Post on 22-Aug-2021
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
89
CONSERVATION STRATEGIES FOR JERANGAU MERAH (BOESENBERGIA STENOPHYLLA) USING DNA
PROFILING AND MICROPROPAGATION
Aicher Joseph Toyat
Department of Crop Science,
Faculty of Agriculture and Food Science, Universiti Putra Malaysia Bintulu Campus,
Jalan Nyabau, 97008, Bintulu, Sarawak, Malaysia.
aichertoyatrodway@gmail.com
Nur Ashikin Psyquay Abdullah
Department of Crop Science
Faculty of Agriculture and Food Science, Universiti Putra Malaysia Bintulu Campus,
Jalan Nyabau, 97008, Bintulu, Sarawak, Malaysia.
nurashikin@upm.edu.my
Rusea Go
Department of Biology
Faculty of Science, Universiti Putra Malaysia,
43400 UPM Serdang, Selangor, Malaysia.
rusea@upm.edu.my
Thohirah Lee Abdullah
Department of Crop Science
Faculty of Agriculture, Universiti Putra Malaysia,
43400 UPM Serdang, Selangor, Malaysia.
thohirah@upm.edu.my
Ghizan Saleh
Deputy Vice-Chancellor,
Universiti College Agrosciences Malaysia,
Ayer Pa’ abas 78000 Alor Gajah, Melaka, Malaysia.
salehgb@yahoo.com
Make Jiwan
Department of Crop Science,
Faculty of Agriculture and Food Science, Universiti Putra Malaysia Bintulu Campus,
Jalan Nyabau, 97008, Bintulu, Sarawak, Malaysia.
make@upm.edu.my
Franklin Ragai Kundat
Department of Crop Science,
Faculty of Agriculture and Food Science, Universiti Putra Malaysia Bintulu Campus,
Jalan Nyabau, 97008, Bintulu, Sarawak, Malaysia.
franklin@upm.edu.my
Mohd. Maulana Magiman
Department of Social Science,
Faculty of Agriculture and Food Science, Universiti Putra Malaysia Bintulu Campus,
Jalan Nyabau, 97008, Bintulu, Sarawak, Malaysia
mdmaulana@upm.edu.my
ABSTRACT
Jerangau merah (Boesenbergia stenophylla) is highly endemic to the highland of Borneo. Their medicinal value attracts many
plant collectors which raise up to the concern on their population size .A study was carried out to establish the conservation
approaches for this species. The objectives of this study are to determine the genetic variations among accession from Bario and
to develop the in vitro culturing protocolfor productions of seedlings. Genetic variation studies were done using simple sequence
repeats (SSR) and random amplified polymorphic DNA markers (RAPD). Micropropagation of shoot tips was carried out using
BAP and NAA plant growth regulator supplemented in MS media. The genetic variation studies using SSR and RAPD marker
show no variations among accession and three sub populations. Two steps protocol was recommended for the tissue culture of
B.stenophylla. But it start with culturing using shoot tips in MS media containing 0.2 mg/L NAA for shoot induction followed by
sub–culturing to MS media with 2 mg/L BAP +0.4 mg/L NAA for rapid shoot elongation. This study suggests that their
conservation should remain as in situ and seedling production under optimum nursery conditions should be carried out near to
their natural populations.
Key words: Boesenbergia, Jerangau, microsatellites
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
90
Introduction
Boesenbergia stenophylla R.M. Sm. is a plant species from the family Zingiberaceae. It is known with various names depending
on in which village it was found. Typically it is known as jerangau merah (malay) and kaburo adak (Kelabit/Lun Bawang). This
species is considered as rare and highly endemic to Borneo highland (Poulsen, 2006). It is mainly found in the Tropical Heat
Forest of Sarawak at an altitude of above 3000 ft. (Ahmad & Jantan, 2003). Villagers from where this species are found used the
rhizomes to treat stomach-ache, food poisoning and alcohol intoxication (Christensen, 2002; Poulsen, 2006; Chai, 2006; Jing,
2010). The sales of its rhizome is slowly penetrating the local markets but at a high price. For the collectors, this was seen as
lucrative and due to this, harvesting of these plants from their natural habitat has become more widespread. To date, these plants
are not domesticated. They are found thriving under heavy shaded forest floor, preferring slopes nearby streams. It was never
found on altitude less than 3000 ft. and therefore may requires low temperature for optimum growth. Factors such as over
harvesting and climate change posed as possible threats on the existence of B. stenophyla and therefore conservation measures
are required to ensure that their populations are not heavily disturbed, but at the same time the needs of this plant to improve the
socio economic of the villagers is also important.
Conservations can be done following two approaches. First is to put the plant species into cultivation and second is to mass
produce their seedlings. The first approach can be done through ex situ cultivation under nursery conditions where their
agronomic practices will be identified. In this case, the productions of rhizomes are of interest and the dependence of collectors
to harvest plants from the forest can be stop. The second approach is to produce the seedlings in mass number but conventional
method through vegetative propagation is time consuming. Micropropagation has an advantage over conventional propagation
where it provide optimum controlled culture environment. Also, through micropropagation the number of seedlings produced
over time is higher as compared to the conventional techniques. The approach using in vitro technique was seen used for the
conservation of the threatened Boesenbergia pulcherrima (Anish et al., 2008). It was also reported that Boesenbergia rotunda
cultures supplemented with 2.0mg/L BAP+ 0.5mg/L NAA resulted in four multiple shoot per explant whereas, 2.0 mg/L BAP
promotes shoot development from callus (Yusuf et al., 2011).
As part of the conservation strategy, genetic profiles of the species of interest are often obtained. A better understanding of
genetic diversity and its distribution is essential for its conservation and use (Rao & Hodgkin, 2002; Rodríguez-Bernal, 2013).
Molecular biology helps conservationist to explain the genetic structure of species by applying genetic marker for identifying
their status in their natural population. According to Srivatsava & Nidhi (2009) a genetic marker is “a gene or DNA sequence
with a known location on a chromosome and associated with a particular gene or a character. Variations in the marker may arise
due to mutation or alteration of nucleotide in the genomic loci. DNA markers are more reliable because the genetic information
is unique for each species and is independent of age, physiological conditions and environmental factors (Kalpana et al., 2004;
Kumar et al., 2009; Pourmohammad, A. 2013).
The usage of this co dominant marker in detecting genetic variations in the taxonomic and systematic analyses of plant have
proven to be valuable such as conservation of wild pear Pyrus praster (Condello et al., 2008). Simple Sequence Repeats (SSRs)
or microsatellite is a common co-dominant marker. It is a short tandem repeats with 1 to 6 nucleotides (Goldstein & Pollock,
1997; Tharachand et al., 2012). Microsatellites have become the genetic marker of choice in mammalian and many plant systems
(Weber and May, 1989; Tharachand et al., 2012). It has several advantages over other molecular markers such as they are co-
dominant, highly polymorphic, identification of many alleles at single locus, they are evenly distributed all over the genome, the
analysis can be semi-automated and performed without the need of radioactivity and very little DNA is require (Gupta et al.,
1994; Goldstein and Pollock, 1997; Zheng et al., 2008; Tharachand et al., 2012,). Furthermore, using molecular marker has
proven to be the most effectively tool in various studies fields such as taxonomy, plant breeding, genetic engineering etc.
(Tharachand et al., 2012). The most useable dominant marker for detection of genetic variations among populations is random
amplified polymorphic DNA (RAPD) which was first introduced by Williams et al., (1990). This dominant marker was
frequently used to distinguish a lot of the Zingiberaceae family species such as Curcuma spp. (Wangsomnuk et al., 2002),
confirmation of 11 species of Boesenbergia, six species of Kaempferia, and two species of Scaphochlamys from Southern
Thailand (Vanijajiva et al., 2004), Boesenbergia rotunda (Vanijajiva et al., 2005) and Zingiber spp. and Curcuma spp. from
eastern India (Mohanty et al., 2013).
This study was carried out for the purpose of establishing conservation strategies for Boesenbergia stenophylla by investigating
their genetic profiles and ways to mass propagate seedlings. The genetic profile of B.stenophylla population in Bario shall give
an insight of their mode of reproduction and diversity. Production of seedlings through micropropagation can contribute to the
reintroduction of seedling into their natural population and also providing seedlings for nurseries and sellers. The objectives of
this study are, to determine the genetic variations among Boesenbergia stenophylla from Bario population and to establish in
vitro propagation protocols.
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
91
Materials and Methods
Sampling Locations
Fresh leaves were collected from Bario Highland and are kept in silica gel before DNA extraction for preservation through rapid
drying of plant tissues. There were 3 sub populations in Bario with a total of 20 individual per sub population. The
subpopulations (Figure 1) are from Besar, Arur Dalan and Ramudu.
Figure 1: Map of Bario Highland with the location of the (x) three sub-populations.
DNA Extraction
Total genomic DNA was extracted from young leaves using GENEALL® Exgene™ Plant SV Mini Kit (Geneall, Korea)
following the manufacturer’s instructions. DNA was collected in 50µL 1X TE (10mMTris, pH8.0, 1 mM EDTA). Quantification
and the DNA quality were determined by using a spectrophotometer (NanoDrop™).
Screening and Developing of Population and Genetic Diversity Marker RAPD Marker
DNA amplification was performed in a thermo cycler (BioRad) using Simple Sequences Repeat (SSR) and Random Amplified
Polymorphic DNA (RAPD) primers DNA markers. Selected RAPDs primers were OPA 1-20 and OPB 1-20 were screened for
positive amplification and polymorphism. Since there are no specific SSR primers reported for Boesenbergia stenophylla,
available SSR primers developed from Boesenbergia siamensis was used.
Development of SSR Primers for Boesenbergia Stenophylla
Since cross-amplification could amplified the same genus, existing microsatellites DNA sequences of Boesenbergia siamensis
were obtained from Genbank http://www.ncbi.nlm.nih.gov/ submitted by (Tappiban & Triwitayakorn, 2012). A total of 58
Boesenbergia siamensis DNA sequences were used for synthesizing primers using Primer3 via online (Steve & Skaletsky, 2000)
to generate the forward and reverse oligonucleotides. From the 58 DNA sequences, 20 primers with high GC% and zero 3’ (Self
Complementarity) were selected and later screened with DNA template from B.stenophylla (Table 1).
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
92
Table 1: Twenty primer pairs developed to determine the genetic variations of B. stenophylla. Selections were based on the high
GC and zero 3’ (Self Complementarity) content and their annealing temperature
Primer Primer Sequences (5’-3’) Annealing temperature
(°C)
GC %
BS45 F: AGGGAGAGAGAGGAAGAGGG
R: ACCTGCGAATCCACTACGAT
52.7
53.3
60
BS39 F: CACGCTAACATCACACGAGG
R: GCCTCCCTCTACCTCCATTC
53.3
53.7
55
BS35 F: GACTACCCCGATCTTCCGAG
R: TGCGATCTTAACCCCGATGA
54.8
57.5
60
BS7 F: CGCCCTGAATGTTTGATCCA
R: GGCTTCGAGAATCATCGTCG
57.8
56.8
50
BS62 F: TGTGTTGGTCATGAATGCGC
R: CAACCGTTGCGAGGTCATAC
57.4
55.1
50
BS43 F: CCCACAGACGATGCCAATTT
R: ACTTGATCGTCGGAGTGGTT
56.9
53.1
50
BS29 F: TAGGCAGCACTTGGGCTTTA
R: GCTTTGCTCCTTCCAACCTT
54.9
54.8
50
BS5 F: AGAGACCTTGGCAGACTGAC
R: ACAGCCATACCTTCACGAGT
50.3
50.8
55
BS26 F: CATCCTTCCTGTAAACCCGC
R: AGAAAGCCTGTGGAGAGCAT
55.7
52.7
55
BS64 F: TGGCATTGGGAGATGGAACT
R: CACGGCTGATGATTTGCGTA
56.4
56.7
50
BS86 F: GTGGGGCTTCAACGTTACTG
R: AACCCTGCAACAAATCGGTC
54.3
56.0
55
BS92 F: TATCCTGCACACTTTCCCGT
R: TTTCCTTCTTGTGTCCGTGC
54.2
54.8
50
BS100 F: GTTTCTCTTTCGGCAGCGTC
R: GCTCCTTCAACCGCTTCAAT
56.2
55.6
55
BS109 F: CGTTCCTTGTATGGCAGCTC
R: CGTATCCACCGTCCGTCTAA
54.5
54.7
55
BS27 F: ACGCTCAAGTCAGTCACCAA
R: CCTAGGTGGGAACTGGTCAA
52.7
53.6
50
BS30 F: GCTGCTAATCGGAAACTGCA
R: CGAAGGGCACAAAATCGGAT
55.3
58.3
50
BS61 F: ACGTCGCTAGATTCGCTGAT
R: AGAGTCGAGCAAAGGAACCA
53.8
53.6
50
BS89 F: TAGCCCCCTCTCTATCAGCA
R: CTGCAGTCCGCTACACAAAA
53.7
53.6
55
BS93 F: TCAGTCGTTGGTCGTGAAAG
R: GGTTCCCTTGATTCCTCTCC
53.2
53.7
50
BS108 F: CCAACGAAAAGTGGAAGGAA
R: GATCCCCATGAGTTCCAAAA
53.9
53.4
45
Note: GC% = Percentage of Guanine and Cytosine
DNA Amplification using SSR Primers
DNA amplification was carried out using the 20 primers through polymerase chain reaction (PCR) protocol. Each PCR was
perform in 20 µL mixture containing 10 µL 2X AmpMaster™ Taq2X AmpMaster™ Taq GENEALL® (each dNTP mixture
200µM contain each of dATP, dTTP, dGTP and dCTP), 2.5 mM MgCl2 reaction buffer 1X, 2.5 U Taq DNA polymerase and 1X
Loading dye & stabilizer, 1 μL DNA template 1~100ng/ μL, 1µL primer forward, 1µL primer reverse and add up with deionize
water to obtain a 20 µL volume reaction mix. Amplification was carried out in a thermo cycler (Bio Rad), as follows: one cycle
of 2 min at 95°C for initial denaturation, 30 cycles of 20 sec at 95°C for template denaturation; 10 sec annealing standardize to
all primer at 56 °C, and 50 sec at 72°C extension; one cycle of 5 min at 72°C for final extension. The PCR products were then
separated in 3% Metaphor agarose gels prepared using 100mL 1X TBE buffer and Atlas Clear Sight as DNA Stain. The allele
size of each fragment was obtained and scored as presence (1) or absence (0) for each loci and by using UVIDoc software to
generate the number of alleles.
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
93
DNA Amplification using RAPD Primers
Forty primers were screened following their respected annealing temperature. Each PCR reaction volume was perform in 20 µL
mixture containing 10 µL 2X AmpMaster™ Taq2X AmpMaster™ Taq GENEALL® (each dNTP mixture 200µM contain each
of dATP, dTTP, dGTP and dCTP), 2.5 mM MgCl2 reaction buffer 1X, 2.5 U Taq DNA polymerase and 1X Loading dye &
stabilizer, 1 μL DNA template 1~100ng/μL, 1µL primer and add up with deionize water to 20 µL. PCR was carried out as
follows: one cycle of 3 min at 94°C for initial denaturation, 10 cycles of 1min at 95°C for template denaturation; 1 min annealing
at 57 °C with decrease increment - 1°C per cycles, and 2 min at 72°C extension; one cycle of 5 min at 72°C for final extension,
and then 25 subsequent cycles of 94°C for 1 min, 57°C, 72°C for 2 min, and the final elongation at 72°C for 10 min. The PCR
products were then separated in 1.5% agarose gels prepared using 100mL 1X TBE buffer and Atlas Clear Sight as DNA Stain.
The allele size of each fragment was obtained and scored as presence (1) or absence (0) for each loci and by using UVIDoc
software to generate the number of alleles.
Micropropagation
Sterilization of explants followed the protocol reported by Afendia et al. (2013) without the use of mercury chloride, where
sprouted shoots were collected and washed under running water for 30 minutes and dipped into 95% of the ethanol solution for
2-3 seconds, 70 % ethanol for 2-3 seconds, 20 % NaClO + a drop of Tween 20 for 20 minutes, 70% ethanol for 2-3 seconds,
80% NaClO + a drop of Tween 20 for 10 minutes then finally rinse with dH2O 4 times duration per rinse in 1 minute. Clean and
aseptic explants were then inoculated on MS (Murashige and Skoog, 1962) media containing 30.0 g/l sucrose and 2.0 g/l gelrite
as solidifying agent supplemented with cytokinins (6-benzylaminopurine (BAP) ranging from 0.0, 1.0, 2.0, 3.0, 4.0 mg/l and
auxin (α-naphthaleneacetic acid (NAA) ranging from 0.0, 0.2, 0.4, 0.5 and 0.6 mg/l with different concentration of BAP and
NAA for shoot multiplication (Table 2). A single shoot was cultured into each test tube and replicated 3 times for each treatment.
Table 2: Treatments used for shoot induction B. stenophylla with different combinations of BAP and NAA concentrations
Note: All cultures were examined periodically, and parameters such as no. shoot, no. of roots and no. of leaves
were obtained.
Treatments BAP (mg/l) NAA(mg/l)
T0 0 0
T1 1 0
T2 2 0
T3 3 0
T4 4 0
T5 0 0.2
T6 1 0.2
T7 2 0.2
T8 3 0.2
T9 4 0.2
T10 0 0.4
T11 1 0.4
T12 2 0.4
T13 3 0.4
T14 4 0.4
T15 0 0.5
T16 1 0.5
T17 2 0.5
T18 3 0.5
T19 4 0.5
T20 0 0.6
T21 1 0.6
T22 2 0.6
T23 3 0.6
T24 4 0.6
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
94
Results and Discussion
SSR Analysis
Twenty SSR primers developed from B. siamensis was used to amplify DNA from B. stenophylla. From the 20 primers, eight
primers were able to amplify the DNA of B. stenophylla showing the capability of cross species amplification (Figure 2). The
size of the eight polymorphic primers ranged from 170bp to 216bp (Table 3). However, seven primers were selected to determine
the genetic variations. Primer BS27 was omitted because it amplified heterozygous alleles.
Figure 2: DNA amplification of B. stenophylla on 3% Metaphor agarose gels compared wih 100bp DNA ladder
Table 3: Selected primer for population genetic variation with the scoring and alleles size
Primer Scored Alleles size (bp)
BS 39 1 209
BS 86 1 170
BS 35 1 175
BS 108 1 168
BS 30 1 163
BS 109 1 216
BS 45 1 197
Each primers were used to amplified the microsatellite DNA regions of B. stenophylla from (1) Bukit besar (2) Arur Dalan and
(3) Ramudu (Figure 3). A fourth plant (4) was included as control, a plant specimen of unknown origin that was raised under
glasshouse. All primers were polymorphic. However, five primers i.e. BS35, BS109, BS27, BS30 and BS108 showed the same
allele size for all B. stenophylla for different sub-populations. The differences in allele size as shown by BS45 and BS86 was
considered as ambiguous because the gel was distorted during electrophoresis.
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
95
Figure 3: DNA amplification of the SSR regions using 8 primers on sub-population collected from (1) Bukit Besar, (2) Arur
Dalan (3) Ramudu and (4) Glasshouse
For further confirmation the primers were used to amplify DNA from the entire individual from each sub-population. The results
again showed no polymorphism in any of the sub-population for each primer. An example of the DNA amplification is shown in
figure 4.
Figure 4: An example of SSR DNA amplification using primer BS109 on 20 individuals from Arur Dalan showing no variations
among accessions
SSR marker is a powerful DNA marker to differentiate the possible genetic variation among populations. In this study, using
seven polymorphic SSR primers showed no variations among sub-populations. This indicates that the population in Bario is
genetically similar as the entire individual shared the same allele weight. However, homoplasy which showed similar allele
length but different in DNA sequences could occur. To determine this, DNA sequencing of each individual are usually used and
variations are determine by identifying changes in nucleotides. However, DNA sequencing is costly therefore RAPDs markers
are used to identify possible genetic variations.
RAPD Analysis
A total of 40 primers were randomly selected to determine their effectiveness in RAPD analysis. 20 OPA and 20 OPB primers
were screened and those primers that generated clear bands were identified. Eighteen primers produced 105 reproducible
fragments, with an average of 5.8 fragments per primer. The allele length ranged from 191 - 2500 bp with polymorphic bands
(Figure 5).
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
96
Figure 5: Amplified of screening primer (M) 100bp ladder (A) OPA 1-20, (B) OPB 1-20
Initial test was done using two polymorphic OPA3 and OPA15. No polymorphic band was found within each sub-population.
We did not carry on further with the other eight primers with an assumption that it will produced results similar to OPA3 and
OPA15. This test was repeated for three OPA and OPB primers (Figure 6, 7 and 8) and by randomly selecting one individual
from each population which also resulted in no variations in allele size.
A
B
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
97
Figure 6: RAPD primer OPA 1 amplified on 3 sub population with no variation among sub populations. (M) 100bp ladder,
(1-20) individual DNA from each subpopulations
Figure 7: RAPD primer OPA 15 amplified on 3 sub population with no variation among sub populations (M) 100bp ladder, (1-
20) individual DNA from each subpopulations
ARUR
DALAN
BUKIT
BESAR
RAMUDU
ARUR
DALAN
BUKIT
BESAR
RAMUDU
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
98
Figure 8: Selected primer for screening population show no variation between population (M) 100bp ladder, (1) Arur Dalan, (2)
Bukit Besar, (3) Ramudu
The molecular analysis using SSR and RAPD markers in this study showed no genetic variations found among accessions in
Bario populations even when sub populations was far apart. During the sampling period from July 2013 to October 2014, only
one plant was found flowering bearing single white flower. No accounts were found on the phenology of this species. Other
species B. hirta, B. ischnosiphon, B. lambirensis, observed in Lambir, Sarawak are pollinated by halictid bees. Most species of
the genus seem to flower with little seasonality or synchrony (Sakai & Nagamasu, 2006). The reproduction of B. stenophylla is
successful through vegetative rhizomes. It is still early to conclude that genetic variations were not detected in this population is
due to their mode of vegetative reproduction. Further determination such as DNA sequencing of SSR alleles and their breeding
system holds vital information for future cultivation and horticultural improvement strategies.
Micropropagation
Shoot tip cultures showed physiological responses when expose to BAP and NAA. Growth was observed after 16 weeks of
inoculation on MS media. Figure 4 showed that explants in treatment T12 (0.2 mg/L NAA) and T5 (2 mg/L BAP + 0.4 mg/L
NAA) has better growth in term of number of shoots and shoot height. Single treatment of 0.2 mg/L NAA induced more number
of shoots.Supplement of 2 mg/L BAP + 0.4 mg/L NAA causes shoots to elongate faster than the rest of the treatment but the
number of shoot induced was less than treatment 5. Therefore, it is recommended that for in vitro culture of B. stenophylla, the
initial culture should begin with shoot induction in MS media containing 0.2 mg/L NAA in order to obtain high number of
shoots. Subsequent sub-culture should be followed with sub-culturing into MS media containing 2 mg/L BAP + 0.4 mg/L NAA.
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
99
Figure 4: Respond of explant after 16 week inoculation on MS media
B. stenophylla is highly endemic to the highland region and when the plants that were kept in the nursery under 70% shade with
the range of temperature between 26°C to 30ºC they remained small, with slow leaf development and leaf colour turning
yellowish. Due to this and the limited number of plants found from their natural populations, in vitro propagation was used for
their multiplications. Although single treatment of NAA induced multiple shoots from the explant and 2 mg/L BAP + 0.4 mg/L
NAA produced taller shoots, we believe the growth performance could be better if their culturing environment was optimized
and mimicked their natural ecosystem in the wild. Micropropagation is considered efficient in term of cost when mass number of
plantlets is produced within a short period of time. The protocol in this study could produce more than five shoots per explant but
it took 16 weeks of culturing. Therefore, micropropagation is considered not suitable for propagation of B. stenophylla if the
main objective is to achieve large number of seedlings within a short period of time. Nevertheless, because this species is
difficult to find and growth requires specific environment, the tissue culture protocol that was developed in this study is
important for the multiplications of B. stenophylla.
Conclusion
This study on genetic diversity found that there are no genetic variations among B. stenophylla accessions from three sub-
populations in Bario. The main factor responsible for high level of differentiation among populations and the low level of
diversity within populations is probably the clonal nature of plant species (Li & Ge, 2001; Dev et al., 2010). Nevertheless,
despite high natural fragmentation and the importance of vegetative reproduction, some plant species do display levels of gene
flow. RAPDs analysis showed low polymorphic bands were detected, indicating that the genetic diversity of Boesenbergia
tenuispicata was low, and all the endemic populations in Thailand was most likely consisted of the same genotype. The result
suggested that the management for the conservation of genetic variability in B. tenuispicata should aim to preserve every
population (Vanijajiva, 2012). The proposed protocol for the in vitro cultures of B. stenophylla includes initial culturing using
shoot tips in MS media containing 0.2 mg/L NAA for shoot induction followed by sub-culturing to MS media with 2 mg/L BAP
+ 0.4 mg/L NAA for rapid shoot elongation. However, the cultures took 16 months to produce shoots.
In situ and ex situ conservation methods are complementary and the method chosen should depend on the species concerned and
such factors as its distribution and ecology as well as the availability of resources in areas in which it occurs (Rao & Hodgkin,
2002; Normah et al., 2012) and as apart conserving the biodiversity . The genetic variation of B.stenophylla from Bario
population was determined and the in vitro culture protocol was developed. B. stenophylla is highly endemic, having small
populations, possibly lacks genetic variations and difficult to grow in in vitro cultures. This study suggests that their conservation
should remain as in situ and seedlings production under optimum nursery conditions should be carried out near to their natural
populations.
Acknowledgements
The authors would like to acknowledge the financial assistance provided by Ministry of Education Malaysia under Exploratory
Research Grant Scheme (ERGS) (Project No: ERGS/1-2013/STWN03/UPM/02/5). They also extended their appreciation to
Faculty of Agriculture and Food Science, Universiti Putra Malysia for the use of laboratory, technical assistance and also to
Forest Department Sarawak and Sarawak Biodiversity Centre for permit and approval.
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
100
References
Afendia, S. A. M., Leeb, C. T., Disfania, M. N., Javeda, M. A. (2013). A Non Mercuric Shoots Bud Sterilization Technique for
Boesenbergia rotunda (L.) Mansf. Kulturpfl. Jurnal Teknologi (Sciences & Engineering), 64(2), 21–24.
Ahmad, F. & Jantan, I. (2003). The essential oils of Boesenbergia stenophylla R. M. Sm. as natural sources of methyl (E)-
cinnamate. Flavor and Fragrance Journal, 18 (6), 485-486.
Anish, N. P., Dan, M. and Bejoy, M. (2008) Conservation using inviro progenies of the threatened ginger- Boesenbergia
pulcherrima (Wall.) Kuntze. International Journal of Botany, 4(1), 93-98.
Chai, P. P. K. (2006). Medicinal Plants of Sarawak. Sarawak: Lee Miing Press.
Christensen, H. (2002). Ethnobotany of the Iban and the Kelabit. Malaysia: Forest Department Sarawak.
Dev, S. A., Shenoy, M. & Borges, R. M. (2010). Genetic and clonal diversity of the endemic ant-plant Humboldtia brunonis
(Fabaceae) in the Western Ghats of India. J. Biosci, 35 (2), 1-12.
Condello, E., Palombi, M. A., Tonelli, M. G., Damiano, C., Caboni, E. (2009). Genetic stability of wild pear (Pyrus pyraster,
Burgsd) after cryopreservation by encapsulation dehydration. Agri. Food Sci, 18, 136-143.
Goldstein, D. B. & Pollock, D. D. (1997). Launching microsatellites: a review of mutation processes and methods of
phylogenetic inference. J Hered, 88, 335–342.
Gupta, M., Chyi Y-S, Romero-Severson, J., Owen, J. L. (1994). Amplification of DNA markers from evolutionary diverse
genomes using single primers of simple sequence repeats. Theoretical and applied genetics, 89, 998-1006.
Jing, L. J., Mohamed, M., Rahmat, A., Bakar, A. B. (2010). Phytochemicals, antioxidant properties and anticancer investigations
of the different parts of several gingers species (Boesenbergia rotunda, Boesenbergia pulchella var attenuata and Boesenbergia
armeniaca. Journal of Medicinal Plants Research, 4(1), pp. 27-32.
Kalpana, J., Warude, P. C. and Bhushan, P. (2004). Molecular markers in herbal drug technology. Current Science, 87(2), 159-
165.
Kumar, P., Gupta, V.K., Misra, A.K., Modi, D. R. and Pandey, B. K. (2009).Potential of Molecular Markers in Plant
Biotechnology. Plant Omics Journal, 2(4), 141-162
Li, A. and GE, S. (2001). Genetic variation and clonal diversity of Psammochloa villosa (Poaceae) detected by ISSR Markers.
Annals of Botany, 87, 585 - 590.
Mohanty, S., Panda, M. K.., Acharya, L., Nayak, S. 2013. Genetic diversity and gene differentiation among ten species of
Zingiberaceae from Eastern India. 3 Biotech, 4, 383–390
Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol.
Plant, 15, 495-497.
Normah, M. N., Chin, H. F. and Reed, B. M. (2012). Conservation of Tropical plant species. Springer science& business media.
pp 445.
Pourmohammad, A. (2013). Application of molecular markers in medicinal plant studies. Acta Universitatis Sapientiae.
Agriculture and Environment, 5, 80-90.
Poulsen, A. D. (2006). Gingers of Sarawak. Borneo: Natural History Publication.
Rao, V. R. & Hodgkin, T. (2002). Genetic diversity and conservation and utilization of plant genetic resources. Plant Cell,
Tissue and Organ Culture, 68, 1-19.
Rodríguez-Bernal, A., Piña-Escutia, J. L., Vázquez-García, L. M. and Arzate-Fernández, A.M. (2013) .Genetic diversity of
Cosmos species revealed by RAPD and ISSR markers. Genetics and Molecular Research, 12 (4), 6257-6267.
Sakai, S. and Nagamasu, H. (2006). Systematic studies of Borneon Zingiberaceae v. Zingiberoideae of Lambir Hills, Sarawak.
BLUMEA, 51, 95-115.
Srivatsava S. and Nidhi M. (2009). Genetic Markers – A Cutting Edge Technology in Herbal Drug Research. Journal of
Chemical and Pharmaceutical Research, 1(1), 1-18.
Steve, R. and Skaletsky, H. J. (2000). Primer3 on the WWW for general users and for biologistogrammers.In: Krawetz S,
Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386.
International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)
2015
101
Tappiban, P. & Triwitayakorn, K. (2012). SSR Markers of Krachai Sayam, endmic plant in Kanchanaburi province,
Thailand.38th Congress on Science and Technology of Thailand (Full paper). I_I0055.
Tharachand, C., Immanuel, S. C. and Mythili, M. N. (2012). Review Article Molecular markers in characterization of medicinal
plants: An overview. Research in Plant Biology, 2(2), 01-12.
Vanijajiva, O., Sirirugsa, P. and Suvachittanont, W. (2005).Confirmation of relationships among Boesenbergia (Zingiberaceae)
and related genera by RAPD. Biochemical Systematics and Ecology, 33(2), 159–170.
Wangsomnuk, P. P., Wangsomnuk, P., Muza, B. (2002). Biodiversity and molecular aspects of Curcuma species from the north-
east of Thailand, Proceeding of the Third Symposium on the Family Zingiberaceae. Thailand :Khon Kean University, pp. 109–
119.
Vanijajiva, O., Sirirugsa, P. and Suvachittanont, W. (2004).Confirmation of relationships among Boesenbergia (Zingiberaceae)
and related genera by RAPD. Biochemical Systematics and Ecology, 33,159–170
Vanijajiva, O. (2012). Low genetic variation of Boesenbergia tenuispicata, a species endangered and endemic to Thailand, using
RAPD markers. Thai Journal of Genetics, 25(1), 67-78.
Weber, J. L., and May, P. E. (1989). Abundant class of human DNA polymorphisms which can be typed using the polymerase
chain reaction. Am. J. Hum. Genet, 44, 388–396.
Williams, J. G. K., Kublelik, A. R., Livak ,K. J., Rafalski, J. A. and Tingey, S. V. (1990). DNA polymorphism’s amplified by
arbitrary primers are useful as genetic markers. Nucleic Acids Res, 18,6531-6535.
Yusuf, N. A. Annuar, M. M. S. and Khalid, N. (2011). Rapid micropropagation of Boesenbergia rotunda (L.) Mansf. Kulturpfl.
(a valuable medicinal plant) from shoot bud explants. African Journal of Biotechnology, 10(7), 1194-1199.
Zheng, Y., Zhang, G., Lin, F., Wang, Z., Jin, G., Yang, L., Wang, Y., Chen, X., Xu, Z., Zhao, X. (2008). Development of
microsatellite markers and construction of genetic map in rice blast pathogen Magnaporthe grisea. Fungal Genet Biol, 45, 1340-
1347.