Post on 12-Jan-2016
©2011 MFMER | slide-1
Practical Challenges in Clinomics: A Mayo Perspective
Eric D. Wieben, Ph.D.August 4, 2012
Disclosure Statement Disclosure Statement of Financial Interestof Financial Interest
• I, Eric Wieben,I, Eric Wieben,
DO NOT DO NOT have a financial have a financial interest/arrangement or affiliation with one interest/arrangement or affiliation with one
or more organizations that could be or more organizations that could be perceived as a real or apparent conflict of perceived as a real or apparent conflict of interest in the context of the subject of this interest in the context of the subject of this
presentation. presentation.
From Wikipedia (so it must be real)
Clinomics is the study of -omics data along with its associated clinical data.
©2011 MFMER | slide-4©2011 MFMER | slide-4
Translational ProgramClinomics
Overall Objective
The objective of the Clinomics Program is to create value from genome sequence information
We can now sequence an entire set of protein coding genes from individual patients, or even entire genomes.
Should we?What are the possible benefits?What are the risks?
AGATAAGGAGTTCCAAACTGTGCTTTCTTATTTGTTATTTTAAAAAACAAGTTTTTATTTGCTAATTCTCTATGGCCCTGCAAATCCTTTATTGGAAATAACCTTGGTCTCACTGCTGTCTTTCTGTCCTTTGTACTGCGTAATGGGGCTTGAGGATTAGTGTGCTGATATTTGTGCATGTAAATGCTTCTGTATATGCATGTGCCTTCTGAAAACTTTTTTAGGTTTGGAGCTGAATTTTGGATTATTGATCATTCTCTTTTGCCTGGTCTTCCCTGTGACTGTTTTGCATGATGTTGGGTAAAATAATAGTGTGGGTGAGCATGTCACAGTGCTTCTCAGTGTGTTAGAGAGGTGTGCTGTGTACCTTATACCTGTTGTATTTTTTAAATCCTAACAAGAACCTAATGAGATGCAAGGATTACTACTATCCTGTATTCATAGCTGAGGAAACAGAGACAGATGTTAAACAACTGGATCTTAAGGCAGCCAATAATGAAATTAGGTTTTAACCTCAGGTTTGTCTAGCTCAAAGTCCTGAGTTCTATACACACACACACACACACACACACACACACACACACATCAGACAGCTCATTTTTGCAAGATTATATAGGCAAACAGTGTGATATTGAGGCTTCGCACGAAATGCTATCTGTGATCTTTAGGGTAGATAGCATTTTTAAAAATGTGTCTAATGTTGTAATGATGTCAACCATATCCATTATTTTTCCCGCCTTTGTATCCAAATAAACTACCCTTCCAATTTATGACAGATATCAATGTGACTAAATATGTCTTTCTCATATCTTTATTAGTTTTACTAAGAAAATACAGTAGATATTTTAAAAGTTGTGCTTTCATTCTGTTGTAAGTTGATAGTCTACATGGATGCCAATGAAAACATGTTTTTATGTAGCTAATCAATTCAGAATTTGAGGTAACCAAGCCTGATGTATTAATATGTAAAAAAATAAGGATCTCCTGTCTTTAAATATAAAAAAGTTTTGCAGTTCGTTGTTAGATCTTTGAAACTTAATATTCAAGAACAATACCCTCAATTCTATCTGCATCACTAAAATAAGCAGTTTTGAAGGTTTGATATGTCTGTTACCAGACATGTGCTTAAAATGTTACATT
And it doesn’t come neatly labeled and interpreted
Molecular Anatomy
•Exons make up only about 1.5% of total genome
Current estimate= 29,567 protein coding genes*(up from 28,259 #)
29, 567 x 1500 coding/gene= 44 million
Just over 1% of the genome codes for protein—1 inch of 6 feet
http://www.ncbi.nlm.nih.gov/projects/CCDS/CcdsBrowse.cgi?REQUEST=SHOW_STATISTICS#Current_Homo_sapiens_36_3
Compared to the reference sequence, Venter has:
•3,213,401 single nucleotide polymorphisms (SNPs)•53,823 block substitutions (2–206 bp) •559,473 homozygous indels (1–82,711 bp)•62 CNVs•292,102 heterozygous insertion/deletion events (indels)(1–571 bp) •90 inversions
Levy et al., PLoS Biol. 2007 October; 5(10): e254
Korean
AfricanChinese
3775
55092373
3511
9039 nsSNPs 11251 nsSNPs
10162 nsSNPs
Adapted from J-I Kim et al. Nature 000, 1-5 (2009) doi:10.1038/nature08211
So what is the right reference genome?
•M. N. Bainbridge, W. Wiszniewski, D. R. Murdock, J. Friedman, C. Gonzaga-Jauregui, I. Newsham, J. G. Reid, J. K. Fink, M. B. Morgan, M.-C. Gingras, D. M. Muzny, L. D. Hoang, S. Yousaf, J. R. Lupski, R. A. Gibbs, Whole-Genome Sequencing for Optimized Patient Management. Sci. Transl. Med. 3, 87re3 (2011).
Whole genome sequencing is leading to “cures”—dopa responsive dystonia
Noah and Alexis Beeryhttp://www.youtube.com/watch?v=yUQFHecs8EQ
From http://myasthenickids.org/
Ellen was not diagnosed with CMS until 18 months old, there although was obviously 'something wrong' from birth as she was unable to feed and maintain her weight and suffered inexplicable weakness and fatigue.
Diagnosed with Congenital Myasthenic Syndrome at the Evelina Children's Hospital at Guys and St Thomas, Ellen is now on pyridostigmine every three hours. She attends mainstream school with support. Her gene fault is currently unknown.
Congenital Myasthenic Syndrome
A few Mayo CMS pedigrees
Selcen et al., Annals of Neurology 64: 71
The Concept
Patient inquiry
DNA Sequencing
Mutation Discovery
Improved Treatment
AZ Patient with Liver Cancer
Fails Conventional Therapy
Inquires about WGS
Potential to Help?
Stop
Business Office
- Est. of Cost- Deposit?- What is Billable?*Ethics
*Genetics
Individualized Medicine
Clinic
Genome Savvy MedOnc
BioethicistMedical Geneticist / Genetics Counselor
Potential to Help?
Stop
Patient Desire to Proceed?
Stop
IM Clinic Review Board
Approve?
Stop
Research Consent(s)Run Test(s)
Subscription?
Store Data andOffer Copy to
Patient
Ongoing Interaction
Share Results- MedOnc- Medical
Geneticist- Subspecialist?
Druggable Target?
Stop
Research Consent
Off Label Use
Monitor and Track Results
NN N
NN
Y Y
Y
Y
Y
Y
N
The Practicality--Individualized Medicine Clinic
The Issues•Ethical challenges
• What are the risks?• What are the potential benefits?
•Scientific challenges• Data generation, accuracy,
interpretation and management•Administrative/Legal challenges•Clinical challenges
• Will it change treatment?
The pilot project—Driven by Ethics and Medical Genetics Staff
•Sequence genomes exomes from ten members of the Center for Individualized Medicine leadership•Pick participants by lottery•Engage in counseling•Provide opportunity to opt out•Determine what information each person wants•Proceed with sequencing, etc•Survey attitudes before and after
Ethical challenges• What are the risks?
• Most genetic “news” is bad• Incidental findings• VUS issue
• Effect of bad news extends beyond the patient in the office
• Insurance risk? • What are the potential benefits?
• For THIS patient• What constitutes informed consent?
Scientific challenges• Data generation, interpretation and
management
NGS instruments
Data Storage Compute/Analysis
Consultant Workbench
Interpretive Report to LIS
Interpretive Report and Discrete Data
to EMR(s)
Scientific/Technical challenges
•Accuracy (85% perfect reads)• Requires orthogonal validation
•Alignment • What is the most appropriate
reference sequence? • What about repetitive regions?
•Too much data• 10,000 missense changes per
sample (80 nonsense)• Storage?
• Over 200 million reads per sample—100 bp each (>250x coverage)
• 70,000 SNVs in coding region per sample
• 70-80 Nonsense mutations• 10,000 missense mutations• 8000 indels in coding region*
Run 2 per lane
Exome sequencing statistics for newest 72Mb capture set
©2011 MFMER | slide-22
What’s the problem?
Note 62,000 rows!
©2011 MFMER | slide-23
What’s the problem?
HBB
What’s going on outside the exome?There ARE disease causing mutations here!
©2011 MFMER | slide-24
What’s the problem?
Even in exons, coverage is not even.So what are we missing?
HBZ
Mismapped repetitive sequences
Scientific/Technical Challenges
After all the other problems are “solved” and technical conclusions are validated, there are still mysteries to be considered•VUS (Variants of Uncertain Significance)—generally private mutations that may or may not constitute risk alleles
• Do change the structure of important proteins• Functional consequences?• Reportable back to patient?
From Ashley et al. Clinical Assessment incorporating a personal genome, Lancet. 2010 May 1; 375(9725): 1525–1535
Challenges remain in the application of whole genome data to the practice
Administrative/Legal Challenges
•Cost—What is billable? Reimbursable?•What goes into the EMR? How?•What about proprietary genes and tests?
Clinical challenges
•Will it change treatment? For the better?•Will it inform future discovery efforts that could lead to better treatment?•Will it inform genetic counseling?
A New Treatment’s Tantalizing Promise Brings Heartbreaking Ups and DownsBy GINA KOLATA, New York Times, July 8, 2012
So why bother?
Finding new mutations in a number of genetic diseases, including CMSThese give insights into fundamental disease process, allow for better counseling and (sometimes) suggest new therapies
From http://myasthenickids.org/
©2011 MFMER | slide-31
“Individualized Medicine Clinic” to open September 30, 2012
• Advanced cancer patients• “Diagnostic odyssey” patients
•Issues being considered• Expectations, pre-counseling and informed
consent• Unexpected results• VUS interpretation?• Implications for family
members
New Frontiers in Individualized Medicine
Environment, including microbiome
If the child looks like the father, it’s geneticIf the child looks like the neighbor, it’s environmental
MyGenome—Available NOW in the iTunes AppStore
©2011 MFMER | slide-34