated cells with hp-SWCNTs. P, S, Ca, Fe XRF maps
(128 µm x 112 µm) image of cell exposed to highly purified carbon nanotubes (hp-SWCNTs). Visible
light image (a), the X-ray microscopy absorption (b) and phase contrast (c) images of the corresponding
cells are also reported below. The absorption and phase contrast images were measured at 0.9 KeV
photon energy, whereas the XRF maps were acquired at 7.2 keV.
Figure 25 shows the XRF maps and absorption (b) and phase contrast (c) images of
cells exposed to highly purified carbon nanotubes (hp-SWCNT). Phosphorus (P) and
sulphur (S) maps identified the cellular shape, while the iron (Fe) map revealed a few
iron-rich spots inside the cell. Looking at the iron (Fe) map, it was interesting to note
that there was an inhomogeneous increase of its intracellular presence and iron-rich
spots could overlap with hp-SWCNTs that deposited onto the cell’s surface. The
89
marginal iron alteration observed in this sample is surely due to the higher purity grade
of hp-SWCNTs (5 wt % iron).
2.3.3 Results of ferritin assay
The results demonstrated that the ferritin was increased in the cell exposed to crocidolite
fibres and iron sulphate (FeSO4) compared to control cells (as shown in Figure 26).
Cells treated with r-SWCNTs had a lower ferritin stimulation than crocidolite fibres.
The cells treated with p-SWCNTs had a lower stimulation than cells treated with r-
SWCNTs, while cells treated with hp-SWCNTs showed a similar ferritin content than
control cells (as shown in Figure 26). The results showed that the amount of
intracellular ferritin of BeWo cells treated with different NMs was lower than that of
treated mesothelial cells (MeT5A) (Figure 18).
Figure 26. Intracellular concentrations of ferritin after in vitro exposure of placental cells to different
nanomaterials. *Significantly increased is found in samples treated with crocidolite and iron sulphate, and
also raw- and purified-SWCNTs.
90
2.4 Conclusions and comparison between pleura and placenta cell responses
We have demonstrated that the combination of advanced synchrotron-based X-ray
microscopy and fluorescence techniques (µXRM and XRF) are promising to study the
toxic mechanisms induced by asbestos and carbon nanotubes in the pleural and the
placental cell lines. The results obtained by simultaneous structural and elemental
analysis showed that there was an increase of iron, which was also confirmed by the
stimulation of ferritin, after the exposure to nanomaterial. The presence of iron
impurities in the nanomaterials seemed to be the main cause of toxic effects that result
in an alteration of iron metabolism.
The cells treated with raw-SWCNTs and crocidolite fibres compared to the control
showed a severe alteration of iron metabolism, which was maximal in the pleural cells
(MeT5A) and was clearly related to the presence of iron into the fibre. Highly purified
nanotubes, in fact, did not altered iron metabolism. X-ray absorption and phase contrast
images confirmed that the toxicity of nanomaterials was characterized by membrane
damage with vesicle secretion and filipodia formation.
The placenta barrier showed a difference in the cell response and alteration of iron
metabolism. In fact, while X-ray fluorescence analyses clearly revealed a homogeneous
intracellular iron increase in pleural cells after fibre exposure, the same technique
showed that the iron changes inside placental cells were restricted to small intracellular
regions just in contact with nanofiber or nanotube. This observation was confirmed by
AFM analysis that allowed to clarify the cell-nanofiber interactions as well as the cell
morphology.
In relation to this toxic mechanism quite complex and still unknown, the evaluation of
intracellular ferritin demonstrated that crocidolite and raw carbon nanotubes gave a
severe stimulation of this protein in both cell models, while highly purified carbon
nanotubes gave values comparable to control. The ferritin stimulation was clearly lower
in placental cells, and clearly linked to a different uptake of fibres in these cells,
suggesting that this barrier is less vulnerable than the pleura.
91
References
[1] Singh P, Campidelli S, Giordani S, Bonifazi D, Bianco A, Prato M. Organic
functionalisation and characterisation of single-walled carbon nanotubes. Chem
Soc Rev. 2009 Aug;38(8):2214-30.
[2] Movia D, Prina-Mello A, Bazou D, Volkov Y, Giordani S. Screening the
cytotoxicity of single-walled carbon nanotubes using novel 3D tissue-mimetic
models. ACS Nano. 2011 Nov 22;5(11):9278-90.
[3] Andolfi L, Trevisan E, Zweyer M, Prato S, Troian B, Vita F, Borelli V, Soranzo
MR, Melato M, Zabucchi G. The crocidolite fibres interaction with human
mesothelial cells as investigated by combining electron microscopy, atomic force
and scanning near-field optical microscopy. J Microsc. 2013 Mar;249(3):173-83.
[4] Kaulich B, Gianoncelli A, Beran A, Eichert D, Kreft I, Pongrac P, Regvar M,
Vogel-Mikus K, Kiskinova M. Low-energy X-ray fluorescence microscopy opening
new opportunities for bio-related research. J. R. Soc. Interface 6 Suppl 5, S641–S647
(2009).
[5] Gianoncelli A, Morrison GR, Kaulich B, Bacescu D, Kovac J. A fast readout CCD
camera system for scanning X-ray microscopy. Appl. Phys. Lett 89, 251117–251119
(2006).
[6] Morrison GR, Gianoncelli A, Kaulich B, Bacescu D, Kovac J. A fast readout
CCDsystem for configured-detector imaging in STXM. Conf. Proc. Series IPAP 7,
277–379 (2006).
[7] Alberti R, Klatka T, Longoni A, Bacescu D, Marcello A, De Marco A, et al.
Development of a low-energy x-ray fluorescence system with submicrometer
spatial resolution. X-Ray Spectrometry 2009, 38:205-209.
[8] Gianoncelli A, Kaulich B, Alberti R, Klatka T, Longoni A, de Marco A, et al.
Simultaneous Soft X-ray Transmission and Emission Microscopy. Nuclear
Instruments and Methods in Physics Research A 608, 195–198 (2009).
[9] Bohic S, Cotte M, Salomé M, Fayard B, Kuehbacher M, Cloetens P, Martinez-
Criado G, Tucoulou R, Susini J. Biomedical applications of the ESRF synchrotron-
based microspectroscopy platform. J. Struct. Biol. 177, 248–258 (2012).
[10] Sole A, Papillon E, Cotte M,Walter P, Susini J. Amultiplatform code for the
analysis of energy-dispersive X-ray fluorescence spectra. Spectrochim Acta B 62,
63–68 (2007).
92
[11] Mutsaers SE. The mesothelial cell. Int J Biochem Cell Biol. 2004 Jan;36(1):9-16.
Review.
[12] Murphy FA, Schinwald A, Poland CA, Donaldson K. The mechanism of pleural
inflammation by long carbon nanotubes: interaction of long fibres with
macrophages stimulates them to amplify pro-inflammatory responses in
mesothelial cells. Part Fibre Toxicol. 2012 Apr 3;9:8.
[13] Tabet L, Bussy C, Amara N, Setyan A, Grodet A, Rossi MJ, Pairon JC,
Boczkowski J, Lanone S. Adverse effects of industrial multiwalled carbon
nanotubes on human pulmonary cells. J Toxicol Environ Health A. 2009;72(2):60-73.
[14] Baldys A, Aust AE. Role of iron in inactivation of epidermal growth factor
receptor after asbestos treatment of human lung and pleural target cells. Am J
Respir Cell Mol Biol. 2005 May;32(5):436-42.
[15] Ghio AJ, Soukup JM, Dailey LA, Richards JH, Turi JL, Pavlisko EN, Roggli VL.
Disruption of iron homeostasis in mesothelial cells after talc pleurodesis. Am J
Respir Cell Mol Biol. 2012 Jan;46(1):80-6
[16] Bussy C, Paineau E, Cambedouzou J, Brun N, Mory C, Fayard B, Salomé M,
Pinault M, Huard M, Belade E, Armand L, Boczkowski J, Launois P, Lanone S.
Intracellular fate of carbon nanotubes inside murine macrophages: pH-dependent
detachment of iron catalyst nanoparticles. Part Fibre Toxicol. 2013 Jun 25;10:24.
[17] Porter AE, Gass M, Muller K, Skepper JN, Midgley PA, Welland M. Direct
imaging of single-walled carbon nanotubes in cells. Nat Nanotechnol. 2007
Nov;2(11):713-7.
[18] Bussy C, Cambedouzou J, Lanone S, Leccia E, Heresanu V, Pinault M, Mayne-
L'hermite M, Brun N, Mory C, Cotte M, Doucet J, Boczkowski J, Launois P. Carbon
nanotubes in macrophages: imaging and chemical analysis by X-ray fluorescence
microscopy. Nano Lett. 2008 Sep;8(9):2659-63.
[19] Zhu L, Chang DW, Dai L, Hong Y. DNA damage induced by multiwalled
carbon nanotubes in mouse embryonic stem cells. Nano Lett.2007 Dec;7(12):3592-7.
[20] Ghio AJ, Carter JD, Samet JM, Quay J, Wortman IA, Richards JH, Kennedy TP,
Devlin RB. Ferritin expression after in vitro exposures of human alveolar
macrophages to silica is iron-dependent. Am J Respir Cell Mol Biol. 1997
Nov;17(5):533-40.
93
[21] Ghio AJ, Stonehuerner J, Steele MP, Crumbliss AL. Phagocyte generated
superoxide displaces Fe31 from surface of asbestos. Arch. Biochem. Biophys. 1994.
315:219–225.
[22] Cartwright L, Poulsen MS, Nielsen HM, Pojana G, Knudsen LE, Saunders M,
Rytting E. In vitro placental model optimization for nanoparticle transport studies.
Int J Nanomedicine. 2012;7:497-510.
[23] Correia Carreira S, Walker L, Paul K, Saunders M. The toxicity, transport and
uptake of nanoparticles in the in vitro BeWo b30 placental cell barrier model used
within NanoTEST. Nanotoxicology. 2015 May;9 Suppl 1:66-78.
[24] Poulsen MS, Mose T, Maroun LL, Mathiesen L, Knudsen LE, Rytting E. Kinetics
of silica nanoparticles in the human placenta. Nanotoxicology. 2015 May;9 Suppl
1:79-86.
[25] Myllynen PK, Loughran MJ, Howard CV, Sormunen R, Walsh AA, Vähäkangas
KH. Kinetics of gold nanoparticles in the human placenta. Reprod Toxicol. 2008
Oct;26(2):130-7.
[26] Cunningham HM, Pontefract RD. Placental transfer of asbestos. Nature. 1974
May 10;249(453):177-8.
[27] Haque AK, Mancuso MG, Williams MG, Dodson RF. Asbestos in organs and
placenta of five stillborn infants suggests transplacental transfer. Environ Res. 1992
Aug;58(2):163-75.
[28] Haque AK, Vrazel DM, Burau KD, Cooper SP, Downs T. Is there transplacental
transfer of asbestos? A study of 40 stillborn infants. Pediatr Pathol Lab Med. 1996
Nov-Dec;16(6):877-92.
[29] Bai Y, Zhang Y, Zhang J, Mu Q, Zhang W, Butch ER, Snyder SE, Yan B.
Repeated administrations of carbon nanotubes in male mice cause reversible testis
damage without affecting fertility. Nat Nanotechnol 5, 683–689 (2010).
[30] Qi W, Bi J, Zhang X, Wang J, Wang J, Liu P, Li Z, Wu W. Damaging effects of
multi-walled carbon nanotubes on pregnant mice with different pregnancy times.
Sci Rep. 2014 Mar 12;4:4352.
[31] Hougaard KS, Jensen KA, Nordly P, Taxvig C, Vogel U, Saber AT, Wallin H.
Effects of prenatal exposure to diesel exhaust particles on postnatal development,
behavior, genotoxicity and inflammation in mice Part. Fibre Toxicol. 5 (2008) 3.
94
[32] Ema M, Kobayashi N, Naya M, Hanai S, Nakanishi J. Reproductive and
developmental toxicity studies of manufactured nanomaterials. Reprod. Toxicol. 30
(2010) 343–352.
[33] Jackson P, Hougaard KS, Vogel U, Wu D, Casavant L, Williams A, Wade M,
Yauk CL, Wallin H, Halappanavar S. Exposure of pregnant mice to carbon black by
intratracheal instillation: toxicogenomic effects in dams and offspring. Mutat Res.
2012 Jun 14;745(1-2):73-83.
[34] Campagnolo L, Massimiani M, Palmieri G, Bernardini R, Sacchetti C,
Bergamaschi A, Vecchione L, Magrini A, Bottini M, Pietroiusti A. Biodistribution and
toxicity of pegylated single wall carbon nanotubes in pregnant mice. Part Fibre
Toxicol. 2013 Jun 6;10:21.
[35] Heaton SJ, Eady JJ, Parker ML, Gotts KL, Dainty JR, Fairweather-Tait SJ,
McArdle HJ, Srai KS, Elliott RM. The use of BeWo cells as an in vitro model for
placental iron transport. Am J Physiol Cell Physiol. 2008 Nov;295(5):C1445-53
95
CHAPTER 3 - A “NANOTOXICOGENOMIC”
STUDY: THE ROLE OF BAP1 IN
MESOTHELIOMA DEVELOPMENTa
a) A manuscript is under preparation: “Puzzling results from BAP1 germline mutations
in a small group of asbestos exposed patients in Northeast Italy”. Cammisuli F.,
Athanasakis E., Rizzardi C., Dal Monego S., Costantinides F., Bassan F.,Licastro D.,
Canzonieri V., Melato M., Pascolo L.
A new route to understand the link between genetic variation and susceptibility to
nanomaterials is the so-called “nanotoxicogenomics”. The harmful effects arising from
exposures to nanomaterials can be different for the same dose, depending on the
genotype and genetic predisposition of an individual.
Asbestos is the main risk factor in the etiology of malignant mesothelioma (MM), while
CNTs may represent a risk factor for the future. Typically, asbestos exposure induces a
chronic inflammatory response in response to biopersistent fibres that may lead to
malignant cell transformation after a 15-40 year latency period following initial fibre
exposure [1]. However, only a small proportion of people exposed to asbestos develop
mesothelioma, suggesting that the genetic susceptibility could play an important role in
its development.
Although the commercialization and industrial use of asbestos have been limited since
1990 and it is almost abolished today, the long latency of the pathology will ensure that
the incidence will peak between the years 2010 and 2020. Epidemiological studies have
estimated that about 86-95% of mesothelioma cases are related to demonstrable
asbestos exposure [2-3].
In addition to asbestos inhalation and inflammatory response, the suggestion that
genetic factors are implicated in the etiology of malignant mesothelioma has been put
forward since several years [5-6]. The correlation has been proved by the association of
BAP1 (BRCA1-associated protein 1) germline mutations with the development of
mesothelioma. A study in three villages in Cappadocia (Turkey) showed a clear
96
association among certain families, revealing a genetic susceptibility to development of
mesothelioma that occurs probably in an autosomal dominant way [7].
The BAP1 gene is a tumor-suppressor gene that is located on the short arm of
chromosome 3 (3p21) (Figure 27) and belongs to the ubiquitin C-terminal hydrolase
subfamily of deubiquitinating enzymes, which are involved in the removal of ubiquitin
from proteins. In addition, BAP1 is also involved in regulation of gene transcription,
regulation of cell cycle and growth, response to DNA damage and modulation of
chromatin (epigenetic mechanisms) [8].
Figure 27. Schematic representation of BAP1 domains. Human BAP1 is 729 amino acids (90 kDa).
The amino-terminal region contains ubiquitin C-terminal hydrolases (UCH) domain. BAP1 binds to the
RING finger domain of BRCA1 through its carboxyl-terminal region (594-657 amino acids). Domain
comprised by residues 182-365 of BAP1 interacts with the RING finger domain of BARD1. UCH
domain; BARD1 binding domain; HBM binding domain; BRCA1 binding domain; NLS, nuclear
localization signal. BAP1 interacts with HCF-1 (host cell factor 1) through HCF-binding motif (HBM).
The C-terminal region contains a putative nuclear localization signal.
Germline BAP1 mutations are found in families where there is a high incidence of
malignant tumours, which are often developed in an earlier age with respect to the
general population [9]. A “BAP1 cancer syndrome” has been proposed, which includes
mesothelioma, uveal melanoma, cutaneous melanoma and possibly other malignant
tumours [10].
A further study showed a patient with the BAP1 hereditary cancer predisposition
syndrome. The patient, a 72-year-old woman diagnosed with uveal melanoma,
peritoneal mesothelioma and a primary biliary tract adenocarcinoma [11]. She had a
family history of mesothelioma as well as other malignancies including renal cell
carcinoma. This study revealed a germline BAP1 missense mutation (p.Tyr173Cys) that
alters the active site of the ubiquitin hydrolase domain and it is predicted to generate a
non-functional full-length protein [11]. Other studies reported similar germline BAP1
missense mutation in pleural biphasic mesothelioma (p.Tyr173Cys) [11-12] and uveal
melanoma (p.Ser172Arg) [11,13].
97
A recent study showed a novel germline BAP1 nonsense mutation (c.1777C>T) which
produces a truncated BAP1 protein product and segregates with cancer [14]. The patient
had multiple cancers and a family history of melanocytic tumors and cutaneous
melanomas in early age and with autosomal dominant inheritance. In addition, the
proband with the same BAP1 germline mutation developed other tumors including
thyroid cancer [14].
Another paper revealed a homozygous substitution of BAP1 gene (c.2054A>T;
p.Glu685Val) in an MPM cell line derived from a mesothelioma patient [15]. These
results demonstrated that aberrant splicing caused by this mutation creates a novel 5'
splice site and activation of cryptic splice sites, contributing to MPM through disruption
of normal splicing [15].
In addition, somatic BAP1 mutations seem also to contribute to the growth and
aggressiveness of malignant mesothelioma [16].
In the present study, we investigated the possible presence of a genetic predisposition to
develop mesothelioma, as BAP1 gene mutation, in a well-characterized court of
asbestos-exposed subjects who developed mesothelioma. The Northeastern of Italy
(around the cities of Trieste and Gorizia) is one of Italy's areas where occupational
exposure to asbestos occurred in the past and caused an excess incidence of malignant
mesothelioma among the people [4].We examined a total of 29 patients from this
asbestos-related disease endemic area, revealing a total of two new Bap1 mutations.
3.1 Material and Methods
3.1.1 Patients and tissue samples
Tissues samples were obtained from twenty-nine autoptic cases randomly selected from
the archives of the Institute of Forensic Medicine of the University of Trieste. All the
cases were subjected to legal medical advice to establish the cause of death and a
possible correlation to a professional exposure to asbestos and/or to the presence of
asbestos-related diseases. All the patients were residents of Trieste, a ship-building town
in North-Eastern Italy with a high incidence of mesothelioma among workers and in
general population.
In Table B1 of Appendix B are reported the clinical features of 29 patients. They are
sex, age of diagnosis and death, survival time, cancer and concurrent diseases,
98
malignant mesothelioma histotype, and treatment including surgery, chemotherapy, and
radiation, asbestos exposure circumstances, occupation and asbestos bodies count.
The 21 cases of mesothelioma (20 pleural and 1 peritoneal) were histologically
diagnosed either during their clinical course or at post-mortem examination, according
to standard histological and immunohistochemical criteria, and classified according to
the WHO classification of pleural tumors [17]. Among these, 7 cases were epithelioid, 2
sarcomatoid and 11 biphasic, while the peritoneal mesothelioma was the epithelioid
histological type (Table B1, in Appendix B).
In addition, the causes of death included cell carcinoma (2 cases) and adenocarcinoma
(1 case) of the lung, and squamous cell carcinoma of the oral cavity metastasized to the
lungs in 1 case (Table B1, in Appendix B).
3.1.2 Nucleic Acid Extraction and PCR Amplification
Genomic DNA of 29 patients was extracted from frozen tissues using QIAamp DNA
Mini Kit (Qiagen, Hilden, Germany) according to the manufacture’s protocol. PCR
amplification of 17 BAP1 exons and of all their exon-intron boundaries (NCBI
accession number: NM_004656.3) was performed as previously described by Bortot et
al. [18]. Briefly, primer designs was performed using the Primer3web v4.0.0 on-line
software [19-20] (Table 3). All amplifications was carried out using the KAPA2G Fast
ReadyMix (Kapa Biosystems, Cape Town, South Africa) in a 96-well PCR plate and
sharing a common annealing temperature in a two-cycle step touchdown protocol: first,
an initial denaturation step at 96°C for 3 minutes was followed by a touchdown step
planning to decrease the temperature by 0.5°C/cycle, through 10 cycles: 95°C for 15
seconds, 62°C for 15 seconds, and 72°C for 1 second; the second endpoint-PCR step
through 30 cycles was performed as follows: 95°C for 10 seconds, 59°C for 10 seconds,
and 72°C for 1 second.
Total RNA was isolated from frozen tissues using the EuroGOLD Total RNA Kit
(EuroClone, Milan, Italy). Reverse transcription (RT) reaction was performed using the
GoScript Reverse Transcription System (Promega, Madison, WI, USA) according to the
manufacture’s protocol. RT was performed in a reaction volume of 5 µl containing 5 µg
of total RNA and 15 pM of each sequence-specific primer (Table 3). Primers were
designed using the on-line NCBI Primer-BLAST tool [21] and their specificity was
checked on the Refseq mRNA database. Finally, cDNA PCR amplification was
99
conducted according to the above describe touchdown protocol using the same
sequence-specific primers of each RT reaction.
3.1.3 Sanger Sequencing and Mutation Data Handling
PCR products were purified using Illustra ExoStar 1-Step kit (GE Healthcare, UK)
according to the manufacturer’s protocol. Sequencing of the PCR fragments was carried
out using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies, Foster
City, CA, USA) following the manufacturer’s instructions. Automated electrophoreses
were performed on an ABI 3500Dx Genetic Analyzer and the sequencing results were
analyzed using the SeqScape v2.7 software (Life Technologies, Foster City, CA, USA).
All identified variants were annotated using a custom bioinformatics pipeline basic on
Annovar software [22] and referring to several databases as reported in the Table 3. To
detect alterations in exon-intron boundary regions and splicing motifs due to nucleotide
changes, the bioinformatics tools for splice site prediction HSF [23], NNSplice [24],
NetGene [25] and SPANR [26] were used. All selected variants were reconfirmed either
on genomic DNA or, in case of splicing site mutations, on cDNA by Sanger sequencing.
An in silico mutation analysis was performed for the non-synonymous selected
mutations to predict if the aminoacid substitution could involve a structural
modification of BAP1 protein. Phyre2 v2.0 [27], a web-based resource for template-
based modeling, was used. Wild type aminoacid sequence (NCBI accession number:
NP_004647.1) was submitted through the intensive method in order to obtain a PDB
structure. The outcome wild type protein structure presented a structural homology at
100% of confidence with the ubiquitin carboxyl-terminal hydrolase isozyme l5 (PDB
ID: 3IHR) [28] from the 5 to the 238 amino acids of query sequence. The modeling of
the remain amino acid sequence was predicted. In a second attempt, the mutated
aminoacid sequence was aligned using the same tool on the wild type protein obtained
previously. Analyses of all docked poses were performed using the molecular
visualization software UCSF-Chimera v1.10.2 [29].
100
Exon number Forward 5‟ to 3‟ Reverse 5‟ to 3‟
1 gttcgccttcgagcgcatg cacgagcagggtgaagaggc
2 and 3 gaataagggctggctggagctg gccctgttctctgggaccttc
4 cacagcaaggacacctgagtgatg cttcctccatttccacttcccaagc
5 gttgtccagatatgactgacctgctc catgtggtagcattcccagtgg
6 and 7 cgtctgtgttccttccgattcctg gctggtcgggcaatatggtgtag
8 ctacaccatattgcccgaccagc cccatgatctaagcctgatcttgcc
9 tgccaggatatctgcctcaacct gctgaagcccagatctacaagagagt
10 gaatgggtagagccaaggcc agactttccctgtttaggcctccc
11 gcttgctgactcccattgcac accacatgggaaaattgcctgttg
12 gactcagtctggaaaaccatgttggc aggtgctcaacattatctgctgca
13 gtcgggatgtatttaagccattctgggt tgcaggacactttgtggtcacttg
14 gtgatctgggtcctgtcatcagc aggcaaggatgagcagcgagtc
15 and 16 ctcgctgctcatccttgcct caaggtctgctcaagcctcagga
17 tcctgaggcttgagcagaccttg agggcacgatggaaggaatgtg
Exons and cDNA start-
end position
Forward 5‟ to 3‟ Reverse 5‟ to 3‟
Exons 9-11, 715 - 941 atcaagtatgaggccaggctg tctgcaccatctgtgtggttg
Exons 10-12, 921- 1127 cgctggtgctggaagcaaac tcttcttcctcctgcatggg
Exons 13-14, 1628 -
1845
agcctgctgcgtgttgactg catccccgtcttctctctgctgtc
Table 3. List of primers sequences used for Sanger sequencing of DNA (BAP1, NG_031859.1) and
cDNA (BAP1 NM_004656.3, CCDS2853.1) target regions.
3.1.4 Multiplex Ligation-Dependent Probe Amplification
The BAP1 gene were analyzed by MLPA [30] using the SALSA MLPA P471-BAP1 -
LOT1011 (B1) probemix (MRC Holland, Amsterdam, the Netherlands). MLPA
reactions were performed starting from 75 ng of genomic DNA according to the
101
manufacturer’s instructions. The products were separated by capillary electrophoresis
on an ABI 3130XL Genetic Analyzer and controlled using the Gene Mapper v4.0
software (Life Technologies, Foster City, CA, USA). Copy number variations were
predicted in each patient using the Coffalyzer.Net v140721 software (MRC Holland,
Amsterdam, the Netherlands).
3.2 Results
Sanger sequencing of BAP1 gene in 29 patients identified one non-synonymous variant
and two intronic variants. While Sanger sequencing of cDNA revealed no alternative
splicing due to the nucleotide change for each mutations. MLPA analysis revealed no
significant copy number variations at exon level in all patient tumor samples.
Figure 28. Germline BAP1 missense mutation found in patient 9. Electropherogram shows BAP1
missense mutation (c.1028T>C; p.L343P) within exon 11.
In detail, patient 9 carried in heterozygous a missense variant (c.T1028C; p.L343P) at
exon 11 (Figure 28). Mutation pathogenicity prediction web tools reported this variant
as possible benign. Sanger sequencing of cDNA revealed no alternative splicing due to
the nucleotide change. In silico mutation analysis was performed in a predicted protein
structure of BAP1 protein without any significant possible effect of the amino acid
change (Figure 29).
102
Figure 29. In silico mutation analysis. The predicted protein structure of BAP1 protein without any
significant possible effect of the amino acid change. A web-based resource for template-based modeling,
Phyre2 v2.0 is used. Protein structures of wild type aminoacid sequence (NCBI accession number:
NP_004647.1) and of the mutated aminoacid sequence are displayed in figure. The outcome wild type
protein structure present a structural homology at 100% of confidence with the ubiquitin carboxyl-
terminal hydrolase isozyme l5 (PDB ID: 3IHR) from the 5 to the 238 amino acids of query sequence. The
modeling of the remain amino acid sequence is predicted. Analyses of all docked poses are performed
using the molecular visualization software UCSF-Chimera v1.10.2. The yellow star is referred to BAP1
missense mutation, also highlighted in yellow in mutated protein. The in silico analysis was performed by
Simeone Dal Monego (CBM, Trieste).
Patient 4 carried in heterozygous a known intronic variation 8 bases downstream of the
exon 13 (c.1729+8T>C (IVS 13)) (Figure 30). This variant was already described as
SNP (rs150945583) with a minor allele frequency between 0.0030 and 0.0055.
Alternative splicing prediction web tools gave as possible alteration of intronic splicing
site. Sanger sequencing of cDNA revealed no alternative splicing due to the nucleotide
change.
103
Figure 30. Germline BAP1 mutation found in patient 4. Electropherogram shows BAP1 mutation
(c.1729+8T>C) within intron region at 8 bases downstream of the exon 13.
Finally, in patient 15 a heterozygous intronic variation was identified, 8 bases upstream
of the exon 10 (c.784-8G>A (IVS9)) (Figure 31). Alternative splicing prediction web
tools gave contradictory results. Sanger sequencing of cDNA no alternative splicing due
to the nucleotide change.
Figure 31. Germline BAP1 mutation found in patient 15. Electropherogram shows BAP1 mutation
(c.784-8G>A) within intron region at 8 bases upstream of the exon 10.
3.3 Discussion and conclusion
Despite the relatively small number of cases investigated, our study gave puzzling
results on the effects of Bap1 mutation and the concomitant exposure to asbestos.
In total we revealed three mutations for Bap1, two of them in patients with
mesothelioma and one in a patient with only fibrosis.
104
As reported in literature, the tumors with germline BAP1 mutations are much less
aggressive than ones with somatic mutations. It has been reported that the individuals
with germline mutation have a survival time 5 times longer than others. [31].
It was interesting to note that our study reports the case of patient nine, having
mesothelioma, presenting a germline BAP1 missense mutation (c.T1028C; p.L343P)
and with unusual survival time (Table 4). This patient had a story of heavy occupational
exposure and presented the pleural epithelioid mesothelioma in association with diffuse
pleural fibrosis and desmoid-type fibromatosis. The patient underwent a multimodality
therapy and died 3.5 years after the diagnosis from advanced stage mesothelioma with
pulmonary, pericardial, mediastinal, diaphragmatic, peritoneal and osseous metastases.
The survival time of this patient with malignant mesothelioma is clearly unusually long
compared to the median survival time, typically, around 6-12 months.
Table 4. The detailed characteristics of three patients (four, nine and fifteen) with germline BAP1
mutations. In table are displayed gender, age of tumor diagnosis, age of death, cancer and other diseases,
asbestos exposure circumstances, occupation and asbestos bodies count for each patient.
Differently, the survival of patient fifteen, also with pleural mesothelioma, was about 1
year. In this case, the patient had a high content of asbestos bodies (Table 4) and
presented intronic germline BAP1 mutation (c.784-8G>A (IVS9)). It seemed that this
mutation does not affects survival.
A very interesting case was that of patient four, who had pulmonary fibrosis and died
following respiratory failure. His asbestos exposure history was not well documented
and the asbestos bodies count in the lung is quite low, close to environmental exposure.
105
Moreover, the autopsy of this patient with intronic germline BAP1 mutation
(c.1729+8T>C (IVS13)) revealed the presence of renal cell carcinoma.
Renal cell carcinoma was recently associated with BAP1 cancer syndrome. Particularly,
sporadic BAP1 mutations seems to have been identified in a small proportion of renal
cell carcinoma [32], while other renal cell carcinoma can be referred to germline
mutations [33-34].
This means that the mutation, although intronic and considered non dangerous by
computational analyses, clearly was associated to a tumor. Moreover, the patient was
not exposed to high quantities of asbestos, but developed an idiopathic fibrosis, strongly
suggesting a high susceptibility to inflammatory insults in lung.
In conclusion, our findings explained three cases of germline BAP1 missense mutations
in individuals with tumors related to BAP1 cancer syndrome and also exposed to
asbestos. Although the combination of different molecular analyses supported that
BAP1 variants were not a pathogenic mutations, two mesotheliomas and a renal cancer
were associated to mutations. Moreover, in agreement with literature, one patient (nine)
presented significantly increased survival time of three-year and half.
106
References
[1] Liu G, Cheresh P, Kamp DW. Molecular basis of asbestos-induced lung disease.
Annu Rev Pathol. 2013 Jan 24;8:161-87.
[2] Lacourt A, Gramond C, Rolland P, Ducamp S, Audignon S, Astoul P, Chamming's
S, Gilg Soit Ilg A, Rinaldo M, Raherison C, Galateau-Salle F, Imbernon E, Pairon JC,
Goldberg M, Brochard P. Occupational and non-occupational attributable risk of
asbestos exposure for malignant pleural mesothelioma. Thorax. 2014 Jun;
69(6):532-9.
[3] Corfiati M, Scarselli A, Binazzi A, Di Marzio D, Verardo M, Mirabelli D, Gennaro
V, Mensi C, Schallemberg G, Merler E, Negro C, Romanelli A, Chellini E, Silvestri S,
Cocchioni M, Pascucci C, Stracci F, Romeo E, Trafficante L, Angelillo I, Menegozzo S,
Musti M, Cavone D, Cauzillo G, Tallarigo F, Tumino R, Melis M, Iavicoli S,
Marinaccio A; ReNaM Working Group. Epidemiological patterns of asbestos
exposure and spatial clusters of incident cases of malignant mesothelioma from the
Italian national registry. BMC Cancer. 2015 Apr 15;15:286.
[4] Bianchi C, Brollo A, Ramani L, Zuch C. Asbestos-related mesothelioma in
Monfalcone, Italy. Am J Ind Med 1993, 24:149-160.
[5] Bianchi C, Brollo A, Ramani L, Bianchi T, Giarelli L. Familial mesothelioma of
the pleura-a report of 40 cases. Ind Health. 2004 Apr; 42(2):235-9.
[6] Tunesi S, Ferrante D, Mirabelli D, Andorno S, Betti M, Fiorito G, Guarrera S,
Casalone E, Neri M, Ugolini D, Bonassi S, Matullo G, Dianzani I, Magnani C. Gene-
asbestos interaction in malignant pleural mesothelioma susceptibility.
Carcinogenesis. 2015 Oct;36(10):1129-35.
[7] Carbone M, Emri S, Dogan AU, Steele I, Tuncer M, Pass HI, Baris YI. A
mesothelioma epidemic in Cappadocia: scientific developments and unexpected
social outcomes. Nat Rev Cancer 2007, 7:147–154.
[8] Carbone M, Yang H, Pass HI, Krausz T, Testa JR, Gaudino G. BAP1 and cancer.
Nat Rev Cancer 2013; 13: 153–159.
[9] Testa JR, Cheung M, Pei J, Below JE, Tan Y, Sementino E, Cox NJ, Dogan AU,
Pass HI, Trusa S, Hesdorffer M, Nasu M, Powers A, Rivera Z, Comertpay S, Tanji M,
Gaudino G, Yang H, Carbone M. Germline BAP1 mutations predispose to malignant
mesothelioma. Nat Genet. 2011;43(10):1022–5
107
[10] Carbone M, Ferris LK, Baumann F, Napolitano A, Lum CA, Flores EG, et al.
BAP1 cancer syndrome: malignant mesothelioma, uveal and cutaneous melanoma,
and MBAITs. J Transl Med. 2012;10:179.
[11] Klebe S, Driml J, Nasu M, Pastorino S, Zangiabadi A, Henderson D, Carbone M.
BAP1 hereditary cancer predisposition syndrome: a case report and review of
literature. Biomark Res. 2015 Jul 2;3:14.
[12] Yoshikawa Y, Sato A, Tsujimura T, Emi M, Morinaga T, Fukuoka K, Yamada S,
Murakami A, Kondo N, Matsumoto S, Okumura Y, Tanaka F, Hasegawa S, Nakano T,
Hashimoto-Tamaoki T. Frequent inactivation of the BAP1 gene in epithelioid-type
malignant mesothelioma. Cancer Sci. 2012;103(5):868–74.
[13] Harbour JW, Onken MD, Roberson ED, Duan S, Cao L, Worley LA, Council ML,
Matatall KA, Helms C, Bowcock AM. Frequent mutation of BAP1 in metastasizing
uveal melanomas. Science (New York, NY). 2010;330(6009):1410–3.
[14] McDonnell KJ, Gallanis GT, Heller KA, Melas M, Idos GE, Culver JO, Martin SE,
Peng DH, Gruber SB. A novel BAP1 mutation is associated with melanocytic
neoplasms and thyroid cancer. Cancer Genet. 2015 Dec 22. pii: S2210-
7762(15)00255-0.
[15] Morrison A, Chekaluk Y, Bacares R, Ladanyi M, Zhang L. BAP1 missense
mutation c.2054 A>T (p.E685V) completely disrupts normal splicing through
creation of a novel 5' splice site in a human mesothelioma cell line. PLoS One. 2015
Apr 1;10(4):e0119224.
[16] Bott M, Brevet M, Taylor BS, Shimizu S, Ito T, Wang L, Creaney J, Lake RA,
Zakowski MF, Reva B, Sander C, Delsite R, Powell S, Zhou Q, Shen R, Olshen A,
Rusch V, Ladanyi M. The nuclear deubiquitinase BAP1 is commonly inactivated by
somatic mutations and 3p21.1 losses in malignant pleural mesothelioma. Nat Genet.
2011;43(7):668–72.
[17] Galateau-Salle F, Churg A, Roggli V, Travis WD; World Health Organization
Committee for Tumors of the Pleura. The 2015 World Health Organization
Classification of Tumors of the Pleura: Advances since the 2004 Classification. J
Thorac Oncol. 2016 Feb;11(2):142-54.
[18] Bortot B, Athanasakis E, Brun F, Rizzotti D, Mestroni L, Sinagra G, Severini GM.
High-throughput genotyping robot-assisted method for mutation detection in
patients with hypertrophic cardiomyopathy. Diagn Mol Pathol. 2011 Sep;20(3):175-
9.
108
[19] Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen
SG. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012
Aug;40(15):e115.
[20] Koressaar T, Remm M. Enhancements and modifications of primer design
program Primer3. Bioinformatics. 2007 May 15;23(10):1289-91.
[21] Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-
BLAST: a tool to design target-specific primers for polymerase chain reaction.
BMC Bioinformatics. 2012 Jun 18;13:134.
[22] Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic
variants from high-throughput sequencing data. Nucleic Acids Res. 2010
Sep;38(16):e164.
[23] Desmet FO, Hamroun D, Lalande M, Collod-Béroud G, Claustres M, Béroud C.
Human Splicing Finder: an online bioinformatics tool to predict splicing signals.
Nucleic Acids Res. 2009 May;37(9):e67.
[24] Reese MG, Eeckman FH, Kulp D, Haussler D. Improved splice site detection in
Genie. J Comput Biol. 1997 Fall;4(3):311-23.
[25] Hebsgaard SM, Korning PG, Tolstrup N, Engelbrecht J, Rouzé P, Brunak S. Splice
site prediction in Arabidopsis thaliana pre-mRNA by combining local and global
sequence information. Nucleic Acids Res. 1996 Sep 1;24(17):3439-52.
[26] Xiong HY, Alipanahi B, Lee LJ, Bretschneider H, Merico D, Yuen RK, Hua Y,
Gueroussov S, Najafabadi HS, Hughes TR, Morris Q, Barash Y, Krainer AR, Jojic N,
Scherer SW, Blencowe BJ, Frey BJ. RNA splicing. The human splicing code reveals
new insights into the genetic determinants of disease. Science. 2015 Jan
9;347(6218):1254806.
[27] Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ. The Phyre2 web
portal for protein modeling, prediction and analysis. Nat Protoc. 2015
Jun;10(6):845-58.
[28] Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov
IN, Bourne PE. The Protein Data Bank. Nucleic Acids Res. 2000 Jan 1;28(1):235-42.
[29] Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC,
Ferrin TE. UCSF Chimera--a visualization system for exploratory research and
analysis. J Comput Chem. 2004 Oct;25(13):1605-12.
109
[30] Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G.
Relative quantification of 40 nucleic acid sequences by multiplex ligation-
dependent probe amplification. Nucleic Acids Res. 2002 Jun 15;30(12):e57.
[31] Baumann F, Flores E, Napolitano A, Kanodia S, Taioli E, Pass H, Yang H,
Carbone M. Mesothelioma patients with germline BAP1 mutations have 7-fold
improved long-term survival. Carcinogenesis. 2015;36(1):76–81.
[32] Gossage L, Murtaza M, Slatter AF, Lichtenstein CP, Warren A, Haynes B, Marass
F, Roberts I, Shanahan SJ, Claas A, Dunham A, May AP, Rosenfeld N, Forshew T,
Eisen T. Clinical and pathological impact of VHL, PBRM1, BAP1, SETD2,
KDM6A, and JARID1c in clear cell renal cell carcinoma. Genes Chromosomes
Cancer. 2014 Jan;53(1):38-51.
[33] Farley MN, Schmidt LS, Mester JL, Peña-Llopis S, Pavia-Jimenez A, Christie A,
Vocke CD, Ricketts CJ, Peterson J, Middelton L, Kinch L, Grishin N, Merino MJ,
Metwalli AR, Xing C, Xie XJ, Dahia PL, Eng C, Linehan WM, Brugarolas J. A novel
germline mutation in BAP1 predisposes to familial clear-cell renal cell carcinoma.
Mol Cancer Res. 2013 Sep;11(9):1061-71.
[34] Popova T, Hebert L, Jacquemin V, Gad S, Caux-Moncoutier V, Dubois-d'Enghien
C, Richaudeau B, Renaudin X, Sellers J, Nicolas A, Sastre-Garau X, Desjardins L,
Gyapay G, Raynal V, Sinilnikova OM, Andrieu N, Manié E, de Pauw A, Gesta P,
Bonadona V, Maugard CM, Penet C, Avril MF, Barillot E, Cabaret O, Delattre O,
Richard S, Caron O, Benfodda M, Hu HH, Soufir N, Bressac-de Paillerets B, Stoppa-
Lyonnet D, Stern MH. Germline BAP1 mutations predispose to renal cell
carcinomas. Am J Hum Genet. 2013;92(6):974–80.
110
CHAPTER 4 - UV RESONANT RAMAN
SPECTROSCOPY FOR INVESTIGATION OF
OXIDATIVE DNA DAMAGE INDUCED BY
CARBON NANOTUBESa
a) The results shown in this chapter are already published: D'Amico F, Cammisuli F,
Addobbati R, Rizzardi C, Gessini A, Masciovecchio C, Rossi B, Pascolo L. Oxidative damage in
DNA bases revealed by UV resonant Raman spectroscopy. Analyst. 2015 Mar 7;140(5):1477-85
In this chapter, I will report the molecular study that allowed testing the feasibility of
UV resonant Raman spectroscopy to reveal oxidative DNA damage after nanomaterial
exposure [1].
Every day DNA molecules are affected by the normal metabolic processes and
environmental factors that can cause damage to its structure [2]. Since an individual cell
can suffer up to one million DNA changes per day, the cells have developed a number
of mechanisms able to detect and repair the different types of damage that can occur in
DNA [3]. But failures of DNA repair mechanisms can lead to accumulation of
mutations and damage.
One of the major mechanisms associated with DNA damage is attributed to generation
of reactive oxygen species (i.e., superoxide, hydrogen peroxide, and hydroxyl radicals)
[4]. ROS are produced in cells during normal metabolic processes involving oxygen and
they have an important catalytic role. The presence of excess ROS may result from an
imbalance between the ROS generation and the inability of a biological system to
readily detoxify all the reactive species. These last can thus attack and damage cellular
components like proteins, lipids and nucleic acids DNA (i.e., oxidation of DNA
nucleobases, de-purination and DNA strand breaks) [5].
The production of ROS may be significantly increased by exposure to different
environmental contaminants derived from industry, agriculture, air pollution, or tobacco
smoke [6].
Oxidative stress induced by nanomaterials is due to their physical and chemical
properties as well as presence of metal impurities in their composition, while cellular
mechanisms such as mitochondrial respiration, nanomaterial-cell interaction, and
111
activation of immune system are responsible for ROS-mediated damage [7]. When
nanomaterials interact with cells trigger oxidative stress events leading to others
harmful effects such as genotoxicity, inflammation, and fibrosis [8].
The transition metals that are present on nanomaterial surface can generate reactive
oxygen species through the Fenton’s reaction [6].
In this study, an oxidative environment was created in vitro by using carbon nanotubes
(raw-SWCNTs), containing metal impurities (30% of iron), and free radicals OH•
(derived from H2O2). In this condition the elements of DNA, in particular the
nucleotides (dATP, dCTP, dGTP and dTTP), result in increased susceptibility to
oxidative damage.
UV Raman spectroscopy is shown to be maximally efficient to reveal changes in the
nitrogenous bases during this oxidative damage occurring on these molecules.
This chapter is divided in two sections. In the first I will describe the experimental
methods used in this study, and in the second I will discuss the results obtained.
4.1 Material and Methods
4.1.1 UV resonant Raman spectroscopy
Raman spectroscopy has been extensively used in the past few years to characterize the
chemical structure of DNA [7-8] and it has recently been applied to reveal changes in
the DNA structures (i.e., chain breaks and oxidative damage) [9-10].
However, the biggest difficulty in interpreting the Raman spectra of biological
macromolecules is the great number of overlapping vibration modes. Furthermore, in
the specific case of DNA study, the analysis of Raman spectra is complicated by the
presence of interfering fluorescence backgrounds due to the use of visible light as
excitation probe.
Nonetheless, the use of ultraviolet (UV) excitation to obtain Raman spectra has several
important advantages: (i) it allows to obtain spectra without any intense fluorescence
background, (ii) it permits to select the vibrations coming from the DNA bases,
matching the absorption band due to the aromatic rings centered at 260 nm. In this way
it is possible to avoid the overlapping of the bands coming from deoxyribose and
phosphate in the same spectrum [11] and focus the attention on how the oxidation
occurs at the level of nitrogenous bases [12].
112
The study was carried out by using the recently developed UV Raman set-up at the
IUVS beamline of Elettra synchrotron (Italy) [13].
It is an optical set-up able to collect UV resonant Raman (UVRR) spectra from liquid
and solid samples. The scheme of UVRR set-up is reported in Figure 32.
Figure 32. Scheme of the developed UVRR scattering set-up. The SR provided by the Elettra
synchrotron is monochromatized by a CT monochromator Czerny-Turner monochromator. Downstream,
the SR light is focused on the sample using either (I) a plano-convex lens, (II) an off-axis parabolic
mirroror (III) a microscope objective lens, depending on the experimental requirements. The radiation
scattered by the sample is collected in a backscattering geometry by the same focusing element and
focused by a lens into the three-stages Czerny-Turner analyzer (cases (I) and (III)), while in the case (II)
the Raman scattering is collected and focused into the analyzer by two off-axis parabolic mirrors.
SOURCES: D’Amico F. et al. in Nuclear Instruments and Methods in Physics Research [13].
Excitation sources at 532 nm and 266 nm were used with the solutions placed in
standard quartz cuvettes. Samples were continuously agitated during the measurements
to avoid local decomposition due to UV exposure. Spectra were collected in a
backscattering configuration employing an f =750 mm Czerny-Turner spectrometer,
equipped with an holographic reflection grating of 3600 grooves mm−1
and a nitrogen-
cooled back-thinned CCD [1].
At the same time, accurate computational simulations were obtained by using a hybrid
density functional theory (Gaussian-03 software), which allowed us to recognize the
contribution of specific oxidized products in the experimental spectra [1].
113
4.1.2 Computational simulations: Gaussian-03 software
Quantum mechanical simulations have been carried out to obtain the vibrational
frequencies and the Raman scattering activities of the molecules considered in the
present work [1].
We used the hybrid DFT model proposed by Becke and co-authors (B3LYP) [14,15],
where the exchange–correlation function used is the three-parameter Lee–Yang–Parr
function [16]. In addition, we used the basis-set of orbital functions developed by Pople
and co-authors that involves the use of spatially diffused p-(hydrogen atoms) and d-
polarized (carbon, nitrogen and oxygen atoms) functions [17,18]. It has been
demonstrated [19,20] that the choice of these parameters gives optimal results in
predicting the vibrational spectra of aromatic organic molecules against the moderate
use of computational resources.
The simulated spectra were obtained from the sum of different Gaussians, one for each
vibrational mode derived from the simulations, centred at the frequencies νi of the
normal modes with area Ai proportional to
where Ri is the Raman scattering activity derived from quantum simulations and ν0 is
the frequency of the excitation source [21,22]. The full width half maximum were
selected to be 20 cm−1
and 45 cm−1
for the C=O stretching peak, to better fit the
experimental lineshape.
4.1.3 Oxidative DNA damage
Nucleotide and DNA aqueous solutions were exposed to hydrogen peroxide (H2O2) and
iron containing carbon nanotubes (CNTs) to produce Fenton’s reaction and induce
oxidative damage [1].
Commercial dATP (deoxyadenosine triphosphate), dCTP (deoxycytidine triphosphate),
dGTP (deoxyguanosine triphosphate) and dTTP (deoxythymidine triphosphate) solution
(100 mM) were diluted to 10 mM in MilliQ water. Plasmid circular DNA (pUC19
vector) was amplified in bacterial cells (DH5α), then purified with the QIAGEN
114
Plasmid Midi Kit and diluted to a final concentration of 0.5 μg/mL. Aliquots of single
nucleotide and plasmid DNA samples were incubated in ice for 3 hours with iron
containing 5 μg/mL raw single-walled carbon nanotubes (raw-SWCNTs) and 1% H2O2,
in order to produce oxidation from Fenton’s reaction (Figure 33). The incubation was
stopped by removing the carbon nanotubes through a centrifugation step, carried out at
7500 x g for 10 minutes. The samples were then placed in standard quartz cuvettes and
immediately measured by Raman spectroscopy.
Figure 33. The metallic iron nanoparticle impurities, which remain in carbon nanotubes from their
synthesis, are exposed to hydrogen peroxide and cause the iron-mediated production of hydroxyl free
radicals via the Fenton’s reaction.
4.2 Results and discussion
4.2.1 dNTPs Raman analysis before Fenton‟s reaction
Figure 34, panels (a) and (b) respectively, shows the Raman spectra of nucleotides in
aqueous solutions acquired by using 266 and 532 nm excitation wavelengths. Figure 34
(b) also shows the spectrum of pure water for a qualitative comparison with the
nucleotide spectra.
All the spectra recorded at 532 nm exhibited a common feature at 1120 cm−1
, which
could be assigned to the stretching vibration of the three-phosphate group [23,24] and
the characteristic O–H bending mode of water centred at ≈1630 cm−1
.
115
Both these features were almost absent in the Ultraviolet Resonant Raman spectra
(UVRR) collected at 266 nm. The absence of the phosphate signature in the UVRR
spectra (200–300 nm range) [8,11] allowed better recognition of the vibrational modes
associated with nitrogenous bases.
Figure 34. Panel (a): Resonant Raman spectra of nucleotides (shown on the right side) aqueous solutions
collected at 266 nm incident wavelength. Spectra are vertically shifted for a better visualization. Panel
(b): Raman spectra of the same nucleotide solutions collected at 532 nm. The Raman spectrum of pure
water has been included for comparison. Spectra are vertically shifted for a better visualization. The
dotted line evidences the phosphate stretching band. SOURCE: D’amico F et al. in Analyst, 2015, 140,
1477 [1].
In order to provide a correct assignment of the experimental Raman features, the visible
and UV vibrational spectra of each nucleotide were compared with the theoretical
Raman activities obtained for the structure of the four nitrogenous bases (Figure 35).
116
Figure 35. Raman spectra of dATP (panel a), dGTP (panel b), dCTP (panel c) and dTTP (panel d)
collected at 266 and 532 nm of incident radiation, compared with the simulated spectrum of the
corresponding nitrogenous bases (simul.). SOURCE: D’amico F et al. in Analyst, 2015, 140, 1477 [1].
The spectra of dATP collected at 532 and 266 nm (panel (a) of Figure 35) presented the
same features, although the observed vibrational peaks exhibited different intensities in
the two spectra. The Raman spectrum obtained at 266 nm was dominated by three
intense vibrational features centred at 1336, 1481 and 1581 cm−1
, respectively. The
comparison of the experimental profile with the simulated spectrum of adenine (panel a,
lower spectrum) allowed us to assign the first 2 features to the overlapping C–C and C–
N stretching occurring within the aromatic rings. The third peak was associated with the
vibrational stretching modes of the aromatic rings and with many CH2 scissoring
vibrations. It was important to note that the signature at 1581 cm−1
was detectable only
117
in the UV spectrum, due to the absence (or marginal presence) of the O–H water band
contribution.
The Raman spectrum of dGTP, collected at 266 nm, was characterized by the
appearance of an intense and sharp peak centred at 1485 cm−1
that could be assigned to
the C–C and C–N stretching modes involving the aromatic rings, similar to what
observed in the dATP spectrum. The 266 nm-excited spectra matched with good
approximation to the simulated spectra. Another intense feature centred at 1575 cm−1
could be associated with the combination of C–C/C–N bending and CH2 scissoring
vibrations. The feature at 1678 cm−1
could be assigned to the C=O stretching mode. The
broadening of this component was larger than the others, and its frequency was
significantly lower than the simulated one. Both effects were well known and could be
addressed to the hydrophobic interactions of the carbonyl group with the surrounding
water molecules [13,25].
The 266 nm-excited spectrum of dCTP (Figure 35, panel c) exhibited two intense peaks
at 1250 and 1292 cm−1
which were assigned to the 5C–H and 6C–H bending modes,
while the intense peaks found at 1472 and 1528 cm−1
were associated with the aromatic
ring stretching modes. Finally, the feature centred at 1638 was the result of the
overlapping of C=O stretching and NH2 scissoring vibrations.
At wavenumbers below 1300 cm−1
, the dTTP (Figure 35, panel d) spectrum showed an
unexpected discrepancy between the experimental and simulated spectrum. Both visible
and UV Raman spectra exhibited multiple peaks that were clearly underestimated in the
intensity by the simulations. This may be due to the vibrations of the methyl group
added to the base in the simulation that affects the spectra in this wavenumber region. In
the region above 1300 cm−1
the simulations matched more closely the experimental
data.
In this spectral range, we identified the peak at 1374 cm−1
which was related to the
aromatic ring stretching modes, while the intense peak at 1653 cm−1
could be assigned
to the C=O stretching mode of both the carbonyls present in the structure and to the
aromatic ring stretching vibrations.
118
4.2.2 dNTPs Raman analysis after Fenton‟s reaction
Figure 36 displays the changes observed in the dATP solutions after oxidative damage.
Figure 36, panel (a) shows the spectra of the aqueous solution of dATP before and after
the Fenton’s oxidative reaction, while panel (b) displays the simulated spectra of
oxidized products: 2-hydroxyadenine, 8-hydroxyadenine, 8-oxoadenine and 4,6-
diamino-5-fomamidopyrimidine.
Figure 36. Panel (a): Raman spectra of dATP solution before (dATP) and after (dATP ox) the Fenton’s
oxidation process. Panel (b): Simulated spectra of 2-hydroxyadenine, 8-hydroxyadenine, 8-oxoadenine
and 4,6- diamino-5-formamidopyrimidine. The colored bars highlight the main vibrational features of the
spectra. SOURCE: D’amico F et al. in Analyst, 2015, 140, 1477 [1].
119
The comparison between the experimental spectrum of oxidized dATP and the
simulated spectrum of 2-hydroxyadenine demonstrated that they are very similar
spectra. A similar shape for the structures centred at 1326 cm−1
(highlighted in red in the
figure) was in fact found in both the spectra. These vibrational features were associated
with the C–C/C–N stretching modes of the aromatic rings. The small peak at 1417 cm−1
(shown in green) was attributed to a combination of stretching modes occurring in the
aromatic rings and it was found both in the control (although shifted by 3 cm−1
) and
oxidized ATP solution. But the main fingerprint came from the two structures
(highlighted in cyan) between 1472 and 1506 cm−1
, both thought to be caused by the 6-
NH2 scissoring vibrations combined with multiple internal stretching of the aromatic
rings. Finally, there was a good correspondence for the peaks at 1560 and 1610 cm−1
(highlighted in yellow), involved in the 6-NH2 scissoring modes. The last vibration was
downshifted by 29 cm−1
for the oxidized solution with respect to the same feature from
the non-oxidized one (1581 cm−1
). Although the 2-hydroxyadenine appeared to be the
dominant product, the presence of additional oxidation derivatives could be excluded.
Figure 37 displays the spectra of the solution of dGTP before and after the oxidative
stress (panel a), as well as the simulated spectra of 8-hydroxyguanine, 8-oxoguanine
and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (panel b).
The results demonstrated that there was a slight oxidative damage for guanine
molecules. In fact, it was to be noted the persistence of the peak at 1485 cm−1
in the
spectrum of the oxidized dGTP (highlighted in cyan). The most interesting feature of
the oxidized spectrum was the presence of an intense peak at 1607 cm−1
(highlighted in
red), which could be assigned to the overlapping of two types of vibrations involving
respectively C–C/C–H stretching within the aromatic ring and scissoring of the 2-NH2
atoms. This feature was clearly distinguishable in the simulated spectra for 8-
hydroxyguanine, in which these vibrational modes were more intense. Since there were
several bands that overlap above 1650 cm−1
and below 1400 cm−1
, it was very difficult
to assign the features coming from the different oxidized species. The smooth band
above 1600 cm−1
was probably due to 8-OH group bending modes of the 8-
hydroxyguanine 6C=O stretching vibration. Nevertheless, it was not possible to exclude
contributions in the spectra arising from 8-oxoguanine and 2,6-diamino-4-hydroxy-5-
formamidopyrimidine C=O stretching vibrations. The superposition of many vibrational
modes coming from the whole oxidized forms of guanine may also explain the broad
shape of the Raman spectrum below 1400 cm−1
.
120
Figure 37. Panel (a): Raman spectra of dGTP solution before (dGTP) and after (dGTP ox) the Fenton’s
oxidation process. Panel (b): Simulated spectra of 8-hydroxyguanine, 8-oxoguanine and 2,6-diamino-4-
hydroxy-5-formamidopyrimidine. The colored bars highlight the main vibrational features of the spectra.
SOURCE: D’amico F et al. in Analyst, 2015, 140, 1477 [1].
The oxidized product of dCTP generated with Fenton’s reaction was identified as the 5-
hydroxycytosine. This was confirmed by comparison between the simulated spectrum
(Figure 38, panel (b)) with the experimental spectrum of the damaged dCTP solution
(panel (a)). Specifically, the intense peak at 1257 cm−1
(highlighted in red) could be
assigned to the 5-OH group bending on 5-hydroxycytosine. This peak appeared to be
shifted towards lower wavenumbers of about 35 cm−1
with respect to the same
vibrational structure observed in the spectrum of pristine cytosine. The two low
intensity features at 1385 and 1444 cm−1
(highlighted in green) could be attributed to a
combination of 5-OH bending, 6C–H bending, and C–C/C–N stretching modes
121
occurring within the aromatic ring. Finally, the peak at 1547 cm−1
(highlighted in cyan)
could be assigned to 4-NH2 scissoring vibrations while the large band above 1600 cm−1
could be attributed to the overlapping of vibrational modes involving 4-NH2 scissoring,
6C–H bending and C–C/ C–N stretching modes of the aromatic ring.
Figure 38. Panel (a): Raman spectra of dCTP solution before (dCTP) and after (dCTP ox) the Fenton’s
oxidation process. Panel (b): Simulated spectra of 5-hydroxycytosine. The colored bars highlight the
main vibrational features of the spectra. SOURCE: D’amico F et al. in Analyst, 2015, 140, 1477 [1].
Despite a general oxidative damage in the other nucleotides, no changes were detected
in the dTTP’s Raman spectra before and after oxidation (Figure 39). This result
suggested that our experimental conditions did not produce chemical changes in this
nitrogen base when part of a triphosphate acid.
122
Figure 39. Raman spectra of dTTP solution before (dTTP) and after (dTTP ox) the Fenton’s oxidation
process. SOURCE: D’amico F et al. in Analyst, 2015, 140, 1477 [1].
4.2.3 Plasmid DNA Raman analysis
Figure 40, panel (a) shows the spectra of original (pDNA) and oxidized (pDNA ox)
plasmid DNA compared with the water spectrum. In contrast to what was seen with
nucleotides, the intensity of oxidized pDNA spectrum was at least three times lower
than that of control pDNA (see panel b of Figure 40). Moreover, the oxidation observed
in the plasmid DNA differed significantly from the one observed in nucleotide
solutions.
The comparison between the pDNA ox spectrum and the curve dNTP ox suggested an
almost total disappearance of the peak band centred at 1326 cm−1
, characteristic of
adenine and found also in the oxidized dATP solution spectra. Similarly, the vibrational
bands at 1479 and 1506 cm−1
, characteristics of the oxidation of adenine and guanine,
were damped in the spectra of oxidized plasmid DNA. These changes demonstrated that
the oxidation of adenine in the DNA was much more drastic than in the dATP solution,
causing the break of the aromatic ring at the 8C position with a probable consequent
production of derivatives like 4,6-diamino-5-fomamidopyrimidine. A comparable
reasoning could be applied to guanosine: although there was a clear fingerprinting for
the presence of 8-hydroxyguanosine (1610 cm−1
), the intensity of the peak was quite
low. This seemed to indicate that for this base additional degradation products were
formed such as 2,6-diamino-4-hydroxy-5-formamidopyrimidine.
123
Figure 40. Panel (a): Raman spectra of pristine (pDNA) and damaged (pDNA ox) plasmid DNA
solutions. The spectrum of water is still reported for comparison. Panel (b): Raman spectra of damaged
plasmid DNA without the water contribution (pDNAox – H2O). The curve dNTP ox is still reported for
comparison. SOURCE: D’amico F et al. in Analyst, 2015, 140, 1477 [1].
The smaller Raman activity observed for the vibrational modes in 4,6-diamino-5-
fomamidopyrimidine and 2,6-diamino-4-hydroxy-5-formamidopyrimidine with respect
to the corresponding closed-ring oxidized forms (see Figure 36 and 37) supported this
interpretation. Furthermore, it was impossible to detect markers of the oxidation of
cytosine and thymine because of the relatively low intensity of the fingerprint band in
the total spectrum of both nucleotides mix and DNA.
124
4.3 Conclusions
Our study demonstrated the feasibility of using UV-Raman spectroscopy to reveal
oxidation changes in DNA aqueous solutions after Fenton’s reaction. In this conditions,
the main specie responsible for DNA damage was the hydroxyl radical (OH˙) that acted
on the DNA bases, generating a number of DNA base derivatives. It was interesting that
some bases were more susceptible than the others to ROS. Initially we analyzed the
nucleotides (dATP, dGTP, dCTP, dTTP), which are the subunits of DNA. Then, the
Raman spectra obtained for nucleotides, were used as a reference to better understand
the oxidative plasmid DNA damage, recognizing the contribute of single nucleotides.
The results showed that the incident radiation at 266 nm seemed to be more efficient to
detect the chemical modifications on the nitrogenous bases.
Our analysis when combined with computational simulations revealed that the oxidation
on three-phosphate nucleotides in aqueous solutions generated mainly 2-
hydroxyadenine, 8-hydroxyguanine and 5-hydroxycytosine, while 8-hydroxyguanine
was clearly also a product of the DNA oxidation. However, in this case there was more
severe damage of the nitrogenous bases, most probably leading to the opening of the
adenine and guanine aromatic rings.
Under these experimental conditions, the elements of DNA, particularly the dATP,
dCTP, dGTP and dTTP nucleotides, resulted to be more susceptible to oxidative
damage.
The results demonstrated that UV-Raman spectroscopy is useful to reveal the chemical
changes that affect the nitrogenous bases after nanomaterials exposure, providing a
“fingerprint” of the oxidative DNA damage.
125
References
[1] D'Amico F, Cammisuli F, Addobbati R, Rizzardi C, Gessini A, Masciovecchio C,
Rossi B, Pascolo L. Oxidative damage in DNA bases revealed by UV resonant
Raman spectroscopy. Analyst. 2015 Mar 7;140(5):1477-85
[2] Norbury CJ, Hickson ID. Cellular responses to DNA damage. Annu Rev
Pharmacol Toxicol. 2001;41:367-401.
[3] Batty DP, Wood RD. Damage recognition in nucleotide excision repair of DNA.
Gene. 2000 Jan 11;241(2):193-204. Review.
[4] Marnett LJ. Oxyradicals and DNA damage. Carcinogenesis,21,361-370.
[5] Kohen R, Nyska A. Oxidation of biological systems: oxidative stress phenomena,
antioxidants, redox reactions, and methods for their quantification. Toxicol Pathol.
2002 Nov-Dec;30(6):620-50.
[6] Manke A, Wang L, Rojanasakul Y. Mechanisms of nanoparticle-induced
oxidative stress and toxicity. Biomed Res Int. 2013;2013:942916. Epub 2013 Aug 20.
[7] Ng CT, Li JJ, Bay BH, Yung LY. Current studies into the genotoxic effects of
nanomaterials. J Nucleic Acids. 2010 Sep 21;2010.
[8] Benevides JM, Overman SA, Thomas GJ, Jr Raman, polarized Raman and
ultraviolet resonance Raman spectroscopy of nucleic acids and their complexes.
(2005) J. Raman Spectrosc. 36, 279–299.
[9] Panikkanvalappil SR, Mahmoud MA, Mackey MA, El-Sayed MA. Surface-
enhanced Raman spectroscopy for real-time monitoring of reactive oxygen species-
induced DNA damage and its prevention by platinum nanoparticles. ACS Nano.
2013 Sep 24;7(9):7524-33.
[10] Sánchez V, Redmann K, Wistuba J, Wübbeling F, Burger M, Oldenhof H, Wolkers
WF, Kliesch S, Schlatt S, Mallidis C.Fertil. Oxidative DNA damage in human sperm
can be detected by Raman microspectroscopy. Steril. 2012 Nov;98(5):1124-9.e1-3.
[11] Wen ZQ, Thomas GJ Jr. UV resonance Raman spectroscopy of DNA and
protein constituents of viruses: assignments and cross sections for excitations at
257, 244, 238, and 229 nm. Biopolymers. 1998 Mar;45(3):247-56.
[12] Thomas GJ Jr. Raman spectroscopy of protein and nucleic acid assemblies.
Annu Rev Biophys Biomol Struct. 1999;28:1-27.
[13] D'Amico F, Saito M, Bencivenga F, Marsi M, Gessini A, Camisasca G, Principi E,
Cucini R, Di Fonzo S, Battistoni A, Giangrisostomi E, Masciovecchio C. UV resonant
Raman scattering facility at Elettra. Nuclear Instruments and Methods in Physics
126
Research Section A: Accelerators, Spectrometers, Detectors and Associated
Equipment, Vol. 703, pp. 33-37 (2013).
[14] A. D. Becke. Density-functional thermochemistry. III. The role of exact
exchange. J. Chem. Phys. 1993, 98, 5648 - 5652.
[15] Becke AD. Density-functional thermochemistry. IV. A new dynamical
correlation functional and implications for exact-exchange mixing. J Chem Phys.
1996, 104(3):1040–1046.
[16] Lee C, Yang W, Parr RG. Development of the Colle-Salvetti correlation-energy
formula into a functional of the electron density. Phys Rev B Condens Matter. 1988
Jan 15;37(2):785-789.
[17] R. Krishnan, J. S. Binkley, R. Seeger and J. A. Pople. Selfconsistent molecular
orbital methods. XX. A basis set for correlated wave functions. J. Chem. Phys.,
1980, 72, 650.
[18] Frisch MJ, Pople JA and Binkley JS. Self-consistent molecular-orbital methods.
J. Chem. Phys., 1984, 80, 3265.
[19] Sundaraganesan N, Ilakiamani S, Saleem H, Wojciechowski PM, Michalska D.
FT-Raman and FT-IR spectra, vibrational assignments and density functional
studies of 5-bromo-2-nitropyridine. Spectrochim Acta A Mol Biomol Spectrosc. 2005
Oct;61(13-14):2995-3001.
[20] W. Zierkiewicz, D. Michalska and T. Zeegers-Huyskens. Molecular Structures
and Infrared Spectra of p-Chlorophenol and p-Bromophenol. Theoretical and
Experimental Studies. J. Phys. Chem. A, 2000, 104, 11685.
[21] P. L. Polavarapu. Ab initio vibrational Raman and Raman optical activity
spectra. J. Phys. Chem., 1990, 94, 8106.
[22] G. Keresztury, S. Holly, J. Varga, G. Besenyei, A. Y. Wang and J. R. Durig.
Infrared and Raman Spectra of Polyatomic Molecules. Spectrochim. Acta, Part A,
1993, 49, 2007.
[23] Y Guan, C J Wurrey, and G J Thomas, Jr. Vibrational analysis of nucleic acids. I.
The phosphodiester group in dimethyl phosphate model compounds:
(CH3O)2PO2-, (CD3O)2PO2-, and (13CH3O)2PO2-.Biophys J. Jan 1994; 66(1):
225–235
[24] Carey P. Biochemical Applications of Raman and Resonance Raman
Spectroscope. Elsevier (1982).
127
[25] T. Nakabayashi, K. Kosugi, and N. Nishi. Liquid structure of acetic acid studied
by raman spectroscopy and ab initio molecular orbital calculations. J. Phys. Chem.
A, 103:8593-8603 (1999).
128
CHAPTER 5 - GENERAL CONCLUSIONS AND
OUTLOOK
This PhD work was a multidisciplinary study to reveal something new on the toxic
effect of nanomaterials in biological systems, with particular interest to investigate
similarities with an old killer: asbestos. As we have already discussed, the number of
subjects exposed to nanomaterials is increasing, in contexts where the exposure’s
impact on occupational health and safety is difficult to predict. Fetuses, newborns and
children will need protection.
Carbon nanotubes are promising products in industry and medicine, but there are
several concerns for human pulmonary exposure since their fibrous structure might
cause asbestos-like pathology. Our findings demonstrated that the combination of
advanced synchrotron-based X-ray microscopy and fluorescence techniques (µXRM
and XRF) are promising to study the toxic mechanisms induced by asbestos and carbon
nanotubes in the pleural (Met5A) and the placental (BeWo) cell lines.
The morphological and elemental X-ray analysis showed that in both cell models there
was an increase of intracellular iron, which was also confirmed by the stimulation of
ferritin, after the exposure to nanomaterials. It was interesting to highlight that the
presence of iron impurities in the nanomaterial itself seemed to be the main cause of
toxic effects that resulted in an alteration of iron metabolism. The pleural cells treated
with raw-SWCNT and crocidolite fibres compared to the control showed a severe
alteration of iron metabolism, while the same techniques showed that the iron changes
inside placental cells were restricted to small intracellular regions, thought to be just in
contact with the exogenous fibre. This study also found that highly purified nanotubes
did not alter iron metabolism, at least after 24 hrs of treatment. X-ray microscopy
images (absorption and phase contrast imaging), in combination with AFM and SEM
analysis, confirmed that the toxicity of nanomaterials was characterized by membrane
damage with vesicle secretion and filipodia formation. Moreover, the ferritin assay
resulted to be a valid test for toxicity, confirming that the concentration of this iron
transporter was clearly lower in placental cells than in pleural ones. This seems linked
to a different/lower uptake of fibres, suggesting that this barrier is less vulnerable than
the pleura.
129
We were also interested to evaluate the genetic factors involved in susceptibility to
nanomaterial exposure by using conventional molecular techniques (i.e., PCR and
Sanger sequencing).
We investigated the relation between genetic predisposition to develop mesothelioma
and asbestos exposure by looking for BAP1 gene mutations in 29 cases of
mesothelioma or related diseases. All the patients were asbestos-exposed workers.
Sanger sequencing of BAP1 gene in the 29 patients allowed to identify one non-
synonymous variant and two intronic variants: patient 9 carried in heterozygous a
missense variant (c.T1028C; p.L343P) at exon 11; patient 4 carried in heterozygous a
known intronic variation 8 bases downstream of the exon 13 (c.1729+8T>C); in patient
15 carried a heterozygous intronic variation 8 bases upstream of the exon 10 (c.784-
8G>A). Sanger sequencing of cDNA revealed no alternative splicing due to the
nucleotide change for each mutations. In silico mutation analysis demonstrated that
there were no significant possible effect of the amino acid change about exonic
mutations of patient 9 in a predicted protein structure of BAP1 protein. MLPA
(Multiplex ligation-dependent probe amplification) analysis revealed no significant
copy number variations at exonic level in all samples. Although the combination of
different molecular analysis fails to predict that BAP1 variants were pathogenic
mutations, two mesotheliomas and a renal cancer were associated to mutations.
Moreover, in agreement with literature, one patient (nine) presented significantly
increased survival time of three and half years with respect to the average life
expectancy.
Overall the results are puzzling and there was no clear correlation with type and extent
of exposure. However they are the first analyses of BAP1 genotyping in patients of
Friuli Venezia Giulia (Italy) region, which is a known endemic area for asbestos related
diseases.
Based on these results, we intend to expand our casuistic and we will evaluate the
expression levels of BAP1 in both mesothelial (MeT5A) and placental (BeWo) cells
treated with asbestos and carbon nanotubes in order to demonstrate the possible
interference of nanomaterials on genetic (epigenetic) mechanisms.
We are also strongly interested to test the feasibility of UV-Raman (IUVS beamline,
Elettra Synchrotron of Trieste) spectroscopy to reveal oxidative DNA damage after
nanomaterial exposure. The transition metals that are present on nanomaterial surface
can generate reactive oxygen species through the Fenton’s reaction.
130
The oxidative environment created in vitro by using carbon nanotubes (raw-SWCNT),
which contain some impurity in metal traces (iron), and free radicals OH• (derived from
H2O2) caused the oxidative damage of the nucleotides (dATP, dCTP, dGTP and dTTP).
The results showed that the incident radiation at 266 nm seems to be more efficient to
detect the chemical modifications on the nitrogenous bases.
The combination of the experimental analysis with computational simulations allowed
to detect the oxidation on three-phosphate nucleotides in aqueous solutions that
generated mainly 2-hydroxyadenine, 8-hydroxyguanine and 5-hydroxycytosine, while
8-hydroxyguanine was clearly also a product of the DNA oxidation. When we analyzed
the DNA oxidative damage, we found a more severe damage of the nitrogenous bases,
most probably leading to the opening of the adenine and guanine aromatic rings. These
results demonstrated that UV-Raman spectroscopy is useful to reveal the chemical
changes that affect the nitrogenous bases after nanomaterials exposure, providing a
“fingerprint” of the oxidative DNA damage.
After this success, we intend to continue with UV-Raman investigation to reveal
epigenetic changes (DNA methylation) in placental DNA of asbestos-exposed women,
since we believe that the placental methylation alterations may have harmful effects on
fetal development. This new spectroscopic approach may help to unravel the link
between nanomaterial exposure and epigenetic changes.
In conclusion, the power of this multidisciplinary study which encompasses the
biochemistry - study of the role of iron in in vitro cell models after exposure to
nanomaterials - and the molecular biology - the study of genetic predisposition and
molecular damage after exposure to nanomaterials - was the combination of different
microscopic and molecular techniques that allowed to detect the toxic effects and the
cellular interaction of asbestos and carbon nanotubes in biological systems.
131
Appendix A
A1. AFM and µXRM imaging studies on MeT5A cells
Figure A1. Combination of optical, µXRM (absorption and phase contrast, respectively) and
AFM images of MeT5A cells exposed to crocidolite fibres (lane A and B) and to purified s-
SWCNTs (lane C). The mesothelial cells are seeded on Si3N4 windows and the day after are
exposed for 24h to 5μg/mL of each nanomaterial. The absorption and phase contrast images are
measured at 0.9KeV photon energy at TwinMic Beamline (Elettra, Trieste). AFM images are
obtained at Laboratorio TASC-INFM (Elettra, Trieste) with collaboration of PhD Damiano
Cassese.
132
A2. SEM imaging studies on MeT5A cells
Figure A2. SEM images of control MeT5A (A,B,C,D), crocidolite-treated cells (E,F,G,H) and
cells exposed to raw SWCNTs (I,L,M,N) and purified s-SWCNTs (O,P,Q,R). The zoom images
of some detail are shown in right side of the panel for each nanomaterial (D,H,N,R). MeT5A
cells are seeded on ˪-poly-lysine coated coverslipes and day after are exposed for 24 h to
5µg/mL of each nanomaterial. Then the cells are washed in PBS and fixed with 2.5%
glutaraldheyde at room temperature for 20 min, rinsed in PBS and in the end dehydrated in
ascending ethanol concentrations (30%, 50%, 70%, 90%, 100%). At this point, the samples are
transferred to a critical point dryer (Bal-Tec; EM Technology and Application, Furstentum,
Liechtenstein) in 100% ethanol and dried through CO2. Coverslips are mounted on aluminium
sample stubs and gold coated by sputtering (Edwards S150A apparatus, Edwards High Vacuum,
Crawley, West Sussex, UK). SEM measurements are performed by using Leica Stereoscan 430i
scanning electron microscope (Leica Cambridge Ltd., Cambridge, UK), with collaboration of
Dr Francesca Vita at University of Trieste.
133
Appendix B
B1. The clinical features of 29 patients
Case
n.
Gender
Age
of MM
diagnosis
(y)
Age
of
death
(y)
MM
survival
(m)
Cancer
MM
histotype
Other
diseases
Treatment
Asbestos
exposure
circumstances
Occupation
Asbestos
bodies
count
1 M 77.9 77.9 0.5
Pleural
mesothelioma;
prostatic
carcinoma
Epithelioid / Pallliative Occupational Dockworker 13
2 M 87.3 87.6 2.6 Pleural
mesothelioma Epithelioid / Palliative Occupational
Ship
mechanic 34300
3 M NA 72.2 NA
Laryngeal
carcinoma;
prostatic
carcinoma; lung
carcinoma; oral
carcinoma with
lung metastases
/ /
Laringectomy;
pulmonary lobectomy;
emiglossopelvectomy;
partial
pharingoglossectomy;
bilateral neck
dissection; radiotherapy
Occupational Sailor 8400
4 M NA 70.5 NA Renal cell
carcinoma /
Pulmonary
fibrosis / Occupational
Chemical
factory
worker
104
5 F 84.9 85.0 0.5 Pleural
mesothelioma Biphasic / None NA 94
6 M 71.5 72.9 16.8
Pleural
mesothelioma
(circumscribed
non evolutive);
Epithelioid / None Occupational Dockworker 5100
134
oral carcinoma
7 M 82.1 82.6 5.23 Pleural
mesothelioma Epithelioid / Palliative Occupational
Engine
factory
worker
20000
8 M 57.9 68.7 126.6
Pleural
mesothelioma
(healed);
bladder
carcinoma;
contralateral lung
carcinoma
NA / Pneumectomy NA NA 55
9 M 68.3 71.8 41.1 Pleural
mesothelioma Epithelioid
Diffuse
pleural
fibrosis;
desmoid-
type
fibromatosis
Pleurectomy and
decortication, multiple
pulmonary resections;
chemo- and
radiotherapy
Occupational
Ship engine
room worker,
shipyard
worker
229
10 F 68.4 69.9 17.6 Pleural
mesothelioma Epithelioid NA
Pleuropneumectomy;
chemo- and
radiotherapy
Household Housewife 121
11 M 81.5 81.5 0.6 Pleural
mesothelioma Biphasic / None NA
Steel mill
worker 231
12 M 82.1 83.6 17.5 Pleural
mesothelioma Epithelioid /
Chemo- and
radiotherapy NA Electrician 513
13 M NA 78.6 NA / / Asbestosis None Occupational Dockworker 5025
14 M NA 77.1 NA / / Asbestosis None Occupational Ship cook 6580
135
15 M 62.6 64.1 18.1 Pleural
mesothelioma Epithelioid / Chemotherapy Occupational Welder 31330
16 M 66.5 69.4 34.2 Pleural
mesothelioma Epithelioid / Pleurectomy Occupational Dockworker 19840
17 M NA 69.9 NA / / / / Occupational
Engine
factory
worker
6690
18 M 57.3 60.1 32.9 Peritoneal
mesothelioma Epithelioid /
Intestinal resection;
chemotherapy NA NA 25
19 M 82.7 82.9 2.1 Pleural
mesothelioma Epithelioid / Chemotherapy Occupational
Shipyard
worker 119
20 M 64.3 65.5 14.5 Lung carcinoma / / Chemotherapy Occupational Glass factory
worker 136
21 M 64.4 70.5 72.1 Pleural
mesothelioma Epithelioid /
Pleurectomy and
decortication;
chemotherapy
Occupational Elevator
technician 485
22 M 74.3 74.4 1.4 Pleural
mesothelioma NA / None NA NA 75
23 M 55.5 58.0 29.4 Pleural
mesothelioma Epithelioid /
Pleurectomy and
decortication;
chemotherapy
Occupational
Occupational
health and
safety
technician
18
24 M 86.8 87.0 3.0 Pleural
mesothelioma Epithelioid / Palliative Occupational Navy officer 1660
25 M 86.8 87.3 5.7 Pleural
mesothelioma Biphasic / Palliative Occupational Sailor 1320
136
26 M 65.1 65.8 8.2 Lung
adenocarcinoma / /
Chemo- and
radiotherapy Occupational Dockworker 11150
27 M 85.7 88.4 31.1 Pleural
mesothelioma Biphasic / None NA NA 1270
28 F 78.9 79.9 12.3
Pleural
mesothelioma
(regressed)
Epithelioid / Chemo- and
radiotherapy NA NA 0
29 M NA 91.1 NA
Lung carcinoma;
colorectal
carcinoma
/ Asbestosis NA NA NA 1670
Table B1. The table summarizes the clinical features of 29 patients. They are sex, age of diagnosis and death, survival time, cancer and concurrent diseases,
malignant mesothelioma histotype, and treatment including surgery, chemotherapy, and radiation, asbestos exposure circumstances, occupation and asbestos
bodies count. The table was provided by Dr Clara Rizzardi (University of Trieste).
137
ABBREVIATION LIST
NMs: nanomaterials
BSI: British Standard Institute
DNA: deoxyribonucleic acid
SWCNTs: single-walled carbon nanotubes
CNT: carbon nanotube
MWCNTs: multi-walled carbon nanotubes
BBB: blood–brain barrier
BTB: the blood–testis barrier
ROS: reactive oxygen species
COPD: chronic obstructive pulmonary diseases
UFPs: ambient ultrafine particles
AM: alveolar macrophage
TEM: transmission electron microscope
FPP: fibre pathogenicity paradigm
RNS: reactive nitrogen species
IARC: International Agency for Research on Cancer
MAPK: mitogen-activated protein kinase
NF-κB: nuclear factor-kappa B
XRF: X-Ray Fluorescence
XANES: X-ray Absorption Near Edge Spectroscopy
ZP: Zone Plate
OSA: Order Sorting Aperture
PAHs: polycyclic aromatic hydrocarbons
MM: malignant mesothelioma
BAP1: BRCA1-associated protein 1
MBAITs: melanocytic BAP1-mutated atypical intradermal tumours
HiPCO: high pressure carbon monoxide
CVD: Chemical Vapor Deposition
r-SWCNTs: raw-SWCNTs
p-SWCNTs: purified-SWCNTs
hp-SWCNTs: highly purified-SWCNTs
s-SWCNTs: short-SWCNTs
138
PBS: phosphate buffered saline
DMEM: dulbecco’s modified Eagle’s medium
FBS: fetal bovine serum
M-PER: mammalian protein extraction reagent
XRF: X-ray fluorescence
SXM: scanning X-ray microscopy
SDDs: silicon drift detectors
SR-XRF: synchrotron radiation X-ray fluorescence
CB: carbon black
AFM: atomic force microscope
SNOM: scanning near-field optical microscopy
EGFR: epidermal growth factor receptor
ESRF: European Synchrotron Radiation Facility
SEM: scanning electron microscopy
NPs: nanoparticles
o-MWCNTs: oxidised MWCNTs
WHO: World Health Organization Classification
PCR: Polymerase Chain Reaction
NCBI: National Center for Biotechnology Information
RT: Reverse transcription
HSF: Human Splicing Finder
NNSplice: Neural Network Splice
SPANR: Splicing-based Analysis of Variants
PDB: Protein Data Bank
MLPA: Multiplex ligation-dependent probe amplification
dATP: deoxyadenosine triphosphate
dCTP: deoxycytidine triphosphate
dGTP: deoxyguanosine triphosphate
dTTP: deoxythymidine triphosphate
UVRR: ultraviolet resonant Raman spectra
pDNA: plasmid DNA
pDNA ox: oxidized plasmid DNA
139