Post on 09-Oct-2020
Boston ENET Meeting – Janaury 21st, 2020
Patrice M. Milos, PhD – Co-Founder/CEO Patrice@medleygenomics.com
Career in Precision Health: Fund Raising Experiences
Professional Career Milestones
• Transgenic Sciences: Developed the first transgenic mouse Alzheimer's model
• Pfizer Global R&D: Started the Pharmacogenomics group in 1996!
• Helicos BioSciences: CSO - World’s first single molecule DNA sequencing
• Pfizer Boston Center for Therapeutic Innovation: A new model for drug discovery and development
• Claritas Genomics: Pediatric Molecular Diagnostics, company’s founding CEO
• Medley Genomics: Data analytics in oncology, CEO and Co-founder
Personal Goal
To improve patient lives through my passion for personalized healthcare and application of
innovative science and technologies to understand human disease.
You Can Find Me
The Story
The Year is 2011: Helicos® Genetic Analysis Platform
SamplePreparation
HeliScope™Sample Loader
HeliScope™Single Molecule
Sequencer
HeliScope™AnalysisEngine
>GATAGCTAGCTAGCTACACAGAGAT >GATAGACACACACACACACAGCGCA >GTACTACACACAGCGACACAGTCTA >GTCGAACACACATGAACACATGAGC >GTGTCACACACGACTACACATGCAT >TAGTGACACACGTAGACACGACAGT >TCTCGACACACTATCACACGACTCA>TGCACACACACTCGTACACGAGACG
Output(SRF)
SMS Single Use Reagents
7
Transitioning Helicos to Dx Laboratory
Approach• Helicos IPO in 2007 – Raised ~$55M• Two Additional Funding Rounds • Several NIH Grants >$5M • By 2011 – Competition in NGS, Attempted Pivot to Dx NewCo.• Developed Business Strategy/Model/Revenue Projections• Discussions with ~25 Venture Capital Firms
8
The Opportunity
• Newco to launch unique sequencing-based Molecular Diagnostic (MDx) test menu through ConVerge’s CLIA lab
• Helicos: only single-step, targeted single molecule sequencing platform in the world– Freedom-to-Operate in the MDx space
• First product: BRCA1/2 Sequencing Test – Highly profitable genetic test (90% gross margin) - Market estimated at $875M– Launch – within one year
• ConVerge: CLIA licensed, CAP accredited, excellent “Women’s Health Services” – CEO, COO, VP Sales and IT Director each >20 years experience in laboratory services
industry• National Distribution Strategy
– ConVerge in New England as regional prototype for national coverage– COE direct relationship with LiberateDx
• National Distributor Network Platform for distribution of additional tests both developed internally and by others
9
New Company Formation
10
• Intellectual Property• Sequencing Technology• Bioinformatics SW/HW• Sample Preparation Methods• Scientific Expertise• Cancer Center Relationships• Patient Samples
• Experienced Management Team• CLIA/CAP Accreditation• Laboratory Information System• OB/GYN Relationships• Payor Relationships• Sample Accessioning• New England Logistics
Leadership
11
Robert J. GormanCEO
• 27 years in HealthCare with the last 24 in the Independent Clinical Laboratory business. Lead various laboratories through significant growth in revenues and margins for Quest Diagnostics. Spent the last eight years at Quest as the East RVP with responsibility for $1.2B in revenues and in excess of $400M in EBITDA.
• Negotiated purchase of ConVerge Diagnostic Services with Water Street Healthcare partners in May 2009. Implemented the capabilities to compete in the broad commercial laboratory market in New England during the first year . Currently the CEO of Converge Diagnostic Services.
Elaine LabrecqueCOO
• 25 successful years at Quest Diagnostics. With Quest, Elaine had the opportunity to run a regional business with years full P&L responsibility for $150M of Revenue with $50M EBITDA. She also lead several successful business integrations and has extensive experience in Lean Six Sigma. Her last 7 years at Quest were spent as National Director for testing operations and standards.
• Elaine has also worked in the diagnostics field and in hospital environments.
Julia Elvin, MD, PhDPathologist
• PhD in Molecular and Human Genetics and is a Board Certified MD in Anatomic Pathology.• Julia did her residency at Brigham and Women’s in Anatomic Pathology where she served as Chief
Resident. She completed a sub-specialty Fellowship at B&W in Perinatal Pathology under Dr. Christopher Crum.
Patrice Milos, PhDSVP and CSO
• Executive Director at Pfizer Global R&D; Industry leader in pharmacogenomics• Globally recognized CSO in Single Molecule Sequencing technology and applications• Established track record in securing grant funding and partnerships
Avak Kahvejian, PhDVP of Business Development
• Business Development, Sales and Marketing roles at Helicos since 2004• Established relationships with academic, medical and research centers for Dx initiative• Developed early market for Helicos Technology
Mission
• Combine Unique Technology and Disruptive Business Model to Provide Diagnostic Information to HealthCare Professionals and Patients, Resulting in Improved Patient Outcomes
• First product: BRCA1/2 Sequencing Test
• Enable patient and healthcare professional choice by providing alternative to existing monopoly
• Two-pronged nation-wide marketing approach for business growth
– COEs directly
– OB/GYNs through regional distributors
12
Current Market for Myriad Genetics BRACAnalysis™
• Market potential = $875M• Current Revenue from BRACAnalysis = $360M
annualized – with gross margins of 90%– 70% from oncologists/Cancer Centers (50% penetrated)– 30% from OB/GYNs (15% penetrated)
• Pricing– List Price $3,120 (does not include $700 BART test)– ASP ~$2,870
SourcesJ.P.Morgan North American Equity Research, Medical and Life Science Technology Myriad Coverage Initiation Report – 26 April 2010MYGN Form 10-K for the quarterly period ended December 31, 2010 13
MDx IP Rife With Amplification-Based Method Claims
We Do NOT Amplify and Therefore Do NOT Infringe
14
15
Capital Requirements
Year 1 - BRCA Assay Validation $5,000,000
Year 2 - Commercial Launch/Working Capital $5,000,000
Other Provision/Contingency $5,000,000
Total Estimated Capital Funding Requirement $15,000,000
• Summer, 2011 --Unable to raise funds due to uncertainty around Myriad Patent
• June 13, 2013 -- The Supreme Court ruled today that isolated human genes cannot be patented, a partial defeat for Myriad Genetics, a company that had been awarded patents on the so-called BRCA1 and BRCA2 genes in the 1990s.
CLARITAS GENOMICS16
THE TIME IS NOW FOR RARE DISEASE PATIENTS
CLARITAS GENOMICS
The Need is Great: Together We Make a Difference
17
1 NIH, 2CDC, 3Shire, 2013 Rare Disease Impact Report: Insights from patients and the medical community*Rare Disease Defined: Patient population estimated at fewer than 200,000 in the U.S.
By The Numbers1:•>7,400 rare diseases•80% are genetic•50% are pediatric in presentation•25—30M people live with rare disease* (US)•250—300M people live with rare disease (Ex-US)
Studies2,3 Have Found:•7—12 years to diagnosis•8 specialty physicians •2 to 3 misdiagnoses•Physicians don't have the time or information •Major emotional toll on patients and caregivers
CLARITAS GENOMICS
Bringing Strategic Partners – Founding Partners - January 2013Creating a Powerful Force for the Future
18
• Founding institution• World-leading pediatric hospital
• Founding network partner• World-leading pediatric hospital
• Leading provider of DNA sequencing technology
• World leader in healthcare information technology
SERIES A $10M
Bring together strategic partners to create and grow Claritas Genomics as a leading pediatric diagnostics company aligned with the healthcare system
CLARITAS GENOMICS19 CLARITAS GENOMICS19 CLARITAS GENOMICS19
Exome Sequencing for The Million Veteran Program: Building Revenue
19
Applies: 7/2013
~$10M Award: 10/2013
CLARITAS GENOMICS
Continuing Funding Discussions
20
- Pediatric Hospitals- Venture Investors- Pharmaceutical Partners- Biotech Companies- Technology Providers
CLARITAS GENOMICS
Bringing Strategic Partners – Growing the CompanyCreating a Powerful Force for the Future
21
• Founding institution• World-leading pediatric hospital
• Founding network partner• World-leading pediatric hospital
• Leading provider of DNA sequencing technology
• World leader in healthcare information technology
SERIES B $15MBring together strategic partners to create and grow Claritas Genomics as a leading pediatric diagnostics company aligned with the healthcare system
• Leader in genomic analysis platform for discovery and building clinical workflow LEAD INVESTOR
CLARITAS GENOMICS
CLARITAS GENOMICS23
Today:
25
18.1MNew patients /year
(Global)Cancer deaths/ year
(Global)
9.4M
We Still Have More to Do for Cancer Patients…
~20% of Lung Cancer Patients Live Beyond 5 Years
Our Mission
Medley Genomics provides novel data analytics to understand genomic heterogeneity of complex
diseases, providing hope of lasting cures for patients.
26
Cancer Vaccines CAR-T Cell TherapyTargeted Therapies
Data Analytics to Probe Molecular Heterogeneity
27
Differences within Patient Differences across PatientsGenome-scale
Interaction Network
Machine learning approaches to identify altered subnetworks
• Describe unique cell composition• Diagnose, treat and monitor disease
• Define patient-specific mechanisms• Improve disease understanding• Target discovery
Applications for Drug Discovery and Development
• Combination Therapy: Clonal vs. Subclonal, ID Rare Drivers
• Tumor Response/Resistance/Relapse: Longitudinal Data
• Oncology Vaccine Designs: Neoepitope Optimization
• Immuno-therapy Response: Clonality of Neoepitopes
• PDx Mouse Models: Efficacy/Resistance
• Novel Disease Pathways: Reveal Gene Networks
• Patient Stratification: Mutually Exclusive Mutation Patterns
28
29
Winner $20K Pistoia Alliance President’s Innovation Challenge
License Agreement GSKAgreement Nationwide Children’s
$125K Follow-onExisting Investors
Company Formation – Brown UniversitySecured WW Exclusive Licenses
Patent Filings
$300K Seed Funding Slater Technology/Lazarus
Winner
RI Commerce Innovation Voucher
Semi-Finalist MassChallenge
First Revenue
10/16 12/16 9/17 2/182/17 3/17 5/17 10/17 12/17 5/18
Philips HealthWorks
4/18
$300K NCI SBIR
Our Journey
2018 Most Innovative Co.Biotech/Life Sciences
8/18 10/18
Winner $50K Cox Business
4/19
Phase II SBIRSubmitted
???
Additional Fund Raising
• License Sales ongoing
• Still ongoing discussions with Venture Capital Firms and Corporate Venture Arms
• Multiple Pharmaceutical Discussions for Potential Partnerships
• Applied for Phase 2 SBIR - ~$2.5M: Require additional market penetration
Remember – Fundraising Is HardThings I Am Most Proud Of…
• I have always found a way to do…and fund… cutting edge innovation!
• Being a female CEO and an Entrepreneur!
• My passion for science and sharing that passion with my daughter
• Living life with optimism each and every day and sharing that with others because what we do is hard!
• Remembering to be humble
• Always being willing to say “I don’t know the answer…but I’ll find out”
• Recognizing that my success is not mine alone but all the people who work with me to achieve great things if you always think you can!