Bioengineering fluorescent tags from phytochromes

found in Thermosynechococcus

elongatusMills CBST Research Project 2011

Presented by Rosa Meza-Acevedo, Alexandria Magallan

Tianling Ou, with support from Susan C. Spiller, PI

Mills College Center for Biophotonics, Science and

Technology (CBST) Bioengineer a fluorescent tag

Easy-to-detect protein marker Respond to different wavelengths of light Reporter of protein expression

Photographs made at CBST – UC Davis

Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html

Bioengineering A Fluorescent Tag

“DNA for fluorescent tag” can be bioengineered. In our work, we have engineered a nucleic acid sequence that will be translated into the fluorescent protein that we want.

Introduce the Bioengineered Fluorescent Tagged protein

into a living cell

Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html

Plasm

id w

ith n

ew D

NA &

tag

Nucleus

Tra

nsfe

cti

on

Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html

Transfected Eukaryotic Cell Containing

Bioengineered Plasmid with Fluorescent tag

Our Research Goal

Bioengineer a small, red fluorescent tag from a cyanobacteriochrome found in Thermosynechococcus elongatus

Develop this tag to be useful in cellular imaging techniques in vitro and eventually in vivo

Our Research Goal

Bioengineer a new red fluorescent tag

Red illumination of the cytoskeleton

Images modified from: cbst.ucdavis.edu

Why make a red fluorescent tag?

Market Fluorescent Tag:

• Proteins from jellyfish• Limited Imaging• Subject to Photobleaching• Longer Amino Acid

Sequence• Produce Reactive Oxygen

molecule

Introducing a New Fluorescent Tag

Market Fluorescent Tag:• Proteins from jellyfish• Limited Imaging• Subject to Photobleaching• Longer Amino Acid Sequence• Produce Reactive Oxygen Molecule

Our New Fluorescent Tag• Proteins from cyanobacteria• Brighter red, better imaging• Not subject to photobleaching• Shorter amino acid sequence

Introducing a New Fluorescent Tag

New fluorescent tag from T. elongatus

Thermophilic cyanobacteria isolated from hot springs in Beppu Japan

Cyanobacteriochromes Homologous genes to classical plant phytochromes

Photoreverse Absorb light energy Active or Non-active state Phytochromes: Red Far-red Cyanobacteriochromes: Blue Green Mutated GAF: red fluorescent

Genes from cyanobacteriochromes T.

elongatus

GAF Domain Phylogenetic Tree

Rockwell, Nathan. Biochemistry (2008)

Schematic model of the GAF domain and its associated

chromophore

Chromophore in the GAF binding pocket of protein

Rockwell, Nathan. Biochemistry (2008)

Procedure

Protein Purification

PCR genomic DNA

Site-Directed Mutagenesis

SDS-PAGE gel and Transblot

Protein Expression

Transfection

Visualization

!

Restriction enzyme and Ligation

Transformation

PCR genomic DNA:

Genomic DNA from T. elongatus and primers are used in PCR to capture GAF domain only, with the appropriate restriction enzyme recognition sequences at each end.

-- Genomic DNA gift from Dr. Ikeuchi, University of Tokyo, and Dr. J. Clark Lagarias, University of California, Davis

Restriction Enzyme and Ligation

After we obtain the GAF domain with recognition sites at each end from PCR, it is digested with the restriction enzymes, and then ligated by annealing to the sticky ends of the pBAD plasmid, which has been prepared by digesting with the same enzyme.

pBAD + inserted GAF domain (569)

Rolling Circle Site-Directed Mutagenesis:

Mutating Cysteine Aspartate Absorb light in the red region Prevent photoreversibility Fluorescence

Mutated plasmid

GGGTTGGCCACAAGCTCGAGATCAGGTAATTGATTGAGCAGGCAGCCAAATGTGCAGATTGCTTACGTCAGGCTGCGGTGCAGTTAAGTGAGTTGCGCGATCGCCAAGCCATTTTTGAGACCCTTGTGGCAAAGGGCCGTGAACTATTGGCCTGCGATCGTGTCATTGTCTATGCCTTTGATGACAACTATGTGGGAACAGTCGTAGCCGAGTCGGTGGCAGAAGGATCCCTGTTTCCGCGAACACTGGGTAGAGGCCTACCGCCAGGGCCGCATTCAAGCCACGACGGATATTTTCAAGGCAGGGCTAACGGAGTGTCACCTGAATCAACTCCGGCCCCTCAAGGTTCGGGCAAATCTTGTCGTGCCGATGGTGATCGACGACCAACTTTTTGGTCTCCTGATTGCCCACCAGTGCAGTGAACCACGCCAGTGGCAGGAGATCGAGATTGACCAATTCAGTGAACTGGCGAGCACCGGCAGCCTTGTCCTGGAGCGTCTCCATTTCCTTGAGCAGCCCGGG

Mutation of Cysteine (C) in the GAF domain of 569T

TGTGAT

Site-Directed Mutagenesis: Example

Absorbing in the red region makes the protein look blue!

Protein Peak

660nm

Red Region

Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html

Transformation of E. coli with pBAD + 569TM

insert

E.Coli with pPL plasmid pPL plasmid

Contains genetic information to make PCB Hemoxygenase (Ho1) Reductase (PcyA)

Plasmids used to express the cyanobacteriochrome

569TM

pBAD plasmid + 569TM insert

pPL plasmid

Produce: GAF domain Phycocyanobilin (PCB)

Protein Expression Grow E. coli with pPL + pBAD plasmid in

batches in culture medium Add IPTG Add L-arabinose

E. Coli

Protein Expression Centrifugation results E. coli cells are colored

Protein Purification

Mechanical Cell LysisExtract crude protein from cellsCentrifuge to separate soluble protein from cellsNext Step: Chitin binding

www.diversified-equipment.com

Microfluidizer

http://www.microfluidicscorp.com/

Protein Purification

Column set up

Protein Purification

ChitinBead

ChitinBead

Protein of Interest

Cleave!

Elute

Chitin binding column

SDS-PAGE

The process of using an electric current to separate bands of proteins.

Determine the purity of the isolated protein. Pure protein is indicated by a single

band of a particular size The size of the protein can be

determined

SDS – sodium dodecyl sulfate

Anionic detergent

Proteins denature

Negative charge on proteins

Charged groups

Hydrophobic regions

http://www.bio.davidson.edu/courses/genomics/method/SDSPAGE/SDSPAGE.html#SDS

PAGE – PolyAcrylamide Gel Electrophoresis

Gel restrains large molecules from migrating as fast as smaller molecules

Two gel layers 12% Resolving – pH 8.8 4% Stacking – pH 6.68

Preparing PolyAcrylimide Gel

http://upload.wikimedia.org/wikipedia/commons/7/75/SDS-PAGE_Acrylamide_gel.png - Modified

Running Gel-Electrophoresis

Glass gel cassettes

Electrode assembly

Mini Tank

Inner chamber

Outer Chamber

Protein Sample

Lid

Power Source

Blue = NegativeRed = Positive

http://upload.wikimedia.org/wikipedia/commons/4/46/SDS-PAGE_Electrophoresis.png - Modified

SDS-PAGE Gel Results

Rockwell, Nathan .Biochemistry 2008.

Transblot treated with zinc acetate

Zinc Acetate Reveals Bilin Binding

Comassie stained gel

Rockwell, Nathan .Biochemistry 2008.

Rockwell, Nathan .Biochemistry 2008.

Transfection

The process of introducing nucleic acids into eukaryotic cells

Opening transient pores in the cell membrane to allow the uptake of material

There are biochemical methods and physical methods

Physical Method of Transfection:

Electroporation Use of high-voltage electric pulse

to perturb the cell membrane and form transient pores, introducing DNA

Highly efficient for the introduction of foreign genes in tissue culture cells, especially

mammalian cells

Electroporation

Transfection to Jurkat Cells

Jurkat Cells that are transfected by pDsRed-Monmer-Actin

Plasmid we currently use for transfection

http://www.clontech.com/images/pt/PT3827-5.pdf

Visualizing the Transfected Cells

Deconvolution fluorescence microscope at CBST

A video from CBST, taken on a deconvolution microscope