Post on 23-Apr-2017
Universidade do Algarve
Departamento de Ciências Biomédicas e Medicina
Mestrado Integrado em Medicina
Módulo de Escolha do Estudante
Characterization of FOXO3a-mediated gene expression following NPV-BEZ235 exposure
Laboratório Wolfgang Link
Tutor: Richard Hill
Realizado por: Teresa Martins (a39062)
Nº de Palavras: XXXX
Characterization of FOXO3a-mediated gene expression following NPV-BEZ235 exposure
Abstract ______________________________________________________________________
Blablablabla
Introduction __________________________________________________________________
Cancer is the uncontrolled growth of cells in the body. Among the many types of cancers that can rise in an organism, melanoma, originated in anomalous melanocytes, is considered one of the most deadly forms of skin cancer and one of the most aggressive and treatment-resistant human cancers (Fellner e 1131.full). According to the World Health Organization, melanoma kills approximately 53,000 pacients per year, worldwide (Fellner). Of all cancers, melanoma is considered straightforward to diagnose due to the presence of the melanin pigment, that can be directly observed. Radiation therapy, surgical resection and systemic therapy (interferon, dacarbazine or others), are some of the techniques used in the treatment of melanoma. Yet, since it is a disease that spreads quickly to surrounding tissues (due to its high mitotic rate) and it’s highly metastatic, standard treatments don’t supply a high survival rate. (nihms129601) Aside from surgical resection, investigators still lack to find a therapeutic modality that can enhance the likelihood of curative outcome. Over the last few years research has yielded important breakthroughs in our understanding of melanoma particularly regarding the molecular basis of the disease, the deregulated cellular processes essential for continued cell growth within this cancer, the metastatic process and mechanisms of melanoma resistance to chemotherapeutics. (nihms-233789). However to date the only two co-adjuvant treatments approved by the United States of America Food and Drug Administration are
high-dose Interleukin-2 and dacabarzin. NPV-BEZ235 (BEZ) is an imidazoquinoline that targets the phosphatedylinositol 3 kinase (PI3K) and the mammalian target of rapamycin (mTOR), that has demonstrated significant potential antineoplastic properties and is currently being tested I various active clinical trials. (http://www.cancer.gov/drugdictionary?cdrid=589292) PI3Ks (the cellular targets of BEZ) are lipid kinases that play a central role in the regulation of the cell cycle, apoptosis, DNA repair, senescence (terminal cell cycle arrest), angiogenesis, cellular metabolism, and motility. (1756-8722-6-88). The deregulation that leads to diminished cell death and increased growth and proliferation is driven by the accumulation of genetic and epigenetic alterations within the cancer. The activation of PI3Ks has a noticeable relation with tumor growth, since it promotes an increase in cellular mass, cell cycle entry, counteracts apoptosis, modulates and controls cytoskeletal rearrangements and enhances cell migration and metastasis. (601.full) PI3K activation leads to the production of phosphatidylinositol 3,4,5-triphosphate, that activates Phosphoinositide-dependent kinase-1 (PDK1) and Protein Kinase B (Akt). The Akt kinase promotes cell survival by phosphorylating, and thereby inactivating, pro-apoptotic factors, such as the FOXO transcription factor family. (4455.full) The FOXO proteins (including FOXO3a) play an important role in longevity and tumor suppression by regulating a wide range of
genes involved in stress resistance, metabolism, cell cycle arrest and apoptosis. (onc200821a). Previous studies have shown that BEZ treatment of malignant melanoma cells induces FOXO3a-dependent gene expression following the inhibition of PI3K. Functional studies suggest that the tumor suppressive role of was due to their inactivation, caused by constitutively active PI3K/AKT or RAS/ mitogen-activated protein kinase (MAPK)/ERK signaling. Activation of these pathways can directly result in phosphorylation of FOXOs and their subsequent cytoplasmic sequestration and/or degradation via the ubiquitin-proteasome pathway.When FOXO is activated byinhibition of the PI3K/AKT pathway, FOXOs can promote a wide range of effects including cell cyclearrest, cell differentiation, autophagy and apoptosis via various mechanisms. (0008-5472.CAN-12-3767.full)Tribbles-2 (TRIB2), a kinase-like protein, has a role in cell division, that is suggested in up-regulated gene expression in a subset of acute myeloid leukaemias. Members of tribbles family have been reported to interact and modulate the activity of signal transduction pathways, including the PI3K/Akt and the MAPK systems. (dxn116)When TRIB2 is highly expressed in metastatic melanoma cells and has been
implicated in the resistance of various cancers to a range of chemotherapeutics. including inhibitors of PI3K that are under clinical trials. (laura e lab) While it is highly tempting to therapeutically inhibit PI3K/Akt (that is constitutively active in many cancers) driving the accumulation of nuclear FOXO, a recent, important study revealed that in the presence of high nuclear β-catenin, that the activation of FOXO3a by PI3K or Akt inhibitors induced metastasis rather than mediating a pro-apoptotic anti-tumor response as would have been predicted. (1457-14905-3-PB)Based on all this known information, my research goal was to understand if the repression following Trib2 overexpression was due to an inability of FOXO3a to bind target gene promoters.To this aim, several genes were analyzed, such as Bcl-2 interacting mediator of cell death (BIM), Cyclin-dependent kinase inhibitor 1B (p27), whose major function is to stop or slow down the cell division cycle, murine doble minute 2 (MDM2), a negative regulator of tumor suppressor gene p53, BCL2-associated X protein (BAX), that promotes apoptosis, cyclin-dependent kinase inhibitor 1 (distal p21), that promotes growth arrest and is able to mediate cellular senescence, and Fas ligand (FasL).
Methods______________________________________________________________________
Tissue Culture
Cell linesThe cell lines used for this research experiment were G631 Human Melanoma Cell Line and the U2OS Human Bone Osteosarcoma Epithelial Cell Line. The cells were cultivated in 15 cm plates with Serum DMEM 10% with Pen/Strep.
Each cell line was previously transfected with a plasmid containing the TRIB2 and treated with BEZ as described on table 1.
G631- Empty Bez Treatment
Non Treated- Trib 2 shRNA Bez Treatment
Non TreatedU2OS- Empty Bez Treatment
Non Treated- Trib 2 shRNA Bez Treatment
Non TreatedTable 1 – Cells line and applied treatments and transfections.
Imunnoblotting / Western Blotting
This technique provides information about the presence, relative molecular weight, and/or quantity of an antigen by combining protein separation via gel electrophoresis with specific recognition of antigens by antibodies.
List of used antibodies:
Actin (I-19): sc-1616
Bim (H-191): sc-11425
caspase-3 (E-8): sc-7272
Cleaved caspase-3 p11 (h176)-R:sc-22171-R
FAS-L (C-178): sc-6237
FKHRL1 (N-16): sc-9813
MDM2 (C-18): sc-812
p53 (DO-1): sc-126
p-Akt1/2/3 (Ser 473): sc-33437
p-FKHRL1 (Ser 253): sc-12897
Akt1 (C-20): sc-1618
TRIB 2Table 2 – List of used antibodies. All the antibodies were commercialized by Santa Cruz Bayer Technology, except TRIB2, that was developed in the laboratory.
Protein ExtractionThe cells were scraped from the plate into a clean Eppendorf with PBS, and then centrifuged. The supernatant was removed.To prepare samples for running on a gel, cells and tissues on the pellet need to be lysed to release the proteins of interest. This breaks the cell membrane and the nuclear envelope, and allows the proteins to migrate individually through a separating gel. Cells (+/- treatments) were lysed using RIPA buffer (100mM EDTA stock, PIC, Na3VO4, 200mM NaF and RIPA – Tris, NaCl, H2O
and Nonidet P40 buffer and sodium dodecyl chloride). In brief, these lysis buffers differ in their ability to solubilize proteins, with those containing sodium dodecyl sulfate and other ionic detergents considered to be the harshest and therefore most likely to give the highest yield. After incubation on ice, the sample was centrifuged again, the pellet was discarded and the supernatant transferred into a new Eppendorf tube.
SDS-PAGE GelsFirst, the samples were prepared and mixed with sample buffer (loading buffer) and then, the proteins were separated by gel-electrophoresis. After that, the separated proteins were transferred to a sheet of nitrocellulose. The blot was incubated with a 5% milk to prevent non-specific binding of the used antibodies. A specific primary antibody to the interest protein is then added to the solution, and incubated overnight. The primary antibody is removed, the membrane is washed three times with TBS + Tween 20 (Bio-Rad), and after that, the secondary antibody is added in BSA. This antibody has an enzyme or dye attached. The membrane is washed again three times, with TBS + Tween 20 (Bio-Rad). Finally, the membrane is revealed on ChemiDoc, using ECL Plus.
Co-Imunnoprecipitation
The cells were washed with medium. Trypsin was added to the plate with the cultivated cells and then the cells were scraped. The solution was collected to new Eppendorf tubes and centrifuged, and the supernatant was collected to new tubes. The protein A/G-agarose beads were washed for 2 times with PBS and a 50% protein A/G agarose working solution (in PBS) was made.
A 50% protein A/G agarose with ratio of 100μl for a 500 µl sample solution was added.The sample was centrifuged and the supernatant was transferred to new tubes.The primary antibody was added, and the sample was incubated overnight at 4oC.The samples were centrifuged, the pellet was kept, and washed with pre-chilled washing buffer (or cold PBS) for 3 times.
Chromatin Imunnoprecipitation (ChIP)
Cross-Linking and Cell Harvesting
The plates were washed with medium, and a 1% formaldehyde/PBS solution was added to promote cross-linking of proteins to DNA. The solution was removed, and the plates were washed with medium again. The cells were scraped from the plates with 1M Tris-HCl with 10mM DTT, and transferred to Eppendorf tubes. After centrifugation, the pellets were washed with Buffer I and II. After centrifugation, the pellet was resuspended in lysis buffer (made fresh with PIC).
Sonication
The cells were sonicated (6 times for 10 sec each sample) on ice, to shear DNA to an average fragment size of 200-100bp.After centrifugation to pellet cell debris, the supernatant was transferred into a new Eppendorf and Buffer D and PIC (Protein Inhibitor Coktail) were added. At this point, it was removed part of the supernatant from the inputs (sample after sonication; used to quantify the DNA concentration and serve as a control on the PCR process), and the SDS and NaCHO3 concentrations were adjusted.
Reverse Cross-Linking
The samples were heated overnight at 65°C.
Immunoprecipitation
To the remaining supernatant (after the inputs were taken off), it was added sheared salmon sperm DNA, the antibody of interest, G Fast flow beads (SIGMA) and Buffer D. After incubation, the beads were pulled down and washed with TSE I, II and III. Between incubations, each ChIP sample was washed again with TSE I, II and III. After that, the beads were washed with ice cold TE. The DNA was extracted with three washes with a solution of NaCHO3 and SDS. The beads were incubated each time the DNA was extracted, and after centrifugation, the supernatant was transferred to a fresh Eppendorf. The elutes were polled and incubated at room temperature for one hour.
DNA Purification
After that, the input and the ChIP samples were loaded into SIGMA gel extraction/clean up kit., and eluted with water. qPCR was then performed and the products were also visualized on an agarose gel.
Real Time PCR
Real-time PCR is usually the preferred technique to analyze specific DNA fragments in the immunoprecipitated samples. Results are often presented as “percent input” values, calculated by using real-time PCR to quantify the abundance of the DNA fragment of interest added to the ChIP reaction, with respect to the abundance of the DNA fragment found in the final immunoprecipitate.The used primers were BIM, p27, MDM2 and distal p21.
Primers’ SequencesBIM
Reverse CCCGCTCCTACGCCCAATCA
Forward AGCAAGCAGAGTTACTCCGGTAAACA
p27
Reverse GGAAACCAACCTTCCGTTCTForward GTCCCTTCCAGCTGTCACATdistal p21
Reverse CTCCTACCATCCCCTTCCTCForward CTGGACTGGGCACTCTTGTCMDM2
Reverse
ForwardTable 3 – Primers’ Sequences used on the ChIP Real Time PCR.
Figure 1 - Real Time PCR thermal profile
Each sample was tested for the previous described genes, following the Real Time PCR thermal profile on figure 1.
Results________________________________________________________________________
Figure 1: TRIB2 over expressing cells show significant resistance to PI3K inhibitors via the repression of FOXO3-regulated genes. A). Western blots (100 ug total protein) B. FACS (48 hours post BEZ treatment) C. Western blot (50 ug total protein per lane). D. Gene expression (qRT-PCR) at hours post BEZ treatment (100nM)
A. Comparing the expression of caspase 3 and cleaved caspase 3 on the U2OS (empty-GFP) and U2OS (TRIB2-GFP) cell lines, it is possible to conclude that the expression of caspase 3 is not affected by the presence of Trib2 or treatment with Bez. Analyzing the expression of cleaved caspase 3 (the active form of the enzyme caspase 3), it is visible that the absence of Trib2 and the treatment with Bez, promote de expression of the enzyme. Trib2 served as a control for the transfection and Actine as a control for the procedure.
B. Although there is not a significant difference between de two cell lines when there is no damage inflicted (no treatment), comparing both cell lines, after 48 hours of damage with BEZ, it is shown that cell line U2OS (TRIB2-GFP) has a much sharper G1 peak than U2OS (empty-GFP). Therefore, this shows that TRIB2 has no effect on cell division under non-damage conditions, but with BEZ treatment (causing the inhibition of PI3Ks), TRIB2 confers resistance (significantly less dying cells on subG1) and presents a healthier FACS profile (showing a greater similarity between images 3 and 4 than between images 1 and 2).
C. Comparing the expression of BIM and FasL on the U2OS (empty-GFP) and U2OS (TRIB2-GFP) cell lines, it is possible to conclude that the absence of Trib2 and the treatment with Bez, promote de expression of the proteins. Actine served as a control for the procedure.
D. Real Time PCR confirms the previous findings, as it is possible to conclude that the absence of Trib2 and the lasting of the treatment with Bez increases the expression of the genes in study. There is more FOXO3a binding to the promoter under NT conditions, however when BEZ is added, the empty cells show significant FOXO3a activation and promoter recruitment and the TRIB2 cells do not show this. They show only a very minor increase in the amount of FOXO3a on the p27 promoter. It is interesting because the cell cycle arrest aspect is not significantly different between either cell line, rather it is the pro-apoptotic components.
Figure 2: Our PI3K inhibitor is effective at the concentration (100 nM) we have used. Western blots (100 ug protein per lane).
It is possible to conclude that the use of BEZ decreases the expression of the phosphorylated proteins (P-Ser473-Akt and P-Ser253-FOXO3a), but does not affect the total proteins (Total AKT and Total FOXO3a, regardless the phosphorylation state).
Figure 3: TRIB2 over expressing cells show a deregulated p53-MDM2 relationship. A. Western blot (50 ug per lane). B). Immunoprecipitation for p53 or FOXO3a to confirm our antibody would bind to each protein prior to conducting ChIP assays.
1. Comparing the expression of MDM2 on U2OS (empty-GFP) and U2OS (TRIB2-GFP), it is not possible to show a pattern for the influence of the treatment with Bez, or for the relationship
between MDM2 and Total p53. Despite that, BEZ treatment on U2OS (empty-GFP), appears to induce the expression of Total p53, having the opposite effect on the U2OS (TRIB2-GFP) cell line
2. Binding of our antibody to the proteins of interest was confirmed before conducting the ChIP assays.
Figure 4: Chromatin immunoprecipitation indicates significant differences in FOXO3a and p53 recruitment to gene promoters following PI3K inhibition. A. ChIP assays for FOXO3a and p53 in G361 cells B. Quantification of the captures shown in A. C. ChIP assays for FOXO3a and p53 in U2OS cells. D. Quantification of ChIP assays shown in C.
A and B. Recruitment of FOXO3a to p21 and MDM2 gene promoters doesn’t occur, and there are no differences between the treated (12h BEZ) and non-treated samples. On the contrary, there is significant FOXO3a recruitment to p27 and Bim gene promoters, and that recruitment is increased by the treatment with BEZ on the G631 (TRIB2shRNA). These conclusions are confirmed by the quantification of the captures, showing a major difference between both cell lines and the influence of BEZ treatment. As for the recruitment of p53, has exactly the opposite profile of recruitment to the same gene promoters: recruitment of p53 doesn’t occur to p27 and BIM gene promoters, but is recruited to p21 and MDM2 gene promoters, showing an increase of this recruitment on the G631 (TRIB2shRNA) after treatment with BEZ. These conclusions are once again sustained by the quantifications of the ChIP assays by Real Time PCT.
C and D. The U2OS cell line presents the exact same patern of recruitment FOXO3a and p53 to p27, Bim, p21 and MDM2 gene promoters.
Discussion_____________________________________________________________________
Analyzing the effect of the overexpression of TRIB2, it is possible to conclude that it confers resistance to the chemotherapic agent BEZ, confirmed by the fact that on the cellular line overexpressing TRIB2, had a much smaller amount of the active form of the enzyme caspase 3, that plays an important role in the execution-phase of cell apoptosis. That fact is also confirmed by the promotion of the expression of the proteins BIM and FasL, both pro-apoptotic regulators, on cells lacking the overexpression of TRIB2.
Another proof of the interaction of TRIB2 with the cell cycle, is increased binding of the transcription factor FOXO3a to the pro-apoptotic components (such as p27) on the cell lines without the overexpression of
TRIB2, when compared to the cell line that overexpress it.
The treatment with BEZ also decreases the expression of the phosphorylated forms of AKT and FOXO3a, decreasing this way the cell proliferation.
Aside from these gene promoters, MDM2 and p53 were also studied, but a clear relation between p53 and MDM2 couldn’t be established.
The interaction between FOXO3a and the p27 and BIM gene promoters apparently is increased on the cell lines overexpressing TRIB2 after the treatment with BEZ. As for p53, it apparently shows a high recruitment to p27 and BIM gene promoters after BEZ
treatment of cell lines overexpressing TRIB2. Since the levels after BEZ treatment are similar on both cell lines (empty and overexpressing TRIB2), this
results suggest that the BEZ influence on the apoptosis of cancer cells is independent from TRIB2.
Future Perspectives_____________________________________________________________
To confirm these new findings, and confirm if the chemotherapic agent BEZ is able to surpass the resistance problems that other chemotherapic agents find when TRIB2 is overexpressed in melanoma cells, all these experiments should be performed again.