Post on 13-Aug-2020
A peer-reviewed version of this preprint was published in PeerJ on 10January 2017.
View the peer-reviewed version (peerj.com/articles/2850), which is thepreferred citable publication unless you specifically need to cite this preprint.
Clark WS, Galen SC, Hull JM, Mayo MA, Witt CC. 2017. Contrasting molecularand morphological evidence for the identification of an anomalous Buteo: acautionary tale for hybrid diagnosis. PeerJ 5:e2850https://doi.org/10.7717/peerj.2850
Contrasting molecular and morphological evidence for the identification of an anomalous 1
Buteo: a cautionary tale for hybrid diagnosis 2
William S. Clark, (raptours@earthlink.net), 2301 South Whitehouse Circle, Harlingen, TX 3
78550 4
Spencer C. Galen, Sackler Institute for Comparative Genomics, American Museum of Natural 5
History, New York, New York, 10024 6
7
Joshua M. Hull, Department of Animal Science, University of California, Davis, California, 8
95616 9
Megan A. Mayo, Department of Animal Science, University of California, Davis, California, 10
95616 11
Andrew Engilis, Jr., Museum of Wildlife and Fish Biology, University of California, Davis, 12
California, 95616 13
Christopher C. Witt, Department of Biology and Museum of Southwestern Biology, University 14
of New Mexico, Albuquerque, New Mexico, 87131, USA 15
16
PeerJ Preprints | https://doi.org/10.7287/peerj.preprints.2039v1 | CC-BY 4.0 Open Access | rec: 10 May 2016, publ: 10 May 2016
Unusual Cal RS
2
17
Abstract. 18
An adult Buteo was found dead as a road-kill south of Sacramento, California, and was thought 19
to represent the first state record of the eastern Red-shouldered Hawk (B. lineatus lineatus; Pyle 20
et al. 2004). It is now a specimen in the Museum of Wildlife and Fish Biology (WFB 4816) at 21
the U. of California, Davis. We examined this specimen and found that many of its plumage 22
characters differed from all other adult Red-shouldered Hawks examined, including nominate 23
adults. Plumage markings and measurements were intermediate between Red-tailed Hawk 24
(Buteo jamaicensis, ssp calurus) and Red-shouldered Hawk (ssp elegans), leading us to 25
hypothesize that the bird was a hybrid. However, mtDNA sequences and nuDNA microsatellites 26
proved definitively that the bird was a Red-shouldered Hawk, most likely of eastern origin. This 27
case illustrates that apparent hybrids or apparent vagrants could be individuals with anomalous 28
phenotypes caused by rare genetic variation or novel epigenetic effects. 29
Keywords: Unusual plumage, DNA ,specimen, hybrid, morphology, phenology 30
31
32
33
Unusual Cal RS
3
34
INTRODUCTION 35
Hybridization often occurs between sympatric populations of closely related species, and it is a 36
process that can have important evolutionary consequences (Seehausen, 2004; Rheindt and 37
Edwards 2011). Hybridization can accelerate or slow speciation (Abbott et al., 2013), can rescue 38
inbred lineages (Frankham, 2015), and can lead to extinction (Allendorf et al., 2001). Often the 39
youngest, or most recently radiated species experience hybridization (Mallet, 2005). Raptors of 40
the genus Buteo are part of a rapid, recent radiation in which many species overlap in their 41
distribution (Riesing et al. 2003). Numerous cases of hybridization among Buteo species have 42
come to light relatively recently (e.g., Dudás et al. 1999, Pfander and Schmigalew 2001, Clark 43
and Witt 2006, Hull et al. 2007a, Corso and Gildi 2007, Gjershaug 2010), often resulting in 44
individuals with intermediate characteristics. 45
Presently, we examine a specimen that appears intermediate in physical characteristics between 46
Red-tailed Hawk (B. jamaicensis) and Red-shouldered Hawk (B. lineatus), a hybrid combination 47
not previously noted in the peer-reviewed literature. This specimen provides an opportunity to 48
more closely examine hybridization using morphological and genetic data of two mobile, wide-49
ranging species in North America.. The specimen had been described previously as a vagrant 50
eastern Red-shouldered Hawk (B. l. lineatus) in California (Pyle et al. 2004); however, the 51
possibility of hybrid status was not examined quantitatively, and no molecular data were used. 52
We re-evaluated the findings of Pyle et al. (2004) for two reasons: (1) Many of the plumage 53
markings and morphological characteristics appear to be intermediate between Red-shouldered 54
and Red-tailed and (2) several recent records of hybrids between Buteo species suggest that 55
Unusual Cal RS
4
hybridization is occurring regularly in the genus; therefore, understanding the circumstances 56
where hybridization occurs can illuminate the ongoing evolutionary processes within this genus. 57
METHODS 58
We examined the plumage patterns and colors of 76 specimens of adult eastern and western 59
Red-shouldered Hawks in nine museums (Appendix 1). We scored the following characters: 60
malar and throat color, color and markings of the remiges and upper tail coverts, color of the 61
lesser upper wing coverts, and the number of white tail bands. We compared these characters to 62
those of the putative hybrid (WFB 4816). 63
We measured the wing chord, exposed culmen length, hallux chord, tarsus length, and standard 64
tail length of adult specimens of three taxa: western Red-tailed Hawks (B. j. calurus) from 65
California (n=23), Red-shouldered Hawks from California (B. l. elegans; N=33), and eastern 66
North America (B. l. lineatus; N=46), respectively. We centered and scaled the variables prior to 67
conducting a principle components analysis (PCA) using the command prcomp in the stats 68
package in R (http://www.r-project.org/). Individual measurements are shown in Appendix 1. 69
We extracted DNA from a toepad sample of WFB4816 using a modified Qiagen DNeasy kit 70
protocol by adding 30 ul 100mg/ml DTT (dithiothreitol) to the proteinase K digestion and eluting 71
the sample in 50 μl instead of the standard 200 μl. A negative control was included during the 72
extraction process. We designed primers that amplify a 191 bp fragment of the mitochondrial 73
gene ND2 (buteoND2F: CTGAACAAAATCCCCCACAC; buteoND2R: 74
CGAGGCGGAGGTAGAAGAAT), and PCR amplified this fragment using 45 cycles of 94° for 75
30 s, 50° annealing for 30 s, and 72° extension for 1 minute. We Sanger-sequenced this PCR 76
product on an ABI 3130 machine. 77
Unusual Cal RS
5
Extracted DNA was amplified and genotyped at 18 microsatellite loci (A110, A302, A303, 78
B111a, B220, B221, D107, D122, D123, D127, D207, D220, D223, D234, D235, D310, D327, 79
D330) in six multiplex PCRs following the conditions described in Hull et al. (2007b). PCR 80
products were separated with a 3730 DNA Analyzer (Applied Biosystems Inc.), and then scored 81
using STRAND version 2.3.89 (Toonen and Hughes 2001). For comparison, we obtained 82
genotypes from these loci for eastern and western Red-shouldered Hawks and Red-tailed Hawks 83
from previous population genetic studies of these species (Hull et al. 2008a, Hull et al. 2008b). 84
85
To visualize the genetic relationship of the possible hybrid specimen with eastern Red-86
shouldered Hawks and Red-tailed Hawks, we performed a factorial correspondence analysis 87
(FCA) (GENETIX 4.05.2; Belkhir et al. 2000). The FCA clustered genotypic groups based on 88
microsatellite allele frequencies using the ordination of samples along varying factorial axes to 89
visualize genetic similarity of the samples in two-dimensional space. In this analysis, a hybrid 90
individual would be indicated by its intermediate location in the FCA between the genotypic 91
groups for Red-shouldered and Red-tailed Hawks. 92
93
We also investigated the ancestry of the museum specimen through assignment tests using a 94
Bayesian clustering algorithm (STRUCTURE version 2.1; Pritchard et al. 2000). This analysis 95
was first performed comparing the museum specimen with a combined eastern and western 96
sample of Red-shouldered Hawks and a sample of Red-tailed Hawks. Subsequently, we 97
performed a second analysis comparing the museum specimen to separate eastern Red-98
shouldered hawks and western Red-shouldered Hawks. No Red-tailed Hawks were included in 99
the second test. For both analyses we used the population admixture model with a population 100
Unusual Cal RS
6
prior corresponding to either species (test 1) or sampling location (test 2) and assumed that allele 101
frequencies were correlated among populations. We ran the simulation with a 10,000 iteration 102
burn-in and a run length of 100,000 iterations. We limited the analysis to K = 2 (where K is the 103
number of populations) because of our prior knowledge of the species and geographic origin of 104
the samples. We then generated Q plots to visualize proportion of ancestry for the museum 105
specimen in relationship to possible populations of origin. 106
107
RESULTS 108
The putative hybrid specimen (WFB 4816) differed in plumage from all adult Red-shouldered 109
Hawks, and, specifically, from adult eastern ones. Plumage differences are summarized in Table 110
1. Figure 1A shows that the putative hybrid has a dark throat, as compared to a typical adult Red-111
shouldered, all of which have a pale throat and dark malar stripes. The putative hybrid also 112
shows dark brown barring on the belly, a feature not shown on any adult Red-shouldered Hawk. 113
Figure 1B shows that the putative hybrid has six or seven narrower white tail bands, compared to 114
adult Red-shouldered Hawks, which usually have three or four wider bands (but a few had five 115
bands). The tail bands and upper tail coverts on the putative hybrid show rufous tinges that are 116
not seen on any adult Red-shouldered Hawk. Figure 1C shows the lack of white spotting on the 117
uppersides of the remiges of the putative hybrid, whereas adult Red-shouldered Hawks always 118
show numerous white spots. The lack of rufous on the lesser upper wing coverts of the putative 119
hybrid is another characteristic that is inconsistent with Red-shouldered Hawk (shoulder; Fig 3). 120
The largest hallux measurement on any adult eastern Red-shouldered Hawk was 23.9 mm 121
(range 18.4-23.9 mm, n=46), which was smaller than that of the putative hybrid specimen, 25.1 122
mm. 123
Unusual Cal RS
7
The PCA analysis of morphological measurements showed that eastern and western Red-124
shouldered Hawks each formed distinct clusters, but with some overlap. Red-tailed Hawks 125
formed a separate, discrete cluster. The putative hybrid specimen fell outside of the ranges of 126
measurement of any of the three taxa in our PCA (Figure 2). Although it was closest to eastern 127
Red-shouldered Hawks, it was also outside of the range of variation observed in other eastern 128
Red-shouldered Hawks, and it was in between the centroids of California Red-shouldered Hawks 129
and California Red-tailed Hawks on the PC1 axis, which explained 80.5% of the variance. 130
We successfully sequenced the complete 191 bp ND2 fragment of specimen WFB4816 131
(GenBank accession number: KX154215). An NCBI BLAST search revealed that the sequence 132
has 100% sequence identity to Red-shouldered Hawk (EU583276.1) and 99% similarity to two 133
additional Red-shouldered Hawk sequences (GQ264875.1, GQ264874.1). All Red-tailed Hawk 134
ND2 sequences on GenBank differ from WFB4816 by at least 7 substitutions in the sequenced 135
fragment (96% similarity). 136
Mitochondrial DNA (mtDNA) showed that the putative hybrid matches Red-shouldered Hawk, 137
providing decisive evidence that its mother was a Red-shouldered Hawk. However, the mtDNA 138
haplotype that we recovered was shared between eastern and western North American 139
populations of Red-shouldered Hawk. 140
The factorial correspondence analysis showed distinct clusters of individuals corresponding to 141
Red-tailed Hawks and Red-shouldered hawks in the comparison between these species (Fig. 3A) 142
with WFB 4816 grouping within the Red-shouldered hawk cluster. In the second factorial 143
correspondence analysis, we found two clusters corresponding to eastern and western Red-144
Unusual Cal RS
8
shouldered Hawks with an area of overlap between the two (Fig. 3B). In this second analysis 145
WFB 4816 grouped within the eastern Red-shouldered Hawk cluster. 146
The Bayesian clustering analysis revealed a similar pattern to that seen in the factorial 147
correspondence analysis. In the first analysis when K was set to 2 we found two distinct groups 148
with very high proportions of ancestry corresponding to either Red-tailed Hawks or Red-149
shouldered Hawks (Fig. 4A). In this analysis, WFB 4816 showed ancestry solely from Red-150
shouldered Hawks. In the second analysis, K = 2 corresponded to groupings of eastern and 151
western Red-shouldered Hawks with low levels of admixture between the two groups (Fig. 4B). 152
In this case, WFB 4816 showed a high proportion of ancestry derived from eastern Red-153
shouldered Hawks. 154
DISCUSSION 155
The mtDNA and nuDNA data that we analyzed definitively identified this specimen as a Red-156
shouldered Hawk. The microsatellite data suggests that it was most likely of eastern origin, 157
consistent with the original conclusion of Pyle et al. (2004). Records of eastern Red-shouldered 158
Hawks outside of their eastern range, though rare, have been recorded previously, including a 159
specimen that was salvaged in Albuquerque, New Mexico, in 1991 (MSB:Bird:8174). 160
The morphometric measurements and plumage comparison that we present here appeared to 161
comprise compelling evidence that WFB 4816 represents a hybrid between a Red-tailed Hawk 162
and Red-shouldered Hawk. F1 hybrids are typically intermediate in size and plumage between 163
the parental species (Rohwer 1994). The fact that this adult was larger than any of 46 eastern 164
Red-shouldered Hawks that we measured appears to conflict with the conclusion of Pyle et al. 165
(2004) that the specimen represented an eastern vagrant. Furthermore, its combination of 166
Unusual Cal RS
9
plumage markings is unknown from any other specimen we examined and resembles an 167
amalgamation of characteristics from both species. 168
This case illustrates that anomalous plumage markings or size measurements that are 169
intermediate between two species do not always result from hybridization. Although we cannot 170
rule out that Red-tailed Hawk alleles may have contributed to the intermediate phenotype of 171
WFB 4816, the microsatellite data do not show any evidence of mixed ancestry. Pyle et al. 172
(2004) described this specimen as an eastern Red-shouldered Hawk and reported it as the first 173
definitive record of an eastern Red-shouldered Hawk in California, our results support this 174
conclusion. We conclude the anomalous phenotype of this bird was most likely the result of a 175
rare genetic mutation, congenital abnormality, or unusual epigenetic interaction. Future 176
diagnoses of hybrid or subspecies status should consider these possibilities. 177
This specimen is not the only suspected hybrid between Red-tailed Hawks and Red-shouldered 178
Hawks. Photographs of a similar adult from Connecticut have been posted on-line (Connecticut 179
Audubon Society blog, January 6, 2011). Additional Buteo hybrids include those reported by 180
Clark and Witt (2006), a hybrid specimen of Rough-legged (B. lagopus) x Swainson’s (B. 181
swainsoni) Hawks, and Hull et al. (2007) on several cases of hybrids between Red-tailed and 182
Swainson’s Hawks. Both of these papers also used DNA, plumages, and morphometrics to 183
determine hybridization. We have examined unpublished photographs of two adults that show 184
characters of two species, one of Red-tailed and Ferruginous (B. regalis) Hawks and the other of 185
Red-tailed and Rough-legged Hawks. Four further hybridizations between two species of Buteo 186
have been reported from Eurasia—Rough-legged x Common (B. buteo) Buzzards (Gjershaug et 187
al. 2010), Long-legged x Common Buzzards (Dudás et al. 1999, Corso 2007) , and Long-legged 188
x Upland (B. hemilasius) Buzzards (Pfander and Schmigalew. 2001). Clark et al. (2005) report 189
Unusual Cal RS
10
on four instances of hybrids, three between species in Buteo, but also an intergeneric case of 190
Swainson’s Hawk male and Red-backed Buzzard (Geranoaetus polyosoma) in Colorado. The 191
provenance of the latter was never determined (Allen 1998). The most phylogenetically distant 192
hybrid pairing involving a Buteo is that reported by Corso and Gildi (1998) from Italy of a 193
Common Buzzard mated with a Black Kite (Milvus migrans) that produced two fledglings. 194
Although hybridization occurs regularly but at low levels within Buteo, there appears to be no 195
evidence of extensive introgression that may destabilize species boundaries. However, low levels 196
of hybridization may result in reciprocal exchange of novel genes between otherwise stable 197
species if resultant offspring can successfully backcross. In such cases, novel genes may cause 198
evolutionary change if the novel genes result a selective advantage to the recipient species. 199
Continued examination of atypical museum specimens in combination with genomic analyses 200
may provide an opportunity to test whether genetic introgression has resulted from the rare 201
occasions of hybridization. 202
ACKNOWLEDGEMENTS 203
We would like to thank the American Museum of Natural History, the Museum of Southwestern 204
Biology of the University of New Mexico, the Western Foundation of Vertebrate Zoology, and 205
the Museum of Wildlife and Fish Biology of the University of California-Davis for making their 206
collections open to our study. Funding was provided in part by NSF DEB-1146491 and NSF 205 207
GRF 1148897. 208
209
LITERATURE CITED 210
Unusual Cal RS
11
ABBOTT, R., ALBACH, D., ANSELL, S., ARNTZEN, J.W., BAIRD, S.J.E., BIERNE, N., 211
BOUGHMAN, J., BRELSFORD, A., BUERKLE, C.A., BUGGS, R. and BUTLIN, R.K., 212
2013. Hybridization and speciation. Journal of Evolutionary Biology 26:229-246. 213
ALLEN, S. 1988. Some thoughts on the identification of Gunnison’s Red-backed Hawk (Buteo 214
polyosoma) and why it’s not a natural vagrant. Journal of the Colorado Field 215
Ornithologists 22:9–14. 216
ALLENDORF, F. W., LEARY, R. F., SPRUELL, P., and WENBURG, J. K. 2001. The 217
problems with hybrids: setting conservation guidelines. Trends in Ecology and Evolution 218
16: 613-622. 219
BELKHIR, K., BORSA, P., CHIKHI, L., RAUFASTE, N., and BONHOMME, F. 1996–2001. 220
GENETIX 4.02, logiciel sous Windows TM pour la génétique des populations, 221
Laboratoire Génome, Populations, Interactions; CNRS UMR 5000; Université 222
Montpellier II, Montpellier, France. 223
.CLARK, W. S., M. REID, and B. K. WHEELER. 2005. Four cases of hybridization in North 224
American Buteos. Birding 37:256-263. 225
CLARK, W. S., and C. C. WITT. 2006. First known specimen of a hybrid Buteo: Swainson’s 226
Hawk (Buteo swainsoni) x Rough-legged Hawk (B. lagopus) from Louisiana. Wilson 227
Journal of Ornithology 118:42-52. 228
CORSO, A. and GILDI, R. 1998. Hybrids between Black Kite and Common Buzzard in Italy in 229
1996. Dutch Birding 20: 226–233 230
Unusual Cal RS
12
DUDÁS, M., J. TAR, and I. TÓTH. 1999. [Natural hybridization of Long-legged Buzzard 231
(Buteo rufinus) and Common Buzzard (B. buteo) in the Hortobagy National Park.] In 232
Hungarian. Ölyvek,, keveredése”. Temészet, 5-6:8-10. 233
FRANKHAM, R. 2015. Genetic rescue of small inbred populations: a meta-analysis reveals 234
large and consistent benefits of gene flow. Molecular Ecology 24: 2610-2618. 235
GJERSHAUG, J. O., O. A. FORSET, K. WOLDVIK and Y. ESPMARK. 2010. Hybridisation 236
between Common Buzzard Buteo buteo and Rough-legged Buzzard B. lagopus in 237
Norway. Bull. B.O.C. 2006 126(1):73-80. 238
HULL, J. M., W. SAVAGE, J. P. SMITH, N. MURPHY, L. CULLEN, A. C. HUTCHINS, and 239
H. B. ERNEST. 2007. Hybridization among Buteos: Swainson’s Hawks (Buteo 240
swainsoni) X Red-tailed Hawks (Buteo Jamaicensis). The Wilson Journal of Ornithology 241
119(4):579–584. 242
MALLET, J. 2005. Hybridization as an invasion of the genome. Trends in Ecology and 243
Evolution 20: 229-237. 244
PFANDER, P. and S. SCHMIGALEW. 2001. [Extensive hybridization of Long-legged Buzzard 245
Buteo rufinus and Upland Buzzard B. hemilasius.] In German. Ornithologische 246
Mitteilung 53:344-349. 247
PRITCHARD J,. K, STEPHENS, and M, DONNELLY. 2000. Inference of population structure 248
using multilocus genotype data. Genetics, 155, 945-959. 249
.PYLE, P., A. ENGILIS, JR., and T. G. MOORE. 2004. A specimen of the nominate subspecies 250
of the Red-shouldered Hawk from California. Western Birds 35:100-104. 251
Unusual Cal RS
13
RHEINDT, F. E., and S. V. EDWARDS. 2011. Genetic introgression: an integral but neglected 252
component of speciation in birds. Auk 128:620-632. 253
RIESING, J. M., L. KRUCKENHAUSER, A. GAMAUF, AND E. HARING. 2003. Molecular 254
phylogeny of the genus Buteo (Aves: Accipitridae) based on mitochondrial marker 255
sequences, Molecular Phylogenetics and Evolution 27(2):328-342. 256
ROHWER, S. 1994. Two new hybrid Dendroica warblers and new methodology for inferring 257
parental species. Auk 111:441–449. 258
SEEHAUSEN, O. 2004. Hybridization and adaptive radiation. Trends in Ecology and Evolution 259
19: 198-207. 260
TOONEN RJ, and S. HUGHS. 2006. Increased throughput for fragment analysis on an ABI 261
PRISM (R) 377 automated sequencer using a membrane comb and STRAN software. 262
BioTechniques, 31, 1320-1439.263
Unusual Cal RS
14
264
265
266
Figure 1. Comparison of adult Eastern Red-shouldered Hawk (r) with WFB 4816 (l). A. 267
Undersides. Note dark throat and dark belly markings of WFB 4816. B. Upper tails. Note six 268
tail bands of WFB 4816. C. Upper wings. Note lack of white spotting on upper wings of WFB 269
4816. 270
271
272
Unusual Cal RS
15
273
274
275
276
−1
0
1
−2 0 2 4
PC1 (80.5% explained var.)
PC
2 (
9.7
% e
xpla
ine
d v
ar.)
B. j. calurus B. l. elegans B. lineatus, eastern subspp. Putative hybrid, WFB 4816
277
Figure 2. Plot of the first two principle components based on the PCA of five measurements 278
from 103 adult eastern Red-shouldered Hawks (B. lineatus subspp.), California Red-shouldered 279
Hawks (B. l. elegans), and western Red-tailed Hawks (B. j. calurus) representing both sexes 280
showing that the putative hybrid is intermediate in its morphometric measurements between Red-281
shouldered Hawk and Red-tailed Hawk. 282
283
Unusual Cal RS
16
284
Figure 3. Results of the principle components analysis of 18 microsatellite loci for WFB 285
4816 (yellow circles) compared to (A) eastern and western Red-shouldered Hawks, and (B) 286
eastern and western Red-shouldered Hawks and western Red-tailed Hawks287
Figure 4. Results of Bayesian clustering analysis of 18 microsatellite loci for (A) Red-tailed Hawks, eastern and western Red-
shouldered Hawks, and WFB 4816 and (B) eastern and western Red-shouldered Hawks and WFB 4816. Figure 4A compares
the proportion of ancestry for each individual for K=2 with one population composed of Red-shouldered Hawks (indicated in
green) and on population of Red-tailed Hawks (indicated in red). Figure 4B compares the proportion of ancestry for each
individual for K=2 with one population composed of eastern Red-shouldered Hawks (indicated in green) and one population
composed of western Red-shouldered Hawks (indicated in red); note that one of the Red-shouldered Hawks sampled in
California appears to have mixed eastern and western ancestry. WFB 4816 is at the left of each figure and outlined in a dashed
line. In figure 4A WFB 4816 shows a high proportion of Red-shouldered Hawk ancestry and in Figure 4B WFB 4816 ii further
indicated as having primarily eastern Red-shouldered Hawk ancestry.
Unusual Cal RS
18
Table 1. Comparison of plumage characters and hallux with putative hybrid specimen with specimens of adult eastern and
western Red-shouldered Hawks and western Red-tailed Hawks.
Character WFB 4816 Adult East & West RS’s Adult West RT’s Figure no.
Malar & throat Uniformly dark Darker malars; paler throat, often Dark or dark with pale streaks 1 with dark streaks
Belly barring Dark brown, with short Rufous Dark brown with short dark 1 dark streaks streaks Uppersides of remiges Gray barring, no white Gray barring with white spots Dark brown. No white on 3 on primaries across primaries primaries Remige tips Narrow gray tips Wide white tips Dark tips 3 Lesser upper wing Dark brown with no Show rufous ‘shoulders’ Dark brown 3 coverts rufous Upper tail coverts Dark brown with rufous Dark brown with white barring Rufous with dark brown barring 3 and white barring only No. of tail bands 6 (or 7) 4 or fewer (five had 5 bands) No pale bands 2 Tail band color White with rufous tint White only, no rufous No pale bands 2
__________________________________________________________________________
Unusual Cal RS
19
Appendix 1. Morphometric data used in the PCA. Museum acronyms in specimen identifiers include AMNH (American Museum of Natural History), MSB (Museum of Southwestern Biology of the University of New Mexico), WFVZ (Western Foundation of Vertebrate Zoology), and WFB (Museum of Wildlife and Fish Biology of the University of California-Davis).
Specimen Taxon Sex Wing chord
(mm) Culmen
(mm) Tarsus
(mm) Hallux
(mm) Tail
(mm) State or
Province WFVZ:Bird:20607 B. j. calurus f 408 27 89.5 27.4 206 CA WFVZ:Bird:32972 B. j. calurus f 419 27.5 97.5 30.4 229 CA WFVZ:Bird:36209 B. j. calurus f 400 26.9 99.6 29.7 217 CA WFVZ:Bird:39 B. j. calurus f 394 25.7 90.9 28.9 221 CA WFVZ:Bird:53726 B. j. calurus f 407 27.8 96.2 28.8 222 CA WFVZ:Bird:53990 B. j. calurus f 419 23.6 101.5 27.7 225 CA WFVZ:Bird:54010 B. j. calurus f 428 24.5 108.6 29.8 230 CA WFVZ:Bird:57218 B. j. calurus f 403 25.7 98.5 28.4 220 CA WFVZ:Bird:5846 B. j. calurus f 404 26.5 90.2 27.5 217 CA WFVZ:Bird:6000 B. j. calurus f 419 26.3 90.5 29.4 221 CA WFVZ:Bird:6337 B. j. calurus f 401 24.2 96.8 28.5 223 CA WFVZ:Bird:705 B. j. calurus f 417 26.7 91.4 30.2 218 CA WFVZ:Bird:20579 B. j. calurus m 377 23.6 95.5 28.3 215 CA WFVZ:Bird:32565 B. j. calurus m 387 24.2 95.8 27.6 203 CA WFVZ:Bird:32936 B. j. calurus m 391 24.2 95.2 27.2 217 CA WFVZ:Bird:37106 B. j. calurus m 365 25.5 92.8 26.6 199 CA WFVZ:Bird:43362 B. j. calurus m 385 24.9 90.6 27.4 202 CA WFVZ:Bird:45305 B. j. calurus m 396 24.2 91.8 27.3 198 CA WFVZ:Bird:53764 B. j. calurus m 397 26.3 95.3 29.8 196 CA WFVZ:Bird:56775 B. j. calurus m 373 24.2 93.3 28.8 194 CA WFVZ:Bird:6517 B. j. calurus m 369 23.3 90.3 27.3 204 CA WFVZ:Bird:6642 B. j. calurus m 394 24.3 95.1 27.4 212 CA WFVZ:Bird:6711 B. j. calurus m 385 23.9 94.3 28.3 202 CA WFVZ:Bird:154 B. l. elegans f 317 20.4 84.2 22.8 193 CA WFVZ:Bird:31 B. l. elegans f 314 20.9 81 22.7 199 CA WFVZ:Bird:44650 B. l. elegans f 307 21.2 84 20.6 191 CA
Unusual Cal RS
20
WFVZ:Bird:44651 B. l. elegans f 320 22.4 86.1 26.2 194 CA WFVZ:Bird:52711 B. l. elegans f 318 21 84.2 22.7 189 CA WFVZ:Bird:53466 B. l. elegans f 307 20.7 85.8 20.7 193 CA WFVZ:Bird:53525 B. l. elegans f 296 21.7 84.3 22.3 190 CA WFVZ:Bird:53751 B. l. elegans f 289 20.1 77.5 20.5 182 CA WFVZ:Bird:53752 B. l. elegans f 310 20.7 81.6 22.6 192 CA WFVZ:Bird:54013 B. l. elegans f 321 21.3 85.4 21.7 209 CA WFVZ:Bird:56778 B. l. elegans f 300 22.2 86.8 22.5 182 CA WFVZ:Bird:56964 B. l. elegans f 311 20 79 21.4 192 CA WFVZ:Bird:5985 B. l. elegans f 312 23.2 82 23 202 CA WFVZ:Bird:6156 B. l. elegans f 314 21.3 80.7 22.7 196 CA WFVZ:Bird:6274 B. l. elegans f 310 25 85.4 23 203 CA WFVZ:Bird:710 B. l. elegans f 301 22.6 82.3 22.2 186 CA MSB:Bird:25344 B. l. elegans m 293 19.56 78.53 21.17 208 CA WFVZ:Bird:29384 B. l. elegans m 291 20.2 78.6 22.8 180 CA WFVZ:Bird:32971 B. l. elegans m 300 19.7 85 18.2 173 CA WFVZ:Bird:3949 B. l. elegans m 302 20.3 84.8 23.1 191 CA WFVZ:Bird:42145 B. l. elegans m 283 20 82.6 19.9 172 CA WFVZ:Bird:43374 B. l. elegans m 297 17.8 77.2 19 176 CA WFVZ:Bird:45273 B. l. elegans m 278 20.8 82.3 20.2 177 CA WFVZ:Bird:5038 B. l. elegans m 292 20.6 78.5 18.8 180 CA WFVZ:Bird:52712 B. l. elegans m 296 19.2 79.7 21.5 181 CA WFVZ:Bird:53484 B. l. elegans m 292 18.2 76.4 17.8 173 CA WFVZ:Bird:56777 B. l. elegans m 289 20.5 80.5 20.2 187 CA WFVZ:Bird:5835 B. l. elegans m 287 19 76.5 19.2 173 CA WFVZ:Bird:5845 B. l. elegans m 292 19.4 81.1 20.3 172 CA WFVZ:Bird:5921 B. l. elegans m 286 19.5 77.3 21.3 184 CA WFVZ:Bird:5933 B. l. elegans m 278 20.8 83 21.4 168 CA WFVZ:Bird:6241 B. l. elegans m 302 18.9 81.5 20.1 181 CA WFVZ:Bird:6519 B. l. elegans m 280 18.5 78.7 20.2 185 CA AMNH:Bird:168613 B. lineatus (eastern) f 352 24.42 80.85 22.92 211 NY AMNH:Bird:352521 B. lineatus (eastern) f 354 24.44 79.23 23.86 204.13 IA AMNH:Bird:352553 B. lineatus (eastern) f 355 23.95 81.13 23.18 208.8 NH AMNH:Bird:352559 B. lineatus (eastern) f 347 22.71 80.8 22.81 199.56 ON
Unusual Cal RS
21
AMNH:Bird:470684 B. lineatus (eastern) f 358 22.94 80.46 21.45 208.6 ON AMNH:Bird:69780 B. lineatus (eastern) f 359 20.24 85.4 23.9 198.45 NJ AMNH:Bird:69781 B. lineatus (eastern) f 346 22.06 81.04 22.25 213 MD AMNH:Bird:750225 B. lineatus (eastern) f 355 21.31 75.5 21.6 208.8 CT AMNH:Bird:832602 B. lineatus (eastern) f 359 23.4 84.3 23.25 211 RI AMNH:Bird:96626 B. lineatus (eastern) f 328 20 74.66 21.66 200.67 NY MSB:Bird:24325 B. lineatus (eastern) f 321 21.5 74.45 20.89 194 LA MSB:Bird:24885 B. lineatus (eastern) f 307 22.22 77.14 21.81 185 FL MSB:Bird:4291 B. lineatus (eastern) f 352 22.55 76.81 22.78 211 IA WFVZ:Bird:20446 B. lineatus (eastern) f 340 21.5 84.9 21.7 200 PA WFVZ:Bird:20447 B. lineatus (eastern) f 350 21.1 82.5 21.8 203 GA WFVZ:Bird:20464 B. lineatus (eastern) f 335 22.2 84.6 23.1 195 GA WFVZ:Bird:20472 B. lineatus (eastern) f 325 20.7 84.7 19.5 207 NJ WFVZ:Bird:20476 B. lineatus (eastern) f 345 21.9 84 21.5 209 MD WFVZ:Bird:20477 B. lineatus (eastern) f 341 20.1 86.8 20.7 213 NJ WFVZ:Bird:20481 B. lineatus (eastern) f 343 20.6 84.9 22.3 205 PA WFVZ:Bird:20483 B. lineatus (eastern) f 327 19.7 81.7 21.1 204 PA WFVZ:Bird:20490 B. lineatus (eastern) f 337 21.3 84.8 19.2 181 FL WFVZ:Bird:47830 B. lineatus (eastern) f 350 22.9 81.9 22.7 214 NC WFVZ:Bird:49754 B. lineatus (eastern) f 324 20 84.2 22.2 197 TX AMNH:Bird:234136 B. lineatus (eastern) m 316 20.22 75.81 20.43 188.47 ON AMNH:Bird:352520 B. lineatus (eastern) m 339 20.24 80.71 20.79 200.19 IA AMNH:Bird:352526 B. lineatus (eastern) m 346 21.14 82.17 20.11 194.75 MO AMNH:Bird:352531 B. lineatus (eastern) m 335 22.45 77.9 20.72 195.57 NJ AMNH:Bird:352535 B. lineatus (eastern) m 333 22.82 79.21 21.27 184.32 NY AMNH:Bird:470683 B. lineatus (eastern) m 330 19.69 73.18 20.41 202.38 ON AMNH:Bird:832603 B. lineatus (eastern) m 324 21.74 79.52 21.11 193.77 MA AMNH:Bird:832604 B. lineatus (eastern) m 337 21.71 80.14 20.91 200.7 RI AMNH:Bird:836423 B. lineatus (eastern) m 341 19.91 74 20.38 195.24 RI AMNH:Bird:98112 B. lineatus (eastern) m 334 21.11 77.29 21.67 197 MA MSB:Bird:21684 B. lineatus (eastern) m 306 19.57 73.52 21.63 207 TX WFVZ:Bird:20461 B. lineatus (eastern) m 321 19.5 83.1 22.2 194 PA WFVZ:Bird:20465 B. lineatus (eastern) m 329 19.1 79.2 21 183 NJ WFVZ:Bird:20470 B. lineatus (eastern) m 310 20 79.8 19.8 185 GA
Unusual Cal RS
22
WFVZ:Bird:20471 B. lineatus (eastern) m 319 20.8 77 18.4 189 GA WFVZ:Bird:20472 B. lineatus (eastern) m 308 18.8 78.5 20.3 184 PA WFVZ:Bird:20473 B. lineatus (eastern) m 323 21.2 84.8 19.9 195 GA WFVZ:Bird:20474 B. lineatus (eastern) m 313 19.5 79 21.9 186 GA WFVZ:Bird:20497 B. lineatus (eastern) m 311 20 75 20 192 GA WFVZ:Bird:20499 B. lineatus (eastern) m 315 19.7 75.9 19.7 185 GA WFVZ:Bird:48010 B. lineatus (eastern) m 302 18.9 78.3 18.4 186 GA WFVZ:Bird:50191 B. lineatus (eastern) m 318 20.2 76.7 21.7 197 TX WFB:Bird:4816 Putative hybrid n/a 350 23.9 83.2 25.12 212 CA