25:(2) fileLaminin-ilişkili salgılanan proteinler olan netrinler filogenetik olarak küçük...

Post on 23-Aug-2019

215 views 0 download

Transcript of 25:(2) fileLaminin-ilişkili salgılanan proteinler olan netrinler filogenetik olarak küçük...

J.Neurol.Sci.[Turk]

Journal of Neurological Sciences [Turkish] 25:(2)# 15;105-116, 2008 http://www.jns.dergisi.org/text.php3?id=220

Research Article

Cloning and Characterization of a Human Novel Gene netrin-G2 Ye XIANGLI1, Lei LIFANG2

1Hunan Normal University, College of Medicine, Changsha, Çin 2Central South University ,

Xiangya 3 Hospital , Changsha, Çin

Abstract

The Netrins is one of a small phylogenetically conserved family members which are laminin- related secreted proteins. The Netrins play a critical role in cell migration and axon guidance. Its homologues have been widely described in various animals. Netrins can be subdivided into two subfamilies, classical Netrins and Netrin-Gs. Since the members of Netrin-G subfamily exhibit a high degree of similarity and there is only one member, Netrin-G1, identified in human, it is presumed that there must be new members in human too.

In this paper the total RNA in brains was extracted from 20 weeks human embryos, and the cDNA Library was constructed by using a cDNA PCR Library Kit. A full-length human netrin-G cDNA, named netrin-G2, was generated by using special primers and PCRs. Finally, a primary study about the expression of human netrin-G2 was carried out by northern blot analysis and a research about the relationship between human Netrin-G2 and other Netrins family members was determined by phylogenetic tree analysis. Human netrin-G2 was indeed a new member of netrin-G subfamily, which mapped to chromosome 9q34. The final assembled cDNA sequence of human netrin-G2 was 2428 bps in length, which could encoding a 530-amino acid protein. Northern blot analysis revealed that netrin-G2 expressed specifically in brain and seldom in other tissues.

These results suggested that netrin-G2 might play an important role in the development of central nervous system and might contribute to excitatory neurotransmission and neural modulation.

Keywords: Netrin-G, netrins, cDNA, GPI, Brain, axon guidance

İnsan Yeni Netrin-G2 Geninin Klonlanması ve Özellikleri

Özet

Laminin-ilişkili salgılanan proteinler olan netrinler filogenetik olarak küçük korunmuş bir familyanın üyelerinden biridir. Netrinler hücre göçünde ve aksona yol göstermede kritik bir görev üstlenirler. Homologları birçok hayvanda geniş olarak tanımlanmıştır. Netrinler iki ana alt gruba ayrılır: Klasik netrinler ve Netrin-Gler. Netrin-G alt grubunda sadece Netrin-G1 insanda tanımlanmıştır ve bu alt grupta daha başka örneklerin bulunması gerektiği varsayılmaktadır.

Bu makalede 20 haftalık insan embryosundan ayrıştırılan beyinlerdeki total RNA ve cDNA Library bir cDNA Library kiti kullanılarak kuruldu. İnsan netrin-G cDNA özel primerler ve PCRlar kullanılarak tüm uzunlukta oluşturuldu ve buna netrin-G2 dendi. Son olarak insan Netrin-G2 yapılanması ile ilgili ilk çalışma northern blot ile yapıldı ve filogenetik ağaç analizi kullanılarak insan Netrin-G2 ve diğer familya üyeleri ile karşılaştırmalı bir araştırma gerçekleştirildi. İnsan netrin-G2nin yeni bir netrin-G altfamilya üyesi olduğu ortaya kondu ve kromozom 9q34e haritalandı. Netrin-G2 geninin en son düzenlenen cDNA sekansı 2428 bps

105

J.Neurol.Sci.[Turk]

uzunluğunda ve 530 amino asid proteini içerdiği gözlendi. Northern blot analizi Netrin-G2nin özellikle beyinde ve nadiren de diğer dokularda bulunduğunu gösterdi.

Bu sonuçlar netrin-G2 nin santral sinir sistemi gelişiminde önemli bir rolü olabileciğini, eksitatuvar nörotransmisyon ve nöral modülasyonda yer alabileceğini göstermektedir.

Anahtar Kelimeler: Netrin-G, netrinler, cDNA, GPI, Beyin, akson yolgösterici INTRODUCTION

The nervous system is an elaborate network of neuronal connections that is generated during development. Embryologic experiments in both vertebrates and invertebrates demonstrate that developing axons are guided to their intermediate or final targets by the interactions of some protein signaling molecules and their cell membrane receptors. These proteins act as short-range and long-range cues for growth cones, among which the Netrins, a small phylogenetically conserved family of laminin- related secreted proteins, play a critical role in axon outgrowth and cell migration.

Homologus of netrins have been wildly described in both vertebrates and invertebrates. UNC-6 has been found in C. elegans which was the first discovered member of the netrin family. Subsequently, netrin A and netin B were described in Drosophila. In vertebrates, netrin-1 has been identified in chickens, mouse, Xenopus, zebrafish, and humans; netrin-1a in zebrafish; netrin-2 (NTN2L) in chickens and humans; netrin-3 in mouse; netrin-4/β-netrin in mouse and humans; netrin-G1 in mouse and humans; and netrin-G2 in mouse and monkey(1,7,9,10,14,15,18,20) All of them are structurally related to the laminin chains (α, β, or γ chains), containing a laminin � domain (LamNT domain) and three EGF-like repeats (LE domain) similar to the laminin V domain (V-1, V-2 and V-3). Recently studies demonstrated that the Netrins could be subdivided into two subfamilies, classical Netrins and Netrin-Gs. Classical Netrins act as attractive and repulsive cues which guide the axon outgrowth via their interactions

with cell receptors(3,4,5). Genetic analyses suggest that the Netrins signal is transduced by two distinct receptor subfamilies, the DCC subfamily and UNC-5 homologs(2,6,7,8,14,19). Members of Netrin-G subfamily are functionally divergent from classical Netrins, for they are linked to the plasma membrane by a glycosyl phosphatidylinositol (GPI) lipid anchor and don't bind to any of the Netrin receptors mentioned above(19,21).

The mRNAs of classical netrins are mostly located in the developing nervous system, but they are also detectable in non-nervous tissue. For example, netrin-1 is strongly expressed in mouse developing spinal cord and many human adult tissues, including brain, heart, ovary and thymus(9,12). However, netrin-Gs are predominantly expressed in the brain. For example, mouse netrin-G1 and mouse netrin-G2 are specifically expressed in the brain, but only weakly expressed in lung and spleen. In vitro, immobilized recombinant netrin-G1 or netrin-G2 can cause extension of thalamic and neocortical neurons(13,16). Thus, members of Netrin-G subfamily probably provide short-range cues for neurite outgrowth. Because the domain V of human netrin-G1 and mouse netrin-G1 exhibit a high degree of similarity (98.4% identity) and mouse netrin-G2 exhibits 56% identity to both human and mouse netrin-G1, both netrin-G1 and netrin-G2 must be members of the netrin-G subfamily.

Since the members of Netrin-G subfamily exhibit a high degree of similarity and there is only one member, Netrin-G1, identified in human, it is presumed that there must be new members in human too.

106

J.Neurol.Sci.[Turk]

METHODS

Construction of cDNA Library of human embryo brain The total RNA in brains from 20 weeks human embryos was extracted using standard methods, which were pretreated with DNase I (RNase free) to eliminate DNA contamination. mRNA preparation and reverse transcription reaction were performed using a cDNA PCR Library Kit and cDNA Synthesis kit according to manufacturer's protocol. Briefly, 500µg of embryonic brain total RNA was used for preparing mRNA with columns. Reverse transcription reactions were performed with 5µg of embryonic brain mRNA and Oligo dT-RA primer according cDNA Synthesis kit protocol. After Cassette Adaptor Ligation reactions using cDNA PCR Library Kit, cDNA amplification reactions were performed with RA primer, CA primer and Ex Taq.

Isolation of cDNA of Netrin-G2 PCR was performed on a PCRSPRINT reactor with one pair of degenerate oligonucletide primers P1 and P2 corresponding to a highly conserved consensus sequence of members of Netrin-G subfamily (Table 1). Thirty five cycles were carried out in two steps, in which the first five cycles included denaturation at 94º for 4 min, annealing at 50º for 1 min, and extension at 72º for 2 min and the remaining thirty cycles included denaturation at 94º for 30 sec, annealing at 55º for 1 min, and extension at 72º for 2 min. PCR products were subcloned into T vectors and sequenced with 377 DNA Sequencer (ABI PRISMTM). The sequences obtained were subjected to homology searching against expressed sequence tags (ESTs) database using Blast.

Table 1: Oligonucleotide Primers

Primer orientation nucleotide sequence

P1 sense ACSTGYGGAGACCCYCCTGAR

P2 antisense CTGRTAGGGCTGCCAKGT

NRp antisense CCATGCAGTCCTCGGCGT

N5Ros sense CATCACCCTTTCGTGGAACA

N5Roas antisense GTAGCGGCTCCAGGTGATG

N3Ris sense GACGACGTGGTGATGACCTT

N3Rias antisense CCCTCCTCCTCCTTGTCGA

107

J.Neurol.Sci.[Turk]

Full-length cDNA cloning 5'- and 3'- Rapid amplification of cDNA ends (5'- and 3'- RACE) were performed using special primers for the gene that was identified in the EST analysis, and nested PCRs were performed on human embryo brain cDNA to extend the 5' upstream and 3' downstream sequences. cDNA amplification kit was used according to the manufacture's instructions. Briefly, a library of adapter-ligated double-stranded cDNA was constructed using mRNA from brain. The first round of PCR was carried out with mRNA as template. To increase the specificity, PCR samples from the first round were diluted by 1:100 and 1µl of first PCR dilution was used as template in a second round of 5'- and 3'-RACE PCR using the specific RACE antisence primer. These 5'- and 3'-RACE fragments were cloned into T-vectors and sequenced. These putative full-length cDNA sequences were confirmed by PCR amplification with specific primer pairs and the products were subcloned into T-vector and sequenced. Specific primers used for the two genes are listed on Table 1.

Total RNA preparation and membranes making Early human embryos at various development stages (15 to 23 weeks) were obtained from Health Center of ChangSha Women and Children Hospital with appropriate advice and consent. Total RNA was extracted from various tissues of early human embryos at different development stages as described in MOLECULAR CLONE. 20µg samples of each tissue were separated by electrophoresis through formaldehyde-agarose gel. The RNA was then transferred to nylon membranes.

Northern blot containing mRNA from variety of adult tissues were purchased from CLONETECH company.

Northern blot Membranes containing mRNA from a variety of adult tissues and membranes containing total RNA from various embryonic tissues at different developmental stages were hybridized with cDNA probes specific for netrin-G2. These probes were labeled with [α32P] dCTP by using a random primer labeling kit. Northern blot membranes were prehybridized in formamide, 2 x SSC, 1% SDS, 10% dextran-sulfate and 0.1 mg/ml human DNA at 42º for 2 h. Probes were denatured in the same buffer, containing with sheared salmon testis DNA, at 94º for 5 min, placed on ice, added to the blot membranes, and allowed to hybridize for 24 h. Membranes were washed two times in 2 x SSC,1%SDS at 42º and two times in 0.2 x SSC, 1%SDS at 42º. The membranes were then exposed to X-ray films with a intensifying screen at –80º. Gene expression levels were estimated according to the ratio of density of the bands for the specific genes and the band density of a control using β-actin.

Phylogenetic tree analysis Phylogenetic tree analysis of amino acid sequence deduced from netrin-G2 cDNA sequence was performed by using the MegAlign program of DNASTAR. The clustal method was chosen to correct the distances for multiple substitutions at a single site. GeneBank Accession Numbers of previously known netrins and netrin-Gs sequences used for analysis are listed on Table 2.

108

J.Neurol.Sci.[Turk]

Table 2: GeneBank Accession Numbers of netrins and netrin-Gs families

Type Species Gene GeneBank Accession Number

Caenorhabditis elegans

C. elegans UNC-6

P34710

Drosophila netrin-A

Q24567 Drosophila

Drosophila netrin-B

Q24568

Xenopus Xenopus netrin-1 AAB87983 zebrafish netrin-1 AAB70266 zebrafish zebrafish netrin-1a

AAC60252

chick netrin-1 Q90922 chick chick netrin-2 Q90923 mouse netrin-1 AAC52971 mouse mouse netrin-3 AAD40063 human netrin-1 NM004822

Classical netrins subfamily

human human NTN2L NM006181 mouse netrin-G1a

AB038667 mouse

mouse netrin-G2a

AB052336

monkey monkey netrin-G2

XM001104957

human netrin-G1f NP055732

netrin-Gs subfamily

human human netrin-G2 AL353631

RESULTS

Full-length cDNA cloning and sequence analysis of netrin-G2 After aligning the domain VI of known netrin-Gs, degenerate primers (Table.1) were designed using program PRIMER PRIMIER5. We used 17 weeks fetal tissue (obtained from therapeutical abortions performed in the Health Institute of Changsha Women and Children Hospital). A brain cDNA library was generated using the cDNA PCR library kit. We found that among the PCR products a band about 320

bps. This product was purified and ligated into the pUCm-T vector for sequencing. Then sequence-specific primers were used to extend the 5' and 3' ends. Analysis of the resulting products generated a full-length human netrin-G cDNA named netrin-G2. The final assembled cDNA sequence of human netrin-G2 is 2428 bps in length (Fig. 1) and has a putative open reading frame of 1593 bps with a methionine start codon at the position 86 and TGA stop codon at position 1678, followed by the poly(A+) tail (Fig. 2).

109

J.Neurol.Sci.[Turk]

The predicted open reading frame encodes a 530-amino acid protein, the first 18-amino acid of which is a putative signal peptide, followed by a domain VI (LamNT) and three EGF-like repeats (LE domain), and a domain C' distinct to the domain C of classical netrins. The putative amino acid sequence of human netrin-G2 protein is highly conserved to mouse netrin-G2 (94.5% identity as a whole), and the lamNT domain shares 55% identity to both human and mouse netrin-G1, but it shows lower homology to classical netrins. The lamNT of it is 24% identity to C.eleganc UNC-6 gene, human netrin-2 and netrin-4; The LE domains are 25% to UNC-6 gene, 29% to human netrin-2 and 26% to human netrin-4 (Fig. 3).

Phylogenetic analysis of members of netrin families showed that netrin-G2 is a distant member of classic netrins, but a member of netrin-G subfamily. (Fig. 4).

Aligned with the genomic sequence (accession number AL353631 and AL159997), human netrin-G2 was tentatively located at 9q34, and the exon-intron boundaries were identified. As shown in Table 1, human netrin-G2 is composed of seven exons ranging from 24 bp (exon 4) to 956 bp (exon 7), spans the genomic DNA of approximately 71 kb. Almost all recognition motifs are corresponding to the human splice site consensus. Respectively, there is always an AG and a GT dinucleotide at the splice acceptor and donor site. The first two exons encode the 5' untranslated region (UTR) and domain VI of human netri-G2; exon 3 encodes the first EGF-like repeat; exon4 and exon 5 encode the second EGF-like repeat; and the last two exons(exon6 and exon7) encode the third EGF-like repeat, domain C', TGA stop translation coden and 3' UTR (Table 3).

Fig 1: PCR results of the estimated human netrin-G2. A brain cDNA library which used as template wasgenerated by using the cDNA PCR library kit, 5' -Rapid amplication of cDNA ends (5' -RACE) wasperformed in order to obtain the full-length cDNA. A band about 320 bp was found in the PCR products,and this product was purified and ligated into the pUCm-T vector for sequencing, then sequence-specificprimers were used to extend the 5' and 3' ends. The final assembled full-length human netrin-G cDNAsequence which named netrin-G2 is 2428 bps in length. (A) Result of 5' RACE PCR. 1: Marker; 2: 5'RACE PCR product; (B) Result of human netrin-G2 full-length cDNA cloning. 1: Marker; 2: Full lengthof the estimated human netrin-G2 cDNA.

110

J.Neurol.Sci.[Turk]

Fig 2: Nucleotide and deduced amino acid sequence of human netrin-G2. Nucleotides numbers andamino acid numbers (in bold characters) are listed on the left; Start codon and stop codon are all in boldcharacters. The nucleotide sequence data reported here appeared in GenBank database (accessionnumber BC013770, updated by NM_032536).

111

J.Neurol.Sci.[Turk]

Analysis of expression of human netrin-G2 To determine the pattern of expression of human netrin-G2, total RNA from 19-24 weeks old human fetus and adult human tissues were analyzed by Northern blot hybridization using 5'RACE PCR products as a prob. Specific hybridization signals are clearly present in the membranes of each stage. In the stages analyzed, human netrin-G2 transcripts were strongly expressed in most parts of brain, such as

temporal lobe, brain stem, frontal lobe, and occipital lobe, and also expressed to a lesser extent in the lung. The results is similar to mouse netirn-G2.The estimated size of the netrin-G2 mRNA is close to the length of the cDNA clone, indicating the cDNA sequence we cloned is full length or nearly full length. The specific expression in brain suggested that netrin-G2 might play an important role in the development of central nervous system (Fig. 5).

Fig 3: Alignment of the deduced amino acid sequence of human netrin-G2, mouse netrin-G1, mousenetrin-G2, human netrin-1 and chicken netrin-2. The numbers refer to the amino acid positions in thecorresponding proteins. Human netrin-G2 shows 93.8% identities to mouse netrin-G2, 56.4% to mousenetrin-G1, but 20% to human netrin-1, and 16% to chicken netrin-2.

112

J.Neurol.Sci.[Turk]

Table 3: Alignment of the netrin-G2 gene

Note: Exon sizes are given in base pairs and the exonic and intronic sequences at the splice junction are shown in capital and lowercase letters, respectively. The exon-intron splicing signals gt and ag are in black italics

5’ intron splice donor sites Intron

-11 -10 -9 -8-7 - 6 -5 -4 -3 -2 -1

Exon Exon size

1 2 3 4 5 6

3’ intron splice receptor sites Exon Intron -6 -5 -4 -3 -2 -1 1 2 3 4 5 6 7 8 9 10 11

Exon 1 a a a a t t a a a a g Exon 2 c c c c g c t g c a g Exon 3 t g t c t c c c c a g Exon 4 c t c t c c c a c a g Exon 5 g g c c g g c c c a g Exon 6 t g t c c g t c c a g Exon 7 t c c g c c t g c a g

C A A T C T 298 G A G A A T 644 G T G C A A 173 G T G C C A 24 A C T G C G 168 A G T G T A 135 C C A A C G 956

T C C C A T g t a a g t c c a c t C G G C A G g t a a g g c c g g g A C G C C T g t a c g t g c c a t T T G G C A g t a a g t a c a c g G C A T T G g t g a g a g g g c a G C T A C C g t g a g t g c g c g T G C T G C c t c c a c g g c c t

Fig 4: Phylogenetic tree analysis of members of Netrin families. Phylogenetic tree analysis of amino acidsequence deduced from netrin-G2 cDNA sequence was performed by using the MegAlign program ofDNASTAR. The CLUSTAL method was chosen to correct the distances for multiple substitutions at asingle site. GeneBank Accession Numbers of previously known netrins and netrin-Gs sequences used foranalysis are C. elegans UNC-6 (P34710), Drosophila netrin-A (Q24567), Drosophila netrin-B (Q24568),Xenopus netrin-1 (AAB87983), zebrafish netrin-1 (AAB70266), zebrafish netrin-1a (AAC60252), chicknetrin-1 (Q90922), chick netrin-2 (Q90923), mouse netrin-1 (AAC52971), mouse netrin-3 (AAD40063),human netrin-1 (NM_004822), human NTN2L (NM_006181), mouse netrin-G1a (AB038667), mousenetrin-G2a (AB052336), monkey netrin-G2 (XM001104957), human netrin-G1f (NP_055732) and humannetrin-G2 (AL353631). Human netrin-G2 is most related to monkey netrin-G2 and absolutely a memberof netrin-G subfamily, but a distant member of classic netrins

113

J.Neurol.Sci.[Turk]

Analysis of terminal signal peptide of human Netrin-G2 protein Secreted proteins are processed from an original form that contains an NH2-terminal signal peptide. And the nascent form of glycan phosphatidylinositol tailed proteins contains both an NH2- and COOH-terminal signal peptide. The two signal peptides have much in common, such as size and hydrophobicity. The characteristic of the amino acids sequence of Netrin-1a lies in its COOH-terminal sequence, which is domain C in Netrins. Unlike classical Netrins, both ends of human Netrin-G2 deduced protein are

hydrophobicity, and both signal peptides are similar in size (18 aa and 17 aa), which is similar to mouse Netrin-Gs. As Netrin-G members, hydrophobicity plots of Netrin-G2 revealed two hydrophobic sequences at both ends, while classic Netrins has a hydrophobic NH2-terminus but a hydrophilic COOH-terminus (Fig. 6). So we think that human Netrin-G2 protein is located in the plasima membrane via GPI lipid anchor. Since studies showed that Netrin-Gs show no appreciable affinity to the classical Netrins, an unidentified group of co-receptors or receptors will also soon be discovered in human.

Fig 5: Northern blot of netrin-G2 in human tissues. The upper row from left to right are heart, brain,lacenta, lung, liver, muscle, kidney and pancreas, which express the tissues’ distribution of netrin-G2; thedown row is β-actin as a control. Human netrin-G2 transcripts were strongly expressed in brain, and alsoexpressed to a lesser extent in the lung, which is similar to mouse netirn-G2 and monkey netrin-G2

Fig 6: Analysis of terminal signal peptide of human Netrin-G2 protein and other members of Netrinfamilies.

114

J.Neurol.Sci.[Turk]

DISCUSSION

In many vertebrates, such as monkey and mouse, both netrin-G1 and netrin--G2 are predominantly expressed in the brain, and each is expressed in distinct subsets of neurons in a complementary manner(9,10). The distribution patterns of Netrin-Gs can be roughly summarized as follows: Netrin-G1 is distributed along the sensory relay projections to the cortices. Netrin-G2 is mainly distributed along intracortical (including intrahippocampal) connections. Netrin-G1 and Netrin-G2 contribute differentially to information processing, such as Netrin-G1 to sensory perception and Netrin-G2 to higher functions, such as memory formation. Studies in humans suggest the possible involvement of netrin-G1 and -G2 in schizophrenia, Rett syndrome, and bipolar disorder(17,18,19,21).

In this study, we have identified a novel member of netrin-G subfamily, human netrin-G2. As classical netrins it contains a laminin � domain and three EGF-like repeats similar to the laminin V domain, but the characteristic structure is its COOH-terminal glycosyl phosphatidylinositol (GPI) lipid anchor, via which netrin-G proteins may link to the cell membrane divergent from classical netrins.

Human netrin-G2 transcripts were strongly expressed in most parts of brain, such as temporal lobe, brain stem, frontal lobe, and occipital lobe, and also expressed to a lesser extent in the lung. These findings suggest that Human netrin-G2 may provide short-range cues for axons outgrowth and play an important role in the development of central nervous system. The netrin-G subfamily members may contribute to the elaboration of the complex and highly organized nervous systems unique to vertebrates.

ACKONWLEDGEMENT This work was supported by Natural Science Foundation of Hunan Province of P. R China (No. 06JJ50062) Correspondence to: Ye Xıanglı E-mail: ye_xiangli@yahoo.com.cn Received by: 18 April 2008 Accepted :26 June 2008 The Online Journal of Neurological Sciences (Turkish) 1984-2008 This e-journal is run by Ege University Faculty of Medicine, Dept. of Neurological Surgery, Bornova, Izmir-35100TR as part of the Ege Neurological Surgery World Wide Web service. Comments and feedback: E-mail: editor@jns.dergisi.org URL: http://www.jns.dergisi.org Journal of Neurological Sciences (Turkish) Abbr: J. Neurol. Sci.[Turk] ISSNe 1302-1664 REFERENCES 1. Colamarino SA, Tessier-Lavigne M. The axonal

chemoattractant netrin-1 is also a chemorepellent for trochlear motor axons. Cell 1995; 81: 621–629.

2. Culotti JG & Merz DC. DCC and netrins. Curr Opin Cell Biol 1998; 10: 609–613.

3. De Breuck S, Lardon J, Rooman I. Netrin-1 expression in fetal and regenerating rat pancreas and its effect on the migration of human pancreatic duct and porcine islet precursor cells. Diabetologia 2003; 46(7): 926-933.

4. Finger JH, Bronson RT, Harris B. The Netrin-1 receptors UNC5H3 and DCC are necessary at multiple choice points for the guidance of corticospinal tract axons. J Neurosci 2002; 22 (23):10346-10356.

115

J.Neurol.Sci.[Turk]

5. Gitai Z, Yu TW, Lundquist EA. The netrin receptor UNC-40/DCC stimulates axon attraction and outgrowth through enabled and, in parallel, Rac and UNC-115/ AbLIM. Neuron 2003; 37 (1):53-65.

6. Hong K, Hinck L, Nishiyama M, Poo M-M, Tessier-Lavigne M, Stein E. A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrin-induced growth cone attraction to repulsion. Cell 1999; 97: 927–941.

7. Ishii N, Wadsworth WG, Stern BD, Culotti JG, Hedgecock EM. UNC-6, a laminin-related protein, guides cell and pioneer axon migrations in C.elegans. Neuron 1992; 9: 873–881.

8. Jiang Y, Liu MT, Gershon MD. Netrins and DCC in the guidance of migrating neural crest- derived cells in the developing bowel and pancreas. Dev Biol 2003; 258 (2): 364-384.

9. Kennedy TE, Serafini T, de la Torre JR, Tessier-Lavigne M. Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinalcord. Cell 1994 ; 78 : 425–435.

10. Kennedy TE. Cellular mechanisms of Netrin function: long-range and short-range actions. Biochem Cell Biol 2000; 78(5): 569- 575.

11. Koch M, Murrell JR, Hunter DD, Olson PF, Jin W, Keene DR, Brunken WJ, Burgeson RE. A novel member of the netrin family, beta-netrin, shares homology with the beta chain of laminin: identification, expression, and functional characterization. J Cell Biol 2000; 151: 221–234.

12. Llambi F, Causeret F, Bloch Gallego E. Netrin-1 acts as a survival factor via its receptors UNC5H and DCC. Embo J 2001; 20 (1): 2715-2722.

13. Miyashita T, Nishimura-Akiyoshi S, Itohara S, Rockland KS. Strong expression of netrin-G2 in the monkey claustrum. Neuro science 2005; 136: 487–496.

14. Nakashiba T, Ikeda T, Nishimura S, Tashiro K, Honjo T, Culotti JG, Itohara S. Netrin-G1: a novel glycosyl phosphatidy-linositol-linked mammalian netrin that is functionally divergent from classical netrins. J Neurosci 2000; 20: 6540–6550.

15. Nakashiba T, Nishimura S, Ikeda T, Itohara S. Complementary expression and neurite outgrowth activity of netrin-G subfamily members. Mech Dev 2002; 111: 47–60.

16. Nishimura-Akiyoshi S, Niimi K, Nakashiba T, Itohara S. Axonal netrin-Gs transneuronally determine lamina-specific subdendritic segments. Proc Natl Acad Sci 2007; 104(37):14801-6

17. Serafini T, Colamarino SA, Leonardo ED, Wang H, Beddington R, Skarnes WC, Tessier- Lavigne M. Netrin-1 is required for commissural axon guidance in the developing vertebrate nervous system. Cell 1996; 87: 1001–1014.

18. Serafini T, Kennedy TE, Galko MJ, Mirzayan C, Jessell TM, Tessier-Lavigne M. The netrins define a family of axon outgrowth-promoting proteins homologous to C.elegans UNC-6. Cell 1994; 78: 409–424.

19. De la Torre JR, Ho¨pker VH, Ming GL, Poo MM, Tessier-Lavigne M, Hemmati-Brivanlou A, Holt CE. Turning of retinal growth cones in a netrin-1 gradient mediated by the netrin receptor DCC. Neuron 1997; 19: 1211–1224.

20. Yin Y, Sanes JR, Miner JH. Identification and expression of mouse netrin-4. Mech Dev 2000; 96: 115–119.

21. Zhang W, Rajan I, Savelieva KV, Wang CY, Vogel P, Kelly M, Xu N, Hasson B, Jarman W, Lanthorn TH. Netrin-G2 and netrin-G2 ligand are both required for normal auditory responsiveness. Genes Brain Behav 2007; doi:10.1111/ 1-8.

116