BSP UP Centennial Professor of · PDF fileBSP‐UP Centennial Professor of Agriculture....

Post on 07-Mar-2018

220 views 2 download

Transcript of BSP UP Centennial Professor of · PDF fileBSP‐UP Centennial Professor of Agriculture....

Annual BSP‐UP Professorial Chair Lectures 

LECTURE NO. 5LECTURE NO. 5LECTURE NO. 5

Abaca Breeding for a More Reliable Philippine Abaca Industry 

Dr. Antonio LalusinBSP‐UP Centennial Professor

of Agriculture

It is endemic to thePhilippines

It is a source of fiberinternationally known asManila hemp

Abaca is an important export crop and is a majordollar earnerThe abaca industry isgenerating 80 millionUS dollar annually

Abaca- Musa textilis Nee

As of 2008, abaca is cultivated in about 140,000 hectares in 52 provinces

The Philippines is supplying 85% of abaca in theworld market

The demand for abaca pulp and fiber will continue to increase

Car manufacturers use abaca as compositematerials for vehicle interiors and automotive parts

More countries are now shifting to the use of natural fibers in their bid to eliminate dependence on materials derived from fossil fuels

Uses of Abaca Fibers

The Abaca IndustryIn 1820, an American lieutenant of the US Navy

brought abaca fiber to the United States

Five years later, the first exportation of abaca was made.

Abaca became well known as one of the strongest materials for marine cordage due to its superior tensile strength and proven durability under sea water

With the onset of the 20th century, abaca fiber became the premier export commodity of the country.

In 1822, attempts to introduce the crop in India, Borneo, German East Africa, West Indies and Florida was done but it was not commercially viable (Copeland, 1911).

In 1923, the US government introduced abaca in many countries with climate similar to the Philippines, when the US Navy relied solely on Philippine abaca as the source of its marine cordage (Spencer, 1953)

In 1925, abaca seed pieces from the Philippines were also used to establish plantations in Sumatra, in British Borneo and in Malaya

In 1939, in New Caledonia and Queensland (Torres and Garrido, 1939).

In Vietnam, in 1958 with seed pieces from Costa Rica.

After World War II, a Japanese owner of the abaca plantation in Davao, started field testing and successfully cultivated abaca in Ecuador which produces abaca for export

INDUSTRY SECTORS

•Farmers 89,071 •Traders (licensed) 617 •Trader-Exporters (licensed) 31 •GBEs (licensed) 20 •Cordage firms (licensed) 6 •Pulp Manufacturers(licensed) 6 •Fibercraft processors (licensed) 105

TOTAL HECTARAGE: 141,711 hectares

TOTAL PRODUCTION: 66,471 m.t

MAJOR PRODUCING PROVINCES:

CatanduanesLeyteSouthern LeyteNorthern SamarDavao OrientalSurigao del SurDavao del SurSuluSorsogonWestern Samar

Abaca is grown in 52 provinces with the following as the top ten producers:

AVERAGE EXPORTS: (1997-2006)

EXPORTSVOLUME(in m.t.)

VALUE(in FOB US$)

RAW FIBERS ……………………………. 12,887 14,049,398MANUFACTURERS

Pulp …………………………………….. 17,384 38,391,313

Cordage, ropes and twines ….. 7,725 11,379,481Yarns and fabrics

…………………. 396,910Fibercrafts

…………………………… 15,046,555AVERAGE TOTAL EXPORT EARNINGS $79,263,657

MAJOR IMPORTING COUNTRIESRAW FIBERS United Kingdom, Japan, Indonesia

MANUFACTURERS

Pulp Germany, Japan, UK, France, USA

Cordage, ropes and twines USA, Singapore, Canada, Germany, Malaysia, United Kingdom, United Arab Emirates

Fibercrafts USA, Japan, Spain, Italy, UK, Hongkong, France, France, Australia

Threats and ProblemsAbaca has long been an established industry, but it is still plagued with problems.

Areas that continue to be addressed are (1) farm productivity, and (2) fiber quality.

Serious and aggressive moves by Indonesia to massively produce abaca under the government's reforestation program

Available cheaper substitutes (e.g., sisal, Ecuadorian abaca)

Cheaper sources of similar materials (e.g., China, India)

Technological advances and breakthroughs which make possible production of cheaper substitutes, whether from natural or synthetic-based materials

Presence of virus diseases

Abaca Bunchy Top

Abaca Mosaic

Abaca Bract Mosaic

Estimated losses in fiber yield and equivalent values in pesos as a result of the widespread occurrence of bunchy-top and mosaic viruses.

Area Disease Incidence

Fiber Yield Loss (kg)

Value

Region-wide 5.19 percent 833,587.99 kg Php18,338,935.78Sorsogon Php9,458,893.40Catanduanes Php5,814,850.36Eastern Visayas

312,076 kg Php8,440,350.00

Northern Samar

153,186 Php3,829,650.00

Northern Leyte 116,280 kg Php3,488,400.00

(source: Raymundo, 2002).

Abaca Bunchy Top

first reported in 1915 in Silang, Cavite and in 1937 inDavao province

a total of 12,000 ha had been wiped out in Laguna, Batangas, Cavite

it spread in Bicol region, Sorsogon and EasternVisayas

fiber yield loss ranged from 13 to 77%

it is caused by abaca bunchy top and transmittedby an aphid vector, Pentalonia nigronervosa

Symptoms of Abaca Bunchy Top

yellowish-white, chlorotic areas on lamina and margins of unfurled leaf

mature leaves become dark green, stiff, narrow, erect and necrotic

the petioles begin to rise from the same plane at the upper end of the pseudostem resulting to a rosette or bunchy appearance

infected plants may remain alive for years but they gradually become smaller until their leaves and leafsheaths turn brown and die

Transmissionby insect vector, banana brown aphid, Pentalonia nigronervosa Coq.

can be found on pseudostem, youngest unfurled leaves and at the underside of old leaves

a single aphid can transmit ABTV

ABTV can be retained in the vector from 5 to 12 days

Abaca Mosaic DiseaseSymptoms

alternate green and yellow streaks, spindle-shaped patterns or dashes on leaves

mottling on leafsheaths and pseudostem

chlorotic areas develop rusty brown borders and extend from midrib to leaf margins

pale green areas turn orange to brown and later dry out

Transmissionby sap

by insect vectors (9 species),Aphis gossypii, A. maidis, A. glycines, Rhopalosiphum nymphaceae, R. maidis, R. prunifoliae, Toxoptera citricidus, Schizaphis graminum, S. cyperi

a single aphid can transmit AMV

it takes only 15 sec to acquire and transmit the virus

Abaca Bract MosaicSymptoms

stringing of young leaves

spindle-shapes chlorotic streaks running parallel to the veins

older leaves show raised leaf veins originating from the midrib

greenish to yellowish streaks o spindle-shaped lesions in petioles

dark-colored mosaic pattern on bracts of the inflorescence

Transmission

by sap

by insect vectors:Aphis gossypiiPentalonia nigronervosaRhopalosiphum maidis

History of Abaca BreedingThe indigenous Musa species – M. acuminata, M.

balbisiana and M. textilis

Natural hybrids of pacol and abaca exist in Bicol region known as Canton and Minay (Valmayor et al., 1956).

The basic chromosome number for the section Eumusa to which the edible bananas belong is 11, whereas that of Australimusa to which abaca belongs is 10.

Minay/Minary/Minray has 2n=21 (Pancho and Capinpin, 1959; Tabora and Carlos 1978)

Canton has 2n=20 (Valmayor et al., 1956)

Crosses between Libuton x Itom and Canorajan x Lagurhuan were developed

As of 1928, there were already hybrids developed for the varietal improvement of abaca (Labrador, 1928).

There were 54 different crosses that were developed from 1928 to 1931, only 29 crosses were successfully planted, 19 in Guinobatan Abaca Experiment Station and 10 in Silang, Cavite

Screening for disease resistance was carried out in 39 clones.

The F1 hybrids produced greater number of suckers than either parent.

Crosses with Maguindanao were better adapted to different conditions and possess stronger root system.

In the early 1950’s, the abaca varietal improvement program was initiated by the College of Agriculture, UP (UPCA) and the Bureau of Plant Industry (BPI)

The emphasis was on varietal collection, classification, evaluation, establishment of disease observationnurseries, clonal selection and intra- and inter specifichybridization.

The cooperative work was centered on the developmentof resistant abaca verieties, and the most notable achievement was the identification of Pacol as a source of resistance.

Experimental breeding between M. balbisiana and M. textilis produced hybrids with morphological characteristics and chromosomal numbers similar to those of Canton and Minay (Bernardo, 1957)

Hybrids between Minay and abaca, with the latter serving as male parent, have been produced.

The hybrids resemble the Minay parent more than the abaca parent (Brewbaker et. al, 1956)

Artificial hybridization proceeds more effectively when the abaca is the male parent.

In 1974, abaca hybrids developed in 1939 were field tested and they were named after the name of the parental.

Crosses with Linawaan x Laylay was named as Linlay , Linawaan x Libutanay as Linlib and Linawaan x Inosa as Linino (Cruz and Balingit, 1974).

Oyardo (1974) also field tested and named some abaca hybrids such as Itom x Lausigon as Itolaus, Itom x Maguindanao as Itomag, and Lausigon x Maguindanao as Lausimag.

Diaz (1997) generated F1 hybrids of Mininongacrossed with six varieties of abaca and screen for bunchy top resistance.

Crosses that produced F1 seedlings: Malaniceron x Mininonga, Mininonga x Itolaus 39, Mininonga x Layahon, Mininonga x Putumag 22, Mininonga x Tinawagan Puti and Sogmad Pula X Mininonga.

The reaction of the hybrids to abaca bunchy top varied,

Malaniceron x Mininonga, Mininonga x Itolaus 39, and Mininonga x Layahon, has resistance to bunchy top virus

Sogmad Pula X Mininonga has moderate resistance.

In 1981, the abaca collection which was then maintained by the Forestry Abaca Gene Bank, was turned over to the UPLB Experiment Station.

Several crosses were made and in 1986 the first six F1 hybrids between Pacol and abaca were released.

These hybrids have resistance to bunchy top virus butthe fiber quality is quite poor.

BC1 crosses were produced in 1995 and evaluated,but the work was ended due to unavailability of funds.

It was only last 2006, that the breeding work wascontinued although to a limited extent, and several BC1crosses were evaluated.

Selected BC1 progenies were backcrossed again toabaca to generate BC2 populations.

BC2 populations are now evaluated forbunchy top resistance and fiber qualities.

Development of Abaca HybridsDevelopment of Abaca HybridsWild

BananaAbaca

x

50% F1 Abaca

x

75% xBC1 Abaca

x87.5% BC2 Abaca

Hybrids

Abaca:w/ good fiber

quality

Wild Banana:w/ resistance to

ABTV92.25% BC3

• F1 hybrids have resistance to ABTV but poor fiber quality• BC1 has resistance and improved fiber quality as compared to F1

Generation of BC2 HybridsGeneration of BC2 HybridsSelected BC1 hybrids were backcrossed to recurrent abaca parents to generate the BC2 populations. 

Germination beds Inoculation w/

P. nigronervosa

Fiber extractionFiber quality analysis

Selection of BC2 hybrids

Best SelectionsBest Selections

Characters Abuab Inosa Pacol BC2-37

Number of Stools

9 8 8 11

Plant Ht.(cm)

273 295 321 290

Girth (cm) 53 38 49 51

Stem Fresh Wt. (kg)

25 24 29 35

Leaf Sheath Number

22 17 19 22

Fiber Length (cm)

250 250 150 260

% Fiber Recovery

0.588 1.104 0.421 0.949

Tensile Strength

71.24 67.28 31.24 53.60

BC2-37

Characters Abuab Inosa Pacol BC2-46

Number of Stools

9 8 8 9

Plant Ht.(cm)

273 295 321 447

Girth (cm) 53 38 49 47

Stem Fresh Wt. (kg)

25 24 29 24

Leaf Sheath Number

22 17 19 19

Fiber Length (cm)

250 250 150 250

% Fiber Recovery

0.588 1.104 0.421 0.952

Tensile Strength

71.24 67.28 31.24 50.12

BC2-46

Characters Abuab Inosa Pacol BC2-76

Number of Stools

9 8 8 9

Plant Ht.(cm)

273 295 321 357

Girth (cm) 53 38 49 38

Stem Fresh Wt. (kg)

25 24 29 32

Leaf Sheath Number

22 17 19 18

Fiber Length (cm)

250 250 150 280

% Fiber Recovery

0.588 1.104 0.421 0.991

Tensile Strength

71.24 67.28 31.24 57.19

BC2-73

Characters Abuab Inosa Pacol BC2-64

Number of Stools

9 8 8 9

Plant Ht.(cm)

273 295 321 290

Girth (cm) 53 38 49 52

Stem Fresh Wt. (kg)

25 24 29 30.3

Leaf Sheath Number

22 17 19 22

Fiber Length (cm)

250 250 150 275

% Fiber Recovery

0.588 1.104 0.421 1.361

Tensile Strength

71.24 67.28 31.24 65.84

BC2-64

Fiber quality analysis of selected abaca with AbBTV resistance

IPB 0 IPB 15 IPB 30

IPB 45 IPB 60

Recent Advances in Abaca Breeding

Research

Development of Abaca Molecular MarkersDevelopment of Abaca Molecular Markers

Sample collection

DNA extraction

DNA Quantification and quality check

Molecular marker analysis

Gel Electrophoresis PCR amplification

Musa SSR PrimersMusa SSR Primers

*4/12 working primers = 33.3%; 3 polymorphic

Primer DesignPrimer Design

6 cellulose synthase genes were shown to be required in cellulose synthesis

Download CesA genes from diff. plants

Find tandem repeats

(TRF and Ocular)

Found tetra-nucleotide (CCTC) repeats in CesA2

barley

Designed gene specific SSR primers targeting the cellulose, lignin and pectin biosynthetic pathway 

Degenerate Resistance Gene Analogs Primers  

Name Primer Sequence from 5’ to 3’ region Type

1. IF GGCGGGGTGGGCaaracnacnht F

2. P3B AIITYIRIIRYIAGIGGIAGICC R

3. 3F2 GAGGTACTTCCTGGTGCTGgaygayrtbtgg F

4. I3R1 CGGCCAAGTCGTGCAyvakrtcrtgca R

5. PIA GGIATGCCIGGIIIIGGIAARACIAC F

6. P3A AIITYIRIIRYIAGIGGYAAICC R

7. PIB GGIATGGGIGGIIIIGGIAARACIAC F

8. CNL298F GGN ATG GGN GGN GTN GGN AAR AC F

9. M1445R YTT NAR NGC NAR NGG NAR NCC R

10. NBS1R CGT CTT TGC MGC NAR NGG NAA NCC R

Genetic Diversity and Phylogenetic Relationships of Abaca Genotypes

SSR amplification products generated by the primer pairs, mMaCIR39, mMaCIR40 and mMaCIR45. A. lanes 1-22 were the representative products of mMaCIR40; B. lanes 30-50 were representative products of mMaCIR39; C. lanes 30-50 were representative products of mMaCIR 45; L: 1kb plus ladder.

Dendogram (UPGMA) of 158 M. textilis from Luzon, Visayas and Mindanao using Nei’s (1978) unbiased genetic identity (limit: 0.72 coef.).

DNA fingerprinting of the 196 BC2 hybrids using PCR with mMaCIR45. Abuab (A) and Lausigon (L) (abaca check) were run in parallel with the BC2 samples; Musa balbisiana (Mb) and ‘Seniorita’ (S) were used as positive controls.

Cloning of Abaca Resistance Gene Analog (RGA)

Reamplified RGA PCR products for cloning

M    1      2    3     4      5   6     M

1325

868

666

M   28      29   30     31   32    33    34    35    36    37    38     39   40    41     42   43    44     45   46    47    48  49    50     51     M

Colony PCR products of three samples with two replicates electrophoresedusing 2% agarose.

Sequences of rgaA1 insert of Musa textilisand the representative chromatogram>Musa textilis rgaA1 – 868 bases       

GGCATGGGAGGCGTGGGAAAGACCTAAAAGATTAACGAGAGGCAAGATGGACCTCAAGATGGGCAATGGAGTAAACATTGTTATAATAGCTGTTGGCATGGTCACCTTACATCTGCTTGGTGGAGCTATTATTGCATTAGATGCATGTTATTTTGTTCCTCTTATTATCAAAAATATTATTTCCATTTCATATTTGATAATTAGTAGATATAAATTAGTTTTTTAGAATAATGGTTGTTCAATAATATTAGATGATGAGATCGTCATGAGAGGAATATTGCATAATGGTTTATTTATACTAGACACTACTCAACATATCATAAATATAAGTGTGTCCAAAAAGAAATTAGATGAGATGAACAGTACATACTTGTAGCATTATAGGCTAGGTCACATCCATAAGGGAATGAGTCAAAAGTTGCTAAAGGATGGATATATAGATCCATTTGACCGTGAGTCATATACAACTTGCAAGCCTTGCCTTCGTGGAAAACTAATATGTATGTGGACCCATGTCATGTCAACTCATGCTATAGGTGGTTACTCATACTTTGTTACTTTTACTAATGATTTCTTAAGGTATAGATATGTGTACTTGATGAAGTACAAGTCCAAGGCTGTTTAGAAATTTAGAGAGTATAAGAATGAAGTGGAGAACCAGACTGGAACGAGTATCAAGACTCTTTAATTAGATCGAAGAGGTGAGTACTAGAGTATAGAGTTCATCCATTTCCTCAAGGACCATGGGATTCTATCCCAATGGACACCTCCTTACACATCTCAGCTCAATGGTATATCTGAAAGGAGGAATCGTACATTGTTAGACATAATGCGGTCCATGATGAGTTTTGCCGACACCTCCCATGCC

OPPORTUNITIES AND PROSPECTS FOR

ABACA

The abaca industry is expected to continue making a stronghold in both the domestic and international markets.

Strong demand for abaca as a result of the expanding market for specialty papers for food packaging as in tea bags and meat casings, filter papers, non-wovens and disposables.

Growing demand to conserve forest resources and to protect the environment from problems posed by non-biodegradable materials, particularly plastics, contributed to the growing demand for natural fibers like abaca.

Due to the environmental degradation, Japan, which is one of the major abaca consumers, is now replacing PVC with natural fibers or materials free from chlorine.

Development of new uses for abaca such as textile materials for the production of pinukpok or as blending material, with silk, piña or polyester, in the production of high-end fabrics.

Growing demand for handmade paper as art media, photo frames, albums, stationery, flowers, all purpose cards and decoratives.

By 2020—when farms expand to 32,600 hectares—abaca fiber production should reach 152,000 metric tons.

Fiber yield is expected to increase from 565kg per hectare per year to 900kg per hectare.

Thank you very much!